{"paper_id":"181c2a06-7873-46ca-b598-2de057cc4ccb","body_text":"Vitamin D binding protein rs7041 and rs4588 gene... | F1000Research <!-- --> <!-- --> <!-- This is commented out to fix display problems on mobile devices. We may use it again once we implement a responsive design that supports native device resolutions. --> \"use strict\";function _typeof(t){return(_typeof=\"function\"==typeof Symbol&&\"symbol\"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&\"function\"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?\"symbol\":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement(\"iframe\");r.style.cssText=\"display:none\",r.name=\"__tcfapiLocator\",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&\"boolean\"==typeof n[3]&&(e=n[3],\"function\"==typeof n[2]&&n[2](\"set\",!0)):\"ping\"===n[0]?\"function\"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:\"stub\"}):o.push(n)},n.addEventListener(\"message\",(function(t){var e=\"string\"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n=\"object\"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,\"*\")}),n.parameter)}),!1))};\"undefined\"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:[\"bam.nr-data.net\"]}}; ;NREUM.loader_config={accountID:\"438030\",trustKey:\"438030\",agentID:\"772317073\",licenseKey:\"97f8f67f26\",applicationID:\"772317073\"} ;NREUM.info={beacon:\"bam.nr-data.net\",errorBeacon:\"bam.nr-data.net\",licenseKey:\"97f8f67f26\",applicationID:\"772317073\",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{\"use strict\";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error(\"All info objects require an agent identifier!\");if(!a[e])throw new Error(\"Info for \".concat(e,\" was never set\"));return a[e]}function c(e,t){if(!e)throw new Error(\"All info objects require an agent identifier!\");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],\"info\")}var u=r(7056);const d=()=>{const e={blockSelector:\"[data-nr-block]\",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:\"*\",maskAllInputs:!0,get blockClass(){return\"nr-block\"},get ignoreClass(){return\"nr-ignore\"},get maskTextClass(){return\"nr-mask\"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=\",\".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error(\"All configuration objects require an agent identifier!\");if(!f[e])throw new Error(\"Configuration for \".concat(e,\" was never set\"));return f[e]}function h(e,t){if(!e)throw new Error(\"All configuration objects require an agent identifier!\");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],\"config\")}function g(e,t){if(!e)throw new Error(\"All configuration objects require an agent identifier!\");var r=l(e);if(r){for(var n=t.split(\".\"),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||\"object\"!=typeof e)return(0,n.Z)(\"Setting a Configurable requires an object as input\");if(!t||\"object\"!=typeof t)return(0,n.Z)(\"Setting a Configurable requires a model to set its initial properties\");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{\"object\"==typeof e[a]&&\"object\"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)(\"An error occurred while setting a property of a Configurable\",e)}return r}catch(e){(0,n.Z)(\"An error occured while setting a Configurable\",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n=\"1.236.0\",i=\"PROD\",o=\"CDN\"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n=\"undefined\"!=typeof window&&!!window.document,i=\"undefined\"!=typeof WorkerGlobalScope&&(\"undefined\"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||\"undefined\"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:\"undefined\"!=typeof WorkerGlobalScope&&(\"undefined\"!=typeof self&&self instanceof WorkerGlobalScope&&self||\"undefined\"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=\"\"+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&\"undefined\"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\\s](\\d+\\.\\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:\"\",ee:void 0};class o{constructor(e){try{if(\"object\"!=typeof e)return(0,n.Z)(\"shared context requires an object as input\");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)(\"An error occured while setting SharedContext\",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:\"\",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:\"feature\";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s=\"nr@context\";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&\"object\"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;f<d;f++)s[f].apply(a,r);var l=T()[c[e]];return l&&l.push([p,e,r,a]),a}}function b(e,t){n[e]=w(e).concat(t)}function y(e,t){var r=n[e];if(r)for(var i=0;i {r.d(t,{E:()=>n,p:()=>i});var n=r(2177).ee.get(\"handle\");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o=\"feature\"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener(\"test\",null,e),n._A.removeEventListener(\"test\",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i=\"xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx\";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split(\"\").map((e=>\"x\"===e?o(t,++r).toString(16):\"y\"===e?(3&o()|8).toString(16):e)).join(\"\")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n=\"NRBA\",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||\"\").indexOf(\"data:\"))return{protocol:\"data\"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement(\"a\"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split(\"://\");!o.port&&a[1]&&(o.port=a[1].split(\"/\")[0].split(\"@\").pop().split(\":\")[1]),o.port&&\"0\"!==o.port||(o.port=\"https\"===a[0]?\"443\":\"80\"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],\"/\"!==o.pathname.charAt(0)&&(o.pathname=\"/\"+o.pathname);var s=!t.protocol||\":\"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),\"/\"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){\"function\"==typeof console.warn&&(console.warn(\"New Relic: \".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&\"object\"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)(\"feat-\"+t,[],void 0,e,r):(0,i.p)(\"block-\"+t,[],void 0,e,r),(0,i.p)(\"rumresp-\"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)(\"feat-\"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)(\"rumresp-\"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if(\"object\"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit(\"internal-error\",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return\"undefined\"==typeof document||\"complete\"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)(\"load\",e,t)}function a(e){if(i())return e();(0,n.iz)(\"DOMContentLoaded\",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:\"bam.nr-data.net\",errorBeacon:\"bam.nr-data.net\"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)(\"visibilitychange\",(function(){if(t)return void(\"hidden\"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i=\"nr@original\";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n=\"\");var a,s,c,u=\"-\"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,\"fetch\",y),t.on(y+\"end\",(function(e,r){var n=this;if(r){var i=r.headers.get(\"content-length\");null!==i&&(n.rxSize=i),t.emit(y+\"done\",[null,r],n)}else t.emit(y+\"done\",[e],n)})),t}const O={},j=[\"pushState\",\"replaceState\"];function S(e){const t=function(e){return(e||n.ee).get(\"history\")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,\"-\")),t}var P=r(3239);const C={},R=[\"appendChild\",\"insertBefore\",\"replaceChild\"];function I(e){const t=function(e){return(e||n.ee).get(\"jsonp\")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\\.([^.]+)/,a=/^(\\w+)(\\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,\"dom-\"),t.on(\"dom-start\",(function(e){!function(e){if(!e||\"string\"!=typeof e.nodeName||\"script\"!==e.nodeName.toLowerCase())return;if(\"function\"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if(\"function\"!=typeof u.parent[u.key])return;var d={};function f(){t.emit(\"jsonp-end\",[],d),e.removeEventListener(\"load\",f,(0,P.m$)(!1)),e.removeEventListener(\"error\",l,(0,P.m$)(!1))}function l(){t.emit(\"jsonp-error\",[],d),t.emit(\"jsonp-end\",[],d),e.removeEventListener(\"load\",f,(0,P.m$)(!1)),e.removeEventListener(\"error\",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],\"cb-\",d),e.addEventListener(\"load\",f,(0,P.m$)(!1)),e.addEventListener(\"error\",l,(0,P.m$)(!1)),t.emit(\"new-jsonp\",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get(\"mutation\")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,\"fn-\")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get(\"promise\")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,\"executor-\",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,\"name\",{value:\"Promise\"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),[\"all\",\"race\"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a(\"all\"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit(\"propagate\",[null,!i],o,!1,!1),i=i||!e}}}})),[\"resolve\",\"reject\"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit(\"propagate\",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,[\"onreadystatechange\"],\"fn-\",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit(\"xhr-resolved\",[],e)),i.inPlace(e,f,\"fn-\",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,\"-xhr-\",E),r.on(\"send-xhr-start\",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on(\"open-xhr-start\",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on(\"fn-end\",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i=\"nr@seenError\"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i=\"sm\",o=\"cm\",a=\"storeSupportabilityMetrics\",s=\"storeEventMetrics\"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i=\"firstbyte\",o=\"domcontent\",a=\"windowload\"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i=\"bstResource\",o=\"resource\",a=\"-start\",s=\"-end\",c=\"fn\"+a,u=\"fn\"+s,d=\"pushState\"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=[\"click\",\"submit\",\"keypress\",\"keydown\",\"keyup\",\"change\"],a=999,s=\"fn-start\",c=\"fn-end\",u=\"cb-start\",d=\"api-ixn-\",f=\"remaining\",l=\"interaction\",h=\"spaNode\",g=\"jsonpNode\",p=\"fetch-start\",m=\"fetch-done\",v=\"fetch-body-\",b=\"jsonp-end\",y=n.Yu.ST,w=\"-start\",x=\"-end\",A=\"-body\",E=\"cb\"+x,T=\"jsTime\",_=\"fetch\"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();[\"setErrorHandler\",\"finished\",\"addToTrace\",\"inlineHit\",\"addRelease\",\"addPageAction\",\"setCurrentRouteName\",\"setPageViewName\",\"setCustomAttribute\",\"interaction\",\"noticeError\",\"setUserId\"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,\"api\");const h={};var g=a.ee.get(e),p=g.get(\"tracer\"),m=\"api-\",v=m+\"ixn-\";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?\"session\":void 0)(t,r)}function y(){}[\"setErrorHandler\",\"finished\",\"addToTrace\",\"inlineHit\",\"addRelease\"].forEach((e=>h[e]=x(m,e,!0,\"api\"))),h.addPageAction=x(m,\"addPageAction\",!0,n.D.pageAction),h.setCurrentRouteName=x(m,\"routeName\",!0,n.D.spa),h.setPageViewName=function(t,r){if(\"string\"==typeof t)return\"/\"!==t.charAt(0)&&(t=\"/\"+t),(0,i.OP)(e).customTransaction=(r||\"http://custom.transaction\")+t,x(m,\"setPageViewName\",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if(\"string\"==typeof e){if([\"string\",\"number\"].includes(typeof t)||null===t)return b(e,t,\"setCustomAttribute\",r);(0,f.Z)(\"Failed to execute setCustomAttribute.\\nNon-null value must be a string or number type, but a type of was provided.\"))}else(0,f.Z)(\"Failed to execute setCustomAttribute.\\nName must be a string type, but a type of was provided.\"))},h.setUserId=function(e){if(\"string\"==typeof e||null===e)return b(\"enduser.id\",e,\"setUserId\",!0);(0,f.Z)(\"Failed to execute setUserId.\\nNon-null value must be a string type, but a type of was provided.\"))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a=\"function\"==typeof t;return(0,o.p)(v+\"tracer\",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?\"\":\"no-\")+\"fn-start\",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit(\"fn-err\",[arguments,this,\"string\"==typeof e?new Error(e):e],r),e}finally{p.emit(\"fn-end\",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,[\"API/\"+t+\"/called\"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,\"api\")})).catch((()=>(0,f.Z)(\"Downloading runtime APIs failed...