{"paper_id":"1967460f-41c4-4c6f-8ce2-c87570b7c5df","body_text":"1 \n \nRestriction-modification systems are required for Neisseria \ngonorrhoeae pilin antigenic variation \n \nSelma Metaane1 and H Steven Seifert1* 1 \n1Department of Microbiology-Immunology, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611, USA, 2 \n*Correspondence: h-seifert@northwestern.edu 3 \n 4 \nSUMMARY 5 \nNeisseria gonorrhoeae (Gc) pilin antigenic variation is a diversity-generating system that uses gene 6 \nconversion to produce a variety of PilE protein variants , the major subunit of the Type IV pilus (T4p). 7 \nPilin antigenic variation allows the bacteria to escape immune surveillance and can alter T4p 8 \nexpression. While pilin antigenic variation requires many conserved homologous recombination and 9 \nDNA repair factors, the pattern of sequence changes leading to pilin antigenic variants resembles 10 \nthat of an annealing reaction, rather than the expected long recombination tracts usually found in 11 \nhomologous recombination. We demonstrate that two paralogous restriction modification modules 12 \ncleave specific, unmodified sequences within the expressed and silent pilin loci and that cleavage is 13 \nessential for pilin antigenic variation. Moreover, these restriction activities affect the bacterium's 14 \nfitness. These findings partially explain the patchwork recombination patterns of pilin antigenic 15 \nvariants and suggest a unique mechanism for generating diversity. 16 \n 17 \n 18 \nKEYWORDS 19 \nRestriction, modification, methylation, antigenic variation, Neisseria, gene conversion 20 \n 21 \n 22 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n2 \n \nINTRODUCTION 23 \nNeisseria gonorrhoeae (Gc) is the causative agent of gonorrhea, a sexually transmitted infection 24 \nthat remains a global health concern due to its development of antimicrobial resistance 1,2. Gc is a 25 \nhuman-restricted bacterium whose adhesion and invasion rely on pili and outer membrane 26 \nproteins (reviewed in 3). Among them, the type IV pilus (T4p) is a critical virulence factor that 27 \nfacilitates bacterial colonization 4–6. Gc type IV pilin antigenic variation (Av) results in the existence 28 \nof multiple versions of its major subunit, pilin (or PilE) 7 within a lineage. During pilin Av one of ~19 29 \nsilent copies (pilS) replaces the analogous sequences in the expressed pilE gene, while the pilS 30 \ngene remains unchanged 8,9. This gene conversion process alters the PilE amino acids sequence, 31 \nwhich generates a variable type IV pilus (T4p). Pilin Av can result in a fully expressed variant pilus, 32 \nreduced T4p expression, or a completely nonpiliated cell 10–12. This extensive variability may 33 \npromote persistence within the host, or more importantly, allow reinfection of a person who was 34 \npreviously colonized by the same bacterium 13,14. 35 \nThe pilE gene itself consists of a conserved region followed by semi-variable and hyper-variable 36 \nregions that share sequence identity with the pilS copies. There are two conserved elements called 37 \ncys1 and cys2 surrounding the hypervariable loop that form a disulfide bond in pilin. The pilE ORF is 38 \nflanked downstream by the SmaCla repeat, which is also found at the 3' end of all pilS loci. The 39 \nregions cys1, cys2, and SmaCla are involved in pilin Av 15,16. Pilin Av also involves transcription of the 40 \ngar (G4-associated RNA) noncoding sRNA upstream of pilE to form a DNA:RNA hybrid (R-loop) 17–19. 41 \nThis R-loop captures the C-rich strand, enabling the formation of a guanine quadruplex (G4) 42 \nstructure 17. Mutation of either the gar promoter or the G4-forming sequence through single-base 43 \nmutations abrogates pilin Av. 44 \nPilin Av recombination tracts are defined by the first and last nucleotide changes that differ from the 45 \nstarting recipient pilE sequence, and these recombination tracks are flanked by regions of 46 \nmicrohomology shared between pilE and the pilS donor 12,20. While pilin Av requires the recA gene 21, 47 \nand the RecF-like pathway genes recO, recR, recJ, and recQ 22–24, the 10 to 500 bp regions of variant 48 \nsequence transferred during pilin Av suggest that pilin AV requires other reactions besides 49 \nhomologous recombination. We have previously proposed that pilin Av involves two steps: an initial 50 \nrecombination between the pilE gene and a pilS copy at a region of microhomology, followed by 51 \nhomologous recombination of the hybrid pilE-pilS intermediate into an intact pilE 20. 52 \nRestriction-modification (RM) systems are widespread in prokaryotic genomes, as 83% of available 53 \ngenomes contain at least one of these modules 25. There are four major types of RMs 26, and type II 54 \nRMs are the most abundant, accounting for 39.2% of bacterial genomes 25. Gc isolate FA1090 55 \npossesses 15 RM systems 27–31. The 11 FA1090 type II RM systems each include a sequence specific 56 \nrestriction endonuclease and a DNA methyltransferase. The endonuclease cleaves double-57 \nstranded DNA at its target motif unless the methyltransferase protects the site 32–34. Several host-58 \nrestricted bacteria, such as Helicobacter, Haemophilus, Streptococcus, and Neisseria, all encode 59 \nmultiple RM modules, despite having relatively small genomes. Being host-restricted, we predict 60 \nthese organisms have fewer bacteriophage predators as compared to environmental bacteria; thus, 61 \nit is unknown why these organisms have multiple RM modules 35. In this work, we demonstrate that 62 \nspecific 5’-CCGG sequences are frequently located at the microhomology bordering the 63 \nrecombinant pilin Av sequences. We show that the pilE and pilS 5’-CCGG sites, as well as the 64 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n3 \n \nparalogous RM modules, are required for efficient pilin AV. Surprisingly, most genomic 5’-CCGG 65 \nsequences are undermethylated and a subset are cut by the paralogous restriction endonucleases. 66 \nRestriction of 5’CCGG sites in a subset of chromosomes results in a Gc fitness defect. These 67 \nresults indicate that Gc has co-opted these RM modules to facilitate pilin Av, albeit at the cost of 68 \nreduced fitness. 69 \n 70 \nRESULTS 71 \n 72 \nA 5’-CCGG site is prevalent at the borders of pilE recombination tracts 73 \nGc isolate FA1090 encodes 15 RM systems, which are conserved in most Gc isolates. Among all the 74 \nputative RM systems present in FA1090, the recognition sites that are the most represented in the 75 \ngenome are 5’-GCSGC (16173 sites) and 5’-CCGG (11103 sites) (Table S1). Some sites overlap, 76 \nsuch as 5’-GCCGGC, which also contains 5’-CCGG. 77 \nThe 5’-CCGG motif shows a differential distribution across the Gc genome, with a frequency higher 78 \nthan one site per 100 bp in 167 out of the 2,211 annotated ORFs (Supplementary Table 3). All 19 pilS 79 \ncopies and the pilE variable region were among these high-density loci. In contrast, 5’-CCGG sites 80 \nwere completely absent from the garP/G4 sequences and the pilE conserved N-terminal coding 81 \nsequences (Fig. 1A, Table S2). 