{"paper_id":"16d67bcb-c6f3-40af-a6fd-ce9af1059ad1","body_text":"Sodium hyaluronate fragments promote the expression of human beta-defensin 2 in the skin to alleviate Staphylococcus aureus infection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Sodium hyaluronate fragments promote the expression of human beta-defensin 2 in the skin to alleviate Staphylococcus aureus infection Yijie Liu, Fan Chen, Yue Wu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8437901/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 10 You are reading this latest preprint version Abstract Background The skin serves as a critical barrier against pathogens and infections, and its microbiome plays a vital role in maintaining immune homeostasis. Human beta-defensin 2 (HBD2) is an antimicrobial peptide essential for skin immunity. While hyaluronic acid (HA) is widely used in pharmaceuticals and cosmetics, its antimicrobial properties against Staphylococcus aureus ( S. aureus ) infection in skin cells remain understudied. This study investigates the role of low molecular weight HA (0.8 kDa) in promoting HBD2 expression and its potential to combat S. aureus infection. Materials and Methods HA was synthesized and tested for its ability to induce HBD2 expression in human keratinocytes and reconstructed epidermal skin equivalents. The antibacterial activity of HA was evaluated using S. aureus infection models, while the underlying signaling pathways were explored through Western blotting and inhibitor studies. Inflammatory cytokines (TNF-α and IL-6) were quantified using ELISA. Results HA (0.8 kDa) significantly upregulated HBD2 expression in keratinocytes and reconstructed skin models through the TLR2/4-MyD88-ERK signaling pathway. HA treatment reduced S. aureus infection and suppressed the secretion of pro-inflammatory cytokines TNF-α and IL-6. In reconstructed epidermal skin equivalents, HA enhanced structural integrity and endogenous antimicrobial activity, further confirming its potential as an anti-inflammatory and antibacterial agent. Conclusion Low molecular weight HA (0.8 kDa) promotes HBD2 expression and exhibits antibacterial and anti-inflammatory effects against S. aureus infection. These findings highlight HA's potential applications in skincare products for enhancing innate immunity and managing skin infections. Health sciences/Diseases Biological sciences/Drug discovery Biological sciences/Immunology Biological sciences/Microbiology antimicrobial peptides hyaluronic acid keratinocytes reconstructed human epidermis Staphylococcus aureus Toll-like receptors Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction The biggest organ in the body, the skin acts as a vital barrier to keep out harmful substances and acts as our main line of protection against infections, poisons, and sunlight [ 1 ]. The skin serves as a sensory interface, protects interior tissues and organs, defines our appearance, and keeps us hydrated in addition to its protective role. Various microorganisms, including bacteria, fungi, protozoa, archaea, and viruses, can be found living on the surface of the skin. Commensal bacteria are essential for bolstering the skin's barrier function, regulating immunological responses, and defending against infections [ 2 ]. The skin has a sophisticated immune system prepared to fight off infections and breaches in its protective layer. Pathogens first come into contact with keratinocytes in diseased areas [ 3 ]. Proinflammatory signals are released when pattern recognition receptors (PRRs) on keratinocytes are activated by pathogen- and damage-associated molecular patterns (DAMPs and PAMPs) [ 4 ]. Although bacteria, fungi, and viruses are among the many pathogens to which humans are constantly exposed, clinical illnesses do not always result from these exposures. This phenomenon is believed to be associated with antimicrobial peptides, essential components of mammalian innate immunity [ 5 ]. Antimicrobial peptides known as alpha and beta-defensins are secreted by phagocytic cells and epithelial cells in a variety of organs [ 6 – 9 ]. TNF-α, interleukin-1β (IL-1β), and other proinflammatory stimuli induce the expression of human beta-defensin 2 (HBD2) in the skin, gastrointestinal tract, respiratory tract, and pancreas [ 10 – 13 ]. Considering skin lesions, the release of beta-defensins by keratinocytes may be especially significant because, in the absence of the stratum corneum, bacteria may be able to penetrate the dermal connective tissue. In this instance, tissue injury may cause the extracellular matrix to degrade [ 14 ]. The extracellular matrix (ECM) contains HA, a glycosaminoglycan that is widely distributed and has a role in the transportation and distribution of plasmatic proteins, the maintenance of the water balance, and the integrity of the matrix structure [ 15 ]. In the cutaneous region, fibroblasts, keratinocytes, and endothelial cells produce HA, which regulates a number of biological activities [ 16 ]. The molecular weight of HA is influenced by the number of repeating disaccharide units and varies from 0.8 kDa to 3000 kDa. It can hold onto water well, therefore, one of HA's most well-known uses is moisturization [ 17 ]. Not only is HA a filler, but it can also influence physiological and pathological processes through binding to proteins, such as matrix proteins and receptors on cell surface (CD44, LYVE1, RHAMM, TLRs, etc.), and include migration of fibroblasts, inflammation, aging, healing of wounds, and invasion of tumors [ 18 ]. It is also commonly recognized that HA speeds up wound healing and lessens the appearance of wrinkles. Aside from these uses, HA-based formulations have demonstrated exceptional effectiveness in the treatment of a variety of inflammatory skin conditions [ 19 – 21 ]. Our investigations revealed other, as-yet-unpublished benefits of HA, including whitening and anti-wrinkling [ 22 ]. Because of its versatility, HA has been the most widely used cosmetic ingredient in recent years. The antibacterial properties of HA, however, have not yet been studied in relation to Staphylococcus aureus infection in keratinocytes and skin equivalents that have been rebuilt from the epidermis. It will be extremely helpful for the development of new products as well as for study of its biological activities. Gram-positive S. aureus bacteria commonly colonizes the epidermis of people with eczema and atopic dermatitis (AD) [ 23 ]. The immune system and the function of the epidermal barrier are known to be impacted by genetic and environmental factors; S. aureus infection is the cause of eczema and AD [ 24 ]. Among the virulence factors that S. aureus produces and causes skin infections are leukocidins, iron-regulated surface proteins, phenol-soluble modulins, cell wall-anchored (CWA) proteins like clumping factor A, clumping factor B, SasX, and protein A [ 25 – 26 ]. The current work examined the potential induction mechanism of HBD2 and the antimicrobial efficacy of HA against S. aureus infection in keratinocytes and skin equivalents that had been rebuilt from the epidermis. Here, we discovered a novel low molecular weight HA (0.8 kDa) that greatly increased HBD2 expression in keratinocytes and reconstructed epidermis skin equivalents through the TLRs-MyD88-ERK pathway. HA, a linear, negatively charged, water-soluble, non-sulfated macromolecular polysaccharide, consists of repeating disaccharide units of N-acetyl-glucosamine β-(1–4) and glucuronic acid β-(1–3) as shown in Fig. 2 A. HA-induced synthesis of functional HBD2 inhibits S. aureus growth and decreases TNF-α and IL6 secretion post infection, improving the response to inflammation. 2. Results 2.1. Hyaluronic Acid–Mediated Human Beta-Defensin 2 Production in Keratinocytes Skin immunity is significantly influenced by HBD2, an antimicrobial peptide that leukocytes and epithelial cells release as a result of infection and inflammation [ 30 ]. In this investigation, we looked at whether HA causes keratinocytes to produce HBD2. For our trials, we selected six distinct HA with varying molecular weights, of which HA1 produced the greatest effect. HBD2 mRNA levels rose dose-dependently upon stimulation of keratinocytes with HA1 (0.8 kDa), reaching a peak at 0.1% of HA1 (Fig. 1 ). To find the best HA induction impact for upcoming in-depth research, screening was done. Although the other HA was investigated in this work as well, we decided not to include it in subsequent trials because treatment with HA1 did not lead to any change. 