{"paper_id":"171af840-5650-4d3a-92ee-8b5974caa3df","body_text":"Amygdalin regulated vasoactive intestinal peptide receptor to protect alveolar epithelial barrier against lung injury induced by influenza A virus | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Amygdalin regulated vasoactive intestinal peptide receptor to protect alveolar epithelial barrier against lung injury induced by influenza A virus Xueyue Song, Ting Wang, Miao Ye, Xunlong Shi, Daofeng Chen, Yan Lu, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6801211/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 02 Oct, 2025 Read the published version in Chinese Medicine → Version 1 posted 9 You are reading this latest preprint version Abstract Background Bitter apricot kernel is a common traditional Chinese medicine used for lung diseases. Previous studies showed that Xuanbai-Chengqi decoction (XCD) containing bitter apricot kernel protected the alveolar and intestinal barriers in influenza-infected mice. However, the specific contribution of bitter apricot kernel and its active substances in viral pneumonia remain unclear. Purpose This study aimed to identify the main active ingredient in bitter apricot kernel and investigate its mechanism in protecting the alveolar epithelial barrier in viral pneumonia. Method Bitter apricot kernel was evaluated based on the efficacy differences between XCD and XCD without bitter apricot kernel. Amygdalin was identified through in vitro activity tests and verified in vivo. Immunohistochemistry, RT-qPCR, and WB were used to assess barrier protection and anti-inflammatory effects. The molecular mechanisms were explored using SPR/LC/MS and validated experimentally. Result Removing bitter apricot kernel significantly weakened XCD's protective effect in influenza A virus-infected mice. Amygdalin showed anti-inflammatory, anti-hypoxia activities, and promoted endothelial cell migration in vitro. Administration of amygdalin at 100 mg/kg effectively mitigated pulmonary injury, suppressed viral replication, and attenuated excessive inflammatory responses in IAV-infected murine models. It protected the alveolar barrier by restoring alveolar type II cells (AT2) and promoting alveolar regeneration, while upregulating surfactant protein A (SP-A) and aquaporin protein-5 (AQP5). Amygdalin bound selectively to vasoactive intestinal peptide receptor 1 (VIPR1) thereby upregulating cyclic adenosine monophosphate (cAMP) levels and the protein expression levels of Protein kinase A (PKA) and Phosphor- protein kinase A (p-PKA). Conclusion Amygdalin is the key bioactive component of bitter apricot kernel, which exhibits protective effects in an IAV-induced pneumonia mouse model by activating the cAMP/PKA/p-PKA signaling cascade and recapitulating the biological effects of vasoactive intestinal peptide (VIP). Viral pneumonia Amygdalin Influenza virus Alveolar epithelial barrier Vasoactive intestinal peptide receptor Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction The annual incidence of viral pneumonia is on the rise, with a high mortality rate in severe cases, posing a serious threat to human health. Influenza A viruses are common pathogens of severe pneumonia [1] . It is estimated that globally, 4–9 out of every 100,000 people die from influenza each year [2] . Currently, treatment for severe viral pneumonia mainly involves anti-infection measures, organ support and immunomodulation but the efficacy is limited [3; 4] . The alveolar epithelial cells and capillary endothelial cells form the air-blood barrier in the lung as its functional unit. Dysfunction of this barrier accelerates the pathological progression of severe viral pneumonia, highlighting an urgent need for developing new drugs targeting for air-blood barrier [5] . When viral infections cause damage to alveolar epithelial cells and trigger an amplified inflammatory response of the innate immune cascade, excessive inflammation disrupts the air-blood barrier, leading to increased vascular permeability, the spread of toxins and inflammatory mediators throughout the body, and progression to sepsis and multiple organ injuries [6; 7] . Influenza A virus replication directly disrupts tight junctions between alveolar epithelial cells, inhibits Na + ion channels on the cell surface, reduces the clearance rate of alveolar fluid, and causes the accumulation of inflammatory exudate and necrotic material in the alveolar cavity, affecting blood oxygen exchange [8] . Moreover, pro-inflammatory cytokines secreted by epithelial cells, neutrophils, and macrophages further damage the integrity of the alveolar epithelium-capillary endothelium barrier [9] . Furthermore, the influenza virus induces a strong oxidative stress response that generates a substantial amount of reactive oxygen species damaging the barrier system which leads to pulmonary edema [10] . These pathological factors, including viral replication, inflammatory mediators, hypoxia-induced effects as well as barrier disruption are significant contributors to severe respiratory failure observed in patients. Modulating the host immune response, enhancing pulmonary immune tolerance, protecting the integrity of the air-blood barrier, and promoting the repair and regeneration have become potential strategies for treating severe lung infections [11] . For example, Vasculotide, a novel peptide acting as an agonist of the tyrosine kinase receptor 2 (Tie2), has been demonstrated to enhance pulmonary endothelial barrier function in a mouse model of severe influenza-induced acute lung injury, thereby improving survival rates, and reducing lung permeability and injury without affecting the pulmonary immune response in a pneumococcal pneumonia mouse model [12; 13] . This suggests that barrier repair is indeed a viable strategy, but the mechanisms underlying epithelial and endothelial repair still require further investigation. Neuroendocrine involvement in the differentiation, proliferation, and repair of alveolar epithelial cells, which is a neglected aspect. VIPR1 belongs to the G-protein-coupled receptors B1 subfamily, and its endogenous ligand VIP are abundant neurotransmitter in lungs and other organs [14] . After the combination of VIP and VIPR1, it exerts a variety of biological effects, such as bronchodilation, vasodilation, anti-inflammation, and immunomodulation, which play an important role in the pathophysiology of pulmonary hypertension, COPD, asthma, pulmonary fibrosis and other lung diseases [15] . Lentivirus-mediated overexpression of VIP significantly reduces inflammatory cell infiltration, maintains alveolar structure integrity, and effectively mitigates LPS-induced acute lung injury (ALI) [16] . VIP also increases the expression of SP-A in alveolar AT2 cells, mainly by the activating protein kinase C (PKC), which in turn activates the c-Fos protein, which is a necessary factor for VIP-induced SP-A expression in AT2 cells [17] . However, the role of VIP in protecting the alveolar epithelial barrier during influenza virus infection remains underexplored. Bitter apricot kernel and sweet apricot kernel, collectively known as apricot kernel kernel, are commonly used ingredients in Chinese soups and baking. They are included in the list of Food & Medicine Homology issued by the Ministry of Health, and are widely applied. Bitter apricot kernel contains amygdalin, fatty oil, emulsin, β-glucosidase, prunase, estrone, and other components. Amygdalin is a common cyanogenic glycoside and the active component of traditional Chinese medicine-bitter apricot kernel. It has been shown to possess pharmacological effects such as antitussive, expectorant, antiasthmatic, and anti-inflammatory properties. Due to the risk of hydrogen cyanide poisoning from excessive consumption, bitter apricot kernel is often combined with other drugs and widely used in the treatment of pulmonary diseases. Traditional Chinese medicine (TCM) has been widely used in the treatment of severe acute respiratory syndrome [18] , influenza A(H1N1), and COVID-19 [19] . It is not limited by the differences in the structural and mechanistic emerging respiratory viruses. Host protection and immune modulation are characteristics of anti-infective properties of TCM, and its effectiveness in prevention and treatment of severe pneumonia has been confirmed. Xuanbai-Chengqi decoction (XCD), originating from the Qing Dynasty medical book \"Wen Bing Tiao Bian,\" is clinically used to treat pneumonia, sepsis, chronic obstructive pulmonary disease, and reduce complications and mortality of acute respiratory distress syndrome (ARDS) patients [20; 21] . XCD consists of Gypsum Fibrosum, Rhei Radix Et Rhizoma, Armeniacae Semen Amarum, and Trichosanthis Pericarpium, with over a hundred compounds. Our previous research demonstrated that XCD could protect alveolar epithelial cells after influenza virus infection and improve lung barrier permeability [22; 23] , but the role of bitter apricot kernel in compound formulations is not clearly understood. Amygdalin is the main active ingredient [24] , but its protective effects on the alveolar epithelial barrier and the underlying mechanisms have not been reported. To systematically identify bioactive components capable of protecting the air-blood barrier, our study employed a multi-step screening approach progressing from compound formula analysis to single herb evaluation and finally to active ingredient characterization. We identified amygdalin, a pivotal monomeric compound derived from bitter apricot kernel, with anti-inflammatory, anti-hypoxic, and repair-promoting activities. Further mechanistic investigations revealed its capacity to preserve alveolar epithelial barrier integrity, which was rigorously validated in an IAV-induced murine model. This experimental framework elucidated both the therapeutic potential and underlying molecular pathways of amygdalin in barrier protection. Results 1. Bitter apricot kernel in XCD is essential for the treatment of severe pneumonia. Male mice were infected with 4LD 50 H1N1 virus dose and constructed severe viral pneumonia model to evaluate the effects of bitter apricot kernel in XCD against viral pneumonia (Fig. 1 A). The results revealed a significant reduction in body weight of IAV-infected mice relative to uninfected controls by day 3 post-infection, but therapeutic administration failed to reverse the progressive weight decline (Fig. 1 B). Lung index, viral replication and IL-6 transcript levels were significantly higher ( P < 0.001) in the model group compared with the uninfected control group (Fig. 1 C-F). In contrast, the XCD group demonstrated a statistically significant reduction in the lung index( P < 0.05), accompanied by marked improvement in lung injury pathology, suppression of viral replication( P < 0.05) and a decrease in IL-6 transcript levels( P < 0.001) (Fig. 1 C-F). Compared with the XCD group, XCD without bitter apricot kernel and bitter apricot kernel did not show significant amelioration of pulmonary edema. However, the bitter apricot kernel group exhibited stronger inhibition of viral replication( P < 0.001) whereas the XCD without bitter apricot kernel group showed attenuated antiviral efficacy (Fig. 1 E). In addition, the XCD group showed the strongest inhibitory effect on inflammation (Fig. 1 F). The above results suggest that although bitter apricot kernel alone does not significantly alleviate lung injury, its contribution to the efficacy of the combination is indispensable. Therefore, it is necessary to identify the pharmacologically active substances in bitter apricot kernel that contribute to the treatment of viral pneumonia and to elucidate their mechanisms of action. 2. Amygdalin exerts multiple activities including anti-inflammatory, anti-hypoxic and promoting cell migration in vitro . Amygdalin is an important bioactive compound derived from bitter apricot kernel. Multifactorial in vitro cell injury models were employed to recapitulate the pathological microenvironment of viral pneumonia including viruses, inflammation, hypoxia, and scratching (Fig. 2 A). The maximum non-toxic concentration of amygdalin was determined to be 50 µM (Fig. 2 B). Lipopolysaccharide (LPS) stimulation markedly elevated nitric oxide (NO) levels in macrophage culture supernatants, but 12.5–50 µM amygdalin treatment suppressed NO production ( P < 0.01) (Fig. 2 C). Compared to the hypoxia model group, treatment with amygdalin at 25 µM markedly increased the viability of HUVECs( P < 0.01) (Fig. 2 D). Amygdalin did not exhibit significant inhibitory effects on H1N1 viral replication in infected A549 cells (Fig. 2 E). Amygdalin at 50 µM significantly enhanced wound closure in HUVECs compared to the untreated control group ( P < 0.05) (Fig. 2 F-G). These findings suggest amygdalin has promising in vitro activity against various pathological aspects of viral pneumonia. 3. Amygdalin ameliorates lung injury in mice caused by influenza virus infection. Male mice were infected with 2LD 50 H1N1 virus dose to study the pharmacological effects of amygdalin in vivo (Fig. 3 A). The results showed that the weight of mice in the model group was significantly reduced by day 3 post-IAV infection, accompanied with significant lung hemorrhage, edema, and the increased lung index( P < 0.001). Histopathological analysis further revealed severe alveolar structural damage, including thickened alveolar walls and inflammatory cell infiltration. Administration of 100 mg/kg amygdalin significantly alleviated these pathological alterations( P < 0.05) (Fig. 3 B-E). Oseltamivir also exhibited a significant therapeutic effect ( P < 0.001) (Fig. 3 B-E). To clarify whether amygdalin affects the host's innate immunity, the viral load and the mRNA levels of IL-6 and IL-10 in mouse lung tissues were analyzed. Amygdalin significantly inhibited influenza virus replication( P < 0.01) and downregulated IL-6 mRNA levels( P < 0.05), while upregulating the IL-10 mRNA levels( P < 0.05) (Fig. 3 F-H). These results suggest that amygdalin administration at 100 mg/kg significantly inhibit influenza virus replication and the excessive inflammatory response, thereby alleviating the pathological damage. Further, the effects of amygdalin on protecting the pulmonary air-blood barrier will be elucidated. 