82 \n 83 \n 84 \n 85 \n 86 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n4 \n \nFig. 1. A restriction and modification target sequence is overrepresented in the pilE gene. A. 87 \nNumber of 5’-CCGG sites across Gc FA1090 genome per 1000 bp bin. B. Zoom-in on the pilE region 88 \nfrom panel A. C. Distribution frequency of 5’-CCGG sites per 1000 bp bin across the genome. D. A 89 \nschematic of the pilE locus. The cartoon shows the garP sRNA promoter, the guanine quadruplex-90 \nforming sequence (G4), the pilE open reading frame that includes the conserved N-terminus coding 91 \nsequences and the semi-variable and hypervariable regions (that are also in the pilS copies), 92 \ncontaining the conserved cys1 and cys2 repeats, followed by the SmaCla repeat. The SmaCla 93 \nrepeat is found at the end of each pilS locus. The 5’-CCGG is the most frequent in the pilE locus and 94 \nis found only within the pilE variable region. E. Quantification of the RM target sites at pilin variant 95 \nrecombination tracts that were identified in the analysis of FA1090 pilin variants12. The 5’-CCGG 96 \nmotif is present at the site of recombination in 82% of the variant strains. 97 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n5 \n \nThe pattern of variant pilE sequence changes has been extensively studied 21,36–38. We reanalyzed 98 \n100 previously described variant pilE sequences, identified their pilS donors, and mapped each 99 \nrecombination tract 12. The sequences bordering the recombination tracts upstream and 100 \ndownstream of the pilS insert indicate where the recombination event occurred. 82% of the 101 \nanalyzed pilE variants contained a 5’-CCGG site at one or both recombination track border (Fig. 1B). 102 \nIn contrast, the six pilE 5’-GGCC sites were only localized at the recombination tracts border of 37% 103 \nof the variant strains (Fig 1A, B). Based on this reanalysis of published sequencing data, we 104 \npostulate that the 5’-CCGG sequences could have a role in pilin Av. 105 \nThe pilE 5’-CCGG sites are important for pilin Av 106 \nThere are several methods for measuring pilin Av frequencies 22,39. One method is the pilus-107 \ndependent colony morphology change (PDCMC) assay, which records the number of nonpiliated or 108 \nunderpiliated blebs that emerge from a piliated colony over time 22. When pilus phase variation 109 \noccurs by pilin Av, they are captured by the PDCMC score 22. One limitation of this assay is that it is 110 \nsensitive to growth rates since slower growth decreases antigenic variation 39,40. We introduced 111 \nsilent mutations that do not change the pilE coding sequence in all four 5’-CCGG sites (strain 112 \nSM598). The PDCMC assay of strain SM598 with the mutated 5’-CCGG sites revealed a significant 113 \ndecrease in pilin Av (Fig. 2 B, E). After 30h of growth, the colonies of the pilE CCGG-disrupted 114 \nmutant strain SM598 did not show any significant growth defect (Fig. 2A). Since the decrease in 115 \nSM598 pilin Av frequencies is not due to decreased growth. These results support the hypothesis 116 \nthat the sites found at the borders of recombination tracts are important for pilin Av (Fig. 2A). 117 \nDespite the lower level of variation in the pilE 5’-CCGG mutant, some pilin variants were observed. 118 \nAnalysis of individually derived nonpiliated or underpiliated (P-) variants of SM598 revealed that 119 \n11/30 had a pilE gene deletion. Some P- variants (5/30) had the parental pilE sequence, indicating 120 \nanother process than pilin Av produced the nonpiliated phenotype. The remaining 14 variants were 121 \npilin antigenic variants. In these variant sequences, reconstituted 5’-CCGG sites were found in the 122 \npilS inserts, but not outside of the recombination tract. However, ten out of twelve pilS variant 123 \nsequences contained 5’-CCGG sites at the variant border. Six had sites on both sides of the insert, 124 \nwhile four had a site on one side. This analysis suggests that 5’-CCGG motifs in pilS may also 125 \ncontribute to pilin Av, even when they are no longer present in pilE. 126 \npilS copy 5’-CCGG Sites are critical for pilin Av 127 \nWe tested whether the 5’-CCGG sites in the pilS donors are also involved in pilin Av. Given the 128 \npresence of 19 pilS copies in the genome, mutating all 5’-CCGG sites within these loci proved 129 \nchallenging. Therefore, we generated a strain where all 19 pilS copies were deleted (the pilS 130 \nhexadeleted mutant, SM564, Fig. 2D). We then reintroduced an unaltered pilS3C1 copy into its 131 \noriginal locus (Strain SM567) and a pilS3C1 copy with five mutated 5’-CCGG sites (strain SM570). In 132 \nthese original and mutated pilS3C1 strains, we also introduced the mutated pilE with or without 5’-133 \nCCGG sites (respectively, strains SM584 and SM585) (Fig. 2D). 134 \nBecause the frequency of pilin Av is lower with a single pilS copy, we could not use the PDCMC 135 \nassay to measure pilin Av. Instead, we used a modified PCR-based sequencing assay to measure 136 \npilin Av 39,41. The pilS3C1-mutated SM564 strain did not exhibit any detectable pilE variation (Fig. 137 \n2E), while the non-mutated pilS3C1 strain SM567 showed typical pilin Av frequency (Fig. 2E). 138 \nMutating the pilE 5’-CCGG motifs with the nonmutated pilS3C1 donor also reduced pilin Av 139 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n6 \n \n(SM584). Finally, disruption of the 5’-CCGG motifs in both pilE and pilS reduced the level of 140 \nantigenic variation to undetectable levels (SM585), identical to the hexadeleted control (SM564, Fig. 141 \n2E). These results show that 5’-CCGG sites in both the donor and recipient gene are critical for pilin 142 \nAv. 143 \n 144 \n 145 \n 146 \nFig. 2. Pilin antigenic variation levels of the parental strain recA6 A. Pilin antigenic variation 147 \nlevels of pilE CCGG disrupted mutant (SM598) measured by the surrogate PDCMC assay in the 148 \nabsence or presence of 1 mM IPTG. B. Colony forming units (CFU) per colony at 30h of growth in the 149 \nparental strain and the pilE CCGG-disrupted mutant (SM598) in the presence and absence of 1 mM 150 \nIPTG. C. Pictures of colonies of the parental recA6 strain and the pilE CCGG-disrupted mutant 151 \n(SM598) after 32h of growth on GCB + IPTG. D. Schematic representation of the pilE (±CCGG 152 \ndisruption) and pilS (±CCGG disruption) constructs in a pilS hexadeleted mutant (SM564). E. PCR-153 \nbased assay using Illumina sequencing to measure the variation level in a pilE amplicon. 154 \nApproximately 500 colonies of the pilS hexadeleted strain were grown with 1mM IPTG. pilE PCR was 155 \nperformed, and Illumina sequencing of the native or mutated pilE and/or pilS loci. Fischer’s LSD 156 \nuncorrected test was used; only p values <0.05 were plotted. 157 \n 158 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n7 \n \nTwo RM Modules targeting 5’-CCGG are required for Pilin Av 159 \nThe pilin Av phenotypes of the pilE and pilS 5’-CCGG mutants suggested that these palindromic 160 \nsites are recognized by factors that are critical for pilin Av. Gc encodes several RM systems 27,42. We 161 \nidentified three type II RM modules that are predicted to recognize 5’-CCGG and 5’-GCCGGC 162 \nsequences. Two of these methylases were previously reported to methylate their predicted sites: 163 \nm.NgoAXIV (RM1M, 5’-CCGG) and m.NgoAIV (RM3M, 5’-GCCGGC) 27. The m.NgoAXIII (RM2M) 164 \nmethylase is predicted to recognize 5’-CCGG 42, but this prediction has not been experimentally 165 \nconfirmed (Table S1). The ngoAXIV (RM1) operon encodes a restriction enzyme with two predicted 166 \nORFs (RM1R1 and RM1R2) and a complete methylase (RM1M), while the ngoAXIII (RM2) operon 167 \nincludes a full restriction enzyme (RM2R) and a methylase split into two predicted ORFs (RM2M1, 168 \nRM2M2) (Fig. S2). Analysis of 47 complete genomes from PubMLST database shows that both 169 \noperons are fully conserved across all analyzed Gc strains. Notably, 71% of Neisseria meningitidis 170 \ngenomes, a closely related species that also undergoes pilin Av, encoded a 5’-CCGG restriction 171 \nenzyme (RM1R). In contrast, neither RM1R nor RM2R was detected in Neisseria lactamica, which 172 \ndoes not undergo pilin Av (Supplementary Table 2). 