2.2. Evaluation of Function of HA (0.8 kDa) During In Vitro Keratinocytes and Epidermal Skin Equivalents Culture After the above experiments, we performed further functional analyses of HA at 0.8 kDa, selecting a non-toxic dose of 0.0025% to 1% (Fig. 2 B). HBD2 expression in keratinocytes was detected by immunofluorescence staining, showing a concentration-dependent pattern and agreed with mRNA levels (Fig. 2 C, D). To further investigate whether the antimicrobial peptides produced were functional, treated cell lysates were accumulated for S. aureus antimicrobial assay. The cells treated with HA were able to produce functional HBD2, significantly inhibiting S. aureus growth (Fig. 2 E). Due to the limitations of keratinocytes, we chose to act on the reconstructed epidermal skin equivalents with 0.1% HA for subsequent assessment of the role of HA. Interestingly, the treated epidermal skin equivalents were structurally compact, with enhanced thickness (Fig. 2 F) and significantly increased HBD2 expression (Fig. 2 G). The HA-treated tissue lysate was collected to determine antimicrobial activity, and the 0.1% HA-treated epidermal skin equivalents could endogenously inhibit the growth of S. aureus (Fig. 2 H). Thus, with in vitro culture, the HBD2 production rate and antimicrobial potential of HA (0.8 kDa) treatment was increased. 2.3. Hyaluronic Acid (0.8 kDa) Enhances HBD2 Production through Toll-Like Receptor-MyD88-ERK Signaling Activation in Keratinocytes As novel agonists and modulators against microbial infection, TLRs identify PAMPs expressed on the microbial surfaces [ 30 ]. To understand the reason why HA can induce HBD2 expression during in vitro culture, we collected mRNAs from treated keratinocytes for analysis. We examined any potential participation of TLR in the HA-mediated signaling pathway. HBD2 expression was tested in the presence of TLR2/TLR4 inhibitors, and the results impeded significant down-regulation of HBD2 expression upon the addition of both inhibitors, and stronger inhibition of the TLR2 effect (Fig. 3 A- 3 B). An essential function of the cytosolic adaptor protein MyD88 is to facilitate both innate and adaptive immune responses [ 31 ]. TLR2/4 was activated in conjunction with the HA (0.8 kDa) activity. The addition of MyD88 inhibitors dramatically inhibited HBD2 expression (Fig. 3 C). The TLR-mediated signaling pathway involves the activation of mitogen-activated protein kinase (MAPK) and ERK [ 32 ]. We examined whether TLR is involved in the HA-mediated signaling pathway. The phosphorylation of ERK was induced in keratinocytes after 1 h of stimulation with 0.1% HA. There were no notable changes observed in other kinases, such as p38, JNK, and NF-κB p65 (Fig. 4 a-n). Following HA stimulation, the ERK pathway-activated STAT3 also increased (Fig. 4 a, 4 c, 4 f). These findings imply that HA enhances signaling induction, which raises the synthesis of HBD2. Finally, our results show that HA activates ERK via TLR2-MyD88-mediated upregulation of HBD2 expression. 2.4. Hyaluronic Acid (0.8kDa) Alleviate S. aureus Infection and Reduces the Secretion of Interleukin-6 and Tumor Necrosis Factor-α Reconstructed epidermal skin equivalents are commonly employed for evaluating skincare or in vitro medicine efficacy due to their similar structure to human skin and resemblance to the in vivo environment. We created a S. aureus infection model of the skin to evaluate the efficacy of HA (0.8 kDa). Immunofluorescence experiments on 0.1% HA-treated skin showed a more compact and continuous epidermal structure (Fig. 5 A), with considerably higher expression of HBD2 (Fig. 5 B). IL6 and TNF-α secretion was quantified by ELISA. The S. aureus stimulated group revealed significantly upregulated IL6 and TNF-α secretion (Fig. 5 C-D); in contrast, the 0.1% HA treatment group exhibited down-regulated secretion of IL6 and TNF-α. 3. Discussion The skin, as the human body's outermost tissue, fights the infiltration of external diseases while also serving as immunological armor. Some pathogenic bacteria can lead to skin infections and inflammation. HBD2 is a defense peptide required for skin immunological defense and plays a role in immune regulation. HA is a glycosaminoglycan polymer found in the extracellular matrix of almost all mammals [ 30 ]. According to recent research, short, fragmented HA polymers interact with innate molecular pattern recognition receptors such as TLR2 and TLR4, inducing innate defense responses in immune cells, endothelial cells, and the epidermis [ 30 ]. The role of fragmented HA in stimulating HBD2 expression and reacting to S. aureus infection remains largely unknown despite these advancements. Numerous pattern recognition receptors act as sentinels of the innate defense response, protecting the integrity of the epithelial barrier against a variety of microbial challenges. In our study, a series of HA fragments were acquired to investigate their unique role in \"immune defense\" activity in vitro . Several methods for assessing hyaluronan function have been examined in current and related research. The connection between HA size and receptor specificity has also been studied [ 33 , 34 ]. These studies will potentially help us understand the molecular basis of the activation and silencing of pathways linked with HA and its breakdown products in vivo . Concurrently, we tried to understand the biological significance of individual pieces by investigating several biomarkers throughout the HBD2-induced expression process. We found that HA (0.8 kDa) boosted the expression of HBD2 in keratinocytes (Fig. 1 ), potentially inhibiting S. aureus infection. Indeed, across the six HA fragment sizes, HBD2 expression was considerably elevated in HA-pretreated cells (0.8 kDa). Relative to the control, the HA (0.8 kDa) treatment had greater CFU values, but it could not prevent S. aureus growth, although HA (0.8 kDa)-treated cell lysates could, with a substantial decline in CFU values (Fig. 2 E). We reconstructed epidermal skin equivalents to assess the influence of HA (0.8 kDa) on skin structure in depth. The addition of HA (0.8 kDa) raised epidermal thickness considerably (Fig. 2 F). Consistent with the cellular results, HBD2 expression was significantly increased in the epidermal equivalent post the addition of HA pretreatment compared to the control (Fig. 2 G), and HA (0.8 kDa)-treated tissue homogenate lysate inhibited S. aureus growth with a remarkable decline in the CFU value compared to the control (Fig. 2 H). Increasing HBD2 in HA (0.8 kDa) mitigated S. aureus infection. S. aureus infections in the skin can induce or exacerbate skin illnesses like AD [ 35 ]. AD symptoms worsen as S. aureus colonizes in the skin increases. S. aureus toxins, such as enterotoxins A and B, as well as toxic shock syndrome toxin-1, increase AD symptoms [ 36 ]. Consequently, avoiding S. aureus infections may aid in decreasing AD symptoms. To investigate the effect of HA on S. aureus infection, we developed a bacterial infection epidermal equivalents. The thickness of the epidermal equivalent was remarkably restored after the addition of HA, which also enhanced the aggregation of HBD2 in the stratum corneum (Fig. 5 B) and decreased inflammatory factors IL6 and TNF-α secretions (Fig. 5 C). The findings mentioned above indicate that HA (0.8 kDa) has some anti-inflammatory properties. TLRs recognize PAMP on pathogen surfaces and participating in numerous intracellular signaling pathways that regulate innate and adaptive immunity [ 37 ]. HA can function as a TLR agonist with immunomodulatory effects. HA fragments prepared using different approaches exhibit some discrepancies. CD44, HARE, LYVE, RHAMM, and TLR are examples of common HA receptors, with TLR being involved in microbial response as well as host defense [ 38 ]. We limited the range to two common TLR receptors, TLR2 and TLR4, for subsequent mechanistic research. In this research, HA (0.8 kDa) promoted HBD2 expression largely via the TLR2/4 and MyD88-mediated signaling pathways, implying that it may activate TLR4. Although the addition of a TLR2 inhibitor reduced HBD2 levels, it was less effective than its levels in the TLR4 inhibitor-treated group (Fig. 3 ). In general, HA of low molecular weight predominantly activates TLR4 and its contact initiates an inflammatory cascade, such as a complex of signals such as MyD88, IRAK, TRAF-6, and nuclear factor-κB [ 39 , 40 ]. However, our investigation into the mechanism of HA (0.8 kDa) revealed that HA administration led to increased amount of cellular phosphorylation and that HBD2 production and associated effects may be mediated via the ERK signaling pathway (Fig. 4 ). Therefore, HA can be applied as a cosmetic ingredient, such as in AD and acne, to inhibit secondary infections of lesions. 