\")))}return[\"actionText\",\"setName\",\"setAttribute\",\"save\",\"ignore\",\"onEnd\",\"getContext\",\"end\",\"get\"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){\"string\"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,[\"API/noticeError/called\"],void 0,n.D.metrics,g),(0,o.p)(\"err\",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,\"api\"),(0,h.Qy)(e,A,\"exposed\"),(0,h.EZ)(\"activatedFeatures\",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:\"ajax\",jserrors:\"jserrors\",metrics:\"metrics\",pageAction:\"page_action\",pageViewEvent:\"page_view_event\",pageViewTiming:\"page_view_timing\",sessionReplay:\"session_replay\",sessionTrace:\"session_trace\",spa:\"spa\"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:\"page_action-aggregate\",147:\"metrics-aggregate\",242:\"session-manager\",317:\"jserrors-aggregate\",348:\"page_view_timing-aggregate\",412:\"lazy-feature-loader\",439:\"async-api\",538:\"recorder\",590:\"session_replay-aggregate\",675:\"compressor\",733:\"session_trace-aggregate\",786:\"page_view_event-aggregate\",873:\"spa-aggregate\",898:\"ajax-aggregate\"}[e]||e)+\".\"+{78:\"ac76d497\",147:\"3dc53903\",148:\"1a20d5fe\",242:\"2a64278a\",317:\"49e41428\",348:\"bd6de33a\",412:\"2f55ce66\",439:\"30bd804e\",538:\"1b18459f\",590:\"cf0efb30\",675:\"ae9f91a8\",733:\"83105561\",786:\"06482edd\",860:\"03a8b7a5\",873:\"e6b09d52\",898:\"998ef92b\"}[e]+\"-1.236.0.min.js\"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t=\"NRBA:\",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName(\"script\"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:\"timeout\",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{\"undefined\"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:\"Module\"}),Object.defineProperty(e,\"__esModule\",{value:!0})},i.j=364,i.p=\"https://js-agent.newrelic.com/\",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&(\"load\"===r.type?\"missing\":r.type),a=r&&r.target&&r.target.src;s.message=\"Loading chunk \"+t+\" failed.\\n(\"+o+\": \"+a+\")\",s.name=\"ChunkLoadError\",s.type=o,s.request=a,n[1](s)}}),\"chunk-\"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,\"\".concat(e,\".enabled\"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,\"privacy.cookies_enabled\");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)(\"A problem occurred when starting up session manager. This page will not start or extend any session.\",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,\"aggregate\");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)(\"Downloading and initializing \".concat(this.featureName,\" failed...\"),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,\"session_trace.enabled\")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),(\"undefined\"==typeof PerformanceNavigationTiming||c.Tt)&&\"undefined\"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)(\"timing\",[\"load\",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if(\"count\"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r=\"\",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean(\"hidden\"===document.visibilityState),(0,N.N)((()=>(0,s.p)(\"docHidden\",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)(\"pagehide\",(()=>(0,s.p)(\"winPagehide\",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem(\"__nr_flags\").split(\",\"),console&&\"function\"==typeof console.log&&(L.console=!0,-1!==R.indexOf(\"dev\")&&(L.dev=!0),-1!==R.indexOf(\"nr_dev\")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on(\"internal-error\",(function(e){z(e.stack)})),L.dev&&H.ee.on(\"fn-err\",(function(e,t,r){z(r.stack)})),L.dev&&(z(\"NR AGENT IN DEVELOPMENT MODE\"),z(\"flags: \"+(0,b.D)(L,(function(e,t){return e})).join(\", \")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on(\"fn-start\",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on(\"fn-err\",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)(\"err\",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on(\"fn-end\",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on(\"internal-error\",(function(t){(0,s.p)(\"ierr\",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener(\"unhandledrejection\",(t=>{const r=function(e){let t=\"Unhandled Promise Rejection: \";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)(\"err\",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){\"function\"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)(\"err\",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)(\"ierr\",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||\"Uncaught error with no additional information\",this.sourceURL=t,this.line=r}let U=1;const q=\"nr@id\";function G(e){const t=typeof e;return!e||\"object\"!==t&&\"function\"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if(\"string\"==typeof e&&e.length)return e.length;if(\"object\"==typeof e){if(\"undefined\"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if(\"undefined\"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!(\"undefined\"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||\"\").toString()||null,i=(r.agentID||\"\").toString()||null,o=(r.trustKey||\"\").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return\"00-\"+t+\"-\"+e+\"-01\"}generateTraceContextStateHeader(e,t,r,n,i){return i+\"@nr=0-1-\"+r+\"-\"+n+\"-\"+e+\"----\"+t}generateTraceHeader(e,t,r,n,i,o){if(!(\"function\"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:\"Browser\",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,\"distributed_tracing\")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener(\"load\",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener(\"progress\",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader(\"X-NewRelic-ID\",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader(\"newrelic\",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader(\"traceparent\",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader(\"tracestate\",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{\"abort\"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),(\"load\"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||\"function\"!=typeof t.onload)&&\"function\"==typeof o.end)&&o.end(t)}catch(e){try{n.emit(\"internal-error\",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set(\"newrelic\",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set(\"traceparent\",t.traceContextParentHeader),t.traceContextStateHeader&&e.set(\"tracestate\",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;\"string\"==typeof i?r=i:\"object\"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&\"object\"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(\"\"+(i&&i instanceof Y&&i.method||n.method||\"GET\")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,\"string\"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i(\"xhr\",[this.params,o,this.startTime,this.endTime,\"fetch\"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||\"agent\")),this.start()):(0,l.Z)(\"Failed to initial the agent. Could not determine the runtime environment.\")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t=\"features\";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)(\"\".concat(t.featureName,\" is enabled but one or more dependent features has been disabled (\").concat((0,D.P)(n),\"). This may cause unintended consequences or missing data...\")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)(\"Failed to initialize all enabled instrument classes (agent aborted) -\",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)(\"bst\",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)(\"bstHist\",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get(\"tracer\"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get(\"events\"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit(\"newURL\",[\"\"+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,\"xhr-resolved\"],this.featureName),f.buffer([ve],this.featureName),u.buffer([\"setTimeout\"+le,\"clearTimeout\"+fe,ve],this.featureName),d.buffer([ve,\"new-xhr\",\"send-xhr\"+fe],this.featureName),l.buffer([me+fe,me+\"-done\",me+he+fe,me+he+le],this.featureName),h.buffer([\"newURL\"],this.featureName),g.buffer([ve],this.featureName),s.buffer([\"propagate\",be,ge,\"executor-err\",\"resolve\"+fe],this.featureName),o.buffer([ve,\"no-\"+ve],this.featureName),a.buffer([\"new-jsonp\",\"cb-start\",\"jsonp-error\",\"jsonp-end\"],this.featureName),y(l,me+fe),y(l,me+\"-done\"),y(a,\"new-jsonp\"),y(a,\"jsonp-end\"),y(a,\"cb-start\"),h.on(\"pushState-end\",m),h.on(\"replaceState-end\",m),window.addEventListener(\"hashchange\",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener(\"load\",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener(\"popstate\",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:\"spa\"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is \"complete\" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event \"completion\" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', \"PixelInitialized\", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { \"@context\": \"https://schema.org\", \"@type\": \"ScholarlyArticle\", \"mainEntityOfPage\": { \"@type\": \"WebPage\", \"@id\": \"https://f1000research.com/articles/14-154\" }, \"headline\": \"Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and...\", \"datePublished\": \"2025-02-04T16:31:51\", \"dateModified\": \"2025-05-21T16:30:34\", \"author\": [ { \"@type\": \"Person\", \"name\": \"Acen L. Ester\" }, { \"@type\": \"Person\", \"name\": \"Joloba L. Moses\" }, { \"@type\": \"Person\", \"name\": \"Ashraf Akintola\" }, { \"@type\": \"Person\", \"name\": \"Rizwana Begum Syed Nabi\" }, { \"@type\": \"Person\", \"name\": \"Irene Andia Biraro\" }, { \"@type\": \"Person\", \"name\": \"William Worodria\" }, { \"@type\": \"Person\", \"name\": \"Alfred Okeng\" }, { \"@type\": \"Person\", \"name\": \"Kelvin Bwambale\" }, { \"@type\": \"Person\", \"name\": \"Mudarshiru Bbuye\" }, { \"@type\": \"Person\", \"name\": \"David Patrick Kateete\" } ], \"publisher\": { \"@type\": \"Organization\", \"name\": \"F1000Research\", \"logo\": { \"@type\": \"ImageObject\", \"url\": \"https://f1000research.com/img/AMP/F1000Research_image.png\", \"height\": 480, \"width\": 60 } }, \"image\": { \"@type\": \"ImageObject\", \"url\": \"https://f1000research.com/img/AMP/F1000Research_image.png\", \"height\": 1200, \"width\": 150 }, \"description\": \" Background Tuberculosis remains a significant global public health concern. Genetic variants influence the distribution of vitamin D in circulation, leading to vitamin D deficiency. The two extensively studied non-synonymous D-binding protein nucleotide polymorphisms rs7041 and rs4588 were found in different populations. These polymorphisms result into three different genotypes, Gc1F (rs7041(A)- rs4588(G)), Gc1S (rs7041(C)- rs4588(G)) and Gc2 (rs7041(A)- rs4588(T)). These genotypes have configurational changes that differ and therefore cause variation in the binding affinity of the vitamin D metabolite. This study aimed to compare the frequency distribution of vitamin D binding protein gene polymorphisms in patients with active Ugandan tuberculosis, individuals with latent tuberculosis infection, and those with no tuberculosis infection. Methods This pilot studyselected 102 samples, including 52 active tuberculosis patients, 23 latent tuberculosis individuals, and 27 individuals without tuberculosis infection, from a previous cross-sectional study. Vitamin D binding protein rs7041 and rs4588 SNPs were genotyped using Polymerase Chain Reaction and Sanger sequencing. Vitamin D binding protein gene polymorphisms were identified using BioEdit software. 7.2 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html) Results This study revealed no significant differences in DBP genetic polymorphisms among the study groups. The frequency distribution of the DBP gene has been reported to be 97% Gc1F, 2% Gc2, and 1% Gc1S. The frequency distribution among patients with TB was 96.2% for Gc1F, 0% for Gc1F, and 3.8% for Gc2. Among the LTBI cases, 95.7% were Gc1F, 4.3% were Gc1S, and 0%were Gc2. The Hardy-Weinberg equilibrium analysis was in equilibrium, D’= 0. P=0.2 Conclusions The Gc1F genotype was predominantly found in the study population, with no difference in the frequency distribution according to TB status. \" } { \"@context\": \"http://schema.org\", \"@type\": \"BreadcrumbList\", \"itemListElement\": [ { \"@type\": \"ListItem\", \"position\": \"1\", \"item\": { \"@id\": \"https://f1000research.com/\", \"name\": \"Home\" } }, { \"@type\": \"ListItem\", \"position\": \"2\", \"item\": { \"@id\": \"https://f1000research.com/browse/articles\", \"name\": \"Browse\" } }, { \"@type\": \"ListItem\", \"position\": \"3\", \"item\": { \"@id\": \"https://f1000research.com/articles/14-154/v2\", \"name\": \"Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in...\" } } ] } Home Browse Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Ester AL, Moses JL, Akintola A et al. Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :154 ( https://doi.org/10.12688/f1000research.160839.