173 \nTo test the involvement of the RM modules in pilin Av, we constructed two mutant strains. We 174 \ndeleted the RM1 and RM2 operons that are predicted to recognize 5’-CCGG (strain SM500). We also 175 \ndeleted the RM3 operon that is predicted to recognize 5’-GCCGGC (strain SM604). The SM604 176 \nmutant showed no differences in growth or pilin Av frequency and was not analyzed further (Fig. 177 \n3B). In contrast, the RM1RM2 double mutant SM500 displayed a significantly lower level of PDCMC 178 \nand increased growth (Fig. 3B, C). Moreover, deleting each restriction gene RM1R1 (SM323) and 179 \nRM2R (SM327) also reduced pilin variation levels (Fig. 4A, B). Pilin Av was restored upon 180 \ncomplementation of the RM1R1 or RM2R mutants with the mutated gene with a TetR-regulated 181 \npromoter gene at an ectopic site (Fig. S3). 182 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n8 \n \n 183 \nFig. 3. Mutation of RM genes alters pilin antigenic variation. A. Pilin Av levels of the parental 184 \nstrain and the SM500 and SM604 mutants measured by the PDCMC assay. B. Growth of the 185 \nparental strain and the SM500 and SM604 mutants without IPTG on solid media. Fischer’s LSD test 186 \nwas used for multiple comparisons; only the p-values <0.05 were plotted. C. Pictures of the 187 \ncolonies grown with and without IPTG, showing the appearance of P- blebs (white arrows). 188 \n 189 \n 190 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n9 \n \n 191 \nFig. 4. Deletion of RM system operons reduces pilin Av. PDCMC assay results (graphs A,B &C) 192 \nand picture of the pilin Av defective colonies (D). A, B & C. Shown are the PDCMC scores for each 193 \nsingle deleted mutant compared to the parental strain grown on GCB + IPTG for 30h. Multiple 194 \ncomparisons were performed using Fisher's LSD test. D. Pictures of the colonies of the parental and 195 \nthe two mutants with a lower PDCMC than the parental, ΔR1.RM1 and ΔR.RM2 grown on GCB and 196 \nGCB IPTG for 30h. 197 \n 198 \n 199 \nThe observed reduction in PDCMC in the ΔRM1R1 (SM323) and ΔRM2R (SM327) mutants was not 200 \ndue to a growth deficiency (Fig. S3). We also observed that the deletion of the entire RM2 operon 201 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n10 \n \nresults in similar levels of pilin Av to those of the RM2R mutant, whereas this was not the case for 202 \nthe RM1 operon (Fig. 3B, C). RNA sequencing data showed that the restriction gene RM2R has 203 \nsignificantly higher transcript levels than its methylase43. Differences in transcription and stability 204 \nbetween RM1 and RM2 effectors could explain why deleting the RM2 restriction enzyme has the 205 \nsame effect as deleting the whole operon. These results indicate that the restriction enzymes 206 \nRM1R1 and RM2 are necessary for efficient pilin Av. 207 \nThe pilE and pilS 5’-CCGG motifs are cut in genomic DNA 208 \nTo test the hypothesis that the restriction endonucleases RM1R1 and RM2R2 digest 5’-CCGG 209 \nsequence, we designed an adapter-DNA with a GC overhang to ligate with the two nucleotide 5’-CG 210 \noverhangs resulting from a 5’-CCGG cut. We ligated the adapter directly to purified genomic DNA, 211 \nand PCR amplification was performed using a primer recognizing the adaptor paired with an 212 \nupstream or downstream pilE primer (pilRBS or pilEREV primers 44). We detected multiple amplified 213 \nproducts whose sizes corresponded to the location of pilE 5’-CCGG sites (Fig. S4). 214 \nWe sequenced the adaptor-ligated DNA using ONT Nanopore long-read sequencing, which enabled 215 \nus to distinguish the pilE and pilS loci. Among the four 5’-CCGG sites found in pilE, the adapter 216 \nmapping revealed cleavage at the second and third 5’-CCGG sites. The first site, 5’-GCCGGC, and 217 \nthe fourth 5’-CCGG site (located 9 bp after the third site) showed no cuts (Fig. S6). In the pilS 218 \ncopies, cuts were detected at 44 of the 54 5’-CCGG sites across all 19 pilS copies, and no ligation 219 \nwas found at the 32 5’-GCCGGC sites. These cleavage patterns matched those observed in the 220 \npositive control pretreated with HpaII, an endonuclease that also targets 5’-CCGG (Fig. 5, 221 \nSupplementary Table 1). No cuts were detected in the RM1RM2-deleted strain (SM500), but 222 \ncleavage was restored in the HpaII-treated control, confirming that deletion of these operons 223 \ninactivates their cognate restriction enzymes. Notably, in the RM1RM2 double mutant pretreated 224 \nwith HpaII, we detected a low-level cut at the last 5’-CCGG site, suggesting that the residual loss of 225 \nmethylation upon RM1M and RM2M deletions implicates a minor protective role for at least one of 226 \nthe two 5’-CCGG-specific RM methylases (Fig. S5). As anticipated, the pilE CCGG-disrupted mutant 227 \n(SM598) showed no cuts in pilE. However, all pilS had cleaved 5’-CCGG sites in SM598, as in the 228 \nparental strain (Fig. 5, Supplementary Table 1). 229 \nMethylation profiles of the pilE and pilS 5’-CCGG sites 230 \nUsing nanopore sequencing, we quantified methylated residues (5mC) at each site with Modkit 231 \n(Oxford Nanopore Technologies, 2023). Remarkably, across pilE and all pilS copies, most 5-232 \nGCCGGC were methylated (32/33 methylated sites), whereas most 5’-CCGG were not methylated 233 \n(4/58 methylated sites) (Fig. 5 A,B). A more in-depth analysis of the methylated 5’CCGG showed 234 \nthese sites in particular overlap with other sites known to be a methylase target (5’-GGNNCC, 235 \nNgoAXV; 5’-RGCGCY; NgoAI; 5’-GGCC, NgoAII). We found no cuts at methylated 5’-GCCGGC sites, 236 \nconfirming their protection. Similarly, methylated 5’-CCGG sites remained intact, and we didn’t 237 \ndetect methylation at the 5’-CCGG sites that were cleaved. Only five pilE 5’-CCGG sites were 238 \nneither methylated nor cut. For this analysis, a cut was defined as detectable if it occurred in 239 \n≥0.25% of the reads at a specific site. In general, the 5’-CCGG sites are found to be 240 \nundermethylated on the whole genome (Supplementary Table 4). This low level of genome-wide 241 \nmethylation at 5’-CCGG sites is consistent with PacBio data for Gc FA1090 deposited to the Rebase 242 \ndatabase 42. Additionally, the RM2 methylase (M.NgoAXIII) is predicted to target 5’-CCGG sites as 243 \nan isoschizomer of HpaIIM, previous studies were unable to identify its target site based on 244 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n11 \n \nmethylation data and concluded that this methylase is inactive 27. Taken together, these results 245 \nshow that there is an undermethylation of some but not all sites within the genome. 246 \n 247 \n 248 \nFig. 5. Mapping of the 5’-CCGG and 5’-GCCGGC cuts and methylation status within pilE and 249 \npilS copies A. Schematic of the pilE locus with 5’-CCGG sites in orange and the 5’-GCCGGC site in 250 \npink. HVL corresponds to the hypervariable loop of pilE and HVT. B Schematic of the 19 aligned pilS 251 \nwith 5’-CCGG sites in orange and the 5’-GCCGGC site in pink. In A & C, the sites that exhibited cuts 252 \nare hatched and the sites that were methylated are boxed. Sites are considered as methylated with 253 \na fraction Nmodified/Nvalid > 3, and as cuts when the adapter was detected in more than 0.25% of the 254 \ntotal reads at that genomic position. 