4. Materials and Methods 4.1. Experimental materials All sodium hyaluronates; molecular weight is 0.8 kDa to 40 kDa were commercially obtained from Bloomage Biotechnology Co., Ltd. (Table 1 ). The human epidermal keratinocytes were procured from the American Type Culture Collection. Table 1 Information about the test hyaluronic acid sample Acronyms Item Molecular Weight(Da) HA1 Hybloom™ Minture 800 HA2 Hybloom™ NANO HA 7521 HA3 Hybloom™Oligo Hyaluronic Acid 7294 HA4 microHA™ Super Active Hyaluronic Acid 2682 HA5 Hybloom™ Hydrolyzed Hyaluronic Acid 40000 HA6 Hybloom™ Hyaluronic Acid 1000 1 All products provided by Bloomage Biotechnology Co., Ltd. 4.2. Reagents The reagents used were as follows: phosphate buffer saline (PBS), Eplife Medium, human keratinocyte growth supplement (HKGS) was obtained through Gibco (Gibco Life Technologies, USA). Potato dextrose agar (PDA) medium, bicinchoninic acid (BCA) solution, dimethyl sulfoxide (DMSO), 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide (MTT), antifade mounting media (VECTASHIELD, H1200, USA), fluorescein isothiocyanate (FITC)-conjugated secondary antibody glucose, peptone procured from Sigma-Aldrich (St.Louis, USA). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was procured from Santa-Curz Biotechnology (Santa Cruz, USA). TRIzol reagent (Invitrogen, Carlsbad, CA, USA). ERK inhibitor PD98059, TLR2 inhibitor C29, myeloid differentiation primary response protein 88 (MyD88) inhibitor T6167923 obtained through Selleck (Selleck, USA). Anti-HBD2 antibody (ab9871), anti-β-actin antibody (ab6276), goat anti-rabbit IgG H&L (HRP) (ab6721), goat anti-mouse IgG H&L (ab6789), horseradish peroxidase-conjugated rabbit anti-goat IgG H&L (ab6741) from Abcam (Abcam, Cambridge, UK); anti-ERK antibody (4695), anti-p-ERK (Thr202/Tyr204) antibody (4370), anti-p38 antibody (8690), anti-p-p38 (Thr180/Tyr182) antibody (4511), anti-Jun N-terminal kinase (anti-JNK) antibody (9252), anti-p-JNK (Thr183/Tyr185) antibody (9251), anti-p65 antibody (8242), anti-p-p65 antibody (3033) obtained from CST (Cell Signaling Technology, Boston, USA); ECL reagent (Thermo Fisher Scientific, Pittsburgh, USA). 4.3. Cell Culture Keratinocytes were cultured in a 5% CO 2 humid environment at 37℃ in EpiLife medium supplemented with calcium, employing cells from passages two to three. Prior to experimentation, the cells were acclimatized for 24 h in a supplement-free medium (without HKGS). 4.4. Quantitative reverse transcription polymerase chain reaction After plating in a 6-well plate, keratinocytes (2×10 5 cells/well) were cultivated for a full day. After that, the cells given a PBS-wash and left in a medium devoid of supplements for 24 h. This medium may contain either a vehicle or six different forms of HA at varying concentrations (Table 1 ). Following this therapy, TRIzol reagent was used to extract total RNA samples from the cells, and a microspectrophotometer (Merinton Instrument, SMA4000, CHN) was used to quantify the samples. Next, in accordance with the manufacturer's recommendations, an equivalent volume of each RNA sample was used to prepare cDNA (complementary DNA) employing Maxima Reverse Transcriptase (Thermo Scientific, USA). Employing a CFX Real-Time System (Bio-Rad, USA), quantitative PCR was performed in 20 µL final volume, comprising 10 µL of Universal SYBR Green Supermix (Bio-Rad, USA), 0.6 µM per primer, and 50 ng of template cDNA. The reference gene used to normalize gene expression was GAPDH. The following primers were employed (Table 2 ): Table 2 Primers (and their sequences) used for rt-PCR Primer target Sequence Forward Sequence Reverse HBD2 TTTGGTGGTATAGGCGATCC GAGGGAGCCCTTTCTGAATC GAPDH GATTCCACCCATGGCAAATTC CTGGAAGATGGTGATGGGATT 4.5. Cell Viability Assessment Using MTT reduction tests, cell viability was evaluated in accordance with Hansen and Nielsen’s protocol [ 27 ]. After being sown at 2×10 4 cells/well into a 96-well plate, keratinocytes were left to attach for the entire night. The cells were then treated with HA (0.8 kDa) at concentrations ranging from 0.0025% to 2% for a minimum of 24 h while they were incubated. DMSO was used to dissolve the purple formazan that resulted after removing the culture supernatants. Absorbance values were measured at 550 nm employing a microplate spectrophotometer, MULTISKAN-Sky (Thermo Fisher Scientific, USA), absorbance values were measured at 550 nm. Calculations of cell viability were made with respect to the absorbance of the negative control group. 4.6. Cellular Immunohistochemical Analysis The method of cell immunofluorescence was utilized to quantify the amount of HBD2. After reaching a density of 70%–80%, keratinocytes were digested and seeded into a 24-well plate. Afterwards, HA (0.8 kDa) was added singly at a concentration of 0.001%–0.1% (wt%). Keratinocytes were fixed for 15 min with cold methyl alcohol following a 48-h incubation period. The supernatant was removed and keratinocytes underwent a saline (phosphate-buffered saline) wash. A blocking solution of 5% bovine serum albumin (BSA) was added, and the mixture was kept at room temperature (RT) for an hour. Subsequently, the blocking solution-diluted anti-HBD2 antibody was added, and the mixture was incubated at 4℃ for the whole night. After being washed with PBS the next day, keratinocytes were incubated with the secondary antibody for 90 min at RT. The keratinocytes were coated with DAPI-containing mounting media. Images were captured using a fluorescence microscope. 4.7. Detection and Determination of Protein Concentration In T25 cell culture flasks, keratinocytes (1×10 6 cells/well) were added and cultured for a duration of 24 h. Every medium was eliminated and the medium devoid of supplements was added. After that, the cells were cultivated for 30 min with either a vehicle or 0.01% or 0.1% of HA (0.8 kDa). Subsequently, the cells were isolated and lysed utilizing a protein extraction solution for radio immunoprecipitation assay (RIPA, Thermo Fisher, USA). Proteins in the lysates were separated by SDS-PAGE and transferred onto a Whatman nitrocellulose membrane (Dassel, Germany) following centrifugation at 13,000×g at 4°C. After 2 h of incubation in tris-buffer saline containing 0.05% Tween 20 and 5% BSA, the membranes were left to overnight at 4°C to be treated with primary antibodies. Next, an ECL reagent was used to identify the secondary antibody that had been coupled with horseradish peroxidase after it had reacted for 2 h at RT. Using ImageJ, the discovered band was densitometrically estimated. 4.8. Generation of epidermal skin equivalents As previously mentioned [ 28 , 29 ], epidermal skin models were created. In summary, 24 well plates were seeded with 2×10 5 keratinocytes from a secondary culture using Epilife media on a filter insert (diameter 6.5 mm; Costar; Corning). Three days post-seeding, the keratinocytes were exposed to air after the apical medium was aspirated, with only the filter insert remaining in contact with the medium. During the liquid cultivation stage, a 0.1% (wt%) HA (0.8 kDa) solution was added to the culture media until the air-liquid culture was finished. The media was replaced with keratinocyte medium devoid of penicillin and streptomycin prior to the introduction of bacteria. Seven-day air-exposed cultures were used for the experimentation. 