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Research Article Revised Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations] Previously titled: Vitamin D binding protein gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study Acen L. Ester https://orcid.org/0000-0001-7048-4643 1 , Joloba L. Moses 2 , Ashraf Akintola 3 , [...] Rizwana Begum Syed Nabi 4 , Irene Andia Biraro https://orcid.org/0000-0002-8303-6046 5 , William Worodria 6 , Alfred Okeng 7 , Kelvin Bwambale 8 , Mudarshiru Bbuye 9 , David Patrick Kateete 2 Acen L. Ester https://orcid.org/0000-0001-7048-4643 1 , Joloba L. Moses 2 , [...] Ashraf Akintola 3 , Rizwana Begum Syed Nabi 4 , Irene Andia Biraro https://orcid.org/0000-0002-8303-6046 5 , William Worodria 6 , Alfred Okeng 7 , Kelvin Bwambale 8 , Mudarshiru Bbuye 9 , David Patrick Kateete 2 PUBLISHED 21 May 2025 Author details Author details 1 Department of Physiology, School of Biomedical Sciences, College of Health Sciences, Makerere University, Kampala, POBOX 7072, Uganda 2 Department of Immunology and Molecular Biology, School of Biomedical Sciences, College of Health Sciences, Makerere University, Kampala, POBOX 7072, Uganda 3 Department of Biomedical Convergence Science and Technology, School of Industrial Technology Advances, Kyungpook National University, Daegu, 41566, South Korea 4 Department of Southern Area Crop Science, National Institute of Crop Science, Rural Development Administration, Miryang, 50424, South Korea 5 Department of Internal Medicine, School of Medicine, College of Health Sciences Unit, Makerere University, Kampala, POBOX 7072, Uganda 6 Department of Internal Medicine, Pulmonary Division, Mulago National Referral Hospital, Kampala, Uganda 7 Department of Molecular Biology and Biotechnology, School of Bio-security and Laboratory Sciences, College of Veterinary Medicine, Makerere University, Kampala, POBOX 7072, Uganda 8 Department of Biosecurity Ecosystems and Veterinary Public Health , School of Bio-security and Laboratory Sciences, College of Veterinary Medicine, Makerere University, Kampala, POBOX 7072, Uganda 9 Makerere Lung Institute, College of Health Sciences, Makerere University College of Health Sciences, Kampala, POBOX 7072, Uganda Acen L. Ester Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Joloba L. Moses Roles: Project Administration, Supervision, Validation, Visualization, Writing – Review & Editing Ashraf Akintola Roles: Formal Analysis, Methodology, Resources, Software, Visualization, Writing – Review & Editing Rizwana Begum Syed Nabi Roles: Formal Analysis, Investigation, Visualization, Writing – Review & Editing Irene Andia Biraro Roles: Project Administration, Resources, Supervision, Validation, Writing – Review & Editing William Worodria Roles: Project Administration, Supervision, Validation, Writing – Review & Editing Alfred Okeng Roles: Formal Analysis, Methodology, Visualization, Writing – Review & Editing Kelvin Bwambale Roles: Methodology, Software, Visualization, Writing – Review & Editing Mudarshiru Bbuye Roles: Software, Visualization, Writing – Review & Editing David Patrick Kateete Roles: Funding Acquisition, Project Administration, Supervision, Validation, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the Genomics and Genetics gateway. Abstract Background Tuberculosis remains a significant global public health concern. Genetic variants influence the distribution of vitamin D in circulation, leading to vitamin D deficiency. The two extensively studied non-synonymous D-binding protein nucleotide polymorphisms rs7041 and rs4588 were found in different populations. These polymorphisms result into three different genotypes, Gc1F (rs7041(A)- rs4588(G)), Gc1S (rs7041(C)- rs4588(G)) and Gc2 (rs7041(A)- rs4588(T)). These genotypes have configurational changes that differ and therefore cause variation in the binding affinity of the vitamin D metabolite. This study aimed to compare the frequency distribution of vitamin D binding protein gene polymorphisms in patients with active Ugandan tuberculosis, individuals with latent tuberculosis infection, and those with no tuberculosis infection. Methods This pilot studyselected 102 samples, including 52 active tuberculosis patients, 23 latent tuberculosis individuals, and 27 individuals without tuberculosis infection, from a previous cross-sectional study. Vitamin D binding protein rs7041 and rs4588 SNPs were genotyped using Polymerase Chain Reaction and Sanger sequencing. Vitamin D binding protein gene polymorphisms were identified using BioEdit software. 7.2 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html) Results This study revealed no significant differences in DBP genetic polymorphisms among the study groups. The frequency distribution of the DBP gene has been reported to be 97% Gc1F, 2% Gc2, and 1% Gc1S. The frequency distribution among patients with TB was 96.2% for Gc1F, 0% for Gc1F, and 3.8% for Gc2. Among the LTBI cases, 95.7% were Gc1F, 4.3% were Gc1S, and 0%were Gc2. The Hardy-Weinberg equilibrium analysis was in equilibrium, D’= 0. P=0.2 Conclusions The Gc1F genotype was predominantly found in the study population, with no difference in the frequency distribution according to TB status. READ ALL READ LESS Keywords Vitamin D, binding protein, gene, polymorphisms, Tuberculosis Corresponding Author(s) Acen L. Ester ( [email protected] ) Close Corresponding author: Acen L. Ester Competing interests: No competing interests were disclosed. Grant information: This work was funded by “The Africa Center of Excellence in Materials, Product Development and Nanotechnology (MAPRONANO ACE) Makerere University” under the World Bank project. The funding agencies did not play any role in the development of this study. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2025 Ester AL et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Ester AL, Moses JL, Akintola A et al. Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :154 ( https://doi.org/10.12688/f1000research.160839.2 ) First published: 04 Feb 2025, 14 :154 ( https://doi.org/10.12688/f1000research.160839.1 ) Latest published: 21 May 2025, 14 :154 ( https://doi.org/10.12688/f1000research.160839.2 ) Revised Amendments from Version 1 In the title we added the DBP SNPS to be more specific. In the abstract we added some details on the GCIF genotypes and their references. The recommendation was removed from the conclusion in the abstract. We have provided details of hypovitaminosis and sunshine exposure of the study population in the introduction section. In the methods section we have given details of the participant characteristics and enrolment period. The genotyping section was broken down in subsections to make it clearer for the readers. The name of the gene was italicised all through the article and the P values were lower cased. the statistical analysis section has an addition on why Fisher’s test was used. In the results section the social demographics section was reorganized for clarity. A section of the comparison of the DBP gene among male and female was added with Table 4 included. In the discussion a component the DBP genotypes and its affinity to vitamin D metabolite was added. More discussions on the comparison and contrast of our study have been added as well. The statement on minor alleles and their association to TB were removed, the recommendation was also removed from the conclusion. In the title we added the DBP SNPS to be more specific. In the abstract we added some details on the GCIF genotypes and their references. The recommendation was removed from the conclusion in the abstract. We have provided details of hypovitaminosis and sunshine exposure of the study population in the introduction section. In the methods section we have given details of the participant characteristics and enrolment period. The genotyping section was broken down in subsections to make it clearer for the readers. The name of the gene was italicised all through the article and the P values were lower cased. the statistical analysis section has an addition on why Fisher’s test was used. In the results section the social demographics section was reorganized for clarity. A section of the comparison of the DBP gene among male and female was added with Table 4 included. In the discussion a component the DBP genotypes and its affinity to vitamin D metabolite was added. More discussions on the comparison and contrast of our study have been added as well. The statement on minor alleles and their association to TB were removed, the recommendation was also removed from the conclusion. To read any peer review reports and author responses for this article, follow the \"read\" links in the Open Peer Review table. READ REVIEWER RESPONSES Introduction Uganda remains among the high-burden TB/HIV countries reporting an incidence that ranges between 200-350 per 100 cases and a tuberculosis-HIV co-infection of 40%. Studies have reported vitamin D deficiency to be a risk factor for TB disease. Our previous study reported a high proportion of hypovitaminosis D among TB patients and household contacts, with the TB patients having significantly lower vitamin D levels compared to the household contacts. 1 This study reported that 42% of the participants had a sun exposure of 1-7 hrs, but 52% did not have a diet with vitamin D. According to another study in Uganda, despite all-round sunshine, a high prevalence of vitamin D deficiency was reported among adult TB patient. 2 Vitamin D Binding Protein (DBP), also known as group-specific component (Gc), is one of the most prevalent and significant carrier proteins of vitamin D metabolites, accounting for an estimated 85-90% of the total metabolite. 3 – 6 The unbound fraction, which is the free fraction, was estimated to be less than 1%, whereas the albumin-bound fraction was approximately 10-15%. 7 DBP, a member of the albumin family, is synthesized in the liver. 8 This protein is considered responsible for vitamin D deficiency in target cells, as the bound fraction has a minimal impact on target cells. 8 , 9 Other functions of DBP include actin scavenging, macrophage activation, and fatty acid transport. 3 The highly polymorphic DBP gene is located at 4q12-q13, with over 120 variants. 10 These genetic variations, affect the circulatory distribution of vitamin D, which leads to vitamin D deficiency. 5 In various populations of the world, the two extensively studied non-synonymous DBP single nucleotide polymorphisms (SNPs) rs7041 and rs4588 exhibit variable distributions. 4 These variations are located in exon 11, where 7041 encodes c.1296 T>G p.Asp416Glu, while rs4588 encodes c.1307 C>A p.Thr420Lys. 11 These two variations give rise to three polymorphic isoforms, which are known to differ by lineage and include Gc1F, Gc1S and Gc2. 12 , 13 The wild type of these SNPs is Gc1Fgenotype variations in the in Gc1F, D416E, and T420K result in, the Gc1S and Gc2 genotypes, respectively. 14 Gc2 is found at locus rs4588 while Gc1F and Gc1S are found at locus rs7041. 10 Previous studies have shown that people who have the rs7041 G allele as a substitute for the T allele and the rs4588 A allele instead of the C allele have higher levels of DBP and a higher affinity for vitamin D, consequently resulting in lower free and bioavailable vitamin D levels. Consequently, the DBP role controlling total, free, and bioavailable vitamin D is crucial in immunity and influences progression of disease. 15 Studies have documented that vitamin D deficiency contributes to TB susceptibility, and individuals with deficiency are at a high risk of developing TB. 16 Therefore, vitamin D status is implicated in the response to M. tuberculosis, and is genotype-dependent, varying across geographical areas. 17 The wild-type Gc1F genotype is predominantly found in the African population, with a low frequency of Gc2 and Gc1S and is associated with low levels of vitamin D. This association is an effect of DBP concentration levels in different genetic variants. The Gc1F genotype has a low concentration of DBP with high affinity for vitamin D metabolites; consequently, low bioavailable vitamin D levels have been reported. 18 Therefore, we performed a cross-sectional study to determine the frequency distribution of DBP gene polymorphisms among ATB patients, LTBI patients, and individuals without TB infection in a Ugandan population. Methods Study design and study setting This pilot study was based on a previous cross-sectional study of 148 participants between the ages of 12-65 years, whose free, bioavailable, and Total vitamin D levels were measured, and a high proportion of hypovitaminosis D was reported in our previous publications. 