255 \n 256 \n 257 \n 258 \n 259 \n 260 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n12 \n \nRestriction at 5’-CCGG sites impacts Gc growth 261 \nThe RM1RM2 double mutant (SM500) displayed an enhanced growth phenotype after 30h of growth 262 \n(Fig. 3A). The pilE CCGG-disrupted mutant (SM598) also displayed bigger colonies than the parental 263 \nstrain, although difference in CFUs was not significant (Fig. 2A). Since reduced growth can equalize 264 \nafter extended growth, we measured the CFU/colony of these strains during a growth curve on solid 265 \nmedia. This solid media growth curve confirmed that SM598 showed enhanced growth compared to 266 \nthe parental strain (Fig. 6 C, D). In addition, strains lacking the 5’-CCGG-targeting restriction 267 \nenzymes (RM1R1 and RM2R) also showed significantly higher CFU/colony counts, and growth was 268 \nreduced by expressing RM1R or RM2R from an ectopic locus (Fig. 6D, F). 269 \nWe measured CFU/colony in hexadeleted strains carrying native pilin loci and the reintroduced pilS 270 \ngene, with and without 5’-CCGG-mutation (Fig. 2A, B). Interestingly, the two strains that showed the 271 \nhighest CFU/colony were the pilE CCGG-disrupted mutant lacking pilS (SM582) or with a 5’-CCGG 272 \nmutant pilS locus (SM585). The strain with native pilE and pilS sequences (SM578) demonstrated 273 \nthe lowest growth (Fig. 6A). Strains with either an intact pilS or pilE locus showed intermediate 274 \ngrowth, confirming that the elevated CFU/colony count in the pilE 5’-CCGG-disrupted mutant is 275 \nattributable to pilE and pilS disruption. 276 \nCollectively, these data indicate that RM1R or RM2R activity at 5’-CCGG sites in pilS or pilE results 277 \nin reduced growth. This observation explains why unpiliated colonies tend to have higher CFU 278 \ncounts 46. To test this hypothesis, we compared the CFU per colony between two nonpiliated 279 \nmutants: a ΔpilE mutant, which does not undergo pilin Av, and a pilE promoter mutant, a mutation 280 \nthat doesn’t affect pilin Av frequency 47. Interestingly, the pilE promoter mutation did not alter CFU 281 \nper colony compared to the parental strain, whereas the ΔpilE mutant exhibited a significantly 282 \nhigher CFU per colony count (Fig. S7). We introduced the pilE promoter mutation in the CCGG-283 \ndisrupted SM598 mutant, but it didn’t affect growth. This result shows that the increased growth we 284 \nobserved is most likely due to the CCGG mutation rather than pilin or pilus expression. These 285 \nresults suggest that cleavage of the pilE and pilS copies, and, by extension, pilin Av, negatively 286 \nimpacts fitness. 287 \n 288 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n13 \n \n14 16 18 20\n10\n100\n1000\n10000\n100000\nTime (hours)\nCFU/colony\npilS3C1pilEStrain\n-native SM576\nnative native SM578\nCCGG-disruptednative SM580\n-CCGG-disrupted SM582\nnative CCGG-disrupted SM584\nCCGG-disrupted CCGG-disrupted SM585\n12 14 16 18 20 22 24\n1\n10\n100\n1000\n10000\nTime (hours)\nCFU/colony\nparental strain\nSM323 ΔR1.RM1\nSM527 ΔR1.RM1\nR.RM1::NICS\n*\n*\nns\n12 14 16 18 20 22 24\n1\n10\n100\n1000\n10000\nTime (hours)\nCFU/colony\nparental strain\nSM327 ΔR.RM2\nSM560 ΔR.RM2::NICSns\n* *\n12 14 16 18 20 22 24\n1\n10\n100\n1000\n10000\n100000\nTime (hours)\nCFU/colony\nParental strain IPTG\nSM598\nSM598 IPTG\nParental strain\n*\n* *\nSM576 SM578 SM580 SM582 SM584 SM585 \n1\n10\n100\n1000\n10000\nCFU/colony\n0.0001\n0.0006\n<0.0001\n0.0038\n<0.0001\n0.0042 <0.0001\n16h timepoint\nA B\nC D\nE F\nParental strain \nGCB\nParental strain \nGCB IPTG\nCCGG-disrupted pilE\nGCB\nCCGG-disrupted pilE\nGCB IPTG\n 289 \nFig. 6 – Growth on solid media. A. Strains from the pilS hexadeleted background with and without 290 \ndisruption of the pilE or pilS1C3 sequences grown in the presence of 1mM IPTG. B. Statistical 291 \nanalysis using Fisher’s LSD multiple comparison of the 16h timepoint from panel A, only 292 \nstatistically significant comparisons are plotted. C. Growth of the parental strain and SM598 (pilE 293 \nCCGG disrupted) in the absence or presence of 1mM IPTG. D. Pictures of the parental strain and 294 \nthe SM598 strain (pilE CCGG disrupted) grown for 18h on GCB in the absence or presence of 1mM 295 \nIPTG. E. Complementation of the SM323 growth in the presence or absence of 1mM IPTG. F. 296 \nComplementation of the SM327 growth in the presence or absence of 1mM IPTG. 297 \n 298 \n 299 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n14 \n \nDISCUSSION 300 \nBacterial adaptation is shaped by a fundamental balance: traits such as virulence factors, 301 \nantibiotic tolerance, or antigenic variation that may reduce individual fitness but allow populations 302 \nto overcome selective pressures – whether from host immunity, microbial competition, or 303 \nenvironmental challenges. Antigenic variation (Av) illustrates this paradox: by generating diverse 304 \nsurface antigen repertoires, some cells escape immune detection, while those with less variation 305 \nare more likely to be eliminated 48,49. 306 \nWe demonstrate that the paralogous restriction enzymes RM1R1 (R1.NgoAXIV) and RM2R 307 \n(R.NgoAXIII), which each cleave the unmethylated 5’-CCGG sites across the genome to induce cuts 308 \nwithin the pilE and pilS loci. We propose that these cuts ligate to create one or two junctions 309 \nbetween the recombining genes, and resulting in regions of microhomology at one or both 310 \nrecombination junctions. These results help explain why small regions of DNA can be transferred 311 \nduring the pilin Av gene conversion reactions. However, these results do not explain the 312 \nrequirement for homologous recombination (e.g., RecA, RecO, and RecR) for pilin AV. Previous data 313 \nsuggested that there is a multi-step process in which a junction is formed between pilE and a pilS 314 \ncopy 20. We postulate that the hybrid locus forms on a donor chromosome and recombines with the 315 \npilE on the recipient chromosome 20,50. This idea is supported by the fact that Gc and the closely 316 \nrelated N. meningitidis, both of which undergo pilin Av 51,52 are polyploid, while N. lactamica that 317 \ndoes not undergo pilin Av is monoploid 50. This model is consistent with the observation that some 318 \npilE recombinants have only one 5’-CCGG site at the recombination tract border. Ultimately, 319 \ninvoking separate donor and recipient chromosomes explains why this represents a gene 320 \nconversion process since the silent copies on the recipient chromosome are not involved. Notably, 321 \nvlsE antigenic variation in Borrelia species, which are also polyploid 53 and possess several RM 322 \nsystems on their plasmids 42, occurs via trans recombination, a process in which genetic exchange 323 \ntakes place between physically distinct DNA molecules 54. It is interesting to speculate that Borrelia 324 \nmay also use RM system-mediated recombination between donor and recipient sequences as a 325 \nstep during antigenic variation. One unexpected observation from this study is the increased growth 326 \nin RM mutants or strains with mutated pilE or pilS 5’-CCGG sites. These results suggest that 327 \nrestriction in the pilE and pilS 5’-CCGG sites interferes with Gc fitness. We knew that a ΔpilE mutant 328 \nexhibits increased growth, and we assumed this was a fitness cost of producing the pilin protein 329 \nand pilus fiber. However, since a pilE promoter -10 mutant (which abolishes pilE expression and 330 \nthus piliation) displays parental-growth, we conclude that the reduced growth when the 5’-CCGG 331 \nsites are cleaved is due to chromosomal loss during pilin AV. 332 \nThere are many unknown parts of the pilin Av process. Our results do not explain how the digested 333 \npilE and pilS copies associate, whether multiple digestions