4.9. Bacterial inoculum preparation The ATCC25923 strain of S. aureus was employed. Long-term preservation of the bacteria was achieved at -80°C in nutritional broth containing 20% (v/v) glycerol. On blood agar plates, inocula from frozen cultures were cultivated over night at 37℃ (BioMérieux). The bacterium was grown for 2.5 h at 37℃ in Luria-Bertani (LB) medium (10 g bactotryptone, 5 g of yeast extract, and 5 g of sodium chloride in 1 L distilled water) under vigorous shaking. Standard vital counts were used to confirm that the concentration of this suspension, which was determined by measuring its absorbance at 600 nm, was approximately 3×10 5 CFU/mL in PBS (pH 7.4). 4.10. Infection of epidermal skin equivalents by the bacterium Skin equivalents were incubated along with 50 µL of the bacterial suspension at 37 ℃ in CO 2 (7.3%). Vehicle and 0.1% HA (0.8 kDa) were used separately before adding the bacterial stimulus. The supernatant post-stimulation was collected after 24 h. To examine the endogenous antimicrobial capacity, two skin equivalents made into a homogenious mixture in PBS employing a glass Potter-Elvehjem tissue homogenizer, and the homogenate proteins were then extracted. 4.11. Enzyme-linked immunosorbent assay (ELISA) The supernatant was collected after 48 h of incubation and centrifuged for 5 min at 1000 rpm. The TNF-α ELISA Kit (Lianke) was then used to measure the amount of TNF-α in the supernatant in accordance with the protocol. The RIPA buffer (Solarbio) was used to extract all proteins from the cells. Quantification of the total protein content was done using a ThermoFisher Scientific BCA kit. The total protein content served as a reference for the quantity of TNF-α and IL6 secreted by each group. An unpaired t-test was utilized to assess all the data, and a statistical difference was defined as p < 0.05. 4.12. Histology and immunohistochemical analysis Following the air-liquid cultivation, 4% paraformaldehyde (PFA) was used to fix the skin equivalents. Gradient ethanol was used to dehydrate the material, and paraffin embedding was the next step. After sectioning the material into 5 µm slices, the pieces were arranged on glass slides. After the tissue slices were deparaffinized with methylcyclohexane and rehydrated with ethanol that was graded in decreasing strength, hematoxylin and eosin (H&E) staining was performed. Under a microscope, photography and observation were carried out. Skin equivalents were coated with O.C.T, sliced into 5 µm thick pieces, and then mounted onto glass slides for immuno-histochemical assessment. For 0.25 h, the parts were glued with cold methyl alcohol. The BSA (5%) and the blocking solution was added and incubated at RT for 1 h. Subsequently, the blocking solution-diluted anti-HBD2 antibody was added individually, and it was incubated at 4 ℃ for the entire night. The slices were then coated with a mounting solution with DAPI after PBS-wash the next day, and treated for 1.5 h at RT with the conjugated secondary antibody. A fluorescence microscope was employed for imaging. 4.13. Antimicrobial Assay Keratinocytes were seeded on a 6-well plate, and HA (0.8 kDa; pre-treated for 24 h). Then, antibiotic-free media were added to the original medium, and the mixture was kept humid and at 5% CO 2 in an incubator. Following a 24-h incubation period, the cells underwent three DPBS washes before being lysed using RIPA-lysed cell centrifugation. The supernatant was then collected to evaluate the inhibitory effect on S. aureus. The test group for the antimicrobial assay was created by completely combining the lysis sample and bacterial inoculum in a 10:1 ratio. The bacterial suspension was used as a negative control in place of the sample solution in the mixture, which was sterilized PBS. For 3 h, the test group and the negative control were incubated concurrently. Each group's mixture was put out separately on a dish. Following a 37°C overnight incubation period, the CFU was estimated. 4.14. Statistical analysis The Student's t-test was applied to acquire the p-values. Statistical significance was deemed at p < 0.05, with p-values denoted as: **p < 0.01, *p < 0.05. The values are calculated from a minimum of three replicates and expressed as mean ± SD. 5. Conclusions To conclude, this research indicates that novel HA with a low molecular weight of 0.8 kDa can simultaneously stimulate HBD2 production through the TLRs-MyD88-ERK pathway (Fig. 6 ) concurrently suppressing S. aureus -induced secretion of cytokines IL6 and TNF-α that cause HA inflammation. This strong improvement in bacterial infection and structural strength via many mechanisms has the potential to improve inherent skin immunity. This work provides new pathways to investigate the biological activities of HA and creates the theoretical foundation for the development of novel immunological and micro-ecological skincare products, even if more in-depth mechanism research is necessary. Declarations Author Contributions: Conceptualization, Y.J.L. and Y.W.; methodology,Y.J.L., Y.W. and F.C.; investigation,Y.J.L.; resources, Y.W.; writing—original draft preparation, Y.J.L.; writing—review and editing, Y.J.L. and Y.W.; visualization, Y.J.L., Y.W. and F.C.; supervision, Y.W. and F.C.; project administration, Y.J.L; funding acquisition, Y.J.L. and Y.W. All authors have read and agreed to the published version of the manuscript. Funding: These studies were a sponsored research collaboration with Bloomage Biotechnology Corporation Limited, which provided research support for the hyaluronic acid samples. Institutional Review Board Statement: Not applicable. No human or animal subjects were use. Informed Consent Statement: Not applicable. Data Availability Statement: The study's supporting data are not publicly available because they contain information that might compromise Bloomage Biotechnology Co., Ltd.'s privacy. However, the corresponding author can provide the data upon request. Acknowledgments: The authors are appreciative of Bloomage Biotechnology Co., Ltd.'s financial support. We thank the American Type Culture Collection for providing the cell lines and bacterial strain. Conflicts of Interest: The authors declare no conflicts of interest. The funders had no role in the design of the study, in the collection, analysis, or interpretation of data, or in the writing of the manuscript. The submission and publication of the manuscript were authorized by Bloomage Biotechnology Co., Ltd. References Harris-Tryon, Tamia, A. E. A. & Grice Microbiota and maintenance of skin barrier function [J]. Science 376 , 940–945 (2022). Gaofeng & Wang Zhen Lin,Yue Li. Colonizing microbiota is associated with clinical outcomes in diabetic wound healing [J]. Adv. Drug Deliv. Rev. 194 , 114727 (2023). Hannigan, G. D. et al. The human skin double-stranded DNA virome: Topographical and temporal diversity, genetic enrichment, and dynamic associations with the host microbiome [J]. mBio 6 (5), e01578–e01515 (2015). Oh, J. et al. NISC Comparative Sequencing Program, Temporal stability of the human skin microbiome [J]. Cell 165 (4), 854–866 (2016). Corrales-Garcia, L. L., Serrano-Carreon, L. & Corzo, G. Improving the heterologous expression of human beta-defensin 2 (HBD2) using an experimental design [J]. Protein Expr Purif. 167 , 105539 (2020). Di Cagno, R. F. et al. Synthesis of γ-aminobutyric acid (GABA) by Lactobacillus plantarum DSM19463: functional grape must beverage and dermatological applications [J]. Appl. Microbiol. Biotechnol. 86 (2), 731–741 (2009). Jia, L. et al. Porphyromonas gingivalis and Lactobacillus rhamnosus GG regulate the Th17/Treg balance in colitis via TLR4 and TLR2 [J]. Clin. Transl Immunol. 