1 Of these, 102 samples were conveniently selected for genotying. The active TB patients were enrolled between July 2019 to August 2020 at Kiruddu Hospital. The LTBI individuals and healthy control samples were retrieved from the Kampala TB cohort. Details of this previous study have been reported elsewhere. 19 This study was nested from a larger study that was conducted in accordance with the Declaration of Helsinki, and approval was granted by the Makerere University School of Biomedical Sciences Higher Degrees Research Ethics Committee (SBS HDREC)/#SBS-637 on 25 th Jan 2019, Kiruddu Referral Hospital, and National Council of Science and Technology (HS2639) on the 31 st October 2019. All experimental protocols were approved by Makerere University SBS HDREC (#SBS-637) and the National Council of Science and Technology (HS2639), as guided by the Helsinki Declaration. Written informed consent was obtained from active TB patients at Kiruddu Hospital for study participation. Informed consent was obtained from the KTB household contacts, and the parents or guardians consented on behalf of the minors. Following the inclusion and exclusion criteria, the active TB patients who were positive on GeneXpert without deranged glucose and renal function tests were selected and 4 mls of whole blood was taken. The KTB PBMC samples of LTBI and individuals with no TB, with volumes between 0.2-1.5 mls were selected for genotyping of DBP gene polymorphisms. This was based on the availability of whole blood for ATB patients and peripheral blood mononuclear cells (PBMCs) for LTBI patients/individuals and those with no TB infection. After obtaining ethical approval and informed consent, Gen-expert-positive TB patients from Kiruddu Referral Hospital were enrolled, and samples of household contacts of LTBI Individuals with (QFN+ TST+) results and individuals with no TB infection who were (QFNTST-) from the Kampala TB (KTB) project were included in the study. Samples from patients with LTBI and those without TB infection were purposively selected. PBMC samples with adequate cells were selected for genotyping, and samples with fewer cells were excluded. Based on this, 46 samples were excluded because of inadequate sample volume and the number of cells available for successful genotyping. Individuals with an HIV + serostatus were not excluded from the study. DBP gene genotyping DNA extraction The phenol-chloroform (PhCHCL 3 ) method was used to extract DNA from whole blood samples of active TB patients, PBMCs fromLTBIpatients, and those with no TB infection. Briefly 100 μl of 10% SDS were Dispensed in eppendorf tubes. 150μl of whole blood were then added and mixed by pipeting up and down. This was followed by incubation at 65°C for 10 min using a heat block. 100 μl of 3N Soduim Acetate were added and 5 vortexed vigorously. This was followed by addition of 700 μl of PhCHCL 3 . And 280 μl of PCR grade water. The tubes were inverted vigorously several times. they were then Centrifuged @ 13000 rpm for 30 min. 450 μl of the aqueous layer was Transferred to a new eppendorf tube. 1000 μl of absolute isopropanol (100%) was then added. DNA was precipitated at -80°C for 20min. this was followed by centrifuging at 14000 rpm for 30 minutes. The isopropanol was removed off leaving approx 50 μl. Add 700 μl of 70% isopropanol were added and Centrifuged @ 14000 rpm for 30 minutes. The 70% isopropanol was completely removed leaving the dry pellet. The DNA tubes were dried at 65°C. DNA was eluted in 100 μl of PCR H 2 O @ 65°C. It was then stored at – 80 °C for future use. Agarose gel electrophoresis method Agarose gel electrophoresis of human genomic DNA was performed using 1% agarose gel prepared by weighing and dissolving 1.5 g of agarose in 150 ml of 1x TAE (1% solution). The agarose was boiled thoroughly in a microwave oven for 3 minutes to allow thorough heating and mixing, and allowed to cool to 50°C at room temperature. 7.5 μl of 5 mg/ml ethidium bromide was added and mixed well by gentle agitation. The Agarose solution-ethidium bromide mixture was poured into an assembled gel casting tray with a comb attached and allowed to set at room temperature for approximately one hour. Upon setting, the gel was placed in to the electrophoretic tank and the combs vertically removed. 1x TAE buffer was poured in to the electrophoretic tank to just cover the gel. 5 μl of loading dye was added to 5 ul of each of the PCR product on the Para film, mixed and then loaded on to the wells in the gel. While loading, the molecular weight marker was always loaded on the first lane and then the extracted human genomic DNA. The samples were run at 120 volts (constant voltages, variable current) for 30 mins. After 1 hr, the electrophoresis was stopped and the gel was carefully transferred to a UV trans illuminator for visualization. PCR of DBP amplicons Primers were purchased from Eurofins Genomics, Inc. Germany. The primer sequences were forward 5″AAATAATGAGCAAATGAAAGAAGAC3′ and reverse 5′ CAATAACAGCAAAGAAATGAGTAGA3′ with expected amplicons of approximately 483 bp. Mastermix preparation was performed from the pre-amplification room as follows: 25 μL of 2X Taq Master Mix, 2.5 μl of the reverse primer (6 pM) and 2.5 μl of forward primer (0.6 pM), and 15 μL of PCR water, making a volume of 45 μL for each reaction. Forty-five microliters of the master mix and 5 μL of DNA were added to each of the PCR tubes. Five microliters of PCR water was added to the negative control tube and transferred into the SimpliAmp Thermocycler for 40 cycles under the following programmed conditions: enzyme activation step 5 min at 95°C, denaturation for 20 s at 95°C, annealing for 45 s at 56°C, extension for 10 sat 72°C, Final Extension for 5 min at 72°C, and finally an infinite hold at 4°C. The amplicons were run on a 2% agarose gel, as previously described, and a product size of 483 bp was obtained ( Figure 1a and b ). Sanger sequencing Under ambient conditions, the PCR products were sent for Sanger sequencing using the forward primer at ACGT in the United States of America. The ABI Big Dye Termination Kit (Applied Biosystems, USA) and the ABI prism 310 Genetic analyser (Applied Biosystems) was used. The sequenced chromatograms were obtained and cleaned up to remove low yield peaks. A BLAST query sequence was performed to confirm the DBP gene against that of the NCBI library. The gene products were named Homo sapiens Gc vitamin D binding protein (Gc), with sequence sizes between 414 bp and 448 bp with a percent identity of 98-99%. The DBP gene reference sequence (AH004448.2, Homo sapiens vitamin D-binding protein gene) was retrieved from the National Center for Biotechnology Information (NCBI). The raw DBP gene sequences from our analysis were aligned to the reference genome. Variant filtering was performed in which low-read regions and errors were identified. Coverage, quality scores, and proximity were also checked. Sites that differed from the reference genome and sequences were identified and sorted according to their nucleotide and amino acid composition. The detection of the presence of SNPs was performed by searching for the possible change in the codon GAT to GAG at position 416, representing the rs7041 variant, and ACG to AAG at position 420 for the rs4588 variant. Figure 1. a: Agarose gel electrophoresis of the 483 bp DBP gene PCR product representative of active TB patients. Lanes: L=100bp DNA ladder, NC= Negative control, 1- 10=samples from active TB patients. b: Agarose gel electrophoresis of the 483bp DBP gene PCR product representative of LTBI and those with no TB infection. Lanes: L=100bp DNA ladder, NC= Negative control, 1-10=samples from LTBI and those with no TB infection. All the figures provided here are only found in a preprint and have not been published anywhere else. I therefore assume I do not need to request for copy right permissions. Statistical analysis The data were summarized using STATA software (Stata Corp. STATA 16.0, College Station, Texas, USA). Frequency and percentage (n [%]) were used to determine the frequency distribution of the DBP gene variants. Fisher’s exact test was used to compare the frequency of DBP among the study groups because of the sample size. A potential deviation from Hardy–Weinberg equilibrium was performed using the dnaSP software. V5 ( http://www.ub.es/dnasp ). The p-value was considered significant at P < 0.05, with a 95% confidence interval. Results Socio-demographic description of study participants A total of 102 participants were included, 52 were newly diagnosed ATB patients, 23 had LTBI and 27 had no TB infection with a median age of 28 years (IQR 12–65). The majority (44.6%) were aged between 19 and 30 years, and most were female (61.2%). Half of the participants (50.1%) had ATB. A small proportion of these were HIV-positive, 9 (18.4%). Table 1 shows the social, demographic, and clinical characteristics of the study participants and more details of the study participants have been described elsewhere. 19 Table 1. Socio-demographic and clinical characteristics of study participants. Participant characteristic Frequency n( %) Median (IQR) Age (years) 28 (12,65) 18 and below 19(18.4) 19-30 46(44.6) 31-40 22(21.3) Above 40 15(14.5) Sex Female 63(61.2) Male 40(38.8) TB status No TB infection 27(26.4) Latent TB infection 23(22.5) Active TB 52(50.1) BCG scar No 47(46.1) Yes 55( 53.9) Alcohol consumption No 75(73.5) Yes 27 (26.5) Smoking No 96(94.1) Yes 6(5.9) HIV status Negative 83(81.4) Positive 19(18.6) Frequency distribution of the DBP rs7041 and rs4588 SNPs among active TB patients, LTBI, and those with no TB infection A Gc1S reference sequence with the GAG codon at position 416 was retrieved from the NCBI database (Homo sapiens vitamin D-binding protein gene) for use. According to our search in BioEdit, all our sequences had the wild-type GAT codon at this position compared to the reference sequence. At position 420, all of our samples had an ACG codon, except for two samples that showed a conversion to AAG. Ninety-seven percent of the study population had rs7041 GAT and ACG for the rs4588 codons, 2% had GAT rs7041 and AAG rs4588, and 1% had rs7041 GAG and rs4588 ACG (Gc1S). Figure 2a - c show the details of this analysis and highlighted transformations. Therefore, the frequency distribution of the DBP genotypes in the study population was Gc1F, 97%; Gc, 2.2%; and Gc1S, 1%. The frequency distribution of the DBP genotypes among patients with TB was 96.2% Gc1f, 0% Gc1S, and 3.8% Gc2. Among the LTBI cases, 95.7% were Gc1F, 4.3% were Gc1S, and 0% were Gc2. For those without TB infection, the frequencies were Gc1F 100%, Gc1s 0% and 0% for Gc2. There was no statistically significant difference in the predominant Gc1F genotype among ATB patients, LTBI individuals, and those without TB infection (P=0.3). Notably, the participants with the Gc2 genotype were ATB patients with HIV coinfection. Furthermore, we also found that individuals with the Gc1S genotype had LTBI. The genotype and allele distributions of the study participants are shown in Table 2 and Table 3 , respectively. The Hardy-Weinberg equilibrium analysis was in equilibrium, D’=0, P=0.2. Figure 2. a: A Sanger sequencing representative chromatogram of the GAT and ACG (Gc1F) genotype. No conversion was observed in both SNPs rs7041and rs4588, The figure was generated using BioEdit 7.2 software http://www.mbio.ncsu.edu/BioEdit/bioedit.html by A.A. b: A Sanger sequencing representative chromatogram of the GAG and ACG (Gc1S) genotype. A conversion was observed in the rs7041 SNP GAT to GAG and no conversion noted in the rs4588 SNP. The figure was generated using. The figure was generated using BioEdit 7.2, http://www.mbio.ncsu.edu/BioEdit/bioedit.html by A.A. c: A Sanger sequencing representative chromatogram of the GAT and AAG (Gc2)genotype. No conversion was observed in the rs7041 SNP and conversion is noted in the rs4588 SNP from ACG to AAG. The figure was generated using BioEdit 7.2 http://www.mbio.ncsu.edu/BioEdit/bioedit.html by A.A. Table 2. Genotype and allele distribution of the DBP gene among ATB patients, LTBI, and those without TB infection. GENOTYPES ALLELES Active TB patients LTBI Those with no TB infection N Total/ P value N= 52 N=23 N=27 N=102 GCIF GC1F rs7041(A)- rs4588(G) 50 (49%) 22 (21.6%) 27(26.4%) P=0.6 GCIS GC1S rs7041(C)- rs4588(G) 0 (0%) 1(1%) 0 (0%) GC2 GC2 rs7041(A)- rs4588(T)) 2 (2%) 0(0%) 0 (0)% Table 3. Frequency distribution of DBP genotypes according to TB status. DBP genotypes TB patients n %=52 LTBI n %=23 Those with no TB infection n %=27 P value Gc1F 50(96.2%) 22(95.7%) 27(100%) 0.29 Gc1S 0(0%) 1(4.3%) 0(0%) Gc2 2 (3.8%) 0(0% 0(0%) Comparison of Vitamin D Binding Protein (DBP) genotype distribution between female and male participants The distribution of DBP genotypes (Gc1F, Gc1S, and Gc2) was similar between females and males, with no statistically significant difference observed (p=1.00). The Gc1F genotype was predominant in both sexes, being present in 96.8% of females and 97.5% of males ( Table 4 ). Table 4. Distribution of DBP genotypes by gender DBP genotypes Female (n=62), n (%) Male (n=40), n (%) p-value Gc1F 60 (96.8) 39 (97.5) 1.00 Gc1S 1 (1.6) 0 (0.0) Gc2 1 (1.6) 1 (2.5) Relatedness of the DBP reference gene sequence and study sequence data A phylogenetic tree was constructed to determine the closeness of the sequences using the maximum likelihood method. The phylogenetic tree revealed a close relationship between the samples and the reference genes, as shown in Figure 3 . Figure 3. Showing a phylogenetic tree indicating the relationship between the reference gene and sequence data, The figure was generated using BioEdit 7.2 http://www.mbio.ncsu.edu/BioEdit/bioedit.html by A.A. Discussion DBP is highly polymorphic, with approximately 120 variants; however, the widely studied variants are the rs7041 and rs4588 SNPs from these three variant genotypes, Gc1F, Gc1S, and Gc2. These genotypes are the predominant source of diversity observed across different geographic locations and ethnicities. Well-documented reports have focused on multiracial populations and lack adequate information regarding homogeneous populations. Extensive research in population genetics has found that the frequency of the Gc1F genotype is predominantly found in Africans and African-Americans and that Gc2 is the lowest. 