events occur within the pilin loci on a 334 \nsingle chromosome, and if other parts of the digested chromosomes would ligate together. Given 335 \nthat most pilin loci are clustered within a 30 kb region of the 2.1 Mb chromosome, hybrid formation 336 \nmay simply result from the proximity of these loci and their high density of 5’-CCGG sites. While we 337 \npostulate that recombination occurs between a hybrid formed between a donor chromosome and a 338 \nrecipient, this would require protection of the second chromosome from digestion. Alternatively, 339 \nhybrid locus formation could occur in one half of a diplococcus, with the recipient chromosome 340 \nresiding in the second coccal unit. 341 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n15 \n \nTaken together, these results imply that RM-mediated cleavage at 5’-CCGG sites in pilE is an early 342 \nand critical step in pilin Av. This improvement in fitness in laboratory conditions was inversely 343 \ncorrelated with the decrease in Pilin Av frequencies, which implies that pilin Av has a fitness cost 344 \neven without immune pressure. This aligns with observations in other pathogens, such as malaria 345 \nparasites and viruses, where antigenic diversity involves fitness costs in vitro 55,56. These findings 346 \nadvocate that the pilin Av mechanism is adapted to limit the proliferation of non-varying cells, 347 \nthereby maintaining population-level diversity. These observations reinforce a key evolutionary 348 \nprinciple: population resilience often depends on limiting individual fitness. 349 \n 350 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n16 \n \nMETHODS 351 \nBacterial strains and growth 352 \nBacterial strains used in this study (listed in Table S3) are derivatives of the N. gonorrhoeae FA1090 353 \nisolate. All strains were checked to have the pilE 1-81-S2 variant sequence developed during 354 \nhuman volunteer colonization 44. The strains were grown in 37°C at 5% CO2 on Gonococcal (Gc) 355 \nMedium Base (BD Difco) (36.25 g/L), agar (1.25g/L), Kellogg Supplement I (22.2 mM glucose, 0.68 356 \nmM glutamine, 0.45 mM cocarboxylase), and Kellogg Supplement II [1.23 µM Fe(NO3)3] 11. 357 \nPilin antigenic variation measurements 358 \nPDCMC pilin Av assay 359 \nThe PDCMC assay was performed as previously published 22. The Gc strains were revived on GCB 360 \nfrom a frozen stock overnight. The next day, a single colony was reisolated onto GCB and GCB 1 mM 361 \nIPTG plates and incubated overnight. After 18h of growth, 20 colonies were selected, and their 362 \nmorphologies were monitored to score the appearance of nonpiliated blebs. After 30h of growth, 363 \nthe number of blebs in the selected colonies was counted. The variation score was counted e.g., 1 364 \nfor 1 bleb, 2 for 2 blebs, 3 for 3 blebs, and 4 for 4 or more blebs. The PDCMC score corresponds to 365 \nthis variation score divided by the number of colonies (20). 366 \nAnalysis of pilE variants 367 \nAfter 30h of growth on GCB 1mM IPTG, a bleb was reisolated from each colony on GCB. The next 368 \nday, a single colony was used to perform a PCR with the primers PilRBS and S3PA 44. The amplicon 369 \nwas then sequenced using Genewiz Azenta Sanger services. The alignment of the sequences was 370 \nperformed using Jalview 57. 371 \nPilin Av DNA sequencing assay 372 \nTo enable measuring of pilin Av frequencies by Illumina sequencing, recA6 strains were grown for 373 \n22 h on 1 mM IPTG GCB, which corresponds to about 19 or 20 generations 39. About 500 colonies 374 \nwere collected, and genomic DNA was extracted. The KOD Hot Start (Novagen, Toyobo) PCR was 375 \nperformed according to the supplied protocol, with 100 ng of template genomic DNA. False 376 \n“variants” can occur by in vitro recombination during the PCR amplification 39. To limit these PCR-377 \ngenerated hybrids, we limited the number of cycles to 30. The PCR product was then purified using 378 \nQiagen PCR purification kit, and Illumina sequencing (SeqCenter). The sequencing data were 379 \naligned with pilE 1-81-S2 sequence as a reference genome using Hisat2 58 and Samtools 59 . The 380 \nvariant calling was then run using Pysam 60 in a custom script 61. 381 \nDetection of restricted 5’-CCGG sites 382 \nA synthetic adaptor was produced with a 5’-GC overhang and a single phosphorylated 5’-end. To 383 \nprepare the adapter-ligated DNA, we annealed the oligonucleotides SM243 TOP 384 \n(CGGGTCGGCAGTAACGTATTGATGCATACC) and SM244 BOT 385 \n(GGTCGGCAGTAACGTATTGATGCATACCCG) to create a CG overhang by mixing SM244 BOT and 386 \nSM243 TOP, heating the mixture to 98°C, and gradually decreasing the temperature by 5°C every 10 387 \nminutes until reaching 4°C to allow efficient annealing. We purified the product using the column 388 \ncleanup PCR purification kit (Qiagen). We ligated the purified adapters with purified SM18 recA6 389 \ngenomic DNA using T4 DNA ligase at 16°C overnight (NEB). For the positive control of this 390 \nexperiment, we used genomic DNA pre-treated with the restriction endonuclease Hpa II (NEB). 391 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n17 \n \nPCR was performed using forward and reversed primers corresponding to the adapter sequences 392 \nand the primers pilRBS 44, pilEREV 44, SM241 (GGCGTTACCGCGCCCGTC) and SM242 393 \n(ATCCATGAACCCGACCGCACAACG). The reaction was performed using GoTaq (Promega) with the 394 \nadapter-ligated gDNA as the template. The amplified products were analyzed on agarose gels. 395 \nWe performed nanopore sequencing of the adapter-ligated gDNA (SeqCenter). We analyzed the 396 \nsequencing data using a custom script that mapped the adapters across the genome 61. The script 397 \nprocesses nanopore sequencing data to identify adapter positions by mapping the FASTQ reads to 398 \na reference genome using minimap2, detecting adapters with edlib, and splitting reads at adapter 399 \nsites. Adapter positions were filtered and the location of adaptors was visualized using matplotlib. 400 \nThe workflow utilizes pysam for BAM/FASTA file handling and Bio.Seq for sequence manipulation, 401 \nproviding a comprehensive analysis of sequencing data quality and biological significance. 402 \nMethylation analysis 403 \nMethylated bases were identified using Modkit dist_modkit_v0.4.4_7cf558c 45, a tool designed for 404 \nanalyzing nanopore sequencing data. Raw sequencing reads were aligned to the reference genome 405 \nusing EPI2ME with default parameters. The resulting BAM files were processed with Modkit module 406 \nfor detection of the 5mC methylations. Methylation frequencies were visualized, and regions of 407 \ninterest were extracted for downstream analysis, comparing treated and control samples. 408 \nQUANTIFICATION AND STATISTICAL ANALYSIS 409 \nThe statistical analysis was conducted using GraphPad Prism. The growth and PDCMC statistical 410 \nanalysis were executed using an ANOVA test with the multiple comparison Fisher's LSD 411 \nparameters. Each bar graph represents the individual values that are represented by symbols. The 412 \nbar graphs correspond to the mean, with the SD indicated as an error bar. 413 \nACKNOWLEDGEMENTS 414 \nWe would like to thank Dr. Shaohui Yin for providing the hexadeleted mutant. We are also grateful to 415 \nDr. Linda Hu for her insightful and constructive feedback during the revision of this manuscript, and 416 \nto all the members of the Seifert lab for their valuable discussions throughout the study. 417 \nResearch reported in this publication was supported by the National Institute of Allergy and 418 \nInfectious Disease (NIAID) of the National Institutes of Health under grant numbers R37 AI033493, 419 \nR01AI146073, and R21AI148981. 