4. Amygdalin protects the alveolar epithelial barrier in influenza virus-infected mice. Viral infection resulted in lung injury, evidenced by damage to alveolar type I epithelial cells (AT1), decreased proliferation and differentiation of AT2, decreased lung surfactant, and changed in lung osmolarity [25; 26] . The AT2 cell numbers in lung tissues of the model group was significantly reduced( P < 0.001) compared to controls (Fig. 4 A-B). Treatment with amygdalin significantly restored the number of AT2( P < 0.001) (Fig. 4 A-B), concurrently upregulating the expression of SPA( P < 0.05) (Fig. 4 D-E) and enhancing AQP5 mRNA and protein levels( P < 0.001) (Fig. 4 F-G). However, amygdalin exhibited no significant effect on the population of AT1 cells (Fig. 4 A&C). These results suggest that amygdalin can consolidate the alveolar epithelial barrier by promoting the proliferation of AT2 cells, up-regulating the expression of SPA and AQP5 proteins to maintain fluid balance in the lungs and alleviate pulmonary edema. 5. Amygdalin exerts VIP-like effects by binding lung VIPR1. The surface plasmon resonance (SPR) and liquid chromatography-tandem mass spectrometry (LC-MS) were used to identify target and mechanism of amygdalin. A total of 121 proteins with scores of over 1000 were identified as potential candidate targets (Fig. 5 A-B). Through a systematic analysis of the functional roles of these proteins reported in prior literature, VIPR1 emerged as a critical focus of our investigation. VIPR1 has received increasing attention for its ability to exert multiple biological effects such as bronchodilation, vasodilation, anti-inflammation, and immunomodulation when bound to its endogenous ligand VIP. Molecular docking showed that amygdalin binds well to VIPR1 (Fig. 5 C). In vitro, 50 µM amygdalin significantly inhibited IL-6 transcription in LPS-induced Ana-1 cells( P < 0.05) (Fig. 5 D), but the effect was weakened by the VIPR antagonist. These results suggest that VIPR1 may be the target for amygdalin to exert its biological effects. 6. Amygdalin protects the alveolar epithelial barrier via the VIPR1/cAMP/PKA/p-PKA signaling pathway. To elucidate the regulatory role of amygdalin in VIPR1, both mRNA and protein expression levels of VIPR1 in lung tissues were quantitatively assessed. Notably, administration of 100 mg/kg amygdalin up-regulated VIPR1 levels( P < 0.05) compared to the model group (Fig. 6 A-C), indicating its potential to potentiate endogenous VIP effects through receptor upregulation. While both the model group and amygdalin groups exhibited moderate increases in VIP secretion relative to normal controls, no statistically significant differences were observed, suggesting amygdalin's activity occurs independently of VIP level (Fig. 6 D). Building upon previous findings linking amygdalin to AQP5 upregulation via cAMP-dependent pathways downstream of VIPR1 activation. H1N1 infection induced a profound suppression of cAMP levels( P < 0.001), but administration of 100 mg/kg amygdalin significantly upregulated it( P < 0.05) (Fig. 6 E). To delineate the mechanistic cascade, we further analyzed proteins of the downstream signaling pathway. Consistent with the cAMP results, both PKA and p-PKA protein expression were significantly attenuated in the model group ( P < 0.01), but significantly increased through administration of 100 mg/kg amygdalin ( P < 0.05, P < 0.01) (Fig. 6 F-I). These results demonstrate that amygdalin up-regulates and binds VIPR1 receptors, activating the cAMP/PKA/p-PKA signaling cascade, ultimately mediating its therapeutic pharmacological effects . Discussions In this study, we found that removing bitter apricot kernel from XCD impaired its therapeutic effects of reducing the lung index, alleviating lung hemorrhage and edema, and inhibiting the transcription level of the inflammatory factor IL-6. This confirms that bitter apricot kernel plays a vital role in the development of viral pneumonia, but the link of action is not clear. Amygdalin is one of the key active compounds in bitter apricot kernel. Viral infection, hypoxia, inflammation and endothelial dysfunction are associated with the pathological progression of viral pneumonia, so we evaluated its multiple antiviral, anti-inflammatory, anti-hypoxic and pro-endothelial migration activities in vitro , and further evaluate the protective potential of amygdalin against virus infected in mice. Additionally, amygdalin promotes the proliferation of AT2 cells, and the expression of SP-A and AQP5 following H1N1 attack, which contribute to maintaining the integrity and function of the alveolar epithelial barrier. By capturing and validating the target of amygdalin, we determined that amygdalin binds to VIPR1 and activates the downstream cAMP/PKA signaling pathway, thereby protecting the alveolar epithelial barrier. XCD containing bitter apricot kernel is an important base formula in TCM for the treatment of COVID-19, showing significant effects in preventing the development of mild or common disease to severe or critical cases [27] . Bitter apricot kernel used as an adjuvant herb in XCD, is often combined with other herbs in different formulas to treat cough, asthma, COPD, and COVID-19. The content of amygdalin in bitter apricot kernel is approximately 2–3%, which is the main source of its bitterness. At present, researches on the pharmacological effects of amygdalin mainly focuses on cough relief, asthma relief, anti-inflammatory, anti-tumor, anti-organ fibrosis, and immunomodulatory activities, but its target remains unclear [28; 29] . In our study, we evaluated the activities of amygdalin against excessive inflammatory mediators, hypoxia, and barrier damage in the progression of severe viral pneumonia in cellular models. It showed activity of anti-inflammation, anti-hypoxia, and barrier repair. Further studies in animal models confirmed that amygdalin could alleviate virus-induced lung injury. Among the series of targets captured by SPR combined with LC/MS techniques, VIPR1, which is associated with neuroendocrine regulation, caught our attention. Notably, the competitive binding of VIPR1 receptor antagonists inhibited the binding of amygdalin and significantly reduced the anti-inflammatory activity of amygdalin in vitro, suggesting that binding to VIPR1 may be the key target for amygdalin's efficacy. VIP, a neuropeptide abundantly expressed in pulmonary and extrapulmonary tissues, exhibits diverse biological functions including immunomodulation, oxidant/antioxidant homeostasis maintenance, vasodilation, and alveolar integrity preservation [15; 30] . The molecular mechanism of VIP involves its binding to G protein-coupled receptors (GPCRs), which subsequently activates AC and stimulates cAMP production. PKA, as the primary downstream effector of cAMP, is activated through cAMP-mediated dissociation of its regulatory subunits, thereby initiating the cAMP/PKA signaling cascade [31] . Notably, emerging evidence has demonstrated a significant correlation between the expression and subcellular localization of AQP5 protein and this signaling pathway [32; 33] . Experimental studies utilizing both dry eye guinea pig models and LPS-induced acute lung injury rat models have provided compelling evidence that VIP modulates AQP5 expression and macrophage M1/M2 polarization via the cAMP-PKA signaling axis [34; 35] . Our results showed that amygdalin could up-regulate the expression levels of AQP5 and increase the number of VIPR1 receptors in mouse lung tissue in H1N1-infected mice. Therefore, we speculate that its mechanism of action may involve upregulating the number of VIPR1 receptors, allowing more endogenous VIP to bind and exert a series of biological activities. Further results indicate that even without affecting endogenous VIP levels, amygdalin can still increase cAMP content and PKA and p-PKA protein expression, suggesting that amygdalin can bind to upregulated VIPR1, activate downstream signaling pathways, and exert a similar biological to VIP. Whether the specific mechanism by which amygdalin restores the number of alveolar stem cells (AT2) and upregulates SP-A protein levels is related to the activation of VIPR1 receptor still needs further experimental verification. As a component of the air-blood barrier, alveolar epithelium not only facilitates gas exchange, but also serves as a physical barrier between the alveolar cavity and the underlying mucosa, protecting tissues from the invasion of bacterial, viral, and allergen [36] . In acute lung injury caused by viral infections, the integrity and function of the alveolar epithelial barrier is compromised, which may lead to the progression from hypoxemia to respiratory failure. It is a promising strategy to search for active substances from TCM compound libraries that effectively protect the air-blood barrier. This study confirms that amygdalin has potential in regulating the host immune response, protect alveolar epithelial barrier damage, and enhance post-injury repair, thereby preventing the pathological progression of severe viral pneumonia. In conclusion, this study identifies amygdalin as the principal bioactive constituent of bitter apricot kernel with therapeutic efficacy against viral pneumonia. Our findings demonstrate that amygdalin exerts significant protective effects on lung injury in an IAV-induced murine pneumonia model, primarily through the preservation of alveolar epithelial barrier integrity and function. Furthermore, we have elucidated that amygdalin functions as an exogenous ligand for VIPR1 activation, thereby providing mechanistic insights into its preventive and therapeutic actions against viral pneumonia from the perspective of neuroendocrine regulation. Nevertheless, the precise regulatory mechanisms underlying VIPR1 activation warrant further investigation. Future studies will employ targeted knockdown or inhibition of VIPR1 expression to refine and validate these mechanistic pathways. Materials and methods 1. Virus and mice The mouse-adapted IAV strain (A/FM/1/47, H1N1) was maintained at the center for anti-inflammation and anti-virus drug screening (School of Pharmacy, Fudan University, Shanghai, China). Virus as propagated in the lungs of mice and preserved at − 80℃. The median lethal dose (LD 50 ) was determined at a concentration of 10 − 4.3 dilution in the experimental mice. BALB/c male mice (4–6 weeks old, 14–16 g) were purchased from Shanghai Lingchang Biotechnology Co. (Licence No: 20190002002672), and housed in the Bio-safety Level-2 Antiviral Drug Laboratory. All mice were pre-fed for one day before the start of the experiment. The temperature and humidity of the animal house were maintained at 20–25℃ and 40–70% respectively. All the animal experiments complied with the requirements of the Ethics Committee for Laboratory Animals of the School of Pharmacy, Fudan University (2020-09-SY-LJY-01). 2. Cells Human non-small cell lung cancer cells (A549), Mouse macrophage (Ana-1), and Human Umbilical Vein Endothelial Cells (HUVEC) were cultured in DMEM complete medium at 37℃ in the presence of 5% CO 2 . The cells were seeded onto 96-well cell plates at a concentration of 2×10 5 /mL, and the subsequent experiments were carried out when the cell density reached about 80% fusion. Cell activity was tested using the CCK8 assay. The above cells were purchased from the Cell Bank of the Chinese Academy of Sciences. 3. Preparation of therapeutic drugs Preparation of aqueous decoction of XCD was formulated with reference to our previous work [22; 23] . Weigh 50 g of Gypsum Fibrosum(Lys Pharmaceutical Co., Ltd., 201217), 30 g of Rhei Radix Et Rhizoma(Kangmei Pharmaceutical Co.,Ltd., 210327), 20 g of Armeniacae Semen Amarum(Kangmei Pharmaceutical Co.,Ltd., 211001), 15 g of Trichosanthis Pericarpium(Lys Pharmaceutical Co., Ltd., 210112). 1 L of water was added to the Gypsum Fibrosum, and it was first decocted for 30 min, and the Armeniacae Semen Amarum and Trichosanthis Pericarpium were soaked in 500 mL of water for 30 min, and the Gypsum Fibrosum was decocted for 1 h, and the filtrate was filtered, and the filtrate was then decocted for 1 h in 1 L of water, and Rhei Radix Et Rhizoma was soaked for 40 min in advance, and then added to 500 mL of water, and then the decoction was decocted for 10 min, and then the Gypsum Fibrosum was filtered. Filtration. Concentrate to 115 mL by rotary evaporation, the concentration of raw drug is about 1 g/mL. All conditions of extractions were parallel to complete the decoction of another two decomposed recipes. Preparation of amygdalin solution: 60, 30, 15 mg of amygdalin were weighed and dissolved in 6 mL of 0.5% CMC-Na solution to make 10, 5, 2.5 mg/mL of test solution. Preparation of oseltamivir solution: Weigh 32.4 mg of oseltamivir (Roche, O011098), add 6 mL of 0.5% CMC-Na solution to dissolve, and prepare 5.4 mg/mL of test solution. During the experiments, all drug solutions were stored in a refrigerator at 4℃. 4. Constructing the viral pneumonia mice model and treatment scheme The effect of bitter apricot kernel in XCD on lung injury: Thirty BALB/c male mice were pre-housed for 1 day and randomly divided into 5 groups, i.e. Control, H1N1, XCD, XCD de-bitter apricot kernel, and bitter apricot kernel groups. H1N1 infection was at a concentration of 2×10 − 4 (4 LD 50 ), and 0.2 mL/pc of H1N1 was administered by gavage 2 h after infection at the same time every day, once a day for a total of four days. Mechanistic research program on amygdalin: Thirty-six BALB/c male mice were pre-housed for 1 day and randomly divided into 6 groups, i.e. Control group, H1N1 group, amygdalin 100 mg/kg, amygdalin 50 mg/kg, amygdalin 25 mg/kg, and oseltamivir 54 mg/kg. The concentration of H1N1 infection was 1×10 − 4 (2 LD 50 ), and 0.2 mL/piece was administered by gavage 2 h after infection, at the same time every day, once a day, for four days in total. Blood was obtained from mice using the eyeball blood sampling method and centrifuged at 4000 rpm for 15 min after being left at low temperature for 1h. The mice were then decapitated and executed. The thoracic cavity of the mice was dissected and the entire lung tissue was removed. The upper lobe of the right lung and the remaining section was promptly frozen and preserved for subsequent analyses. The samples obtained above were placed in a refrigerator at -80℃ for storage. 