20 Our study showed a frequency distribution of 97% of the Gc1F genotype, 2% of the Gc2 genotype, and 1% of the Gc1S genotype in the population. This is consistent with the genotype frequency distribution of African Black populations. This finding is comparable to that of two West African studies in Gambia, with a nearly homogeneous population like ours. They reported a frequency distribution of 86.0% and 83.3%, respectively, and another study from South Africa reported 80.0%. 13 , 21 , 22 However, these studies had a larger sample size than the current study. Similarly, findings from a study among Black Americans and whites showed a frequency distribution of 92.7% for the Gc1F genotype among Blacks (2.1%) and Gc2 (2%). In contrast, the same study found a high-frequency distribution of Gc1S among the white population. 20 In contrast, a study performed among the Eurasian population found the Gc1F genotype to be the lowest (13.7%) and the highest was Gc1S. 18 Correspondingly, astudy from Finland reported a low frequency of Gc1F (3.7%). 23 The above observations show that DBP polymorphisms are ethnically based; therefore, diverse effects on vitamin D metabolites are likely to be observed. This study did not find a statistically significantdifference in the frequency distribution of the Gc1F DBP genotype among the three study groups (P=0.3). This finding is similar to that of a study from Pakistan that reported a non-significant association of DBP with TB (P=0.3). 24 However, we noted that the Gc2 genotype was only found among active TB patients with HIV coinfection. This finding is comparable to that of the previously mentioned South African study that reported an association between the Gc2 genotype and TB status among Asians. 25 Furthermore, a recent study in China exploring vitamin D pathway gene polymorphisms found that the DBP Gc2 genotype was associated with progression to pulmonary TB. 32 Moreover, in our study, the Gc1S genotype was detected in the LTBI group. Therefore, these findings suggest that the minor alleles in our population have a genetic association. The Gc1F genotype is predominant in the black population; therefore, it is worth mentioning that our population was consistent with the Hardy-Weinberg equilibrium, and the frequency distribution observed is possibly a representation of our study population. Consequently, in addition to genetic predisposition, environmental, social, and economic factors may play a major role in TB susceptibility in the population. Regarding the HIV sub-analysis, no statistical significance was found among the genotypes and TB status. Similarly, from our previous study no significant difference was observed in vitamin D levels among the HIV and none HIV. 26 , 27 Considering the analysis of sex and the DBP gene, no statistical difference was observed in the frequency distribution among male and female participants (P=0.07). This observation is similar to that of a study in India on TB patients. 28 With reference to genetic polymorphisms and vitamin D metabolites, the Gc1F genotype is predicted to have high affinity for total vitamin D compared to others. 29 In our study free and bioavailable vitamin D levels, the Gc1F and Gc1S were associated with higher free and bioavailable vitamin D levels compared to the Gc2 which had the lowest (Data not shown). This finding may be closely similar to a study that found higher levels in the same genotypes compared to Gc2, nonetheless, they measured total vitamin D not free and bioavailable levels. 30 On the contrary, a study from Finland with adjustments parameters reported the Gc2 genotype to have the highest free and bioavailable vitamin D levels and the Gc1F the lowest. 31 A study from Saudi Arabia among postmenopausal women reported similar findings of no association between the DBP gene polymorphism and free and bioavailable vitamin D levels. 27 Furthermore, another study from the same region reported that free and bioavailable vitamin D levels differed according to minor and major rs7041 and rs4588 alleles. 26 We acknowledge that the small sample size and homogeneous population of the current study could have contributed to the less significant effect size needed to detect minor alleles, as observed. Further research is warranted in a larger homogenous and heterogeneous population to increase the probability of detecting minor alleles in the population in order to adequately determine their functional significance and their role in TB pathogenesis. This is important for TB control and prevention. We did not eliminate HIV positive individuals during the selection of the study participants therefore do not know their impact as confounders although this did not reveal in the sub analysis. Therefore, future studies should consider larger sample sizes to increase the probability of detecting minor alleles in the population. The strength of this study is that it is the first to determine DBP gene polymorphisms in the Ugandan population of active TB patients, LTBI, and household contacts, providing an adequate representation of TB status. Conclusion The frequency distribution of the DBP and Gc1F genotypes was predominantly found in the study population, with no statistically significant difference among the ATB patients, LTBI patients, and those with no TB infection. Ethical approval and informed consent This study was nested from a larger study that was conducted in accordance with the Declaration of Helsinki, and approval was granted by the Makerere University School of Biomedical Sciences Higher Degrees Research Ethics Committee (SBS HDREC)/#SBS-637 on 25 th Jan 2019, Kiruddu Referral Hospital, and National Council of Science and Technology (HS2639) on the 31 st October 2019. All experimental protocols were approved by Makerere University SBS HDREC (#SBS-637) and the National Council of Science and Technology (HS2639), as guided by the Helsinki Declaration. Written informed consent was obtained from active TB patients at Kiruddu Hospital for study participation. Informed consent was obtained from the KTB household contacts, and the parents or guardians consented on behalf of the minors. Authors’ contributions Conceptualization: E.L.A., Data curation: E. L. A., Formal analysis: E. L. A., A. A., R.B. S. N., A. O., Funding Acquisition: E.L.A., D.P. K., Investigation: E.L.A., Project Administration: E.L.A., I.A.B., W.W., D.P.K., M.L.J., Methodology: E. L. A., A. A., R.B.S.N., A.O. K. B., Resources: E.L.A., I, A.B., A.A., R.B. S. N., Software: M. B., A.A. K. B. Supervision: W. W., D.P. K., I. A. B., M L. J., Validation: E.L.A., W. W., D.P. K., I. A. B., M L. J., Visualization: E.L.A., A.A.R.B. S. N., M.B., K.B., A.O., Writing – original draft: E. L. A., Writing – review & editing: All authors reviewed the manuscript. Data availability The dataset that was generated and analyzed during the current study is available in GenBank with accession numbers BankIt2605152: *OP032652 - OP032748* https://www.ncbi.nlm.nih.gov/nuccore/OP032652.1/ . The project contains Figshare: Ester supplimentary data.zip. https://doi.org/10.6084/m9.figshare.28234484.v3 . 32 Data are available under the terms of the Creative Commons (CC0 1.0 Public domain dedication), 4 Copyright: © 2025 Ester Acen et al. Acknowledgements My sincere appreciation goes to the staff at Kiruddu National Referral Hospital for data collection. The management and staff at the MBN and Molecular and immunology laboratories for theirassistance with laboratory analyses. The PI of the KTB Household Cohort Study Immunity held by Dr. Irene Andia Biraro provided samples for household contacts. References 1. Acen EL, Biraro IA, Bbuye M, et al. : Hypovitaminosis D among newly diagnosed pulmonary TB patients and their household contacts in Uganda. Sci. Rep. 2022; 12 (1): 5296. PubMed Abstract | Publisher Full Text | Free Full Text 2. Kibirige D, Mutebi E, Ssekitoleko R, et al. : Vitamin D deficiency among adult patients with tuberculosis: a cross sectional study from a national referral hospital in Uganda. BMC Res. Notes. 2013; 6 (1): 293. PubMed Abstract | Publisher Full Text | Free Full Text 3. Speeckaert M, Huang G, Delanghe JR, et al. : Biological and clinical aspects of the vitamin D binding protein (Gc-globulin) and its polymorphism. Clin. Chim. Acta. 2006; 372 (1-2): 33–42. PubMed Abstract | Publisher Full Text 4. Santos, Lecke SB, Spritzer PM: Genetic variant in vitamin D-binding protein is associated with metabolic syndrome and lower 25-hydroxyvitamin D levels in polycystic ovary syndrome: A cross-sectional study. PLoS One. 2017; 12 (3): e0173695. PubMed Abstract | Publisher Full Text | Free Full Text 5. Alhomsi B, Aboualchamat G, Alkadi I: Assessment of vitamin D-binding protein (DBP) gene polymorphisms and their correlation with multiple sclerosis: a case-control study in a sample of the Syrian population. Egypt. J. Med. Hum. Genet. 2020; 21 (1): 1–7. Publisher Full Text 6. Newton EBJ, Kindy MS, Gattoni-Celli S, et al. : Vitamin D binding protein polymorphisms significantly impact vitamin D status in children. Pediatr. Res. 2019; 86 (5): 662–669. PubMed Abstract | Publisher Full Text | Free Full Text 7. Yousefzadeh, Shapses S, Wang X: Vitamin D binding protein impact on 25-hydroxyvitamin D levels under different physiologic and pathologic conditions. Int. J. Endocrinol. 2014; 2014 : 1–6. PubMed Abstract | Publisher Full Text | Free Full Text 8. Rehan M, Aslam A, Umber J, et al. : Immunomodulatory role of vitamin D in infectious and non-infectious diseases. Hosts Viruses. 2019; 6 (5): 115–129. 9. Reis JP, Michos ED, Selvin E, et al. : Race, vitamin D–binding protein gene polymorphisms, 25-hydroxyvitamin D, and incident diabetes: the Atherosclerosis Risk in Communities (ARIC) Study. Am. J. Clin. Nutr. 2015; 101 (6): 1232–1240. PubMed Abstract | Publisher Full Text | Free Full Text 10. Bikle, Schwartz: Vitamin D binding protein, total and free vitamin D levels in different physiological and pathophysiological conditions. Front. Endocrinol. 2019; 10 : 317. Publisher Full Text 11. Kurylowicz A, Ramos-Lopez E, Bednarczuk T, et al. : Vitamin D-binding protein (DBP) gene polymorphism is associated with Graves’ disease and the vitamin D status in a Polish population study. Exp. Clin. Endocrinol. Diabetes. 2006; 114 (06): 329–335. Publisher Full Text 12. Nielson, Kerry J, Chun RF, et al. : Free 25-hydroxyvitamin D: impact of vitamin D binding protein assays on racial-genotypic associations. J. Clin. Endocrinol. Metabol. 2016; 101 (5): 2226–2234. PubMed Abstract | Publisher Full Text | Free Full Text 13. Braithwaite, Jones KS, Schoenmakers, et al. : Vitamin D binding protein genotype is associated with plasma 25OHD concentration in West African children. Bone. 2015; 74 : 166–170. PubMed Abstract | Publisher Full Text | Free Full Text 14. Chun, Peercy BE, Eric SO, et al. : Vitamin D and DBP: The free hormone hypothesis revisited. J. Steroid Biochem. Mol. Biol. 2014; 144 : 132–137. PubMed Abstract | Publisher Full Text | Free Full Text 15. Karcioglu Batur L, Hekim N: The role of DBP gene polymorphisms in the prevalence of new coronavirus disease 2019 infection and mortality rate.2021; 93 (3): 1409–1413. 