420 \n DETAILS. 421 \nThe content is solely the responsibility of the authors and does not necessarily represent the official 422 \nviews of the National Institutes of Health. This manuscript is the result of funding in whole or in part 423 \nby the National Institutes of Health (NIH). It is subject to the NIH Public Access Policy. Through 424 \nacceptance of this federal funding, NIH has been given a right to make this manuscript publicly 425 \navailable in PubMed Central upon the Official Date of Publication, as defined by NIH. 426 \n 427 \n 428 \n 429 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n18 \n \nREFERENCES 430 \n1. World Health Organization ed. (2024). Updated recommendations for the treatment of 431 \nNeisseria gonorrhoeae, Chlamydia trachomatis and Treponema pallidum (syphilis), and new 432 \nrecommendations on syphilis testing and partner services (World Health Organization). 433 \n2. Unemo, M., Golparian, D., Sánchez-Busó, L., Grad, Y., Jacobsson, S., Ohnishi, M., Lahra, M.M., 434 \nLimnios, A., Sikora, A.E., Wi, T., et al. (2016). The novel 2016 WHO Neisseria gonorrhoeae 435 \nreference strains for global quality assurance of laboratory investigations: phenotypic, genetic 436 \nand reference genome characterization. J Antimicrob Chemother 71, 3096–3108. 437 \nhttps://doi.org/10.1093/jac/dkw288. 438 \n3. Quillin, S.J., and Seifert, H.S. (2018). Neisseria gonorrhoeae host adaptation and pathogenesis. 439 \nNat Rev Microbiol 16, 226–240. https://doi.org/10.1038/nrmicro.2017.169. 440 \n4. Swanson, J. (1973). Studies on gonococcus infection. IV. Pili: their role in attachment of 441 \ngonococci to tissue culture cells. J Exp Med 137, 571–589. 442 \nhttps://doi.org/10.1084/jem.137.3.571. 443 \n5. Merz, A.J., So, M., and Sheetz, M.P. (2000). Pilus retraction powers bacterial twitching motility. 444 \nNature 407, 98–102. https://doi.org/10.1038/35024105. 445 \n6. Craig, L., Forest, K.T., and Maier, B. (2019). Type IV pili: dynamics, biophysics and functional 446 \nconsequences. Nat Rev Microbiol 17, 429–440. https://doi.org/10.1038/s41579-019-0195-4. 447 \n7. Hagblom, P., Segal, E., Billyard, E., and So, M. (1985). Intragenic recombination leads to pilus 448 \nantigenic variation in Neisseria gonorrhoeae. Nature 315, 156–158. 449 \nhttps://doi.org/10.1038/315156a0. 450 \n8. Meyer, T.F., Mlawer, N., and So, M. (1982). Pilus expression in Neisseria gonorrhoeae involves 451 \nchromosomal rearrangement. Cell 30, 45–52. https://doi.org/10.1016/0092-8674(82)90010-1. 452 \n9. Hamrick, T.S., Dempsey, J.A.F., Cohen, M.S., and Cannon, J.G. (2001). Antigenic variation of 453 \ngonococcal pilin expression in vivo: analysis of the strain FA1090 pilin repertoire and 454 \nidentification of the pilS gene copies recombining with pilE during experimental human 455 \ninfection. Microbiology (Reading) 147, 839–849. https://doi.org/10.1099/00221287-147-4-839. 456 \n10. Long, C.D., Madraswala, R.N., and Seifert, H.S. (1998). Comparisons between Colony Phase 457 \nVariation of Neisseria gonorrhoeae FA1090 and Pilus, Pilin, and S-Pilin Expression. Infect 458 \nImmun 66. https://doi.org/10.1128/IAI.66.5.1918-1927.1998. 459 \n11. Kellogg, D.S., Douglas S. Kellogg, Kellogg, D.S., Peacock, W.L., William L. Peacock, Deacon, 460 \nW.E., Deacon, W.E., Brown, L., and Pirkle, C.I. (1963). NEISSERIA GONORRHOEAE I. Virulence 461 \nGenetically Linked to Clonal Variation. Journal of Bacteriology 85, 1274–1279. 462 \nhttps://doi.org/10.1128/jb.85.6.1274-1279.1963. 463 \n12. Criss, A.K., Kline, K.A., and Seifert, H.S. (2005). The frequency and rate of pilin antigenic 464 \nvariation in Neisseria gonorrhoeae: Neisseria gonorrhoeae pilin variation. Molecular 465 \nMicrobiology 58, 510–519. https://doi.org/10.1111/j.1365-2958.2005.04838.x. 466 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n19 \n \n13. Criss, A.K., and Seifert, H.S. (2012). A bacterial siren song: intimate interactions between 467 \nNeisseria and neutrophils. Nat Rev Microbiol 10, 178–190. 468 \nhttps://doi.org/10.1038/nrmicro2713. 469 \n14. Shafer, W.M., and Rest, R.F. (1989). INTERACTIONS OF GONOCOCCI WITH PHAGOCYTIC 470 \nCELLS. Annual Review of Microbiology 43, 121–145. 471 \nhttps://doi.org/10.1146/annurev.mi.43.100189.001005. 472 \n15. Howell-Adams, B., Wainwright, L.A., and Seifert, H.S. (1996). The size and position of 473 \nheterologous insertions in a silent locus differentially affect pilin recombination in Neisseria 474 \ngonorrhoeae. Molecular Microbiology 22, 509–522. https://doi.org/10.1046/j.1365-475 \n2958.1996.00128.x. 476 \n16. Wainwright, L.A., Pritchard, K.H., and Selfert, H.S. (1994). A conserved DNA sequence is 477 \nrequired for efficient gonococcal pilin antigenic variation. Molecular Microbiology 13, 75–87. 478 \nhttps://doi.org/10.1111/j.1365-2958.1994.tb00403.x. 479 \n17. Cahoon, L.A., and Seifert, H.S. (2009). An alternative DNA structure is necessary for pilin 480 \nantigenic variation in Neisseria gonorrhoeae. Science 325, 764–767. 481 \nhttps://doi.org/10.1126/science.1175653. 482 \n18. Cahoon, L.A., and Seifert, H.S. (2013). Transcription of a cis-acting, Noncoding, Small RNA Is 483 \nRequired for Pilin Antigenic Variation in Neisseria gonorrhoeae. PLoS Pathog 9, e1003074. 484 \nhttps://doi.org/10.1371/journal.ppat.1003074. 485 \n19. Prister, L.L., Yin, S., Cahoon, L.A., and Seifert, H.S. (2020). Altering the Neisseria gonorrhoeae 486 \npilE Guanine Quadruplex Loop Bases Affects Pilin Antigenic Variation. Biochemistry 59, 1104–487 \n1112. https://doi.org/10.1021/acs.biochem.9b01038. 488 \n20. Howell-Adams, B., and Seifert, H.S. (2000). Molecular models accounting for the gene 489 \nconversion reactions mediating gonococcal pilin antigenic variation. Molecular Microbiology 490 \n37, 1146–1158. https://doi.org/10.1046/j.1365-2958.2000.02067.x. 491 \n21. Koomey, M., Gotschlich, E.C., Robbins, K., Bergström, S., and Swanson, J. (1987). Effects of 492 \nrecA mutations on pilus antigenic variation and phase transitions in Neisseria gonorrhoeae. 493 \nGenetics 117, 391–398. https://doi.org/10.1093/genetics/117.3.391. 494 \n22. Sechman, E.V., Rohrer, M.S., and Seifert, H.S. (2005). A genetic screen identifies genes and 495 \nsites involved in pilin antigenic variation in Neisseria gonorrhoeae: Gonococcal mutants with 496 \nimpaired pilin variation. Molecular Microbiology 57, 468–483. https://doi.org/10.1111/j.1365-497 \n2958.2005.04657.x. 498 \n23. Skaar, E.P., Lazio, M.P., and Seifert, H.S. (2002). Roles of the recJ and recN Genes in 499 \nHomologous Recombination and DNA Repair Pathways of Neisseria gonorrhoeae. J Bacteriol 500 \n184, 919–927. https://doi.org/10.1128/jb.184.4.919-927.2002. 501 \n24. Mehr, I.J., and Seifert, H.S. (1998). Differential roles of homologous recombination pathways in 502 \nNeisseria gonorrhoeae pilin antigenic variation, DNA transformation and DNA repair. Mol 503 \nMicrobiol 30, 697–710. https://doi.org/10.1046/j.1365-2958.1998.01089.x. 504 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n20 \n \n25. Tesson, F., Hervé, A., Mordret, E., Touchon, M., d’Humières, C., Cury, J., and Bernheim, A. 505 \n(2022). Systematic and quantitative view of the antiviral arsenal of prokaryotes. Nat Commun 506 \n13, 2561. https://doi.org/10.1038/s41467-022-30269-9. 507 \n26. Loenen, W.A.M., Dryden, D.T.F., Raleigh, E.A., Wilson, G.G., and Murray, N.E. (2014). Highlights 508 \nof the DNA cutters: a short history of the restriction enzymes. Nucleic Acids Res 42, 3–19. 509 \nhttps://doi.org/10.1093/nar/gkt990. 