5. SPR-LC-MS/MS approach The lung tissues were removed from the refrigerator and processed for jet lysis. The supernatant was centrifuged for concentration determination (Thermo Fisher BCA Protein Assay Kit). The concentration was adjusted to a final concentration of 200 µg/mL. The label-free photocross-linker sensor chips provided by BetterWays Inc., Guangzhou, China. In order to monitor the enrichment process of the target protein, we performed a real-time surface plasmon resonance experiment using bScreen LB 991 Label-free Microarray System (BERTHOLD TECHNOLOGIES, Germany). MS data were collected by Xcalibur (Thermo Scientific, version 2.2.0), and MS experiments were performed triply for each sample. The MS data were analysed using MaxQuant software (COX LAB, version 1.3.0.5). Peptides were identified by database searching and the MS2 results for selected proteins that changed quantity between sample types were annotated via BLASTP. Differential expression ratios for proteins were obtained using Mascot software (Matrix Science, version 2.4). 6. Molecular docking Crystal structures were obtained from the Protein Data Bank ( http://www.rcsb.org/ ), and molecular docking was performed using the Surflex-Dock Geom (SFXC) docking mode with the SYBYL-X 2.1 programme. The result is the highest value of Total Score. 7. ELISA analysis Lung tissue was homogenized in tissue grinder (Shanghai Jingxin Equipment Co.,Ltd.) a concentration of 100 mg tissue per 1.0 mL PBS. Lung cytokines like VIP and cAMP, were detected using ELISA kits. Measurements were made at 450 nm using a multi-detector ELISA (BioTek). 8. Real-time fluorescence quantitative PCR (RT-qPCR) Total RNA from lung tissue was extracted by Trizol extraction (Takara). The cDNATM Series III first-strand cDNA synthesis premix (5×) (Beyotime, D7182) was used for reverse transcription using BeyoRT kit. The reverse transcription reaction programme was set as follows: ① 37℃, 15 min; ② 85℃, 5 sec; ③ 4℃, 10 sec. The mRNA levels of target genes were quantified relatively by RT-qPCR on a StepOne Plus RT-PCR system (Applied Biosystems). The PCR amplification programme was set as follows: ① pre-denaturation at 95℃ for 5 min; ② denaturation at 95℃ for 15 s; ③ annealing and extension at 60℃ for 1 min, with a total of 40 cycles. Table 1 Sequences of primers used for real-time quantitative PCR. Gene Forward Primer (5`-3`) Revrse Primer (5`-3`) Influenza Virus M AAGACCAATCCTGTCACCTCTGA CAAAGCGTCTACGCTGCAGTC Human-GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG Mouse-IL-6 AGCCTCCGACTTGTGAAGTG CTGATGCTGGTGACAACCAC Mouse-IL-10 GCTCTTACTGACTGGCATGAG CGCAGCTCTAGGAGCATGTG Mouse-AQP5 GCTGGAGAGGCAGCATTGGAT GTCTGAGCTGTGGCAGTCGTT Mouse-PDPN ACAACCACAGGTGCTACTGGAG GTTGCTGAGGTGGACAGTTCCT Mouse-VIPR1 TCTCGGAAGATCCTGTGCCAATC TTGCTTTCTGAGGCGGGTGTAG Mouse-β-actin CATTGCTGACAGGATGCAGAAGG TGCTGGAAGGTGGACAGTGAGG 9. Western blotting analysis Lung tissue was lysed with a protease inhibitor (Beyotime, P1045) in RIPA buffer (Beyotime, P0013B). BCA assay kit (Beyotime, P0010) was used to detect the protein concentration, and the target protein was purified by 10% sodium dodecyl sulphate-polyacrylamide gel electrophoresis. After protein transfer and sealing with QuickBlock™ sealing buffer (Beyotime, P0252), PVDF membranes with protein bands were incubated with specific primary antibodies at 4℃ overnight. The membrane was then washed with TBST and incubated with a second HRP conjugated antibody the next day. Finally, the ECL luminescence kit (Beyotime, P0018s) is used in gel imagers (ProteinSimple, FluorChem) to emit proteins. Finally, the gray value statistics of the obtained bands were performed using Image J data analysis software. 10. Antibodies Anti-α-Tubulin antibody, HRP-Labelled Goat anti-Rabbit IgG (H + L) Antibody, FITC-Goat anti-Rabbit IgG(H + L) and Cy3- Goat anti-Rabbit IgG(H + L) were purchased from Beyotime Biotechnology Co.,Ltd. Anti-Rabbit SFTPA1 antibody, anti-Rabbit AQP5 antibody, anti-Rabbit PKA C-alpha antibody and anti-Rabbit phospho-PKA C-alpha-T197 antibody were purchased from ABclonal Technology Co.,Ltd. Anti-Rabbit VIPR1 antibody was purchased from Proteintech Group, Inc Co.,Ltd. Anti-pro-SPC antibody was purchased from Millipore. Anti-T1α antibody was purchased from Novus Biologicals. 11. Histopathological and immunofluorescence analysis of lungs. Tissue sampling from the lungs of mice on the fourth day after infection, upper lobes of the right lungs were fixed in 4% formaldehyde for 72 hours and 4 µm paraffin-embedded sections were stained with hematoxylin and eosin (H&E). All images were captured using an Olympus SLIDEVIEW VS200 research grade slide scanner. For fluorescence imaging of paraffin-embedded lung sections, slides were incubated in a microwave oven in sodium citrate solution for 10 min for antigen repair, then cooled to room temperature and closed in 10% goat serum. Primary antibodies were incubated overnight at 4℃. Sections were washed in TBST and then incubated with the corresponding secondary antibody for 1 hour at room temperature and sealed with DAPI (Beyotime, P0131). Fluorescent images were observed and captured using an Olympus turntable confocal microscope (Olympus Scientific Solutions, Japan). 12. Statistical methods The experimental data were statistically analysed using Graphpad Prism version 9.0, and quantitative data were expressed as mean ± standard deviation; comparisons of numerical analyses between groups were performed using t-test or one-way (ANOVA). \"ns\" indicates P > 0.05, no significant difference; \"*\" indicates P < 0.05; \"**\" indicates P < 0.01; \" ***\" indicates P < 0.001. Abbreviations XCD, Xuanbai-Chengqi decoction; IAV, influenza A virus; AT2, Alveolar type II cells; SP, Surfactant protein; AQP5, Aquaporin Protein-5; VIPR1, Vasoactive intestinal peptide receptor 1; Tie2, Tyrosine kinase receptor 2; VIP, vasoactive intestinal peptide; ALI, Acute lung injury; PKC, protein kinase C; TCM, Traditional Chinese medicine; ARDS, Acute respiratory distress syndrome; SPR, Surface plasmon resonance; LC-MS, Liquid chromatography-tandem mass spectrometry; ELISA, Enzyme-linked immunosorbent assay; H&E, Hematoxylin-eosin staining; HRP, Horseradish peroxidase; IL-6, Interleukin-6; IL-10, Interleukin-10; IL-1β, Interleukin-1β; LPS, Lipopolysaccharide; cAMP, Cyclic adenosine monophosphate; PKA, Protein kinase A; p-PKA, Phosphor- protein kinase A; COPD, Chronic obstructive pulmonary disease; COVID-19, Coronavirus-19; AC, Adenylyl cyclase. Declarations Acknowledgements Not applicable. Authors contribution Xueyue Song: Formal analysis, Visualization, Writing-original draft. Ting Wang: Methodology, Investigation, Data curation, Formal analysis, Visualization. Miao Ye: Investigation. Xunlong Shi: Methodology, Investigation. Daofeng Chen: Investigation, Resources. Yan Lu: Identification of Chinese medicinal materials, Supervision. Haiyan Zhu: Conceptualization, Funding acquisition, Resources, Project administration, Supervision, Writing -review & editing. Funding This work was supported by National Natural Science Foundation of China (82141219，82030113). Availability of data and materials The article (along with its accompanying files) contained all the data during this study. The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request. Ethics approval and consent to participate This animal experiment was reviewed and approved by the Animal Ethics Committee of School of Pharmacy, Fudan University (NO:2020-09-SY-LJY-01). Consent for publication All authors agreed with the final version and accepted the responsibility to submit for publication. Competing interests All authors declared that there are no potential conflicts of interest that are directly relevant to the content of this article. References Watkins, R. R. Using Precision Medicine for the Diagnosis and Treatment of Viral Pneumonia. Adv Ther, 2022. 39(7), 3061-3071. doi:10.1007/s12325-022-02180-8 Iuliano, A. D., Roguski, K. M., Chang, H. H., Muscatello, D. J., Palekar, R., Tempia, S., . . . Bresee, J. S. Estimates of global seasonal influenza-associated respiratory mortality: a modelling study. Lancet, 2018. 391(10127), 1285-1300. doi:10.1016/s0140-6736(17)33293-2 Jain, S. Epidemiology of Viral Pneumonia. Clin Chest Med, 2017. 38(1), 1-9. doi:10.1016/j.ccm.2016.11.012 Kelesidis, T., Mastoris, I., Metsini, A., & Tsiodras, S. How to approach and treat viral infections in ICU patients. BMC Infect Dis, 2014. 14, 321. doi:10.1186/1471-2334-14-321 Batah, S. S., & Fabro, A. T. Pulmonary pathology of ARDS in COVID-19: A pathological review for clinicians. Respir Med, 2021. 176, 106239. doi:10.1016/j.rmed.2020.106239 Shah, R. D., & Wunderink, R. G. Viral Pneumonia and Acute Respiratory Distress Syndrome. Clin Chest Med, 2017. 38(1), 113-125. doi:10.1016/j.ccm.2016.11.013 Feng, J., Liu, L., He, Y., Wang, M., Zhou, D., & Wang, J. Novel insights into the pathogenesis of virus-induced ARDS: review on the central role of the epithelial-endothelial barrier. Expert Rev Clin Immunol, 2021. 17(9), 991-1001. doi:10.1080/1744666x.2021.1951233 Short, K. R., Kasper, J., van der Aa, S., Andeweg, A. C., Zaaraoui-Boutahar, F., Goeijenbier, M., . . . Kuiken, T. Influenza virus damages the alveolar barrier by disrupting epithelial cell tight junctions. Eur Respir J, 2016. 47(3), 954-966. doi:10.1183/13993003.01282-2015 Gu, Y., Zuo, X., Zhang, S., Ouyang, Z., Jiang, S., Wang, F., & Wang, G. The Mechanism behind Influenza Virus Cytokine Storm. Viruses, 2021. 13(7). doi:10.3390/v13071362 Xu, J., Yu, J., Yang, L., Zhou, F., Li, H., & Cao, B. Influenza Virus in Community-Acquired Pneumonia: Current Understanding and Knowledge Gaps. Semin Respir Crit Care Med, 2020. 41(4), 555-567. doi:10.1055/s-0040-1710584 Latreille, E., & Lee, W. L. Modulation of the Host Response as a Therapeutic Strategy in Severe Lung Infections. Viruses, 2023. 15(7). doi:10.3390/v15071462 Gutbier, B., Jiang, X., Dietert, K., Ehrler, C., Lienau, J., Van Slyke, P., . . . Witzenrath, M. Vasculotide reduces pulmonary hyperpermeability in experimental pneumococcal pneumonia. Crit Care, 2017. 21(1), 274. doi:10.1186/s13054-017-1851-6 Sugiyama, M. G., Armstrong, S. M., Wang, C., Hwang, D., Leong-Poi, H., Advani, A., . . . Lee, W. L. The Tie2-agonist Vasculotide rescues mice from influenza virus infection. Sci Rep, 2015. 5, 11030. doi:10.1038/srep11030 Couvineau, A., & Laburthe, M. VPAC receptors: structure, molecular pharmacology and interaction with accessory proteins. Br J Pharmacol, 2012. 166(1), 42-50. doi:10.1111/j.1476-5381.2011.01676.x Zhong, H. L., Li, P. Z., Li, D., Guan, C. X., & Zhou, Y. The role of vasoactive intestinal peptide in pulmonary diseases. Life Sci, 2023. 332, 122121. doi:10.1016/j.lfs.2023.122121 Sun, G. Y., Yang, H. H., Guan, X. X., Zhong, W. J., Liu, Y. P., Du, M. Y., . . . Guan, C. X. Vasoactive intestinal peptide overexpression mediated by lentivirus attenuates lipopolysaccharide-induced acute lung injury in mice by inhibiting inflammation. Mol Immunol, 2018. 97, 8-15. doi:10.1016/j.molimm.2018.03.002 Li, L., She, H., Yue, S., Feng, D., & Luo, Z. Vasoactive intestinal peptide induces surfactant protein A expression in ATII cells through activation of PKC/c-Fos pathway. Peptides, 2010. 31(11), 2046-2051. doi:10.1016/j.peptides.2010.07.017 Roberti di Sarsina, P. Italy and the Dialogue on Human Health between Traditional Chinese Medicine Culture and Western Medicine. Forsch Komplementmed, 2013. 20(2), 148-150. doi:10.1159/000350770 Huang, K., Zhang, P., Zhang, Z., Youn, J. Y., Wang, C., Zhang, H., & Cai, H. Traditional Chinese Medicine (TCM) in the treatment of COVID-19 and other viral infections: Efficacies and mechanisms. Pharmacol Ther, 2021. 225, 107843. doi:10.1016/j.pharmthera.2021.107843 Jiao, J., Tang, Q., Wang, T. J., Fan, J., Zhang, T. R., Bi, K. S., . . . Liu, R. The therapeutic effect of Xuanbai Chengqi Decoction on chronic obstructive pulmonary disease with excessive heat in the lung and fu-organs based on gut and lung microbiota as well as metabolic profiles. J Chromatogr B Analyt Technol Biomed Life Sci, 2022. 1198, 123250. doi:10.1016/j.jchromb.2022.123250 Mao, Z., & Wang, H. Effects of Xuanbai Chengqi decoction on lung compliance for patients with exogenous pulmonary acute respiratory distress syndrome. Drug Des Devel Ther, 2016. 10, 793-798. doi:10.2147/dddt.S93165 Guo, L., Bao, W., Yang, S., Liu, Y., Lyu, J., Wang, T., . . . Chen, D. Rhei Radix et Rhizoma in Xuanbai-Chengqi decoction strengthens the intestinal barrier function and promotes lung barrier repair in preventing severe viral pneumonia induced by influenza A virus. J Ethnopharmacol, 2024. 319(Pt 2), 117231. doi:10.1016/j.jep.2023.117231 Huo, J., Wang, T., Wei, B., Shi, X., Yang, A., Chen, D., . . . Zhu, H. Integrated network pharmacology and intestinal flora analysis to determine the protective effect of Xuanbai-Chengqi decoction on lung and gut injuries in influenza virus-infected mice. J Ethnopharmacol, 2022. 298, 115649. doi:10.1016/j.jep.2022.115649 Wei, Y., Li, Y., Wang, S., Xiang, Z., Li, X., Wang, Q., . . . Dai, L. Phytochemistry and pharmacology of Armeniacae semen Amarum: A review. J Ethnopharmacol, 2023. 308, 116265. doi:10.1016/j.jep.2023.116265 Bhattacharya, J., & Matthay, M. A. Regulation and repair of the alveolar-capillary barrier in acute lung injury. Annu Rev Physiol, 2013. 75, 593-615. doi:10.1146/annurev-physiol-030212-183756 Budinger, G. R., & Sznajder, J. I. The alveolar-epithelial barrier: a target for potential therapy. Clin Chest Med, 2006. 27(4), 655-669; abstract ix. doi:10.1016/j.ccm.2006.06.007 Fan, L., Feng, S., Wang, T., Ding, X., An, X., Wang, Z., . . . Li, Y. Chemical composition and therapeutic mechanism of Xuanbai Chengqi Decoction in the treatment of COVID-19 by network pharmacology, molecular docking and molecular dynamic analysis. Mol Divers, 2023. 27(1), 81-102. doi:10.1007/s11030-022-10415-7 Figurová, D., Tokárová, K., Greifová, H., Knížatová, N., Kolesárová, A., & Lukáč, N. Inflammation, It's Regulation and Antiphlogistic Effect of the Cyanogenic Glycoside Amygdalin. Molecules, 2021. 26(19). doi:10.3390/molecules26195972 Jaszczak-Wilke, E., Polkowska, Ż., Koprowski, M., Owsianik, K., Mitchell, A. E., & Bałczewski, P. Amygdalin: Toxicity, Anticancer Activity and Analytical Procedures for Its Determination in Plant Seeds. Molecules, 2021. 26(8). doi:10.3390/molecules26082253 Groneberg, D. A., Rabe, K. F., & Fischer, A. Novel concepts of neuropeptide-based drug therapy: vasoactive intestinal polypeptide and its receptors. Eur J Pharmacol, 2006. 