16. Talat N, Perry S, Parsonnet J, et al. : Vitamin D deficiency and tuberculosis progression. Emerg. Infect. Dis. 2010; 16 (5): 853–855. PubMed Abstract | Publisher Full Text | Free Full Text 17. Meyer V, Saccone DS, Tugizimana F, et al. : Methylation of the Vitamin D Receptor (VDR) Gene, Together with Genetic Variation, Race, and Environment Influence the Signaling Efficacy of the Toll-Like Receptor 2/1-VDR Pathway. Front. Immunol. 2017; 8 . PubMed Abstract | Publisher Full Text | Free Full Text 18. Nizamutdinov I, Popov Y, Ilinsky V, et al. : Allele frequency distribution of SNPs associated with levels of Vitamin D-binding protein and 25-hydroxyvitamin D. bioRxiv. 2019; 564229. 19. Acen EL, Kateete DP, Worodria W, et al. : Evaluation of circulating serum cathelicidin levels as a potential biomarker to discriminate between active and latent tuberculosis in Uganda. PLoS One. 2022; 17 (8): e0272788. PubMed Abstract | Publisher Full Text | Free Full Text 20. Powe CE, Evans MK, Wenger J, et al. : Vitamin D–binding protein and vitamin D status of black Americans and white Americans. N. Engl. J. Med. 2013; 369 (21): 1991–2000. PubMed Abstract | Publisher Full Text | Free Full Text 21. Mogire RM, Morovat A, Muriuki JM, et al. : Prevalence and predictors of vitamin D deficiency in young African children. BMC Med. 2021; 19 : 1–14. Publisher Full Text 22. Martineau, Leandro A, Cristina CS, et al. : Association between Gc genotype and susceptibility to TB is dependent on vitamin D status. Eur. Respir. J. 2010; 35 (5): 1106–1112. PubMed Abstract | Publisher Full Text | Free Full Text 23. Saarnio E, Pekkinen M, Itkonen ST, et al. : Serum parathyroid hormone is related to genetic variation in vitamin D binding protein with respect to total, free, and bioavailable 25-hydroxyvitamin D in middle-aged Caucasians–a cross-sectional study. BMC Nutrition. 2016; 2 : 1–9. Publisher Full Text 24. Junaid K, Rehman A, Jolliffe DA, et al. : Vitamin D deficiency associates with susceptibility to tuberculosis in Pakistan, but polymorphisms in VDR, DBP and CYP2R1 do not. BMC Pulm. Med. 2016; 16 (1): 73. PubMed Abstract | Publisher Full Text | Free Full Text 25. Martineau AR, Leandro AC, Anderson ST, et al. : Association between Gc genotype and susceptibility to TB is dependent on vitamin D status. Eur. Respir. J. 2010; 35 (5): 1106–1112. PubMed Abstract | Publisher Full Text | Free Full Text 26. Al-Daghri NM, Mohammed AK, Bukhari I, et al. : Efficacy of vitamin D supplementation according to vitamin D-binding protein polymorphisms. Nutrition. 2019; 63-64 : 148–154. PubMed Abstract | Publisher Full Text 27. Alharazy S, Naseer MI, Alissa E, et al. : Association of SNPs in GC and CYP2R1 with total and directly measured free 25-hydroxyvitamin D in multi-ethnic postmenopausal women in Saudi Arabia. Saudi J. Biol. Sci. 2021; 28 (8): 4626–4632. PubMed Abstract | Publisher Full Text | Free Full Text 28. Harishankar M, Sampath P, Athikesavan V, et al. : Association of rs7041 and rs4588 polymorphisms of vitamin D binding protein gene in pulmonary tuberculosis. Meta Gene. 2020; 26 : 100822. Publisher Full Text 29. Braithwaite VS, Jones KS, Schoenmakers I, et al. : Vitamin D binding protein genotype is associated with plasma 25OHD concentration in West African children. Bone. 2015; 74 : 166–170. PubMed Abstract | Publisher Full Text | Free Full Text 30. Mogire RM, Morovat A, Muriuki JM, et al. : Prevalence and predictors of vitamin D deficiency in young African children. BMC Med. 2021; 19 (1): 115. PubMed Abstract | Publisher Full Text | Free Full Text 31. Saarnio E, Pekkinen M, Itkonen ST, et al. : Serum parathyroid hormone is related to genetic variation in vitamin D binding protein with respect to total, free, and bioavailable 25-hydroxyvitamin D in middle-aged Caucasians – a cross-sectional study. BMC Nutr. 2016; 2 (1): 46. Publisher Full Text 32. Acen EL, Joloba ML, Akintola A, et al. : Ester supplimentary data.zip. Dataset. figshare. 2025. Publisher Full Text Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 04 Feb 2025 ADD YOUR COMMENT Comment Author details Author details 1 Department of Physiology, School of Biomedical Sciences, College of Health Sciences, Makerere University, Kampala, POBOX 7072, Uganda 2 Department of Immunology and Molecular Biology, School of Biomedical Sciences, College of Health Sciences, Makerere University, Kampala, POBOX 7072, Uganda 3 Department of Biomedical Convergence Science and Technology, School of Industrial Technology Advances, Kyungpook National University, Daegu, 41566, South Korea 4 Department of Southern Area Crop Science, National Institute of Crop Science, Rural Development Administration, Miryang, 50424, South Korea 5 Department of Internal Medicine, School of Medicine, College of Health Sciences Unit, Makerere University, Kampala, POBOX 7072, Uganda 6 Department of Internal Medicine, Pulmonary Division, Mulago National Referral Hospital, Kampala, Uganda 7 Department of Molecular Biology and Biotechnology, School of Bio-security and Laboratory Sciences, College of Veterinary Medicine, Makerere University, Kampala, POBOX 7072, Uganda 8 Department of Biosecurity Ecosystems and Veterinary Public Health , School of Bio-security and Laboratory Sciences, College of Veterinary Medicine, Makerere University, Kampala, POBOX 7072, Uganda 9 Makerere Lung Institute, College of Health Sciences, Makerere University College of Health Sciences, Kampala, POBOX 7072, Uganda Acen L. Ester Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Joloba L. Moses Roles: Project Administration, Supervision, Validation, Visualization, Writing – Review & Editing Ashraf Akintola Roles: Formal Analysis, Methodology, Resources, Software, Visualization, Writing – Review & Editing Rizwana Begum Syed Nabi Roles: Formal Analysis, Investigation, Visualization, Writing – Review & Editing Irene Andia Biraro Roles: Project Administration, Resources, Supervision, Validation, Writing – Review & Editing William Worodria Roles: Project Administration, Supervision, Validation, Writing – Review & Editing Alfred Okeng Roles: Formal Analysis, Methodology, Visualization, Writing – Review & Editing Kelvin Bwambale Roles: Methodology, Software, Visualization, Writing – Review & Editing Mudarshiru Bbuye Roles: Software, Visualization, Writing – Review & Editing David Patrick Kateete Roles: Funding Acquisition, Project Administration, Supervision, Validation, Writing – Review & Editing Competing interests No competing interests were disclosed. Grant information This work was funded by “The Africa Center of Excellence in Materials, Product Development and Nanotechnology (MAPRONANO ACE) Makerere University” under the World Bank project. The funding agencies did not play any role in the development of this study. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (2) version 2 Revised Published: 21 May 2025, 14:154 https://doi.org/10.12688/f1000research.160839.2 version 1 Published: 04 Feb 2025, 14:154 https://doi.org/10.12688/f1000research.160839.1 Copyright © 2025 Ester AL et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Ester AL, Moses JL, Akintola A et al. Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :154 ( https://doi.org/10.12688/f1000research.160839.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 2 VERSION 2 PUBLISHED 21 May 2025 Revised Views 0 Cite How to cite this report: Wolde HM. Reviewer Report For: Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :154 ( https://doi.org/10.5256/f1000research.182062.r434456 ) The direct URL for this report is: https://f1000research.com/articles/14-154/v2#referee-response-434456 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 11 Dec 2025 Habtamu Milkias Wolde , School of Medicine, Department of Precision Medicine, SungKyunKwan University, Suwon, Seoul, South Korea Approved VIEWS 0 https://doi.org/10.5256/f1000research.182062.r434456 Comment This is an interesting study that investigates the distribution of Vitamin D binding protein gene polymorphism among patients with active TB, latent TB and individuals with no TB infection in Uganda. It’s known fact that ... Continue reading READ ALL Comment This is an interesting study that investigates the distribution of Vitamin D binding protein gene polymorphism among patients with active TB, latent TB and individuals with no TB infection in Uganda. It’s known fact that Vitamin D plays an important role in the immune systems response to TB and DBP gene polymorphisms can affect Vitamin D levels in the body and potentially increasing individuals’ susceptibility to TB. And the authors found no significant difference in the level of polymorphisms among the study groups which is again an interesting null finding. However, there are certain issues that need to be clarified before the manuscript is ready to be indexed, which I describe below as questions or suggestions. Introduction On the first line of the introduction section, the phrase “between 200-350 per 100 cases…” seems to be incorrect. Did you mean per 100,000 cases or some other denominator? On the 6th line the following phrase “…reported among adult TB patient” patient should be made plural by adding “s”. There are similar editorial issues the authors should carefully look into Methods Regarding the sample size, the study has included only 102 participants and out of these 46 samples were excluded. Would this size be sufficient enough reach to the conclusion? The samples were selected based on a convenience sampling method which is a non-random method? So, do you think this is going to affect generalizability of the study to the Ugandan population? Fisher’s exact test is preferred for small samples sizes but power calculations should have been done. With small sample, the study might be underpowered to detect modest risk/effect of the polymorphism on TB disease. Though the authors mostly conducted descriptive analyses of the data. But associations between variables/cause and effect are better assessed though stronger methods including regression models. Why did you restrict the analyses to descriptive stats only? Measuring the level of Vitamin D in the participants would have aided the analysis acting as a direct measure (e.g., comparison of blood plasma level) in addition to the genetic analysis. Results and discussion It would be insightful to discuss about the effect of the polymorphism on the different groups of participants including whether it accelerates progression of latent TB into active TB or whether it predisposes healthy individuals to be susceptible to TB infection. Minor Issues Grammar and clarity, many sentences require editing for clarity. Methods section is too long. It should be shortened unless critical. Acronyms should be defined once and then used consistently (e.g., ATB, LTBI) Some typographical issues like missing spaces, repeated words, uppercase errors. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Partly Competing Interests: No competing interests were disclosed. Reviewer Expertise: My broader area of expertise is Tropical and Infectious Diseases but I specialize in diseases such as Tuberculosis and Measles. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Wolde HM. Reviewer Report For: Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :154 ( https://doi.org/10.5256/f1000research.182062.r434456 ) The direct URL for this report is: https://f1000research.com/articles/14-154/v2#referee-response-434456 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Sari DK. Reviewer Report For: Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :154 ( https://doi.org/10.5256/f1000research.182062.r386374 ) The direct URL for this report is: https://f1000research.com/articles/14-154/v2#referee-response-386374 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 24 Jun 2025 Dina Keumala Sari , Department of Nutrition, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia Approved VIEWS 0 https://doi.org/10.5256/f1000research.182062.r386374 I think this paper already fulfill the ... Continue reading READ ALL I think this paper already fulfill the criterias and corrections. I have no further comments. Competing Interests: No competing interests were disclosed. Reviewer Expertise: Vitamin D and polimorphism of Vitamin D receptors. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Sari DK. Reviewer Report For: Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :154 ( https://doi.org/10.5256/f1000research.182062.r386374 ) The direct URL for this report is: https://f1000research.com/articles/14-154/v2#referee-response-386374 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Version 1 VERSION 1 PUBLISHED 04 Feb 2025 Views 0 Cite How to cite this report: Bethunaickan R. Reviewer Report For: Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :154 ( https://doi.org/10.5256/f1000research.176796.r369604 ) The direct URL for this report is: https://f1000research.com/articles/14-154/v1#referee-response-369604 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 13 Mar 2025 Ramalingam Bethunaickan , ICMR-National Institute for Research in Tuberculosis, Chennai, India Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.176796.r369604 The authors studied Vitamin D binding protein gene polymorphisms in Ugandan tuberculosis patients and household contacts and reported no significant differences in DBP genetic polymorphisms among the study groups. This study needs to address the following points for better clarity. ... Continue reading READ ALL The authors studied Vitamin D binding protein gene polymorphisms in Ugandan tuberculosis patients and household contacts and reported no significant differences in DBP genetic polymorphisms among the study groups. This study needs to address the following points for better clarity. Major comments: 1. This study was conducted in small sample size. The 102 samples were selected from previous cross-sectional study among which approximately 50% of the samples were excluded and stated that due to inadequate sample volume. For genotyping maximum 2ml blood is adequate for DNA extraction to carry out the experiment, hence those excluded can be done with lesser blood volume using cost effective methods like PCR-RFLP. Moreover, in this study individuals with an HIV+ serostatus were not excluded, then how authors would eliminate those confounders from the study results? 2. This study lack to study different genetic models and better fit model for their study population. Haplotype analysis needs to be done. 3. VDBP gene variants shown to be associated with serum vitamin D levels. Hence, for better understanding vitamin D and VDBP levels needs to be correlated with gene variants to known its association with the disease. 4. The authors stated that minor alleles appear to be associated with an increased risk of active and latent TB. However, no such significant association was noted in analysis and the frequencies in TB were 0% Gc1S, and 3.8% Gc2. Among the LTBI cases, 4.3% were Gc1S, and 0% were Gc2. For those without TB infection, the frequencies were Gc1s 0% and 0% for Gc2. This needs to be confirmed with larger sample size. Minor comments: 1. Include Gender based association Table. 2. Gene name mention in italics 3. In methods section, give sub-titles for DNA isolation, Gel electrophoresis, and Sanger methods. 4. Conclusion, minor allele association needs to be removed. 5. Grammar and typological errors needs to be checked throughout the manuscript. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Immunology- Immunogenetics- Nutrition- SLE and Tuberculosis I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Bethunaickan R. Reviewer Report For: Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :154 ( https://doi.org/10.5256/f1000research.176796.r369604 ) The direct URL for this report is: https://f1000research.com/articles/14-154/v1#referee-response-369604 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Sari DK. Reviewer Report For: Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :154 ( https://doi.org/10.5256/f1000research.176796.r369603 ) The direct URL for this report is: https://f1000research.com/articles/14-154/v1#referee-response-369603 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 11 Mar 2025 Dina Keumala Sari , Department of Nutrition, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.176796.r369603 Title : please add specific with the reference SNPs that stated in this study to clear which gene that involved in this research. Abstract: In the introduction: please state about Gc1F genotype and its Reference SNPs. ... Continue reading READ ALL Title : please add specific with the reference SNPs that stated in this study to clear which gene that involved in this research. Abstract: In the introduction: please state about Gc1F genotype and its Reference SNPs. In the methods: please clear when and where this research conducted. In conclusions: no need to state about recommended larger studies, because this study should be collect the data by counting the right sample size. Keywords: please choose other keywords that are not in the title to increased the search engine to the reader. Main text: Introduction: state about prevalence of Tuberculosis and vitamin D deficiency in Uganda, is it still main infectious problem? show the important or urgent of this study. So, it became the based of the research conducted. Add more references that support the lower vitamin D level in this population. Is there any information about sun exposure or vitamin D intake in this area? Methods: Please add about the inclusion and exclusion criteria for each groups, the information about inclusion and exclusion based on previous study only explain about household contact subject based on BMC Infectious Diseases 2015 15 , Article number: 438 Biraro et al. study and PLoS One. 2022 Acen et al [2022 (Ref-1)]: https://doi.org/10.1371/journal.pone.0272788. Not clear enough. Is there any data about vitamin D level serum in this research? Why this research did not assess vitamin D serum level whether 25(OH)D serum level or 1.25(OH)D serum level as the most active metabolite. Statistical analysis: Why choosing Fisher's exact test than Chi-Square test, is there any adjustment for this decisions? Results: Please revise the P symbol into lettercase and itallic Is there any difference between ATB-LTBI patient and group with no TB infection? Discussion: Please add more discussion about related of this SNPs related to the Vitamin D level. Please stated also about sun exposure in Uganda and also is there any possibility all the subject avoid the sun exposure. There are a statement about HIV, is this related to the lower vitamin D level? Is there any co founding factor in this research? how to control it? Is there superiority of these two genotypes? is it okay if we only check for one genotype? state about TB control and prevention. Conclusions: Please move the last statement of conclusions to discussion and add more information. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes References 1. Acen EL, Kateete DP, Worodria W, Olum R, et al.: Evaluation of circulating serum cathelicidin levels as a potential biomarker to discriminate between active and latent tuberculosis in Uganda. PLoS One . 2022; 17 (8): e0272788 PubMed Abstract | Publisher Full Text Competing Interests: No competing interests were disclosed. Reviewer Expertise: Vitamin D and polimorphism of Vitamin D receptors. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Sari DK. Reviewer Report For: Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :154 ( https://doi.org/10.5256/f1000research.176796.r369603 ) The direct URL for this report is: https://f1000research.com/articles/14-154/v1#referee-response-369603 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 04 Feb 2025 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 3 Version 2 (revision) 21 May 25 read read Version 1 04 Feb 25 read read Dina Keumala Sari , Universitas Sumatera Utara, Medan, Indonesia Ramalingam Bethunaickan , ICMR-National Institute for Research in Tuberculosis, Chennai, India Habtamu Milkias Wolde , SungKyunKwan University, Suwon, South Korea Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Wolde H. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 11 Dec 2025 | for Version 2 Habtamu Milkias Wolde , School of Medicine, Department of Precision Medicine, SungKyunKwan University, Suwon, Seoul, South Korea 0 Views copyright © 2025 Wolde H. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Comment This is an interesting study that investigates the distribution of Vitamin D binding protein gene polymorphism among patients with active TB, latent TB and individuals with no TB infection in Uganda. It’s known fact that Vitamin D plays an important role in the immune systems response to TB and DBP gene polymorphisms can affect Vitamin D levels in the body and potentially increasing individuals’ susceptibility to TB. And the authors found no significant difference in the level of polymorphisms among the study groups which is again an interesting null finding. However, there are certain issues that need to be clarified before the manuscript is ready to be indexed, which I describe below as questions or suggestions. Introduction On the first line of the introduction section, the phrase “between 200-350 per 100 cases…” seems to be incorrect. Did you mean per 100,000 cases or some other denominator? On the 6th line the following phrase “…reported among adult TB patient” patient should be made plural by adding “s”. There are similar editorial issues the authors should carefully look into Methods Regarding the sample size, the study has included only 102 participants and out of these 46 samples were excluded. Would this size be sufficient enough reach to the conclusion? The samples were selected based on a convenience sampling method which is a non-random method? So, do you think this is going to affect generalizability of the study to the Ugandan population? Fisher’s exact test is preferred for small samples sizes but power calculations should have been done. With small sample, the study might be underpowered to detect modest risk/effect of the polymorphism on TB disease. Though the authors mostly conducted descriptive analyses of the data. But associations between variables/cause and effect are better assessed though stronger methods including regression models. Why did you restrict the analyses to descriptive stats only? Measuring the level of Vitamin D in the participants would have aided the analysis acting as a direct measure (e.g., comparison of blood plasma level) in addition to the genetic analysis. Results and discussion It would be insightful to discuss about the effect of the polymorphism on the different groups of participants including whether it accelerates progression of latent TB into active TB or whether it predisposes healthy individuals to be susceptible to TB infection. Minor Issues Grammar and clarity, many sentences require editing for clarity. Methods section is too long. It should be shortened unless critical. Acronyms should be defined once and then used consistently (e.g., ATB, LTBI) Some typographical issues like missing spaces, repeated words, uppercase errors. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Partly Competing Interests No competing interests were disclosed. Reviewer Expertise My broader area of expertise is Tropical and Infectious Diseases but I specialize in diseases such as Tuberculosis and Measles. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Wolde HM. Peer Review Report For: Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :154 ( https://doi.org/10.5256/f1000research.182062.r434456) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-154/v2#referee-response-434456 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Sari D. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 24 Jun 2025 | for Version 2 Dina Keumala Sari , Department of Nutrition, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia 0 Views copyright © 2025 Sari D. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions I think this paper already fulfill the criterias and corrections. I have no further comments. Competing Interests No competing interests were disclosed. Reviewer Expertise Vitamin D and polimorphism of Vitamin D receptors. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Sari DK. Peer Review Report For: Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :154 ( https://doi.org/10.5256/f1000research.182062.r386374) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-154/v2#referee-response-386374 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Bethunaickan R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 13 Mar 2025 | for Version 1 Ramalingam Bethunaickan , ICMR-National Institute for Research in Tuberculosis, Chennai, India 0 Views copyright © 2025 Bethunaickan R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The authors studied Vitamin D binding protein gene polymorphisms in Ugandan tuberculosis patients and household contacts and reported no significant differences in DBP genetic polymorphisms among the study groups. This study needs to address the following points for better clarity. Major comments: 1. This study was conducted in small sample size. The 102 samples were selected from previous cross-sectional study among which approximately 50% of the samples were excluded and stated that due to inadequate sample volume. For genotyping maximum 2ml blood is adequate for DNA extraction to carry out the experiment, hence those excluded can be done with lesser blood volume using cost effective methods like PCR-RFLP. Moreover, in this study individuals with an HIV+ serostatus were not excluded, then how authors would eliminate those confounders from the study results? 