9 (11), e1213 (2020). Ludwig, I. S. et al. Lactobacillus rhamnosus GG -Derived Soluble Mediators Modulate Adaptive Immune Cells [J]. Front. Immunol. 9 , 1546 (2018). Natividad, B. et al. Human Milk Oligosaccharides and Lactose Differentially Affect Infant Gut Microbiota and Intestinal Barrier In Vitro [J]. Nutrients , 14 (12). (2022). Strandwitz, P. et al. GABA-modulating bacteria of the human gut microbiota [J]. Nat. Microbiol. 4 (3), 396–403 (2018). Uberoi, A. et al. Commensal microbiota regulates skin barrier function and repair via signaling through the aryl hydrocarbon receptor [J]. Cell. Host Microbe 2021 , 29 (8): 1235–1248 e1238. Weinberg, A. et al. Quantification of Human β-Defensin-2 and – 3 in Body Fluids: Application for Studies of Innate Immunity [J]. Clin. Chem. 53 (4), 757–765 (2007). Xiong, W-B. et al. Dehydroandrographolide enhances innate immunity of intestinal tract through up-regulation the expression of hBD-2 [J]. DARU J. Pharm. Sci. , 23 (1). (2015). Donnarumma, G. et al. Malassezia furfur induces the expression of defensin-2 in human keratinocytes in a protein kinase C-dependent manner [J]. Arch. Dermatol. Res. 295 , 474–481 (2004). Jiang, D. J. et al. Regulation of lung injury and repair by Toll-like receptors and hyaluronan [J]. Nat. Med. 11 , 1173–1179 (2005). Keen, M. A. Hyaluronic Acid in Dermatology [J]. Skinmed 15 (6), 441–448 (2017). Witting, M. et al. Interactions of hyaluronic Acid with the skin and implications for the dermal delivery of biomacromolecules [J]. Mol. Pharm. 12 (5), 1391–1401 (2015). Šínová, R. et al. A key player or just a bystander in skin photoaging [J]. Exp. Dermatol. 31 (4), 442–458 (2022). Hong, L. et al. Hyaluronic acid (HA)-based hydrogels for full-thickness wound repairing and skin regeneration [J]. J. Mater. Sci. Mater. Med. 29 (9), 150 (2018). Litwiniuk, M., Krejner, A. & Speyrer, M. S. Hyaluronic acid in inflammation and tissue regeneration [J]. Wounds 28 (3), 78–88 (2016). Chen, L. H., Xue, J. F. & Zheng, Z. Y. Hyaluronic acid, an efficient biomacromolecule for treatment of inflammatory skin and joint diseases: a review of recent developments and critical appraisal of preclinical and clinical investigations [J]. Int. J. Biol. Macromol. 116 , 572–584 (2018). Chen, F., Guo, X. & Wu, Y. Skin antiaging effects of a multiple mechanisms hyaluronan complex [J]. Skin. Res. Technol. 29 (6), e13350 (2023). Gong, J. Q. et al. Skin colonization by Staphylococcus aureus in patients with eczema and atopic dermatitis and relevant combined topical therapy: A double-blind multicentre randomized controlled trial [J]. Br. J. Dermatol. 155 , 680–687 (2006). Sajić, D., Asiniwasis, R. & Skotnicki-Grant, S. A look at epidermal barrier function in atopic dermatitis: Physiologic lipid replacement and the role of ceramides [J]. Skin. Therapy Lett. 17 , 6–9 (2021). Lacey, K. A., Geoghegan, J. A. & McLoughlin, R. M. The role of Staphylococcus aureus virulence factors in skin infection and their potential as vaccine antigens [J]. Pathogens 5 (1), 22 (2016). Linz, M. S., Mattappallil, A. & Parker, D. Clinical Impact of Staphylococcus aureus Skin and Soft Tissue Infections. Antibiotics (Basel) [J]. 12 (3): 557. (2023). Hansen, M. B., Nielsen, S. E. & Berg, K. Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill [J]. J. Immunol. Methods . 119 (2), 203–210 (1989). El Ghalbzouri, A., Siamari, R., Willemze, R. & Ponec, M. Leiden reconstructed human epidermal model as a tool for the evaluation of the skin corrosion and irritation potential according to the ECVAM guidelines [J]. Toxicol. Vitro 22 , 1311–1320 (2008). Thakoersing, V. S. et al. Unraveling barrier properties of three different in-house human skin equivalents [J]. Tissue Eng. Part. C Methods . 18 (1), 1–11 (2012). Scharf, S. et al. Induction of human β-defensin-2 in pulmonary epithelial cells by Legionella pneumophila: involvement of TLR2 and TLR5, p38 MAPK, JNK, NF-κB, and AP-1 [J]. Am. J. Physiology-Lung Cell. Mol. Physiol. 298 (5), L687–L695 (2010). Uberoi, A. et al. Commensal microbiota regulates skin barrier function and repair via signaling through the aryl hydrocarbon receptor [J]. Cell. Host Microbe 2021 , 29 (8): 1235–1248 e1238. Seo, H-S. et al. Adiponectin Attenuates the Inflammation in Atopic Dermatitis-Like Reconstructed Human Epidermis [J]. Ann. Dermatol. , 31 (2). (2019). Valachová, K., Hassan, M. E., Šoltés, L. & Hyaluronan Sources, Structure, Features and Applications [J]. Molecules (Basel Switzerland) . 29 (3), 739 (2024). Lierova, A. et al. Hyaluronic Acid: Known for Almost a Century, but Still in Vogue [J]. Pharmaceutics 14 (4), 838 (2022). Clowry, J. et al. Distinct T cell signatures are associated with Staphylococcus aureus skin infection in pediatric atopic dermatitis[J]. JCI Insight . 9 (9), e178789 (2024). Gimenez-Rivera, V. A. et al. NOD2 Agonism Counter-Regulates Human Type 2 T Cell Functions in Peripheral Blood Mononuclear Cell Cultures: Implications for Atopic Dermatitis[J]. Biomolecules 13 (2), 369 (2023). Resko, Z. J., Anderson, C. M. & Federle, M. J. A Staphylococcal Glucosaminidase Drives Inflammatory Responses by Processing Peptidoglycan Chains to Physiological Lengths[J]. Infect. Immun. 91 (2), e0050022 (2023). Weigel, P. H. Planning, evaluating and vetting receptor signaling studies to assess hyaluronan size-dependence and specificity[J]. Glycobiology 27 (9), 796–799 (2017). Melrose, J. Hyaluronan hydrates and compartmentalises the CNS/PNS extracellular matrix and provides niche environments conducive to the optimisation of neuronal activity[J]. J. Neurochem . 166 (4), 637–653 (2023). Xu, C. et al. Hyaluronan ameliorates LPS-induced acute lung injury in mice via Toll-like receptor (TLR) 4-dependent signaling pathways[J]. Int. Immunopharmacol. 28 (2), 1050–1058 (2015). Additional Declarations No competing interests reported. Supplementary Files SupplementaryInformation.pdf Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 12 May, 2026 Reviews received at journal 08 May, 2026 Reviewers agreed at journal 28 Apr, 2026 Reviews received at journal 03 Mar, 2026 Reviewers agreed at journal 09 Feb, 2026 Reviewers invited by journal 09 Feb, 2026 Editor assigned by journal 09 Feb, 2026 Editor invited by journal 07 Jan, 2026 Submission checks completed at journal 05 Jan, 2026 First submitted to journal 05 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-8437901\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":588624150,\"identity\":\"c01f5077-bccc-4e00-ba13-c73758aa3212\",\"order_by\":0,\"name\":\"Yijie Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Bloomage Biotechnology Corporation Limited\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yijie\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":588624161,\"identity\":\"1f81e557-c22e-4591-906d-10d8cac37887\",\"order_by\":1,\"name\":\"Fan Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Bloomage Biotechnology Corporation Limited\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Fan\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":588624169,\"identity\":\"3fa8fcba-f528-452a-96ea-653779ff4ea5\",\"order_by\":2,\"name\":\"Yue Wu\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0ElEQVRIiWNgGAWjYPACG34GhgQQg5loLWmSDaRqOUyCFoMbyQeYedvOSxgcT372gKHCOrGB/ewBAlrSEoBabksYnHlmbsBwJj2xgScvgYCWHAPm3LbbdQY3EswkGNsOJzZI8BgQ0JL/AajlnITBjfRvEoz/iNKSwwDUcgCoJQdoSwMRWiTPPDNg/nMuWULyzJsyiYRj6cZtPDn4tfAdT37AOKPMToLvePo2iQ811rL97Gfwa1E4wMD+A85LAGI2vOqBQL6BkIpRMApGwSgYBQB/9kT7ql849QAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"Bloomage Biotechnology Corporation Limited\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Yue\",\"middleName\":\"\",\"lastName\":\"Wu\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-12-24 01:53:39\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-8437901/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-8437901/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":102450466,\"identity\":\"89a26640-f66f-4ff8-b707-7c2cdd4e984f\",\"added_by\":\"auto\",\"created_at\":\"2026-02-11 18:47:23\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":71401,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHyaluronic acid (HA)–mediated human beta-defensin 2 (HBD2) production in keratinocytes. The recommended dosage of HA was used to activate keratinocytes for a full day. Real-time PCR was used to determine the amounts of HBD2 mRNA following the extraction of total RNA and cDNA synthesis. Six kinds of HA were assessed with distinct HBD2 induction effects. * P \\u0026lt; 0.05; ** P \\u0026lt; 0.01; *** P \\u0026lt; 0.001 relative to those of untreated cells.