533(1-3), 182-194. doi:10.1016/j.ejphar.2005.12.055 Gancedo, J. M. Biological roles of cAMP: variations on a theme in the different kingdoms of life. Biol Rev Camb Philos Soc, 2013. 88(3), 645-668. doi:10.1111/brv.12020 D'Agostino, C., Parisis, D., Chivasso, C., Hajiabbas, M., Soyfoo, M. S., & Delporte, C. Aquaporin-5 Dynamic Regulation. Int J Mol Sci, 2023. 24(3). doi:10.3390/ijms24031889 Parvin, M. N., Kurabuchi, S., Murdiastuti, K., Yao, C., Kosugi-Tanaka, C., Akamatsu, T., . . . Hosoi, K. Subcellular redistribution of AQP5 by vasoactive intestinal polypeptide in the Brunner's gland of the rat duodenum. Am J Physiol Gastrointest Liver Physiol, 2005. 288(6), G1283-1291. doi:10.1152/ajpgi.00030.2004 Liu, X., Li, Y., Shen, H. X., Gao, W. P., Zhao, N., Li, L. J., & Liu, C. Y. Acupuncture promotes tear secretion by up-regulating VIP/cAMP/PKA/AQP5 signaling in guinea pigs with aqueous tear deficiency dry eye. Zhen Ci Yan Jiu, 2023. 48(10), 1025-1032. doi:10.13702/j.1000-0607.20230061 Wang, W. B., Li, J. T., Hui, Y., Shi, J., Wang, X. Y., & Yan, S. G. Combination of pseudoephedrine and emodin ameliorates LPS-induced acute lung injury by regulating macrophage M1/M2 polarization through the VIP/cAMP/PKA pathway. Chin Med, 2022. 17(1), 19. doi:10.1186/s13020-021-00562-8 Guillot, L., Nathan, N., Tabary, O., Thouvenin, G., Le Rouzic, P., Corvol, H., . . . Clement, A. Alveolar epithelial cells: master regulators of lung homeostasis. Int J Biochem Cell Biol, 2013. 45(11), 2568-2573. doi:10.1016/j.biocel.2013.08.009 Additional Declarations No competing interests reported. Supplementary Files Graphicabstract.pdf Supplementarydocuments.docx Cite Share Download PDF Status: Published Journal Publication published 02 Oct, 2025 Read the published version in Chinese Medicine → Version 1 posted Editorial decision: Revision requested 19 Jun, 2025 Reviews received at journal 13 Jun, 2025 Reviews received at journal 11 Jun, 2025 Reviewers agreed at journal 06 Jun, 2025 Reviewers agreed at journal 06 Jun, 2025 Reviewers invited by journal 06 Jun, 2025 Editor assigned by journal 04 Jun, 2025 Submission checks completed at journal 04 Jun, 2025 First submitted to journal 02 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6801211\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":467747628,\"identity\":\"0eef8786-f2fe-4c17-955e-b24d92b5a1dd\",\"order_by\":0,\"name\":\"Xueyue Song\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"School of Pharmaceutical Sciences Fudan University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xueyue\",\"middleName\":\"\",\"lastName\":\"Song\",\"suffix\":\"\"},{\"id\":467747629,\"identity\":\"a9540ea2-15f0-4e6b-8a0b-3a5172c5953e\",\"order_by\":1,\"name\":\"Ting Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Fudan University Pudong Medical Center\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ting\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":467747630,\"identity\":\"c3fe6413-92c0-4bc6-b5f9-3460a897d859\",\"order_by\":2,\"name\":\"Miao Ye\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"School of Pharmaceutical Sciences Fudan University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Miao\",\"middleName\":\"\",\"lastName\":\"Ye\",\"suffix\":\"\"},{\"id\":467747631,\"identity\":\"e6923339-9e20-4566-89e0-b210c9ede05f\",\"order_by\":3,\"name\":\"Xunlong Shi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"School of Pharmaceutical Sciences Fudan University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xunlong\",\"middleName\":\"\",\"lastName\":\"Shi\",\"suffix\":\"\"},{\"id\":467747634,\"identity\":\"e85d2481-a7e8-41fe-94a2-c8ee90aab7b6\",\"order_by\":4,\"name\":\"Daofeng Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"School of Pharmaceutical Sciences Fudan University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Daofeng\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":467747636,\"identity\":\"5383ba0e-fe32-4519-aae8-207416b7839d\",\"order_by\":5,\"name\":\"Yan Lu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"School of Pharmaceutical Sciences Fudan University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yan\",\"middleName\":\"\",\"lastName\":\"Lu\",\"suffix\":\"\"},{\"id\":467747638,\"identity\":\"352cc0c1-e9c2-4d8d-9823-1b48ac36a824\",\"order_by\":6,\"name\":\"Haiyan Zhu\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+ElEQVRIiWNgGAWjYBACAwbGBhCdwMDe+ICBhwHCJlILz2EDYrUwQJVJJBOpxZz9cJvEzx11eQY3H7NJvKm5w8DPnmPA8HMHbi2WPYltkr1n2IoNbiezSc459oxBsueNAWPvGTwOO5DYJsHbxpO44Xb+MWketsMMBjdyDJgZ2/BoOf+wTfJvm0TihpuH2aR5/h1msCeo5UZimzRvm0HihhvMbEAG0BYJgloeNlvLtiUkzjyTzGw5t+8wj8SZZwUHe/E6LP3hzbdtdYl9xw8z3njz7bAcf3vyxgc/8WgBAhYJZB44ag7g1cDAwPyBgIJRMApGwSgY6QAAH0BU+7ejF2MAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"School of Pharmaceutical Sciences Fudan University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Haiyan\",\"middleName\":\"\",\"lastName\":\"Zhu\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-06-02 10:23:32\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6801211/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6801211/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1186/s13020-025-01221-y\",\"type\":\"published\",\"date\":\"2025-10-02T15:57:01+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":84297390,\"identity\":\"7cab1b8c-b72b-4e5f-89ed-31ff8e1ebd4e\",\"added_by\":\"auto\",\"created_at\":\"2025-06-10 09:43:53\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1025383,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eBitter apricot kernel is essential for the treatment of severe pneumonia.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA.\\u003c/strong\\u003e Schematic illustration of the XCD administration scheme design. \\u003cstrong\\u003eB.\\u003c/strong\\u003e Changes in body weight of mice in each group. \\u003cstrong\\u003eC.\\u003c/strong\\u003e Macroscopic appearance of lung tissue on day 4. \\u003cstrong\\u003eD.\\u003c/strong\\u003e The lung index. Lung index = lung weight of mice (mg) / body weight of mice (g). (n=5) \\u003cstrong\\u003eE\\u0026amp;F. \\u003c/strong\\u003eThe\\u003cstrong\\u003e \\u003c/strong\\u003etranscription levels of Influenza M gene and IL-6 in lung tissue were measured by RT-qPCR (n=5). Data were presented as mean ± SD. *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001, as compared to H1N1 group. XCD: Xuanbai-Chengqi decoction; XCD(AI-): Xuanbai-Chengqi decoction with apricot kernel Removed; AI: Apricot kernel.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6801211/v1/9f5af8cb307a2fa5a1ca170a.png\"},{\"id\":84297422,\"identity\":\"45c8d493-2798-4d12-902c-69d29bfbaaf0\",\"added_by\":\"auto\",\"created_at\":\"2025-06-10 09:43:58\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":321331,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eAmygdalin exerts multiple activities including anti-inflammatory, anti-hypoxic and promoting cell migration in vitro.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA.\\u003c/strong\\u003e Chemical structure of amygdalin. \\u003cstrong\\u003eB.\\u003c/strong\\u003e Effect of amygdalin on the cell viability of HUVECs was measured by CCK-8. \\u003cstrong\\u003eC. \\u003c/strong\\u003eEffect of amygdalin on NO in the supernatant of ANA-1 cells after LPS stimulation. NO secretion of ANA-1 was measured by Nitric Oxide Assay Kit. \\u003cstrong\\u003eD.\\u003c/strong\\u003e Effect of amygdalin on the cell viability of HUVECs subjected to hypoxia for 18h. \\u003cstrong\\u003eE.\\u003c/strong\\u003e Effect of amygdalin on influenza virus replication in A549 cells. \\u003cstrong\\u003eF\\u0026amp;G.\\u003c/strong\\u003e The percentage wound closure between amygdalin and control group. Data were presented as mean ± SD. **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001, as compared to control group (0 μM). LPS: Lipopolysaccharide.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6801211/v1/8fb6395c02f8df23a0e6ed42.png\"},{\"id\":84297394,\"identity\":\"6b58f0f6-2104-42c5-95a1-da99ddb8bc0d\",\"added_by\":\"auto\",\"created_at\":\"2025-06-10 09:43:53\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":4965545,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eAmygdalin ameliorates lung injury in mice caused by influenza virus infection.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA.\\u003c/strong\\u003e The amygdalin administration scheme design. \\u003cstrong\\u003eB. \\u003c/strong\\u003ePercentage of body weight gain in each group of mice. \\u003cstrong\\u003eC.\\u003c/strong\\u003e Macroscopic appearance of lung tissue on day 4. \\u003cstrong\\u003eD. \\u003c/strong\\u003eRepresentative pathological images of the lungs on day 4 after H1N1 infection, the scale bars are 500 μM or 50 μM. \\u003cstrong\\u003eE.\\u003c/strong\\u003e The lung index (n=5). \\u003cstrong\\u003eF,G,H\\u003c/strong\\u003e The transcription levels of influenza virus M gene,IL-6 and IL-10 in lung homogenates were measured by RT-qPCR (n=5). Data were presented as mean ± SD. *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001, as compared to H1N1 group. L-6: Interleukin-6; IL-10: Interleukin-10; IL-1β: Interleukin-1β.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6801211/v1/0354040f793326f2d72bb58b.png\"},{\"id\":84297397,\"identity\":\"ad9db24c-a16b-489a-a019-61de5994ed6e\",\"added_by\":\"auto\",\"created_at\":\"2025-06-10 09:43:53\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":6700160,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eAmygdalin protects the alveolar epithelial barrier in influenza virus-infected mice.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA.\\u003c/strong\\u003e Immunofluorescence staining of alveolar epithelial cells, AT1 cells were marked with T1α and AT2 cells were marked with proSPC, the scale bars are 50 μM. \\u003cstrong\\u003eB.\\u003c/strong\\u003eAT2 cells per 20× field were counted by using Image J(n=3). \\u003cstrong\\u003eC,G.\\u003c/strong\\u003eThe transcription levels of PDPN and AQP5 in lung tissue were measured by RT-qPCR (n=5). \\u003cstrong\\u003eD,F.\\u003c/strong\\u003e Immunofluorescence staining of the SPA and AQP5 in lung tissue, the scale bars are 50 μM. \\u003cstrong\\u003eE.\\u003c/strong\\u003e The protein expression levels of SPA in lung tissue were measured by western blot. Data were presented as mean ± SD. *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001, as compared to H1N1 group. PDPN: Podoplanin; proSPC: Prosurfactant Protein C ; SPA: Surfactant protein A; AQP5: Aquaporin Protein-5.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6801211/v1/3ff9c68054effd584533cd87.png\"},{\"id\":84297406,\"identity\":\"bbe394b0-c80a-4be4-b43a-8c9fa9b525df\",\"added_by\":\"auto\",\"created_at\":\"2025-06-10 09:43:54\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1848856,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eAmygdalin exerts VIP-like effects by binding lung VIPR1.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA.\\u003c/strong\\u003e MS score heatmap of captured target proteins. \\u003cstrong\\u003eB.\\u003c/strong\\u003eRelative quantity heatmap of captured target proteins. \\u003cstrong\\u003eC.\\u003c/strong\\u003e Molecular docking of amygdalin and VIPR1 protein. \\u003cstrong\\u003eD.\\u003c/strong\\u003e Anti-inflammatory effiency of amygdalin was neutralized by VIPR1 antagonist. The transcription levels of IL-6 in ANA-1 cells were measured by RT-qPCR after 24 h incubation with amygdalin and VIPR1 antagonist (n=4). Data were presented as mean ± SD. *P \\u0026lt; 0.05, ***P \\u0026lt; 0.001, as compared to LPS group. VIPR1: Vasoactive intestinal peptide receptor 1; LPS: Lipopolysaccharide; VIPRA: Vasoactive intestinal peptide receptor antagonist.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6801211/v1/4f5f8176fc38735b9652bc15.png\"},{\"id\":84297391,\"identity\":\"2a44853f-6ed4-409b-a1af-267d912f37ec\",\"added_by\":\"auto\",\"created_at\":\"2025-06-10 09:43:53\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":519586,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eAmygdalin protects the alveolar epithelial barrier via the VIPR1/cAMP/PKA/p-PKA signaling pathway.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA.\\u003c/strong\\u003e The transcription levels of VIPR1 in lung tissue were measured by RT-qPCR (n=5).\\u003cstrong\\u003e B\\u0026amp;C. \\u003c/strong\\u003eThe\\u003cstrong\\u003e \\u003c/strong\\u003eprotein expression levels of VIPR1 in lung tissue were measured by western blot. \\u003cstrong\\u003eD\\u0026amp;E. \\u003c/strong\\u003eThe levels of VIP and cAMP in lung tissue were measured by ELISA (n=5). \\u003cstrong\\u003eF. \\u003c/strong\\u003eThe protein expression levels of PKA(\\u003cstrong\\u003eG\\u003c/strong\\u003e) and p-PKA(\\u003cstrong\\u003eH\\u003c/strong\\u003e) in lung tissue were measured by western blot. Data were presented as mean ± SD. *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, as compared to H1N1 group. VIPR1: Vasoactive intestinal peptide receptor 1; VIP: vasoactive intestinal peptide; cAMP: Cyclic adenosine monophosphate; PKA: Protein kinase A; p-PKA: Phosphor- protein kinase A.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6801211/v1/1f3a86476d9b13192f946f42.png\"},{\"id\":92883756,\"identity\":\"c6af1c8f-0012-4621-869f-549de58a0320\",\"added_by\":\"auto\",\"created_at\":\"2025-10-06 16:09:00\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":14877624,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6801211/v1/3d1ce2a5-6463-4073-94cd-3f2ed9dd1f2f.pdf\"},{\"id\":84297392,\"identity\":\"ff3b4dff-dc9a-4987-af9b-30956e782fc5\",\"added_by\":\"auto\",\"created_at\":\"2025-06-10 09:43:53\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":555012,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Graphicabstract.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6801211/v1/f39048248af13fd7dbc842fc.pdf\"},{\"id\":84297393,\"identity\":\"43cf3996-8770-443c-a552-08c771c6434c\",\"added_by\":\"auto\",\"created_at\":\"2025-06-10 09:43:53\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":10767,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supplementarydocuments.