2. This study lack to study different genetic models and better fit model for their study population. Haplotype analysis needs to be done. 3. VDBP gene variants shown to be associated with serum vitamin D levels. Hence, for better understanding vitamin D and VDBP levels needs to be correlated with gene variants to known its association with the disease. 4. The authors stated that minor alleles appear to be associated with an increased risk of active and latent TB. However, no such significant association was noted in analysis and the frequencies in TB were 0% Gc1S, and 3.8% Gc2. Among the LTBI cases, 4.3% were Gc1S, and 0% were Gc2. For those without TB infection, the frequencies were Gc1s 0% and 0% for Gc2. This needs to be confirmed with larger sample size. Minor comments: 1. Include Gender based association Table. 2. Gene name mention in italics 3. In methods section, give sub-titles for DNA isolation, Gel electrophoresis, and Sanger methods. 4. Conclusion, minor allele association needs to be removed. 5. Grammar and typological errors needs to be checked throughout the manuscript. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Immunology- Immunogenetics- Nutrition- SLE and Tuberculosis I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Bethunaickan R. Peer Review Report For: Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :154 ( https://doi.org/10.5256/f1000research.176796.r369604) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-154/v1#referee-response-369604 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Sari D. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 11 Mar 2025 | for Version 1 Dina Keumala Sari , Department of Nutrition, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia 0 Views copyright © 2025 Sari D. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Title : please add specific with the reference SNPs that stated in this study to clear which gene that involved in this research. Abstract: In the introduction: please state about Gc1F genotype and its Reference SNPs. In the methods: please clear when and where this research conducted. In conclusions: no need to state about recommended larger studies, because this study should be collect the data by counting the right sample size. Keywords: please choose other keywords that are not in the title to increased the search engine to the reader. Main text: Introduction: state about prevalence of Tuberculosis and vitamin D deficiency in Uganda, is it still main infectious problem? show the important or urgent of this study. So, it became the based of the research conducted. Add more references that support the lower vitamin D level in this population. Is there any information about sun exposure or vitamin D intake in this area? Methods: Please add about the inclusion and exclusion criteria for each groups, the information about inclusion and exclusion based on previous study only explain about household contact subject based on BMC Infectious Diseases 2015 15 , Article number: 438 Biraro et al. study and PLoS One. 2022 Acen et al [2022 (Ref-1)]: https://doi.org/10.1371/journal.pone.0272788. Not clear enough. Is there any data about vitamin D level serum in this research? Why this research did not assess vitamin D serum level whether 25(OH)D serum level or 1.25(OH)D serum level as the most active metabolite. Statistical analysis: Why choosing Fisher's exact test than Chi-Square test, is there any adjustment for this decisions? Results: Please revise the P symbol into lettercase and itallic Is there any difference between ATB-LTBI patient and group with no TB infection? Discussion: Please add more discussion about related of this SNPs related to the Vitamin D level. Please stated also about sun exposure in Uganda and also is there any possibility all the subject avoid the sun exposure. There are a statement about HIV, is this related to the lower vitamin D level? Is there any co founding factor in this research? how to control it? Is there superiority of these two genotypes? is it okay if we only check for one genotype? state about TB control and prevention. Conclusions: Please move the last statement of conclusions to discussion and add more information. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes References 1. Acen EL, Kateete DP, Worodria W, Olum R, et al.: Evaluation of circulating serum cathelicidin levels as a potential biomarker to discriminate between active and latent tuberculosis in Uganda. PLoS One . 2022; 17 (8): e0272788 PubMed Abstract | Publisher Full Text Competing Interests No competing interests were disclosed. Reviewer Expertise Vitamin D and polimorphism of Vitamin D receptors. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Sari DK. Peer Review Report For: Vitamin D binding protein rs7041 and rs4588 gene polymorphisms in Ugandan tuberculosis patients and household contacts: A pilot study [version 2; peer review: 2 approved, 1 approved with reservations] . F1000Research 2025, 14 :154 ( https://doi.org/10.5256/f1000research.176796.r369603) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-154/v1#referee-response-369603 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = \"Vitamin D binding protein rs7041 and rs4588...\".replace(\"'\", ''); var linkedInUrl = \"http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/14-154/v2\" + \"&title=\" + encodeURIComponent(lTitle) + \"&summary=\" + encodeURIComponent('Read the article by '); var deliciousUrl = \"https://del.icio.us/post?url=https://f1000research.com/articles/14-154/v2&title=\" + encodeURIComponent(lTitle); var redditUrl = \"http://reddit.com/submit?url=https://f1000research.com/articles/14-154/v2\" + \"&title=\" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Ester AL et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : \"facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com\", services_expanded : \"facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com\", services_custom : [ { name: \"LinkedIn\", url: linkedInUrl, icon:\"/img/icon/at_linkedin.svg\" }, { name: \"Mendeley\", url: \"http://www.mendeley.com/import/?url=https://f1000research.com/articles/14-154/v2/mendeley\", icon:\"/img/icon/at_mendeley.svg\" }, { name: \"Reddit\", url: redditUrl, icon:\"/img/icon/at_reddit.svg\" }, ] }; var addthis_share = { url: \"https://f1000research.com/articles/14-154\", templates : { twitter : \"Vitamin D binding protein rs7041 and rs4588 gene polymorphisms.... Ester AL et al., published by \" + \"@F1000Research\" + \", https://f1000research.com/articles/14-154/v2\" } }; if (typeof(addthis) != \"undefined\"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(\".f1r-shares-twitter\").attr(\"href\", \"https://twitter.com/intent/tweet?text=\" + addthis_share.templates.twitter); $(\".f1r-shares-facebook\").attr(\"href\", \"https://www.facebook.com/sharer/sharer.php?u=\" + addthis_share.url); $(\".f1r-shares-linkedin\").attr(\"href\", addthis_config.services_custom[0].url); $(\".f1r-shares-reddit\").attr(\"href\", addthis_config.services_custom[2].url); $(\".f1r-shares-mendelay\").attr(\"href\", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(\".addthis_button_expanded\").each(function(){ var count = $(this).text(); if (count !== \"\" && count != \"0\") $(this).removeClass(\"is-hidden\"); else $(this).addClass(\"is-hidden\"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get(\"/articles/acj/160839/182062\") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay(\"articles\", \"article\", \"182062\"); $(document).ready(function() { $( \"#frame1\" ).on('load', function() { var mydiv = $(this).contents().find(\"div\"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(\".interactive-living-figure-label .icon-more-info\"), titleLivingFigure = tooltipLivingFigure.attr(\"title\"); tooltipLivingFigure.simpletip({ fixed: true, position: [\"-115\", \"30\"], baseClass: 'small-tooltip', content:titleLivingFigure + \" \" }); tooltipLivingFigure.removeAttr(\"title\"); $(\"body\").on(\"click\", \".cite-living-figure\", function(e) { e.preventDefault(); var ref = $(this).attr(\"data-ref\"); $(this).closest(\".living-figure-list-container\").find(\"#\" + ref).fadeIn(200); }); $(\"body\").on(\"click\", \".close-cite-living-figure\", function(e) { e.preventDefault(); $(this).closest(\".popup-window-wrapper\").fadeOut(200); }); $(document).on(\"mouseup\", function(e) { var metricsContainer = $(\".article-metrics-popover-wrapper\"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(\".article-metrics-close-button\").click(); } }); var articleId = $('#articleId').val(); if($(\"#main-article-count-box\").attachArticleMetrics) { $(\"#main-article-count-box\").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(\".new_figshare_widget\"); if (figshareWidget.length > 0) { window.figshare.load(\"f1000\", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr(\"figshare_articleId\") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { \"411158\": 0, \"434454\": 0, \"411159\": 0, \"434455\": 0, \"411156\": 0, \"434452\": 0, \"411157\": 0, \"434453\": 0, \"411154\": 0, \"434450\": 0, \"411155\": 0, \"434451\": 0, \"434449\": 0, \"411162\": 0, \"411163\": 0, \"411160\": 0, \"434456\": 3, \"411161\": 0, \"434457\": 0, \"420898\": 0, \"386373\": 0, \"386374\": 3, \"420982\": 0, \"420983\": 0, \"420980\": 0, \"420981\": 0, \"420988\": 0, \"420986\": 0, \"420987\": 0, \"420984\": 0, \"420985\": 0, \"405390\": 0, \"405391\": 0, \"405389\": 0, \"415382\": 0, \"405398\": 0, \"415383\": 0, \"405396\": 0, \"405397\": 0, \"405394\": 0, \"405395\": 0, \"405392\": 0, \"405393\": 0, \"415390\": 0, \"367517\": 0, \"415391\": 0, \"408479\": 0, \"367516\": 0, \"415388\": 0, \"367519\": 0, \"415389\": 0, \"367518\": 0, \"415386\": 0, \"367513\": 0, \"415387\": 0, \"415384\": 0, \"367515\": 0, \"415385\": 0, \"367514\": 0, \"408482\": 0, \"367521\": 0, \"367520\": 0, \"408480\": 0, \"408481\": 0, \"367522\": 0, \"368581\": 0, \"369605\": 0, \"368580\": 0, \"369604\": 5, \"368583\": 0, \"369607\": 0, \"368582\": 0, \"369606\": 0, \"368579\": 0, \"369603\": 11, \"368578\": 0, \"369602\": 0, \"387021\": 0, \"368585\": 0, \"369609\": 0, \"368584\": 0, \"369608\": 0, \"368587\": 0, \"369611\": 0, \"368586\": 0, \"369610\": 0, \"387029\": 0, \"387031\": 0, \"387027\": 0, \"408542\": 0, \"408543\": 0, \"408540\": 0, \"408541\": 0, \"387033\": 0, \"387032\": 0, \"408539\": 0, \"387035\": 0, \"387034\": 0, }; $(\".referee-response-container,.js-referee-report\").each(function(index, el) { var reportId = $(el).attr(\"data-reportid\"), reportCount = reportIds[reportId] || 0; $(el).find(\".comments-count-container,.js-referee-report-views\").html(reportCount); }); var uuidInput = $(\"#article_uuid\"), oldUUId = uuidInput.val(), newUUId = \"d5a7c5de-55eb-427b-a906-78f35223e8c5\"; uuidInput.val(newUUId); $(\"a[href*='article_uuid=']\").each(function(index, el) { var newHref = $(el).attr(\"href\").replace(oldUUId, newUUId); $(el).attr(\"href\", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: \"f1000research\", displayName: \"F1000Research\", hostName: \"f1000research.com\", id: \"1\", editorialEmail: \"research@f1000.com\", infoEmail: \"info@f1000.com\", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(\".cookie-warning\").is(\":visible\")) { $(\".sticky\").css(\"margin-bottom\", \"35px\"); $(\".devices\").addClass(\"devices-and-cookie-warning\"); } $(\".cookie-warning .close-button\").click(function (e) { $(\".devices\").removeClass(\"devices-and-cookie-warning\"); $(\".sticky\").css(\"margin-bottom\", \"0\"); }); $(\"#tweeter-feed .tweet-message\").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(\".partner\").on(\"mouseenter mouseleave\", function() { $(this).find(\".gray-scale, .colour\").toggleClass(\"is-hidden\"); }); }); <!-- Sign in --> Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $(\"a[id=googleSignInButton]\").click(function(event){ event.preventDefault(); $(\"input[id=oAuthSystem]\").val(\"GOOGLE\"); $(\"form[id=oAuthForm]\").submit(); }); $(\"a[id=facebookSignInButton]\").click(function(event){ event.preventDefault(); $(\"input[id=oAuthSystem]\").val(\"FACEBOOK\"); $(\"form[id=oAuthForm]\").submit(); }); $(\"a[id=orcidSignInButton]\").click(function(event){ event.preventDefault(); $(\"input[id=oAuthSystem]\").val(\"ORCID\"); $(\"form[id=oAuthForm]\").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($(\"#sign-in-form-gfb-popup\")); $(\".target-field\").each(function () { var uris = $(this).val().split(\"/\"); if (uris.pop() === \"login\") { $(this).val(uris.toString().replace(\",\",\"/\")); } }); });","source_license":"CC-BY-4.0","license_restricted":false}