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage13.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8437901/v1/4d17e5631c763820e6c30d57.png\"},{\"id\":102450467,\"identity\":\"6bc25d67-5a1d-40d1-81f4-73717e2939c1\",\"added_by\":\"auto\",\"created_at\":\"2026-02-11 18:47:23\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":828701,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEvaluation of the function of HA (0.8 kDa) during in vitro keratinocyte and epidermal skin equivalent cultures. (A) The structures of sodium hyaluronate (MW: 0.8 kDa). (B) Using the MTT reagent, cell viability was assessed 24 h after keratinocytes were stimulated with the prescribed amount of HA. (C) Immuno-fluorescent staining of HBD2 keratinocytes using DAPI (blue) and HBD2 (green) antibodies. (D) The recommended dosage of HA was used to activate keratinocytes for a full day. Real-time PCR was used to determine the amounts of HBD2 mRNA following total RNA extraction and cDNA synthesis. (E) Following the spreading of cell lysates, keratinocytes were stimulated with HA for a duration of 24 h, and the CFU was estimated. Antimicrobial activity of HA-treated cell lysate against S. aureus for 24 h. (F) Hematoxylin and eosin staining in equivalents of rebuilt epidermal skin. Skin epidermal equivalents treated with 0.1% HA showed increased epidermal thickness and tightness of basal keratinocytes. (G) Using DAPI (blue) and HBD2 (green) antibodies, an immunohistochemical approach is used to analyze the changes in HBD2 expression in skin equivalents (ES). (H) Skin equivalents were stimulated with HA for 24 h, and the CFU was enumerated after the spreading of tissue lysates. Antimicrobial effect was assessed tissue lysate treated with HA for 24 h against S. aureus.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8437901/v1/12bd91f591c5f1964f91ee8c.png\"},{\"id\":102450469,\"identity\":\"6a9351fd-4018-4341-a676-83d3bdfb9b95\",\"added_by\":\"auto\",\"created_at\":\"2026-02-11 18:47:23\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":45558,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHyaluronic acid (0.8 kDa) increases human beta-defensin 2 (HBD2) production through the TLR-MyD88 pathway in keratinocytes. Relative HBD2 mRNA expression upon the addition of (A) 0.1% HA and a TLR2 inhibitor (10 µM), (B) 0.1% HA and a TLR4 inhibitor (10 µM), and (C) 0.1% HA and a MyD88 inhibitor (10 µM). The expression level was normalized to the GAPDH gene. * P \\u0026lt; 0.05; ** P \\u0026lt; 0.01; *** P \\u0026lt; 0.001 as compared to untreated cells.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8437901/v1/3e653b2ebd55488f3cd8df4f.png\"},{\"id\":102746010,\"identity\":\"80a92297-0b13-4627-beeb-0b0928f93a68\",\"added_by\":\"auto\",\"created_at\":\"2026-02-16 08:55:10\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":337795,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHyalunoric acid (0.8 kDa) stimulates extracellular signal-regulated kinase (ERK) signaling in keratinocytes to enhance HBD2 synthesis. (A) The levels of ERK, p-ERK, P38, p-p38, p-STAT3, STAT3, p-EGF, EGF, JNK, p-JNK, P65, p-p65, and HBD2 proteins in each group were detected by Western blot. Methods for details of uploaded antibodies. Representative blots are shown and were cropped for clarity; spacing indicates blots derived from different gels run under identical conditions. Full-length blots are provided in the Supplementary Information. (B-N) Quantitative results. * P \\u0026lt; 0.05; ** P \\u0026lt; 0.01; *** P \\u0026lt; 0.001 relative to cells that were not treated.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8437901/v1/59eb7db28190277a58b80fc0.png\"},{\"id\":102450470,\"identity\":\"7b790db1-b7ba-4751-b311-e51d12e87f0c\",\"added_by\":\"auto\",\"created_at\":\"2026-02-11 18:47:23\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":659687,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHyaluronic acid (HA) (0.8 kDa) alleviates \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e infection and reduces the secretion of interleukin-6 (IL6) and tumor necrosis factor-α (TNF-α). (A) Staining with H\\u0026amp;E in equivalents of rebuilt epidermal skin. After the air-liquid phase, 50 µL of bacterial inoculum was added to insert to stimulate for 24 h for the\\u003cem\\u003e S. aureus\\u003c/em\\u003e stimulation group; the experimental group was incubated for 24 h in advance with 0.1% HA and then stimulated with \\u003cem\\u003eS. aureus\\u003c/em\\u003e for 24 h. (B) Immunohistochemical analysis of HBD2 expression variations in skin equivalents (ES) using DAPI (blue) and HBD2 (green) antibodies. Increased HBD2 was observed in \\u003cem\\u003eS. aureus\\u003c/em\\u003e-stimulated, HA-treated skin epidermal equivalents; HBD2 accumulates in the stratum corneum. (C) The 0.1% HA and 0.1% HA and \\u003cem\\u003eS. aureus\\u003c/em\\u003e co-treated groups had reduced IL6 release, according to the enzyme-linked immunosorbent test (ELISA). (D) ELISA revealed that the 0.1% HA and 0.1% HA and \\u003cem\\u003eS. aureus\\u003c/em\\u003e co-treated groups secreted less TNF-α. The values are given as mean±SD. The unpaired t-test was used to determine P values. *Importance of the treated group compared to control group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Onlinefloatimage5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8437901/v1/c729a5d640e28cf2f147d17e.png\"},{\"id\":102746329,\"identity\":\"53fdf49e-4f25-4c89-84b5-c60a105cb9a2\",\"added_by\":\"auto\",\"created_at\":\"2026-02-16 08:56:44\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":72107,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHyaluronic acid (HA) (0.8 kDa)-induced patterns of human beta-defensin 2 (HBD2) expression regulation. HA (0. 8kDa) acts as a ligand for Toll-like receptor 2/4 (TLR2/4) on the cell membrane and interact with MyD88, a junction protein contained in the Toll/interleukin-1 receptor (TIR) structural domain. After ligand stimulation, extracellular signal-regulated kinase (ERK)1/2 is activated by phosphorylation via interactions between molecular domains and stimulates HBD2 transcription and expression of in the nucleus, and is ultimately released into the cytoplasm to perform its regulatory function.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Onlinefloatimage6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8437901/v1/c3ed1634d3ee80b8c5645701.png\"},{\"id\":102750618,\"identity\":\"c4bfe54e-fc91-4300-b7dc-eba004b5e858\",\"added_by\":\"auto\",\"created_at\":\"2026-02-16 09:20:50\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":3166826,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8437901/v1/c2f0eee3-096d-43c4-9bf0-8b964e5e7a94.pdf\"},{\"id\":102745537,\"identity\":\"465ef699-b986-4e57-94be-0bf67b14affc\",\"added_by\":\"auto\",\"created_at\":\"2026-02-16 08:51:32\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":453353,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryInformation.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8437901/v1/49a54051e0ad6a20498d836e.