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6801211/v1/6238fa419d562ece234cc8a7.docx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Amygdalin regulated vasoactive intestinal peptide receptor to protect alveolar epithelial barrier against lung injury induced by influenza A virus\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eThe annual incidence of viral pneumonia is on the rise, with a high mortality rate in severe cases, posing a serious threat to human health. Influenza A viruses are common pathogens of severe pneumonia\\u003csup\\u003e[1]\\u003c/sup\\u003e. It is estimated that globally, 4\\u0026ndash;9 out of every 100,000 people die from influenza each year\\u003csup\\u003e[2]\\u003c/sup\\u003e. Currently, treatment for severe viral pneumonia mainly involves anti-infection measures, organ support and immunomodulation but the efficacy is limited\\u003csup\\u003e[3; 4]\\u003c/sup\\u003e. The alveolar epithelial cells and capillary endothelial cells form the air-blood barrier in the lung as its functional unit. Dysfunction of this barrier accelerates the pathological progression of severe viral pneumonia, highlighting an urgent need for developing new drugs targeting for air-blood barrier\\u003csup\\u003e[5]\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eWhen viral infections cause damage to alveolar epithelial cells and trigger an amplified inflammatory response of the innate immune cascade, excessive inflammation disrupts the air-blood barrier, leading to increased vascular permeability, the spread of toxins and inflammatory mediators throughout the body, and progression to sepsis and multiple organ injuries\\u003csup\\u003e[6; 7]\\u003c/sup\\u003e. Influenza A virus replication directly disrupts tight junctions between alveolar epithelial cells, inhibits Na\\u003csup\\u003e+\\u003c/sup\\u003e ion channels on the cell surface, reduces the clearance rate of alveolar fluid, and causes the accumulation of inflammatory exudate and necrotic material in the alveolar cavity, affecting blood oxygen exchange\\u003csup\\u003e[8]\\u003c/sup\\u003e. Moreover, pro-inflammatory cytokines secreted by epithelial cells, neutrophils, and macrophages further damage the integrity of the alveolar epithelium-capillary endothelium barrier\\u003csup\\u003e[9]\\u003c/sup\\u003e. Furthermore, the influenza virus induces a strong oxidative stress response that generates a substantial amount of reactive oxygen species damaging the barrier system which leads to pulmonary edema\\u003csup\\u003e[10]\\u003c/sup\\u003e. These pathological factors, including viral replication, inflammatory mediators, hypoxia-induced effects as well as barrier disruption are significant contributors to severe respiratory failure observed in patients. Modulating the host immune response, enhancing pulmonary immune tolerance, protecting the integrity of the air-blood barrier, and promoting the repair and regeneration have become potential strategies for treating severe lung infections\\u003csup\\u003e[11]\\u003c/sup\\u003e. For example, Vasculotide, a novel peptide acting as an agonist of the tyrosine kinase receptor 2 (Tie2), has been demonstrated to enhance pulmonary endothelial barrier function in a mouse model of severe influenza-induced acute lung injury, thereby improving survival rates, and reducing lung permeability and injury without affecting the pulmonary immune response in a pneumococcal pneumonia mouse model\\u003csup\\u003e[12; 13]\\u003c/sup\\u003e. This suggests that barrier repair is indeed a viable strategy, but the mechanisms underlying epithelial and endothelial repair still require further investigation.\\u003c/p\\u003e \\u003cp\\u003eNeuroendocrine involvement in the differentiation, proliferation, and repair of alveolar epithelial cells, which is a neglected aspect. VIPR1 belongs to the G-protein-coupled receptors B1 subfamily, and its endogenous ligand VIP are abundant neurotransmitter in lungs and other organs\\u003csup\\u003e[14]\\u003c/sup\\u003e. After the combination of VIP and VIPR1, it exerts a variety of biological effects, such as bronchodilation, vasodilation, anti-inflammation, and immunomodulation, which play an important role in the pathophysiology of pulmonary hypertension, COPD, asthma, pulmonary fibrosis and other lung diseases\\u003csup\\u003e[15]\\u003c/sup\\u003e. Lentivirus-mediated overexpression of VIP significantly reduces inflammatory cell infiltration, maintains alveolar structure integrity, and effectively mitigates LPS-induced acute lung injury (ALI) \\u003csup\\u003e[16]\\u003c/sup\\u003e. VIP also increases the expression of SP-A in alveolar AT2 cells, mainly by the activating protein kinase C (PKC), which in turn activates the c-Fos protein, which is a necessary factor for VIP-induced SP-A expression in AT2 cells\\u003csup\\u003e[17]\\u003c/sup\\u003e. However, the role of VIP in protecting the alveolar epithelial barrier during influenza virus infection remains underexplored.\\u003c/p\\u003e \\u003cp\\u003eBitter apricot kernel and sweet apricot kernel, collectively known as apricot kernel kernel, are commonly used ingredients in Chinese soups and baking. They are included in the list of \\u003cem\\u003eFood \\u0026amp; Medicine Homology\\u003c/em\\u003e issued by the Ministry of Health, and are widely applied. Bitter apricot kernel contains amygdalin, fatty oil, emulsin, β-glucosidase, prunase, estrone, and other components. Amygdalin is a common cyanogenic glycoside and the active component of traditional Chinese medicine-bitter apricot kernel. It has been shown to possess pharmacological effects such as antitussive, expectorant, antiasthmatic, and anti-inflammatory properties. Due to the risk of hydrogen cyanide poisoning from excessive consumption, bitter apricot kernel is often combined with other drugs and widely used in the treatment of pulmonary diseases.\\u003c/p\\u003e \\u003cp\\u003eTraditional Chinese medicine (TCM) has been widely used in the treatment of severe acute respiratory syndrome \\u003csup\\u003e[18]\\u003c/sup\\u003e, influenza A(H1N1), and COVID-19\\u003csup\\u003e[19]\\u003c/sup\\u003e. It is not limited by the differences in the structural and mechanistic emerging respiratory viruses. Host protection and immune modulation are characteristics of anti-infective properties of TCM, and its effectiveness in prevention and treatment of severe pneumonia has been confirmed. Xuanbai-Chengqi decoction (XCD), originating from the Qing Dynasty medical book \\\"Wen Bing Tiao Bian,\\\" is clinically used to treat pneumonia, sepsis, chronic obstructive pulmonary disease, and reduce complications and mortality of acute respiratory distress syndrome (ARDS) patients\\u003csup\\u003e[20; 21]\\u003c/sup\\u003e. XCD consists of Gypsum Fibrosum, Rhei Radix Et Rhizoma, Armeniacae Semen Amarum, and Trichosanthis Pericarpium, with over a hundred compounds. Our previous research demonstrated that XCD could protect alveolar epithelial cells after influenza virus infection and improve lung barrier permeability\\u003csup\\u003e[22; 23]\\u003c/sup\\u003e, but the role of bitter apricot kernel in compound formulations is not clearly understood. Amygdalin is the main active ingredient\\u003csup\\u003e[24]\\u003c/sup\\u003e, but its protective effects on the alveolar epithelial barrier and the underlying mechanisms have not been reported.\\u003c/p\\u003e \\u003cp\\u003eTo systematically identify bioactive components capable of protecting the air-blood barrier, our study employed a multi-step screening approach progressing from compound formula analysis to single herb evaluation and finally to active ingredient characterization. We identified amygdalin, a pivotal monomeric compound derived from bitter apricot kernel, with anti-inflammatory, anti-hypoxic, and repair-promoting activities. Further mechanistic investigations revealed its capacity to preserve alveolar epithelial barrier integrity, which was rigorously validated in an IAV-induced murine model. This experimental framework elucidated both the therapeutic potential and underlying molecular pathways of amygdalin in barrier protection.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e1. Bitter apricot kernel in XCD is essential for the treatment of severe pneumonia.\\u003c/p\\u003e \\u003cp\\u003eMale mice were infected with 4LD\\u003csub\\u003e50\\u003c/sub\\u003e H1N1 virus dose and constructed severe viral pneumonia model to evaluate the effects of bitter apricot kernel in XCD against viral pneumonia (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). The results revealed a significant reduction in body weight of IAV-infected mice relative to uninfected controls by day 3 post-infection, but therapeutic administration failed to reverse the progressive weight decline (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB). Lung index, viral replication and IL-6 transcript levels were significantly higher (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001) in the model group compared with the uninfected control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC-F). In contrast, the XCD group demonstrated a statistically significant reduction in the lung index(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05), accompanied by marked improvement in lung injury pathology, suppression of viral replication(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) and a decrease in IL-6 transcript levels(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC-F). Compared with the XCD group, XCD without bitter apricot kernel and bitter apricot kernel did not show significant amelioration of pulmonary edema. However, the bitter apricot kernel group exhibited stronger inhibition of viral replication(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001) whereas the XCD without bitter apricot kernel group showed attenuated antiviral efficacy (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eE). In addition, the XCD group showed the strongest inhibitory effect on inflammation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eF). The above results suggest that although bitter apricot kernel alone does not significantly alleviate lung injury, its contribution to the efficacy of the combination is indispensable. Therefore, it is necessary to identify the pharmacologically active substances in bitter apricot kernel that contribute to the treatment of viral pneumonia and to elucidate their mechanisms of action.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e2. Amygdalin exerts multiple activities including anti-inflammatory, anti-hypoxic and promoting cell migration \\u003cem\\u003ein vitro\\u003c/em\\u003e.\\u003c/p\\u003e \\u003cp\\u003eAmygdalin is an important bioactive compound derived from bitter apricot kernel. Multifactorial in vitro cell injury models were employed to recapitulate the pathological microenvironment of viral pneumonia including viruses, inflammation, hypoxia, and scratching (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA). The maximum non-toxic concentration of amygdalin was determined to be 50 \\u0026micro;M (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). Lipopolysaccharide (LPS) stimulation markedly elevated nitric oxide (NO) levels in macrophage culture supernatants, but 12.5\\u0026ndash;50 \\u0026micro;M amygdalin treatment suppressed NO production (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC). Compared to the hypoxia model group, treatment with amygdalin at 25 \\u0026micro;M markedly increased the viability of HUVECs(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD). Amygdalin did not exhibit significant inhibitory effects on H1N1 viral replication in infected A549 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE). Amygdalin at 50 \\u0026micro;M significantly enhanced wound closure in HUVECs compared to the untreated control group (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eF-G). These findings suggest amygdalin has promising \\u003cem\\u003ein vitro\\u003c/em\\u003e activity against various pathological aspects of viral pneumonia.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e3. Amygdalin ameliorates lung injury in mice caused by influenza virus infection.\\u003c/p\\u003e \\u003cp\\u003eMale mice were infected with 2LD\\u003csub\\u003e50\\u003c/sub\\u003e H1N1 virus dose to study the pharmacological effects of amygdalin \\u003cem\\u003ein vivo\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). The results showed that the weight of mice in the model group was significantly reduced by day 3 post-IAV infection, accompanied with significant lung hemorrhage, edema, and the increased lung index(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001). Histopathological analysis further revealed severe alveolar structural damage, including thickened alveolar walls and inflammatory cell infiltration. Administration of 100 mg/kg amygdalin significantly alleviated these pathological alterations(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB-E). Oseltamivir also exhibited a significant therapeutic effect (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB-E). To clarify whether amygdalin affects the host's innate immunity, the viral load and the mRNA levels of IL-6 and IL-10 in mouse lung tissues were analyzed. Amygdalin significantly inhibited influenza virus replication(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01) and downregulated IL-6 mRNA levels(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05), while upregulating the IL-10 mRNA levels(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eF-H). These results suggest that amygdalin administration at 100 mg/kg significantly inhibit influenza virus replication and the excessive inflammatory response, thereby alleviating the pathological damage. Further, the effects of amygdalin on protecting the pulmonary air-blood barrier will be elucidated.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e4. Amygdalin protects the alveolar epithelial barrier in influenza virus-infected mice.