510 \n27. Sánchez-Busó, L., Golparian, D., Parkhill, J., Unemo, M., and Harris, S.R. (2019). Genetic 511 \nvariation regulates the activation and specificity of Restriction-Modification systems in 512 \nNeisseria gonorrhoeae. Sci Rep 9, 14685. https://doi.org/10.1038/s41598-019-51102-2. 513 \n28. Srikhanta, Y.N., Dowideit, S.J., Edwards, J.L., Falsetta, M.L., Wu, H.-J., Harrison, O.B., Fox, K.L., 514 \nSeib, K.L., Maguire, T.L., Wang, A.H.-J., et al. (2009). Phasevarions Mediate Random Switching 515 \nof Gene Expression in Pathogenic Neisseria. PLOS Pathogens 5, e1000400. 516 \nhttps://doi.org/10.1371/journal.ppat.1000400. 517 \n29. Adamczyk-Poplawska, M., Lower, M., and Piekarowicz, A. (2009). Characterization of the 518 \nNgoAXP: phase-variable type III restriction–modification system in Neisseria gonorrhoeae. 519 \nFEMS Microbiol Lett 300, 25–35. https://doi.org/10.1111/j.1574-6968.2009.01760.x. 520 \n30. Adamczyk-Poplawska, M., Lower, M., and Piekarowicz, A. (2011). Deletion of One Nucleotide 521 \nwithin the Homonucleotide Tract Present in the hsdS Gene Alters the DNA Sequence Specificity 522 \nof Type I Restriction-Modification System NgoAV. Journal of Bacteriology 193, 6750–6759. 523 \nhttps://doi.org/10.1128/jb.05672-11. 524 \n31. Kwiatek, A., Kobes, M., Olejnik, K., and Piekarowicz, A. (2004). DNA methyltransferases from 525 \nNeisseria meningitidis and Neisseria gonorrhoeae FA1090 associated with mismatch nicking 526 \nendonucleases. Microbiology 150, 1713–1722. https://doi.org/10.1099/mic.0.27011-0. 527 \n32. Pingoud, A., and Jeltsch, A. (2001). Structure and function of type II restriction endonucleases. 528 \nNucleic Acids Res 29, 3705–3727. https://doi.org/10.1093/nar/29.18.3705. 529 \n33. Roberts, R.J., Belfort, M., Bestor, T., Bhagwat, A.S., Bickle, T.A., Bitinaite, J., Blumenthal, R.M., 530 \nDegtyarev, S.Kh., Dryden, D.T.F., Dybvig, K., et al. (2003). A nomenclature for restriction 531 \nenzymes, DNA methyltransferases, homing endonucleases and their genes. Nucleic Acids Res 532 \n31, 1805–1812. https://doi.org/10.1093/nar/gkg274. 533 \n34. Shaw, L.P., Rocha, E.P.C., and MacLean, R.C. (2023). Restriction-modification systems have 534 \nshaped the evolution and distribution of plasmids across bacteria. Nucleic Acids Res 51, 6806–535 \n6818. https://doi.org/10.1093/nar/gkad452. 536 \n35. Vasu, K., and Nagaraja, V. (2013). Diverse functions of restriction-modification systems in 537 \naddition to cellular defense. Microbiol Mol Biol Rev 77, 53–72. 538 \nhttps://doi.org/10.1128/MMBR.00044-12. 539 \n36. Swanson, J., Bergström, S., Barrera, O., Robbins, K., and Corwin, D. (1985). Pilus- gonococcal 540 \nvariants. Evidence for multiple forms of piliation control. J Exp Med 162, 729–744. 541 \nhttps://doi.org/10.1084/jem.162.2.729. 542 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n21 \n \n37. Duckworth, M., Jackson, D., Zak, K., and Heckels, J.E. (1983). Structural variations in pili 543 \nexpressed during gonococcal infection. J Gen Microbiol 129, 1593–1596. 544 \nhttps://doi.org/10.1099/00221287-129-5-1593. 545 \n38. Meyer, T.F., Billyard, E., Haas, R., Storzbach, S., and So, M. (1984). Pilus genes of Neisseria 546 \ngonorrheae: chromosomal organization and DNA sequence. Proc Natl Acad Sci U S A 81, 6110–547 \n6114. https://doi.org/10.1073/pnas.81.19.6110. 548 \n39. Rotman, E., Webber, D.M., and Seifert, H.S. (2016). Analyzing Neisseria gonorrhoeae Pilin 549 \nAntigenic Variation Using 454 Sequencing Technology. J Bacteriol 198, 2470–2482. 550 \nhttps://doi.org/10.1128/JB.00330-16. 551 \n40. Quillin, S.J., Luo, D., Gavagan, A., Prindle, A., and Seifert, H.S. (2025). A droplet digital PCR 552 \nassay to measure pilin antigenic variation frequency in Neisseria gonorrhoeae. mSphere 10, 553 \ne0009425. https://doi.org/10.1128/msphere.00094-25. 554 \n41. Ozer, E.A., Prister, L.L., Yin, S., Ward, B.H., Ivanov, S., and Seifert, H.S. (2019). PacBio Amplicon 555 \nSequencing Method To Measure Pilin Antigenic Variation Frequencies of Neisseria 556 \ngonorrhoeae. mSphere 4, e00562-19. https://doi.org/10.1128/mSphere.00562-19. 557 \n42. NEB REBASE. https://rebase.neb.com/cgi-bin/onumget?64360. 558 \n43. Potter, A.D., Baiocco, C.M., Papin, J.A., and Criss, A.K. (2023). Transcriptome-guided metabolic 559 \nnetwork analysis reveals rearrangements of carbon flux distribution in Neisseria gonorrhoeae 560 \nduring neutrophil co-culture. mSystems 8, e01265-22. 561 \nhttps://doi.org/10.1128/msystems.01265-22. 562 \n44. Seifert, H.S., Wright, C.J., Jerse, A.E., Cohen, M.S., and Cannon, J.G. (1994). Multiple 563 \ngonococcal pilin antigenic variants are produced during experimental human infections. J. Clin. 564 \nInvest. 93, 2744–2749. https://doi.org/10.1172/JCI117290. 565 \n45. nanoporetech/modkit (Oxford Nanopore Technologies). 566 \n46. Boiko, I., Metaane, S., and Seifert, H.S. (2025). Publicly Available Neisseria Gonorrhoeae 567 \nGenomes Predominantly Represent In Vitro-Derived Nonpiliated Variants. J Infect Dis, jiaf557. 568 \nhttps://doi.org/10.1093/infdis/jiaf557. 569 \n47. Kline, K.A., Criss, A.K., Wallace, A., and Seifert, H.S. (2007). Transposon Mutagenesis Identifies 570 \nSites Upstream of the Neisseria gonorrhoeae pilE Gene That Modulate Pilin Antigenic Variation. 571 \nJ Bacteriol 189, 3462–3470. https://doi.org/10.1128/JB.01911-06. 572 \n48. Hill, D.J., Griffiths, N.J., Borodina, E., and Virji, M. (2010). Cellular and molecular biology of 573 \nNeisseria meningitidis colonization and invasive disease. Clin Sci (Lond) 118, 547–564. 574 \nhttps://doi.org/10.1042/CS20090513. 575 \n49. Zhang, J.-R., Hardham, J.M., Barbour, A.G., and Norris, S.J. (1997). Antigenic Variation in Lyme 576 \nDisease Borreliae by Promiscuous Recombination of VMP-like Sequence Cassettes. Cell 89, 577 \n275–285. https://doi.org/10.1016/S0092-8674(00)80206-8. 578 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n22 \n \n50. Tobiason, D.M., and Seifert, H.S. (2006). The Obligate Human Pathogen, Neisseria 579 \ngonorrhoeae, Is Polyploid. PLoS Biol 4, e185. https://doi.org/10.1371/journal.pbio.0040185. 580 \n51. Tinsley, C.R., and Heckels, J.E. (1986). Variation in the expression of pili and outer membrane 581 \nprotein by Neisseria meningitidis during the course of meningococcal infection. J Gen Microbiol 582 \n132, 2483–2490. https://doi.org/10.1099/00221287-132-9-2483. 583 \n52. Helm, R.A., and Seifert, H.S. (2010). Frequency and Rate of Pilin Antigenic Variation of Neisseria 584 \nmeningitidis. J Bacteriol 192, 3822–3823. https://doi.org/10.1128/JB.00280-10. 585 \n53. Takacs, C.N., Wachter, J., Xiang, Y., Ren, Z., Karaboja, X., Scott, M., Stoner, M.R., Irnov, I., 586 \nJannetty, N., Rosa, P.A., et al. (2022). Polyploidy, regular patterning of genome copies, and 587 \nunusual control of DNA partitioning in the Lyme disease spirochete. Nat Commun 13, 7173. 588 \nhttps://doi.org/10.1038/s41467-022-34876-4. 589 \n54. Singh, P., and Bankhead, T. (2025). Breaking a barrier: In trans vlsE recombination and genetic 590 \nmanipulation of the native vlsE gene of the Lyme disease pathogen. PLoS Pathog 21, e1012871. 591 \nhttps://doi.org/10.1371/journal.ppat.1012871. 592 \n55. Liu, Y., McNevin, J., Zhao, H., Tebit, D.M., Troyer, R.M., McSweyn, M., Ghosh, A.K., Shriner, D., 593 \nArts, E.J., McElrath, M.J., et al. (2007). Evolution of Human Immunodeficiency Virus Type 1 594 \nCytotoxic T-Lymphocyte Epitopes: Fitness-Balanced Escape. J Virol 81, 12179–12188. 595 \nhttps://doi.org/10.1128/JVI.01277-07. 596 \n56. Villa, M., and Lässig, M. (2017). Fitness cost of reassortment in human influenza. PLoS Pathog 597 \n13, e1006685. https://doi.org/10.1371/journal.ppat.1006685. 