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Sodium hyaluronate fragments promote the expression of human beta-defensin 2 in the skin to alleviate Staphylococcus aureus infection\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003eThe biggest organ in the body, the skin acts as a vital barrier to keep out harmful substances and acts as our main line of protection against infections, poisons, and sunlight [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. The skin serves as a sensory interface, protects interior tissues and organs, defines our appearance, and keeps us hydrated in addition to its protective role. Various microorganisms, including bacteria, fungi, protozoa, archaea, and viruses, can be found living on the surface of the skin. Commensal bacteria are essential for bolstering the skin's barrier function, regulating immunological responses, and defending against infections [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. The skin has a sophisticated immune system prepared to fight off infections and breaches in its protective layer. Pathogens first come into contact with keratinocytes in diseased areas [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. Proinflammatory signals are released when pattern recognition receptors (PRRs) on keratinocytes are activated by pathogen- and damage-associated molecular patterns (DAMPs and PAMPs) [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Although bacteria, fungi, and viruses are among the many pathogens to which humans are constantly exposed, clinical illnesses do not always result from these exposures. This phenomenon is believed to be associated with antimicrobial peptides, essential components of mammalian innate immunity [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. Antimicrobial peptides known as alpha and beta-defensins are secreted by phagocytic cells and epithelial cells in a variety of organs [\\u003cspan additionalcitationids=\\\"CR7 CR8\\\" citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. TNF-α, interleukin-1β (IL-1β), and other proinflammatory stimuli induce the expression of human beta-defensin 2 (HBD2) in the skin, gastrointestinal tract, respiratory tract, and pancreas [\\u003cspan additionalcitationids=\\\"CR11 CR12\\\" citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. Considering skin lesions, the release of beta-defensins by keratinocytes may be especially significant because, in the absence of the stratum corneum, bacteria may be able to penetrate the dermal connective tissue. In this instance, tissue injury may cause the extracellular matrix to degrade [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. The extracellular matrix (ECM) contains HA, a glycosaminoglycan that is widely distributed and has a role in the transportation and distribution of plasmatic proteins, the maintenance of the water balance, and the integrity of the matrix structure [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. In the cutaneous region, fibroblasts, keratinocytes, and endothelial cells produce HA, which regulates a number of biological activities [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. The molecular weight of HA is influenced by the number of repeating disaccharide units and varies from 0.8 kDa to 3000 kDa. It can hold onto water well, therefore, one of HA's most well-known uses is moisturization [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. Not only is HA a filler, but it can also influence physiological and pathological processes through binding to proteins, such as matrix proteins and receptors on cell surface (CD44, LYVE1, RHAMM, TLRs, etc.), and include migration of fibroblasts, inflammation, aging, healing of wounds, and invasion of tumors [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. It is also commonly recognized that HA speeds up wound healing and lessens the appearance of wrinkles. Aside from these uses, HA-based formulations have demonstrated exceptional effectiveness in the treatment of a variety of inflammatory skin conditions [\\u003cspan additionalcitationids=\\\"CR20\\\" citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e].\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eOur investigations revealed other, as-yet-unpublished benefits of HA, including whitening and anti-wrinkling [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. Because of its versatility, HA has been the most widely used cosmetic ingredient in recent years.\\u003c/p\\u003e\\u003cp\\u003eThe antibacterial properties of HA, however, have not yet been studied in relation to \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e infection in keratinocytes and skin equivalents that have been rebuilt from the epidermis. It will be extremely helpful for the development of new products as well as for study of its biological activities.\\u003c/p\\u003e\\u003cp\\u003eGram-positive \\u003cem\\u003eS. aureus\\u003c/em\\u003e bacteria commonly colonizes the epidermis of people with eczema and atopic dermatitis (AD) [\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. The immune system and the function of the epidermal barrier are known to be impacted by genetic and environmental factors; \\u003cem\\u003eS. aureus\\u003c/em\\u003e infection is the cause of eczema and AD [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. Among the virulence factors that \\u003cem\\u003eS. aureus\\u003c/em\\u003e produces and causes skin infections are leukocidins, iron-regulated surface proteins, phenol-soluble modulins, cell wall-anchored (CWA) proteins like clumping factor A, clumping factor B, SasX, and protein A [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. The current work examined the potential induction mechanism of HBD2 and the antimicrobial efficacy of HA against \\u003cem\\u003eS. aureus\\u003c/em\\u003e infection in keratinocytes and skin equivalents that had been rebuilt from the epidermis.\\u003c/p\\u003e\\u003cp\\u003eHere, we discovered a novel low molecular weight HA (0.8 kDa) that greatly increased HBD2 expression in keratinocytes and reconstructed epidermis skin equivalents through the TLRs-MyD88-ERK pathway. HA, a linear, negatively charged, water-soluble, non-sulfated macromolecular polysaccharide, consists of repeating disaccharide units of N-acetyl-glucosamine β-(1\\u0026ndash;4) and glucuronic acid β-(1\\u0026ndash;3) as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA. HA-induced synthesis of functional HBD2 inhibits \\u003cem\\u003eS. aureus\\u003c/em\\u003e growth and decreases TNF-α and IL6 secretion post infection, improving the response to inflammation.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\"},{\"header\":\"2. Results\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1. Hyaluronic Acid\\u0026ndash;Mediated Human Beta-Defensin 2 Production in Keratinocytes\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eSkin immunity is significantly influenced by HBD2, an antimicrobial peptide that leukocytes and epithelial cells release as a result of infection and inflammation [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. In this investigation, we looked at whether HA causes keratinocytes to produce HBD2. For our trials, we selected six distinct HA with varying molecular weights, of which HA1 produced the greatest effect. HBD2 mRNA levels rose dose-dependently upon stimulation of keratinocytes with HA1 (0.8 kDa), reaching a peak at 0.1% of HA1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). To find the best HA induction impact for upcoming in-depth research, screening was done. Although the other HA was investigated in this work as well, we decided not to include it in subsequent trials because treatment with HA1 did not lead to any change.