\\u003c/p\\u003e \\u003cp\\u003eViral infection resulted in lung injury, evidenced by damage to alveolar type I epithelial cells (AT1), decreased proliferation and differentiation of AT2, decreased lung surfactant, and changed in lung osmolarity\\u003csup\\u003e[25; 26]\\u003c/sup\\u003e. The AT2 cell numbers in lung tissues of the model group was significantly reduced(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001) compared to controls (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA-B). Treatment with amygdalin significantly restored the number of AT2(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA-B), concurrently upregulating the expression of SPA(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eD-E) and enhancing AQP5 mRNA and protein levels(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eF-G). However, amygdalin exhibited no significant effect on the population of AT1 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA\\u0026amp;C). These results suggest that amygdalin can consolidate the alveolar epithelial barrier by promoting the proliferation of AT2 cells, up-regulating the expression of SPA and AQP5 proteins to maintain fluid balance in the lungs and alleviate pulmonary edema.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e5. Amygdalin exerts VIP-like effects by binding lung VIPR1.\\u003c/p\\u003e \\u003cp\\u003eThe surface plasmon resonance (SPR) and liquid chromatography-tandem mass spectrometry (LC-MS) were used to identify target and mechanism of amygdalin. A total of 121 proteins with scores of over 1000 were identified as potential candidate targets (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA-B). Through a systematic analysis of the functional roles of these proteins reported in prior literature, VIPR1 emerged as a critical focus of our investigation. VIPR1 has received increasing attention for its ability to exert multiple biological effects such as bronchodilation, vasodilation, anti-inflammation, and immunomodulation when bound to its endogenous ligand VIP. Molecular docking showed that amygdalin binds well to VIPR1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC). In vitro, 50 \\u0026micro;M amygdalin significantly inhibited IL-6 transcription in LPS-induced Ana-1 cells(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eD), but the effect was weakened by the VIPR antagonist. These results suggest that VIPR1 may be the target for amygdalin to exert its biological effects.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e6. Amygdalin protects the alveolar epithelial barrier via the VIPR1/cAMP/PKA/p-PKA signaling pathway.\\u003c/p\\u003e \\u003cp\\u003eTo elucidate the regulatory role of amygdalin in VIPR1, both mRNA and protein expression levels of VIPR1 in lung tissues were quantitatively assessed. Notably, administration of 100 mg/kg amygdalin up-regulated VIPR1 levels(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) compared to the model group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA-C), indicating its potential to potentiate endogenous VIP effects through receptor upregulation. While both the model group and amygdalin groups exhibited moderate increases in VIP secretion relative to normal controls, no statistically significant differences were observed, suggesting amygdalin's activity occurs independently of VIP level (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eD).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eBuilding upon previous findings linking amygdalin to AQP5 upregulation via cAMP-dependent pathways downstream of VIPR1 activation. H1N1 infection induced a profound suppression of cAMP levels(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001), but administration of 100 mg/kg amygdalin significantly upregulated it(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eE). To delineate the mechanistic cascade, we further analyzed proteins of the downstream signaling pathway. Consistent with the cAMP results, both PKA and p-PKA protein expression were significantly attenuated in the model group (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01), but significantly increased through administration of 100 mg/kg amygdalin (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eF-I). These results demonstrate that amygdalin up-regulates and binds VIPR1 receptors, activating the cAMP/PKA/p-PKA signaling cascade, ultimately mediating its therapeutic pharmacological effects .\\u003c/p\\u003e\"},{\"header\":\"Discussions\",\"content\":\"\\u003cp\\u003eIn this study, we found that removing bitter apricot kernel from XCD impaired its therapeutic effects of reducing the lung index, alleviating lung hemorrhage and edema, and inhibiting the transcription level of the inflammatory factor IL-6. This confirms that bitter apricot kernel plays a vital role in the development of viral pneumonia, but the link of action is not clear. Amygdalin is one of the key active compounds in bitter apricot kernel. Viral infection, hypoxia, inflammation and endothelial dysfunction are associated with the pathological progression of viral pneumonia, so we evaluated its multiple antiviral, anti-inflammatory, anti-hypoxic and pro-endothelial migration activities \\u003cem\\u003ein vitro\\u003c/em\\u003e, and further evaluate the protective potential of amygdalin against virus infected in mice. Additionally, amygdalin promotes the proliferation of AT2 cells, and the expression of SP-A and AQP5 following H1N1 attack, which contribute to maintaining the integrity and function of the alveolar epithelial barrier. By capturing and validating the target of amygdalin, we determined that amygdalin binds to VIPR1 and activates the downstream cAMP/PKA signaling pathway, thereby protecting the alveolar epithelial barrier.\\u003c/p\\u003e \\u003cp\\u003eXCD containing bitter apricot kernel is an important base formula in TCM for the treatment of COVID-19, showing significant effects in preventing the development of mild or common disease to severe or critical cases\\u003csup\\u003e[27]\\u003c/sup\\u003e. Bitter apricot kernel used as an adjuvant herb in XCD, is often combined with other herbs in different formulas to treat cough, asthma, COPD, and COVID-19. The content of amygdalin in bitter apricot kernel is approximately 2\\u0026ndash;3%, which is the main source of its bitterness. At present, researches on the pharmacological effects of amygdalin mainly focuses on cough relief, asthma relief, anti-inflammatory, anti-tumor, anti-organ fibrosis, and immunomodulatory activities, but its target remains unclear\\u003csup\\u003e[28; 29]\\u003c/sup\\u003e. In our study, we evaluated the activities of amygdalin against excessive inflammatory mediators, hypoxia, and barrier damage in the progression of severe viral pneumonia in cellular models. It showed activity of anti-inflammation, anti-hypoxia, and barrier repair. Further studies in animal models confirmed that amygdalin could alleviate virus-induced lung injury. Among the series of targets captured by SPR combined with LC/MS techniques, VIPR1, which is associated with neuroendocrine regulation, caught our attention. Notably, the competitive binding of VIPR1 receptor antagonists inhibited the binding of amygdalin and significantly reduced the anti-inflammatory activity of amygdalin in vitro, suggesting that binding to VIPR1 may be the key target for amygdalin's efficacy.\\u003c/p\\u003e \\u003cp\\u003eVIP, a neuropeptide abundantly expressed in pulmonary and extrapulmonary tissues, exhibits diverse biological functions including immunomodulation, oxidant/antioxidant homeostasis maintenance, vasodilation, and alveolar integrity preservation\\u003csup\\u003e[15; 30]\\u003c/sup\\u003e. The molecular mechanism of VIP involves its binding to G protein-coupled receptors (GPCRs), which subsequently activates AC and stimulates cAMP production. PKA, as the primary downstream effector of cAMP, is activated through cAMP-mediated dissociation of its regulatory subunits, thereby initiating the cAMP/PKA signaling cascade\\u003csup\\u003e[31]\\u003c/sup\\u003e. Notably, emerging evidence has demonstrated a significant correlation between the expression and subcellular localization of AQP5 protein and this signaling pathway\\u003csup\\u003e[32; 33]\\u003c/sup\\u003e. Experimental studies utilizing both dry eye guinea pig models and LPS-induced acute lung injury rat models have provided compelling evidence that VIP modulates AQP5 expression and macrophage M1/M2 polarization via the cAMP-PKA signaling axis\\u003csup\\u003e[34; 35]\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eOur results showed that amygdalin could up-regulate the expression levels of AQP5 and increase the number of VIPR1 receptors in mouse lung tissue in H1N1-infected mice. Therefore, we speculate that its mechanism of action may involve upregulating the number of VIPR1 receptors, allowing more endogenous VIP to bind and exert a series of biological activities. Further results indicate that even without affecting endogenous VIP levels, amygdalin can still increase cAMP content and PKA and p-PKA protein expression, suggesting that amygdalin can bind to upregulated VIPR1, activate downstream signaling pathways, and exert a similar biological to VIP. Whether the specific mechanism by which amygdalin restores the number of alveolar stem cells (AT2) and upregulates SP-A protein levels is related to the activation of VIPR1 receptor still needs further experimental verification.\\u003c/p\\u003e \\u003cp\\u003eAs a component of the air-blood barrier, alveolar epithelium not only facilitates gas exchange, but also serves as a physical barrier between the alveolar cavity and the underlying mucosa, protecting tissues from the invasion of bacterial, viral, and allergen\\u003csup\\u003e[36]\\u003c/sup\\u003e. In acute lung injury caused by viral infections, the integrity and function of the alveolar epithelial barrier is compromised, which may lead to the progression from hypoxemia to respiratory failure. It is a promising strategy to search for active substances from TCM compound libraries that effectively protect the air-blood barrier. This study confirms that amygdalin has potential in regulating the host immune response, protect alveolar epithelial barrier damage, and enhance post-injury repair, thereby preventing the pathological progression of severe viral pneumonia.\\u003c/p\\u003e \\u003cp\\u003eIn conclusion, this study identifies amygdalin as the principal bioactive constituent of bitter apricot kernel with therapeutic efficacy against viral pneumonia. Our findings demonstrate that amygdalin exerts significant protective effects on lung injury in an IAV-induced murine pneumonia model, primarily through the preservation of alveolar epithelial barrier integrity and function. Furthermore, we have elucidated that amygdalin functions as an exogenous ligand for VIPR1 activation, thereby providing mechanistic insights into its preventive and therapeutic actions against viral pneumonia from the perspective of neuroendocrine regulation. Nevertheless, the precise regulatory mechanisms underlying VIPR1 activation warrant further investigation. Future studies will employ targeted knockdown or inhibition of VIPR1 expression to refine and validate these mechanistic pathways.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cp\\u003e1. Virus and mice\\u003c/p\\u003e \\u003cp\\u003eThe mouse-adapted IAV strain (A/FM/1/47, H1N1) was maintained at the center for anti-inflammation and anti-virus drug screening (School of Pharmacy, Fudan University, Shanghai, China). Virus as propagated in the lungs of mice and preserved at \\u0026minus;\\u0026thinsp;80℃. The median lethal dose (LD\\u003csub\\u003e50\\u003c/sub\\u003e) was determined at a concentration of 10\\u003csup\\u003e\\u0026minus;\\u0026thinsp;4.3\\u003c/sup\\u003e dilution in the experimental mice.\\u003c/p\\u003e \\u003cp\\u003eBALB/c male mice (4\\u0026ndash;6 weeks old, 14\\u0026ndash;16 g) were purchased from Shanghai Lingchang Biotechnology Co. (Licence No: 20190002002672), and housed in the Bio-safety Level-2 Antiviral Drug Laboratory. All mice were pre-fed for one day before the start of the experiment. The temperature and humidity of the animal house were maintained at 20\\u0026ndash;25℃ and 40\\u0026ndash;70% respectively. All the animal experiments complied with the requirements of the Ethics Committee for Laboratory Animals of the School of Pharmacy, Fudan University (2020-09-SY-LJY-01).\\u003c/p\\u003e \\u003cp\\u003e2. Cells\\u003c/p\\u003e \\u003cp\\u003eHuman non-small cell lung cancer cells (A549), Mouse macrophage (Ana-1), and Human Umbilical Vein Endothelial Cells (HUVEC) were cultured in DMEM complete medium at 37℃ in the presence of 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e. The cells were seeded onto 96-well cell plates at a concentration of 2\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e/mL, and the subsequent experiments were carried out when the cell density reached about 80% fusion. Cell activity was tested using the CCK8 assay. The above cells were purchased from the Cell Bank of the Chinese Academy of Sciences.\\u003c/p\\u003e \\u003cp\\u003e3. Preparation of therapeutic drugs\\u003c/p\\u003e \\u003cp\\u003ePreparation of aqueous decoction of XCD was formulated with reference to our previous work\\u003csup\\u003e[22; 23]\\u003c/sup\\u003e. Weigh 50 g of Gypsum Fibrosum(Lys Pharmaceutical Co., Ltd., 201217), 30 g of Rhei Radix Et Rhizoma(Kangmei Pharmaceutical Co.,Ltd., 210327), 20 g of Armeniacae Semen Amarum(Kangmei Pharmaceutical Co.,Ltd., 211001), 15 g of Trichosanthis Pericarpium(Lys Pharmaceutical Co., Ltd., 210112). 1 L of water was added to the Gypsum Fibrosum, and it was first decocted for 30 min, and the Armeniacae Semen Amarum and Trichosanthis Pericarpium were soaked in 500 mL of water for 30 min, and the Gypsum Fibrosum was decocted for 1 h, and the filtrate was filtered, and the filtrate was then decocted for 1 h in 1 L of water, and Rhei Radix Et Rhizoma was soaked for 40 min in advance, and then added to 500 mL of water, and then the decoction was decocted for 10 min, and then the Gypsum Fibrosum was filtered. Filtration. Concentrate to 115 mL by rotary evaporation, the concentration of raw drug is about 1 g/mL.\\u003c/p\\u003e \\u003cp\\u003eAll conditions of extractions were parallel to complete the decoction of another two decomposed recipes.\\u003c/p\\u003e \\u003cp\\u003ePreparation of amygdalin solution: 60, 30, 15 mg of amygdalin were weighed and dissolved in 6 mL of 0.5% CMC-Na solution to make 10, 5, 2.5 mg/mL of test solution.\\u003c/p\\u003e \\u003cp\\u003ePreparation of oseltamivir solution: Weigh 32.4 mg of oseltamivir (Roche, O011098), add 6 mL of 0.5% CMC-Na solution to dissolve, and prepare 5.4 mg/mL of test solution.