598 \n57. Waterhouse, A.M., Procter, J.B., Martin, D.M.A., Clamp, M., and Barton, G.J. (2009). Jalview 599 \nVersion 2—a multiple sequence alignment editor and analysis workbench. Bioinformatics 25, 600 \n1189–1191. https://doi.org/10.1093/bioinformatics/btp033. 601 \n58. Kim, D., Paggi, J.M., Park, C., Bennett, C., and Salzberg, S.L. (2019). Graph-based genome 602 \nalignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol 37, 907–915. 603 \nhttps://doi.org/10.1038/s41587-019-0201-4. 604 \n59. Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., 605 \nDurbin, R., and 1000 Genome Project Data Processing Subgroup (2009). The Sequence 606 \nAlignment/Map format and SAMtools. Bioinformatics 25, 2078–2079. 607 \nhttps://doi.org/10.1093/bioinformatics/btp352. 608 \n60. Heger, A., Marshall, J., and Jacobs, K. (2009). Pysam: Htslib interface for python. (pysam-609 \ndevelopers). 610 \n61. Interleukine/Two-paralogous-restriction-modification-systems-are-required-for-Neisseria-611 \ngonorrhoeae-pilin-antigen https://github.com/Interleukine/Two-paralogous-restriction-612 \nmodification-systems-are-required-for-Neisseria-gonorrhoeae-pilin-antigen. 613 \n62. Seifert, H.S. (1997). Insertionally inactivated and inducible recA alleles for use in Neisseria. 614 \nGene 188, 215–220. https://doi.org/10.1016/S0378-1119(96)00810-4. 615 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n23 \n \n63. Hu, L.I., Yin, S., Ozer, E.A., Sewell, L., Rehman, S., Garnett, J.A., and Seifert, H.S. (2020). 616 \nDiscovery of a New Neisseria gonorrhoeae Type IV Pilus Assembly Factor, TfpC. mBio 11, 617 \n10.1128/mbio.02528-20. https://doi.org/10.1128/mbio.02528-20. 618 \n 619 \n 620 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n24 \n \nEXTENDED DATA 621 \nTable S1. List of the predicted Type II RM with their predicted recognition motif and the number of 622 \noccurrences in the Gc strain FA1090 N-1-60. 623 \n 624 \nPredicted Type II RM \nsystem \n Motif \n(5’ to 3’) \nNumber of \noccurrences in \nFA1090 N-1-60 \nNumber of non-overlapping \noccurrences in \nFA1090 N-1-60 \nNgoFVII GCSGC 16173 13952 \nNgoAXIV and NgoAXIII CCGG 11103 7884 \nNgoAII GGCC 4590 2018 \nNgoAXIP GATC 2259 2112 \nNgoAXV GGNNCC 2033 818 \nNgoAX CCACC 1575 1380 \nNgoAIV GCCGGC 1572 0 \nNgoAI RGCGCY 622 224 \nNgoAVIII GACNNNNNTGA 407 338 \nNgoAIII CCGCGG 218 45 \nNgoAXVII GAGNNNNNTAC 118 89 \n 625 \nTable S2 – Number of occurrences of each of the known motifs targeted by type II restriction-626 \nmodification systems in Gc strain FA1090 627 \n 628 \nMotif (5’ to 3’) # in pilE # in 19 pilS copies \nGCSGC 2 41 \nCCGG 4 87 \nGGCC 3 48 \nGATC 1 1 \nGGNNCC 0 14 \nCCACC 1 12 \nGCCGGC 1 32 \nRGCGCY 0 8 \nGACNNNNNTGA 0 1 \nCCGCGG 0 0 \nGAGNNNNNTAC 0 0 \n629 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n25 \n \n630 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n26 \n \n 631 \nFig. S1- Sequence alignment of pilE amplicon from the SM598 mutant variants. The variants were reisolated from blebs on GCB IPTG 632 \nafter 30h of growth. The reference sequence is indicated in green, the pilS inserts are indicated in purple and the 5’-CCGG sites are 633 \nindicated in orange. 634 \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n27 \n \n635 \nFig. S2- Genomic organization of the RM1 RM2 and RM3 operons in Gc FA1090. Rectangles 636 \nfollow Rebase nomenclature. ORFs are labeled with Ngo_ identifiers, while NEIS numbers 637 \ncorresponds to PubMLST nomenclature. Red indicates restriction genes; blue, methylase genes. 638 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n28 \n \n0.0\n0.2\n0.4\n0.6\n0.8\n1.0\nPDCMC Score\n<0.0001 0.0007\nparental\nstrain ΔR1 ΔR1\niga-trpB::R1\nRM1\n0.0\n0.2\n0.4\n0.6\n0.8\n1.0\nPDCMC Score\n0.0086\n0.0499\n0.0016\nparental\nstrain ΔR2 ΔR2\niga-trpB::R2\nRM2\n 639 \nFig. S3 – PDCMC score measured in the strains ΔR1.RM1 (SM323) and ΔR.RM2 (SM327) and 640 \ntheir complements. The gene of interest RMR1 on the left, RM2R on the right was reinserted in the 641 \niga-trpB site using pMR69. Fischer’s LSD test was used, only the p-values <0.05 were plotted. 642 \n 643 \n 644 \n 645 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n29 \n \n 646 \nFig. S4 – Measure of the growth of mutants carrying single gene deletions of the three operons. 647 \nCFU/colony of the strains of the individual mutants for the operons A. RM1, B. RM3, and C. RM2, 648 \nafter 30h of growth on GCB with and without IPTG. Multiple comparisons were performed using 649 \nFischer’s LSD test, only the p-values <0.05 were plotted. 650 \n 651 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n30 \n \n 652 \n 653 \nFig. S5 – Ligation of the adapter within the genomic DNA. Migration of the PCR-amplified 654 \nfragments using ligated genomic DNA as a template and several pairs of primers where one of them 655 \nis internal to the ligated adapter (246 or 245). The bands expected if the adapter has ligated into a 656 \n5’-CCGG cut are boxed in reindicated with red arrows. The ligA gene is used as a control fragment 657 \nthat contains only one 5’-CCGG site. 658 \n 659 \n 660 \nFig. S6. Detecting CCGG cuts within the pilE gene. Detection of the adapter within pilE. The 661 \nschematic representation of the pilE shows its different regions with the 5’-CCGG sites are 662 \nrepresented in orange. The panel below the pilE gene shows the locations of the detected CCGG 663 \ncuts in, from top to bottom: the parental strain recA6, it’s HpaII-pretreated control, followed with 664 \nthe RM1RM2 double mutant (SM500), its HpaII control, the CCGG-disrupted strain (SM598) and its 665 \nHpaII control. 666 \n 667 \n 668 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n31 \n \n 669 \n 670 \nFig. S7. Measure of the growth of mutants carrying pilE mutations. CFU/colony of the strains 671 \nΔpilE, pilE promoter mutant, pilE CCGG-disrupted mutant and a mutant bearing both mutations at 672 \n16h of growth on GCB with IPTGMultiple comparisons were performed using Fischer’s LSD test. 673 \n 674 \nTable S3. Strains used in this study 675 \nBacterial strains \nFA1090 recA6 62 recA6 \nFA1090 recA6 CCGG disrupted pilE This study SM598 \nFA1090 recA6 ΔR1.RM1 This study SM323 \nFA1090 recA6 ΔR2.RM1 This study SM325 \nFA1090 recA6 ΔM.RM1 This study SM356 \nFA1090 recA6 ΔRM1 This study SM310 \nFA1090 recA6 ΔM1.RM2 This study SM362 \nFA1090 recA6 ΔM2.RM2 This study SM360 \nFA1090 recA6 ΔR.RM2 This study SM327 \nFA1090 recA6 ΔRM2 This study SM364 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint \n\n \n \n32 \n \nFA1090 recA6 ΔRM1ΔRM2 This study SM500 \nFA1090 recA6 ΔR.RM3 This study SM600 \nN-1-60 CRISPRi ngo0873 (M.RM3) This study SM602 \nFA1090 recA6 ΔRM3 This study SM604 \nFA1090 recA6 ΔpilS123678 hexadeleted mutant Shaohui Yin Q409 \nFA1090 recA6 ΔpilS123678 hexadeleted mutant KanR This study SM564 \nFA1090 recA6 hexadeleted mutant::pilS3C1 KanR This study SM568 \nFA1090 recA6 hexadeleted mutant::CCGG-disrupted pilS3C1 \nKanR \nThis study SM570 \nFA1090 recA6 hexadeleted mutant pilE CCGG-disrupted KanR This study SM582 \nFA1090 recA6 hexadeleted mutant::pilS3C1 pilE CCGG-disrupted \nKanR \nThis study SM584 \nFA1090 recA6 hexadeleted mutant::CCGG-disrupted \npilS3C1 CCGG-disrupted pilE KanR \nThis study SM585 \nFA1090 recA6 ΔR1.RM1 R1.RM1 at iga-trpB This study SM527 \nFA1090 recA6 ΔR.RM2 R.RM2 at iga-trpB This study SM560 \nFA1090 recA6 ΔpilE 63 SM648 \nFA1090 recA6 pilE-10::NheI 47 SM650 \nFA1090 recA6 CCGG-disrupted pilE-10::NheI This study SM655 \n 676 \n 677 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 14, 2026. ; https://doi.org/10.64898/2026.01.10.698803doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}