\\u003c/p\\u003e \\u003cp\\u003eDuring the experiments, all drug solutions were stored in a refrigerator at 4℃.\\u003c/p\\u003e \\u003cp\\u003e4. Constructing the viral pneumonia mice model and treatment scheme\\u003c/p\\u003e \\u003cp\\u003eThe effect of bitter apricot kernel in XCD on lung injury: Thirty BALB/c male mice were pre-housed for 1 day and randomly divided into 5 groups, i.e. Control, H1N1, XCD, XCD de-bitter apricot kernel, and bitter apricot kernel groups. H1N1 infection was at a concentration of 2\\u0026times;10\\u003csup\\u003e\\u0026minus;\\u0026thinsp;4\\u003c/sup\\u003e (4 LD\\u003csub\\u003e50\\u003c/sub\\u003e), and 0.2 mL/pc of H1N1 was administered by gavage 2 h after infection at the same time every day, once a day for a total of four days.\\u003c/p\\u003e \\u003cp\\u003eMechanistic research program on amygdalin: Thirty-six BALB/c male mice were pre-housed for 1 day and randomly divided into 6 groups, i.e. Control group, H1N1 group, amygdalin 100 mg/kg, amygdalin 50 mg/kg, amygdalin 25 mg/kg, and oseltamivir 54 mg/kg. The concentration of H1N1 infection was 1\\u0026times;10\\u003csup\\u003e\\u0026minus;\\u0026thinsp;4\\u003c/sup\\u003e (2 LD\\u003csub\\u003e50\\u003c/sub\\u003e), and 0.2 mL/piece was administered by gavage 2 h after infection, at the same time every day, once a day, for four days in total.\\u003c/p\\u003e \\u003cp\\u003eBlood was obtained from mice using the eyeball blood sampling method and centrifuged at 4000 rpm for 15 min after being left at low temperature for 1h. The mice were then decapitated and executed. The thoracic cavity of the mice was dissected and the entire lung tissue was removed. The upper lobe of the right lung and the remaining section was promptly frozen and preserved for subsequent analyses. The samples obtained above were placed in a refrigerator at -80℃ for storage.\\u003c/p\\u003e \\u003cp\\u003e5. SPR-LC-MS/MS approach\\u003c/p\\u003e \\u003cp\\u003eThe lung tissues were removed from the refrigerator and processed for jet lysis. The supernatant was centrifuged for concentration determination (Thermo Fisher BCA Protein Assay Kit). The concentration was adjusted to a final concentration of 200 \\u0026micro;g/mL. The label-free photocross-linker sensor chips provided by BetterWays Inc., Guangzhou, China. In order to monitor the enrichment process of the target protein, we performed a real-time surface plasmon resonance experiment using bScreen LB 991 Label-free Microarray System (BERTHOLD TECHNOLOGIES, Germany). MS data were collected by Xcalibur (Thermo Scientific, version 2.2.0), and MS experiments were performed triply for each sample. The MS data were analysed using MaxQuant software (COX LAB, version 1.3.0.5). Peptides were identified by database searching and the MS2 results for selected proteins that changed quantity between sample types were annotated via BLASTP. Differential expression ratios for proteins were obtained using Mascot software (Matrix Science, version 2.4).\\u003c/p\\u003e \\u003cp\\u003e6. Molecular docking\\u003c/p\\u003e \\u003cp\\u003eCrystal structures were obtained from the Protein Data Bank (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.rcsb.org/\\u003c/span\\u003e\\u003cspan address=\\\"http://www.rcsb.org/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e), and molecular docking was performed using the Surflex-Dock Geom (SFXC) docking mode with the SYBYL-X 2.1 programme. The result is the highest value of Total Score.\\u003c/p\\u003e \\u003cp\\u003e7. ELISA analysis\\u003c/p\\u003e \\u003cp\\u003eLung tissue was homogenized in tissue grinder (Shanghai Jingxin Equipment Co.,Ltd.) a concentration of 100 mg tissue per 1.0 mL PBS. Lung cytokines like VIP and cAMP, were detected using ELISA kits. Measurements were made at 450 nm using a multi-detector ELISA (BioTek).\\u003c/p\\u003e \\u003cp\\u003e8. Real-time fluorescence quantitative PCR (RT-qPCR)\\u003c/p\\u003e \\u003cp\\u003eTotal RNA from lung tissue was extracted by Trizol extraction (Takara). The cDNATM Series III first-strand cDNA synthesis premix (5\\u0026times;) (Beyotime, D7182) was used for reverse transcription using BeyoRT kit. The reverse transcription reaction programme was set as follows: ① 37℃, 15 min; ② 85℃, 5 sec; ③ 4℃, 10 sec. The mRNA levels of target genes were quantified relatively by RT-qPCR on a StepOne Plus RT-PCR system (Applied Biosystems). The PCR amplification programme was set as follows: ① pre-denaturation at 95℃ for 5 min; ② denaturation at 95℃ for 15 s; ③ annealing and extension at 60℃ for 1 min, with a total of 40 cycles.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eSequences of primers used for real-time quantitative PCR.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGene\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward Primer (5`-3`)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eRevrse Primer (5`-3`)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eInfluenza Virus M\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAAGACCAATCCTGTCACCTCTGA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCAAAGCGTCTACGCTGCAGTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHuman-GAPDH\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGGAGCGAGATCCCTCCAAAAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGGCTGTTGTCATACTTCTCATGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMouse-IL-6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAGCCTCCGACTTGTGAAGTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCTGATGCTGGTGACAACCAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMouse-IL-10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGCTCTTACTGACTGGCATGAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCGCAGCTCTAGGAGCATGTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMouse-AQP5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGCTGGAGAGGCAGCATTGGAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGTCTGAGCTGTGGCAGTCGTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMouse-PDPN\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eACAACCACAGGTGCTACTGGAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGTTGCTGAGGTGGACAGTTCCT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMouse-VIPR1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTCTCGGAAGATCCTGTGCCAATC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTTGCTTTCTGAGGCGGGTGTAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMouse-β-actin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCATTGCTGACAGGATGCAGAAGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTGCTGGAAGGTGGACAGTGAGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e9. Western blotting analysis\\u003c/p\\u003e \\u003cp\\u003eLung tissue was lysed with a protease inhibitor (Beyotime, P1045) in RIPA buffer (Beyotime, P0013B). BCA assay kit (Beyotime, P0010) was used to detect the protein concentration, and the target protein was purified by 10% sodium dodecyl sulphate-polyacrylamide gel electrophoresis. After protein transfer and sealing with QuickBlock\\u0026trade; sealing buffer (Beyotime, P0252), PVDF membranes with protein bands were incubated with specific primary antibodies at 4℃ overnight. The membrane was then washed with TBST and incubated with a second HRP conjugated antibody the next day. Finally, the ECL luminescence kit (Beyotime, P0018s) is used in gel imagers (ProteinSimple, FluorChem) to emit proteins. Finally, the gray value statistics of the obtained bands were performed using Image J data analysis software.\\u003c/p\\u003e \\u003cp\\u003e10. Antibodies\\u003c/p\\u003e \\u003cp\\u003eAnti-α-Tubulin antibody, HRP-Labelled Goat anti-Rabbit IgG (H\\u0026thinsp;+\\u0026thinsp;L) Antibody, FITC-Goat anti-Rabbit IgG(H\\u0026thinsp;+\\u0026thinsp;L) and Cy3- Goat anti-Rabbit IgG(H\\u0026thinsp;+\\u0026thinsp;L) were purchased from Beyotime Biotechnology Co.,Ltd. Anti-Rabbit SFTPA1 antibody, anti-Rabbit AQP5 antibody, anti-Rabbit PKA C-alpha antibody and anti-Rabbit phospho-PKA C-alpha-T197 antibody were purchased from ABclonal Technology Co.,Ltd. Anti-Rabbit VIPR1 antibody was purchased from Proteintech Group, Inc Co.,Ltd. Anti-pro-SPC antibody was purchased from Millipore. Anti-T1α antibody was purchased from Novus Biologicals.\\u003c/p\\u003e \\u003cp\\u003e11. Histopathological and immunofluorescence analysis of lungs.\\u003c/p\\u003e \\u003cp\\u003eTissue sampling from the lungs of mice on the fourth day after infection, upper lobes of the right lungs were fixed in 4% formaldehyde for 72 hours and 4 \\u0026micro;m paraffin-embedded sections were stained with hematoxylin and eosin (H\\u0026amp;E). All images were captured using an Olympus SLIDEVIEW VS200 research grade slide scanner.\\u003c/p\\u003e \\u003cp\\u003eFor fluorescence imaging of paraffin-embedded lung sections, slides were incubated in a microwave oven in sodium citrate solution for 10 min for antigen repair, then cooled to room temperature and closed in 10% goat serum. Primary antibodies were incubated overnight at 4℃. Sections were washed in TBST and then incubated with the corresponding secondary antibody for 1 hour at room temperature and sealed with DAPI (Beyotime, P0131). Fluorescent images were observed and captured using an Olympus turntable confocal microscope (Olympus Scientific Solutions, Japan).\\u003c/p\\u003e \\u003cp\\u003e12. Statistical methods\\u003c/p\\u003e \\u003cp\\u003eThe experimental data were statistically analysed using Graphpad Prism version 9.0, and quantitative data were expressed as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation; comparisons of numerical analyses between groups were performed using t-test or one-way (ANOVA). \\\"ns\\\" indicates \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026gt;\\u0026thinsp;0.05, no significant difference; \\\"*\\\" indicates \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05; \\\"**\\\" indicates \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01; \\\" ***\\\" indicates \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001.\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cp\\u003eXCD, Xuanbai-Chengqi decoction; IAV, influenza A virus; AT2, Alveolar type II cells; SP, Surfactant protein; AQP5, Aquaporin Protein-5; VIPR1, Vasoactive intestinal peptide receptor 1; Tie2, Tyrosine kinase receptor 2; VIP, vasoactive intestinal peptide; ALI, Acute lung injury; PKC, protein kinase C; TCM, Traditional Chinese medicine; ARDS, Acute respiratory distress syndrome; SPR, Surface plasmon resonance; LC-MS, Liquid chromatography-tandem mass spectrometry; ELISA, Enzyme-linked immunosorbent assay; H\\u0026amp;E, Hematoxylin-eosin staining; HRP, Horseradish peroxidase; IL-6, Interleukin-6; IL-10, Interleukin-10; IL-1\\u0026beta;, Interleukin-1\\u0026beta;; LPS, Lipopolysaccharide; cAMP, Cyclic adenosine monophosphate; PKA, Protein kinase A; p-PKA, Phosphor- protein kinase A; COPD, Chronic obstructive pulmonary disease; COVID-19, Coronavirus-19; AC, Adenylyl cyclase.\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors contribution\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eXueyue Song: Formal analysis, Visualization, Writing-original draft. Ting Wang: Methodology, Investigation, Data curation, Formal analysis, Visualization. Miao Ye: Investigation. Xunlong Shi: Methodology, Investigation. Daofeng Chen: Investigation, Resources. Yan Lu: Identification of Chinese medicinal materials, Supervision. Haiyan Zhu: Conceptualization, Funding acquisition, Resources, Project administration, Supervision, Writing -review \\u0026amp; editing.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by National Natural Science Foundation of China (82141219，82030113).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe article (along with its accompanying files) contained all the data during this study. \\u0026nbsp;The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis animal experiment was reviewed and approved by the Animal Ethics Committee of School of Pharmacy, Fudan University (NO:2020-09-SY-LJY-01).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll authors agreed with the final version and accepted the responsibility to submit for publication.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll authors declared that there are no potential conflicts of interest that are directly relevant to the content of this article.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eWatkins, R. R. Using Precision Medicine for the Diagnosis and Treatment of Viral Pneumonia. \\u003cem\\u003eAdv Ther, \\u003c/em\\u003e2022. 39(7), 3061-3071. doi:10.1007/s12325-022-02180-8\\u003c/li\\u003e\\n\\u003cli\\u003eIuliano, A. D., Roguski, K. M., Chang, H. H., Muscatello, D. J., Palekar, R., Tempia, S., . . . Bresee, J. S. Estimates of global seasonal influenza-associated respiratory mortality: a modelling study. \\u003cem\\u003eLancet, \\u003c/em\\u003e2018. 391(10127), 1285-1300. doi:10.1016/s0140-6736(17)33293-2\\u003c/li\\u003e\\n\\u003cli\\u003eJain, S. Epidemiology of Viral Pneumonia. \\u003cem\\u003eClin Chest Med, \\u003c/em\\u003e2017. 38(1), 1-9. doi:10.1016/j.ccm.2016.11.012\\u003c/li\\u003e\\n\\u003cli\\u003eKelesidis, T., Mastoris, I., Metsini, A., \\u0026amp; Tsiodras, S. How to approach and treat viral infections in ICU patients. \\u003cem\\u003eBMC Infect Dis, \\u003c/em\\u003e2014. 14, 321. doi:10.1186/1471-2334-14-321\\u003c/li\\u003e\\n\\u003cli\\u003eBatah, S. S., \\u0026amp; Fabro, A. T. Pulmonary pathology of ARDS in COVID-19: A pathological review for clinicians. \\u003cem\\u003eRespir Med, \\u003c/em\\u003e2021. 176, 106239. doi:10.1016/j.rmed.2020.106239\\u003c/li\\u003e\\n\\u003cli\\u003eShah, R. D., \\u0026amp; Wunderink, R. G. Viral Pneumonia and Acute Respiratory Distress Syndrome. \\u003cem\\u003eClin Chest Med, \\u003c/em\\u003e2017. 38(1), 113-125. doi:10.1016/j.ccm.2016.11.013\\u003c/li\\u003e\\n\\u003cli\\u003eFeng, J., Liu, L., He, Y., Wang, M., Zhou, D., \\u0026amp; Wang, J. Novel insights into the pathogenesis of virus-induced ARDS: review on the central role of the epithelial-endothelial barrier. \\u003cem\\u003eExpert Rev Clin Immunol, \\u003c/em\\u003e2021. 17(9), 991-1001. doi:10.1080/1744666x.2021.1951233\\u003c/li\\u003e\\n\\u003cli\\u003eShort, K. R., Kasper, J., van der Aa, S., Andeweg, A. C., Zaaraoui-Boutahar, F., Goeijenbier, M., . . . Kuiken, T. Influenza virus damages the alveolar barrier by disrupting epithelial cell tight junctions. \\u003cem\\u003eEur Respir J, \\u003c/em\\u003e2016. 47(3), 954-966. doi:10.1183/13993003.01282-2015\\u003c/li\\u003e\\n\\u003cli\\u003eGu, Y., Zuo, X., Zhang, S., Ouyang, Z., Jiang, S., Wang, F., \\u0026amp; Wang, G. The Mechanism behind Influenza Virus Cytokine Storm. \\u003cem\\u003eViruses, \\u003c/em\\u003e2021. 13(7). doi:10.3390/v13071362\\u003c/li\\u003e\\n\\u003cli\\u003eXu, J., Yu, J., Yang, L., Zhou, F., Li, H., \\u0026amp; Cao, B. Influenza Virus in Community-Acquired Pneumonia: Current Understanding and Knowledge Gaps. \\u003cem\\u003eSemin Respir Crit Care Med, \\u003c/em\\u003e2020. 41(4), 555-567. doi:10.1055/s-0040-1710584\\u003c/li\\u003e\\n\\u003cli\\u003eLatreille, E., \\u0026amp; Lee, W. L. Modulation of the Host Response as a Therapeutic Strategy in Severe Lung Infections. \\u003cem\\u003eViruses, \\u003c/em\\u003e2023. 15(7). doi:10.3390/v15071462\\u003c/li\\u003e\\n\\u003cli\\u003eGutbier, B., Jiang, X., Dietert, K., Ehrler, C., Lienau, J., Van Slyke, P., . . . Witzenrath, M. Vasculotide reduces pulmonary hyperpermeability in experimental pneumococcal pneumonia. \\u003cem\\u003eCrit Care, \\u003c/em\\u003e2017. 21(1), 274. doi:10.1186/s13054-017-1851-6\\u003c/li\\u003e\\n\\u003cli\\u003eSugiyama, M. G., Armstrong, S. M., Wang, C., Hwang, D., Leong-Poi, H., Advani, A., . . . Lee, W. L. The Tie2-agonist Vasculotide rescues mice from influenza virus infection. \\u003cem\\u003eSci Rep, \\u003c/em\\u003e2015. 5, 11030. doi:10.1038/srep11030\\u003c/li\\u003e\\n\\u003cli\\u003eCouvineau, A., \\u0026amp; Laburthe, M. VPAC receptors: structure, molecular pharmacology and interaction with accessory proteins. \\u003cem\\u003eBr J Pharmacol, \\u003c/em\\u003e2012. 166(1), 42-50. doi:10.1111/j.1476-5381.2011.01676.x\\u003c/li\\u003e\\n\\u003cli\\u003eZhong, H. L., Li, P. Z., Li, D., Guan, C. X., \\u0026amp; Zhou, Y. The role of vasoactive intestinal peptide in pulmonary diseases. \\u003cem\\u003eLife Sci, \\u003c/em\\u003e2023. 332, 122121. doi:10.1016/j.lfs.2023.122121\\u003c/li\\u003e\\n\\u003cli\\u003eSun, G. Y., Yang, H. H., Guan, X. X., Zhong, W. J., Liu, Y. P., Du, M. Y., . . . Guan, C. X. Vasoactive intestinal peptide overexpression mediated by lentivirus attenuates lipopolysaccharide-induced acute lung injury in mice by inhibiting inflammation. \\u003cem\\u003eMol Immunol, \\u003c/em\\u003e2018. 97, 8-15. doi:10.1016/j.molimm.2018.03.002\\u003c/li\\u003e\\n\\u003cli\\u003eLi, L., She, H., Yue, S., Feng, D., \\u0026amp; Luo, Z. Vasoactive intestinal peptide induces surfactant protein A expression in ATII cells through activation of PKC/c-Fos pathway. \\u003cem\\u003ePeptides, \\u003c/em\\u003e2010. 31(11), 2046-2051. doi:10.1016/j.peptides.2010.07.017\\u003c/li\\u003e\\n\\u003cli\\u003eRoberti di Sarsina, P. Italy and the Dialogue on Human Health between Traditional Chinese Medicine Culture and Western Medicine. \\u003cem\\u003eForsch Komplementmed, \\u003c/em\\u003e2013. 20(2), 148-150. doi:10.1159/000350770\\u003c/li\\u003e\\n\\u003cli\\u003eHuang, K., Zhang, P., Zhang, Z., Youn, J. Y., Wang, C., Zhang, H., \\u0026amp; Cai, H. Traditional Chinese Medicine (TCM) in the treatment of COVID-19 and other viral infections: Efficacies and mechanisms. \\u003cem\\u003ePharmacol Ther, \\u003c/em\\u003e2021. 225, 107843. doi:10.1016/j.pharmthera.2021.107843\\u003c/li\\u003e\\n\\u003cli\\u003eJiao, J., Tang, Q., Wang, T. J., Fan, J., Zhang, T. R., Bi, K. S., . . . Liu, R. The therapeutic effect of Xuanbai Chengqi Decoction on chronic obstructive pulmonary disease with excessive heat in the lung and fu-organs based on gut and lung microbiota as well as metabolic profiles. \\u003cem\\u003eJ Chromatogr B Analyt Technol Biomed Life Sci, \\u003c/em\\u003e2022. 1198, 123250. doi:10.1016/j.jchromb.2022.123250\\u003c/li\\u003e\\n\\u003cli\\u003eMao, Z., \\u0026amp; Wang, H. Effects of Xuanbai Chengqi decoction on lung compliance for patients with exogenous pulmonary acute respiratory distress syndrome. \\u003cem\\u003eDrug Des Devel Ther, \\u003c/em\\u003e2016. 10, 793-798. doi:10.2147/dddt.S93165\\u003c/li\\u003e\\n\\u003cli\\u003eGuo, L., Bao, W., Yang, S., Liu, Y., Lyu, J., Wang, T., . . . Chen, D. Rhei Radix et Rhizoma in Xuanbai-Chengqi decoction strengthens the intestinal barrier function and promotes lung barrier repair in preventing severe viral pneumonia induced by influenza A virus. \\u003cem\\u003eJ Ethnopharmacol, \\u003c/em\\u003e2024. 319(Pt 2), 117231. doi:10.1016/j.jep.2023.117231\\u003c/li\\u003e\\n\\u003cli\\u003eHuo, J., Wang, T., Wei, B., Shi, X., Yang, A., Chen, D., . . . Zhu, H. Integrated network pharmacology and intestinal flora analysis to determine the protective effect of Xuanbai-Chengqi decoction on lung and gut injuries in influenza virus-infected mice. \\u003cem\\u003eJ Ethnopharmacol, \\u003c/em\\u003e2022. 298, 115649. doi:10.1016/j.jep.2022.115649\\u003c/li\\u003e\\n\\u003cli\\u003eWei, Y., Li, Y., Wang, S., Xiang, Z., Li, X., Wang, Q., . . . Dai, L. Phytochemistry and pharmacology of Armeniacae semen Amarum: A review. \\u003cem\\u003eJ Ethnopharmacol, \\u003c/em\\u003e2023. 308, 116265. doi:10.1016/j.jep.2023.116265\\u003c/li\\u003e\\n\\u003cli\\u003eBhattacharya, J., \\u0026amp; Matthay, M. A. Regulation and repair of the alveolar-capillary barrier in acute lung injury. \\u003cem\\u003eAnnu Rev Physiol, \\u003c/em\\u003e2013. 75, 593-615. doi:10.1146/annurev-physiol-030212-183756\\u003c/li\\u003e\\n\\u003cli\\u003eBudinger, G. R., \\u0026amp; Sznajder, J. I. The alveolar-epithelial barrier: a target for potential therapy. \\u003cem\\u003eClin Chest Med, \\u003c/em\\u003e2006. 27(4), 655-669; abstract ix. doi:10.1016/j.ccm.2006.06.007\\u003c/li\\u003e\\n\\u003cli\\u003eFan, L., Feng, S., Wang, T., Ding, X., An, X., Wang, Z., . . . Li, Y. Chemical composition and therapeutic mechanism of Xuanbai Chengqi Decoction in the treatment of COVID-19 by network pharmacology, molecular docking and molecular dynamic analysis. \\u003cem\\u003eMol Divers, \\u003c/em\\u003e2023. 27(1), 81-102. doi:10.1007/s11030-022-10415-7\\u003c/li\\u003e\\n\\u003cli\\u003eFigurov\\u0026aacute;, D., Tok\\u0026aacute;rov\\u0026aacute;, K., Greifov\\u0026aacute;, H., Kn\\u0026iacute;žatov\\u0026aacute;, N., Koles\\u0026aacute;rov\\u0026aacute;, A., \\u0026amp; Luk\\u0026aacute;č, N. Inflammation, It\\u0026apos;s Regulation and Antiphlogistic Effect of the Cyanogenic Glycoside Amygdalin. \\u003cem\\u003eMolecules, \\u003c/em\\u003e2021. 26(19). doi:10.3390/molecules26195972\\u003c/li\\u003e\\n\\u003cli\\u003eJaszczak-Wilke, E., Polkowska, Ż., Koprowski, M., Owsianik, K., Mitchell, A. E., \\u0026amp; Bałczewski, P. Amygdalin: Toxicity, Anticancer Activity and Analytical Procedures for Its Determination in Plant Seeds. \\u003cem\\u003eMolecules, \\u003c/em\\u003e2021. 26(8). doi:10.3390/molecules26082253\\u003c/li\\u003e\\n\\u003cli\\u003eGroneberg, D. A., Rabe, K. F., \\u0026amp; Fischer, A. Novel concepts of neuropeptide-based drug therapy: vasoactive intestinal polypeptide and its receptors. \\u003cem\\u003eEur J Pharmacol, \\u003c/em\\u003e2006. 533(1-3), 182-194. doi:10.1016/j.ejphar.2005.12.055\\u003c/li\\u003e\\n\\u003cli\\u003eGancedo, J. M. Biological roles of cAMP: variations on a theme in the different kingdoms of life. \\u003cem\\u003eBiol Rev Camb Philos Soc, \\u003c/em\\u003e2013. 88(3), 645-668. doi:10.1111/brv.12020\\u003c/li\\u003e\\n\\u003cli\\u003eD\\u0026apos;Agostino, C., Parisis, D., Chivasso, C., Hajiabbas, M., Soyfoo, M. S., \\u0026amp; Delporte, C. Aquaporin-5 Dynamic Regulation. \\u003cem\\u003eInt J Mol Sci, \\u003c/em\\u003e2023. 24(3). doi:10.3390/ijms24031889\\u003c/li\\u003e\\n\\u003cli\\u003eParvin, M. N., Kurabuchi, S., Murdiastuti, K., Yao, C., Kosugi-Tanaka, C., Akamatsu, T., . . . Hosoi, K. Subcellular redistribution of AQP5 by vasoactive intestinal polypeptide in the Brunner\\u0026apos;s gland of the rat duodenum. \\u003cem\\u003eAm J Physiol Gastrointest Liver Physiol, \\u003c/em\\u003e2005. 288(6), G1283-1291. doi:10.1152/ajpgi.00030.2004\\u003c/li\\u003e\\n\\u003cli\\u003eLiu, X., Li, Y., Shen, H. X., Gao, W. P., Zhao, N., Li, L. J., \\u0026amp; Liu, C. Y. Acupuncture promotes tear secretion by up-regulating VIP/cAMP/PKA/AQP5 signaling in guinea pigs with aqueous tear deficiency dry eye. \\u003cem\\u003eZhen Ci Yan Jiu, \\u003c/em\\u003e2023. 48(10), 1025-1032. doi:10.13702/j.1000-0607.20230061\\u003c/li\\u003e\\n\\u003cli\\u003eWang, W. B., Li, J. T., Hui, Y., Shi, J., Wang, X. Y., \\u0026amp; Yan, S. G. Combination of pseudoephedrine and emodin ameliorates LPS-induced acute lung injury by regulating macrophage M1/M2 polarization through the VIP/cAMP/PKA pathway. \\u003cem\\u003eChin Med, \\u003c/em\\u003e2022. 17(1), 19. doi:10.1186/s13020-021-00562-8\\u003c/li\\u003e\\n\\u003cli\\u003eGuillot, L., Nathan, N., Tabary, O., Thouvenin, G., Le Rouzic, P., Corvol, H., . . . Clement, A. Alveolar epithelial cells: master regulators of lung homeostasis. \\u003cem\\u003eInt J Biochem Cell Biol, \\u003c/em\\u003e2013. 45(11), 2568-2573. doi:10.1016/j.biocel.2013.08.009\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"chinese-medicine\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"cmed\",\"sideBox\":\"Learn more about [Chinese Medicine](http://cmjournal.biomedcentral.com)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/cmed/default.aspx\",\"title\":\"Chinese Medicine\",\"twitterHandle\":\"@BioMedCentral\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Viral pneumonia, Amygdalin, Influenza virus, Alveolar epithelial barrier, Vasoactive intestinal peptide receptor\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6801211/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6801211/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e \\u003cp\\u003eBitter apricot kernel is a common traditional Chinese medicine used for lung diseases. Previous studies showed that Xuanbai-Chengqi decoction (XCD) containing bitter apricot kernel protected the alveolar and intestinal barriers in influenza-infected mice. However, the specific contribution of bitter apricot kernel and its active substances in viral pneumonia remain unclear.\\u003c/p\\u003e\\u003ch2\\u003ePurpose\\u003c/h2\\u003e \\u003cp\\u003eThis study aimed to identify the main active ingredient in bitter apricot kernel and investigate its mechanism in protecting the alveolar epithelial barrier in viral pneumonia.\\u003c/p\\u003e\\u003ch2\\u003eMethod\\u003c/h2\\u003e \\u003cp\\u003eBitter apricot kernel was evaluated based on the efficacy differences between XCD and XCD without bitter apricot kernel. Amygdalin was identified through in vitro activity tests and verified in vivo. Immunohistochemistry, RT-qPCR, and WB were used to assess barrier protection and anti-inflammatory effects. The molecular mechanisms were explored using SPR/LC/MS and validated experimentally.\\u003c/p\\u003e\\u003ch2\\u003eResult\\u003c/h2\\u003e \\u003cp\\u003eRemoving bitter apricot kernel significantly weakened XCD's protective effect in influenza A virus-infected mice. Amygdalin showed anti-inflammatory, anti-hypoxia activities, and promoted endothelial cell migration in vitro. Administration of amygdalin at 100 mg/kg effectively mitigated pulmonary injury, suppressed viral replication, and attenuated excessive inflammatory responses in IAV-infected murine models. It protected the alveolar barrier by restoring alveolar type II cells (AT2) and promoting alveolar regeneration, while upregulating surfactant protein A (SP-A) and aquaporin protein-5 (AQP5). Amygdalin bound selectively to vasoactive intestinal peptide receptor 1 (VIPR1) thereby upregulating cyclic adenosine monophosphate (cAMP) levels and the protein expression levels of Protein kinase A (PKA) and Phosphor- protein kinase A (p-PKA).\\u003c/p\\u003e\\u003ch2\\u003eConclusion\\u003c/h2\\u003e \\u003cp\\u003eAmygdalin is the key bioactive component of bitter apricot kernel, which exhibits protective effects in an IAV-induced pneumonia mouse model by activating the cAMP/PKA/p-PKA signaling cascade and recapitulating the biological effects of vasoactive intestinal peptide (VIP).\\u003c/p\\u003e\",\"manuscriptTitle\":\"Amygdalin regulated vasoactive intestinal peptide receptor to protect alveolar epithelial barrier against lung injury induced by influenza A virus\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-06-10 09:43:48\",\"doi\":\"10.21203/rs.3.rs-6801211/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2025-06-19T09:30:58+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-06-13T09:39:21+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-06-12T02:43:57+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"76309724990033144818668810933660026723\",\"date\":\"2025-06-06T22:44:36+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"319724494598253457868612983970276062777\",\"date\":\"2025-06-06T12:29:04+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2025-06-06T10:55:39+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2025-06-04T12:59:13+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2025-06-04T12:58:25+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Chinese Medicine\",\"date\":\"2025-06-02T10:19:15+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"chinese-medicine\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"cmed\",\"sideBox\":\"Learn more about [Chinese Medicine](http://cmjournal.biomedcentral.com)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/cmed/default.aspx\",\"title\":\"Chinese Medicine\",\"twitterHandle\":\"@BioMedCentral\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"2ca635db-e7f4-4a65-8028-b8029a95f58c\",\"owner\":[],\"postedDate\":\"June 10th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-10-06T16:02:07+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-6801211\",\"link\":\"https://doi.org/10.1186/s13020-025-01221-y\",\"journal\":{\"identity\":\"chinese-medicine\",\"isVorOnly\":false,\"title\":\"Chinese Medicine\"},\"publishedOn\":\"2025-10-02 15:57:01\",\"publishedOnDateReadable\":\"October 2nd, 2025\"},\"versionCreatedAt\":\"2025-06-10 09:43:48\",\"video\":\"\",\"vorDoi\":\"10.1186/s13020-025-01221-y\",\"vorDoiUrl\":\"https://doi.org/10.1186/s13020-025-01221-y\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6801211\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6801211\",\"identity\":\"rs-6801211\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}