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003e \\u003cb\\u003e2.2. Evaluation of Function of HA (0.8 kDa) During In Vitro Keratinocytes and Epidermal Skin Equivalents Culture\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eAfter the above experiments, we performed further functional analyses of HA at 0.8 kDa, selecting a non-toxic dose of 0.0025% to 1% (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). HBD2 expression in keratinocytes was detected by immunofluorescence staining, showing a concentration-dependent pattern and agreed with mRNA levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC, D). To further investigate whether the antimicrobial peptides produced were functional, treated cell lysates were accumulated for \\u003cem\\u003eS. aureus\\u003c/em\\u003e antimicrobial assay. The cells treated with HA were able to produce functional HBD2, significantly inhibiting \\u003cem\\u003eS. aureus\\u003c/em\\u003e growth (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE). Due to the limitations of keratinocytes, we chose to act on the reconstructed epidermal skin equivalents with 0.1% HA for subsequent assessment of the role of HA. Interestingly, the treated epidermal skin equivalents were structurally compact, with enhanced thickness (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eF) and significantly increased HBD2 expression (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eG). The HA-treated tissue lysate was collected to determine antimicrobial activity, and the 0.1% HA-treated epidermal skin equivalents could endogenously inhibit the growth of \\u003cem\\u003eS. aureus\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eH). Thus, with \\u003cem\\u003ein vitro\\u003c/em\\u003e culture, the HBD2 production rate and antimicrobial potential of HA (0.8 kDa) treatment was increased.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3. Hyaluronic Acid (0.8 kDa) Enhances HBD2 Production through Toll-Like Receptor-MyD88-ERK Signaling Activation in Keratinocytes\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eAs novel agonists and modulators against microbial infection, TLRs identify PAMPs expressed on the microbial surfaces [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. To understand the reason why HA can induce HBD2 expression during \\u003cem\\u003ein vitro\\u003c/em\\u003e culture, we collected mRNAs from treated keratinocytes for analysis. We examined any potential participation of TLR in the HA-mediated signaling pathway. HBD2 expression was tested in the presence of TLR2/TLR4 inhibitors, and the results impeded significant down-regulation of HBD2 expression upon the addition of both inhibitors, and stronger inhibition of the TLR2 effect (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA-\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB). An essential function of the cytosolic adaptor protein MyD88 is to facilitate both innate and adaptive immune responses [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. TLR2/4 was activated in conjunction with the HA (0.8 kDa) activity. The addition of MyD88 inhibitors dramatically inhibited HBD2 expression (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC).\\u003c/p\\u003e \\u003cp\\u003eThe TLR-mediated signaling pathway involves the activation of mitogen-activated protein kinase (MAPK) and ERK [\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]. We examined whether TLR is involved in the HA-mediated signaling pathway. The phosphorylation of ERK was induced in keratinocytes after 1 h of stimulation with 0.1% HA. There were no notable changes observed in other kinases, such as p38, JNK, and NF-κB p65 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ea-n). Following HA stimulation, the ERK pathway-activated STAT3 also increased (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ea, \\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ec, \\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ef). These findings imply that HA enhances signaling induction, which raises the synthesis of HBD2. Finally, our results show that HA activates ERK via TLR2-MyD88-mediated upregulation of HBD2 expression.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003e \\u003cb\\u003e2.4. Hyaluronic Acid (0.8kDa) Alleviate S. aureus Infection and Reduces the Secretion of Interleukin-6 and Tumor Necrosis Factor-α\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eReconstructed epidermal skin equivalents are commonly employed for evaluating skincare or \\u003cem\\u003ein vitro\\u003c/em\\u003e medicine efficacy due to their similar structure to human skin and resemblance to the \\u003cem\\u003ein vivo\\u003c/em\\u003e environment. We created a \\u003cem\\u003eS. aureus\\u003c/em\\u003e infection model of the skin to evaluate the efficacy of HA (0.8 kDa). Immunofluorescence experiments on 0.1% HA-treated skin showed a more compact and continuous epidermal structure (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA), with considerably higher expression of HBD2 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB). IL6 and TNF-α secretion was quantified by ELISA. The \\u003cem\\u003eS. aureus\\u003c/em\\u003e stimulated group revealed significantly upregulated IL6 and TNF-α secretion (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC-D); in contrast, the 0.1% HA treatment group exhibited down-regulated secretion of IL6 and TNF-α.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. Discussion\",\"content\":\"\\u003cp\\u003eThe skin, as the human body's outermost tissue, fights the infiltration of external diseases while also serving as immunological armor. Some pathogenic bacteria can lead to skin infections and inflammation. HBD2 is a defense peptide required for skin immunological defense and plays a role in immune regulation. HA is a glycosaminoglycan polymer found in the extracellular matrix of almost all mammals [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. According to recent research, short, fragmented HA polymers interact with innate molecular pattern recognition receptors such as TLR2 and TLR4, inducing innate defense responses in immune cells, endothelial cells, and the epidermis [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. The role of fragmented HA in stimulating HBD2 expression and reacting to \\u003cem\\u003eS. aureus\\u003c/em\\u003e infection remains largely unknown despite these advancements. Numerous pattern recognition receptors act as sentinels of the innate defense response, protecting the integrity of the epithelial barrier against a variety of microbial challenges.\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eIn our study, a series of HA fragments were acquired to investigate their unique role in \\\"immune defense\\\" activity \\u003cem\\u003ein vitro\\u003c/em\\u003e. Several methods for assessing hyaluronan function have been examined in current and related research. The connection between HA size and receptor specificity has also been studied [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. These studies will potentially help us understand the molecular basis of the activation and silencing of pathways linked with HA and its breakdown products \\u003cem\\u003ein vivo\\u003c/em\\u003e. Concurrently, we tried to understand the biological significance of individual pieces by investigating several biomarkers throughout the HBD2-induced expression process.\\u003c/p\\u003e\\u003cp\\u003eWe found that HA (0.8 kDa) boosted the expression of HBD2 in keratinocytes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e), potentially inhibiting \\u003cem\\u003eS. aureus\\u003c/em\\u003e infection. Indeed, across the six HA fragment sizes, HBD2 expression was considerably elevated in HA-pretreated cells (0.8 kDa). Relative to the control, the HA (0.8 kDa) treatment had greater CFU values, but it could not prevent \\u003cem\\u003eS. aureus\\u003c/em\\u003e growth, although HA (0.8 kDa)-treated cell lysates could, with a substantial decline in CFU values (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE). We reconstructed epidermal skin equivalents to assess the influence of HA (0.8 kDa) on skin structure in depth. The addition of HA (0.8 kDa) raised epidermal thickness considerably (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eF). Consistent with the cellular results, HBD2 expression was significantly increased in the epidermal equivalent post the addition of HA pretreatment compared to the control (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eG), and HA (0.8 kDa)-treated tissue homogenate lysate inhibited \\u003cem\\u003eS. aureus\\u003c/em\\u003e growth with a remarkable decline in the CFU value compared to the control (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eH). Increasing HBD2 in HA (0.8 kDa) mitigated \\u003cem\\u003eS. aureus\\u003c/em\\u003e infection. \\u003cem\\u003eS. aureus\\u003c/em\\u003e infections in the skin can induce or exacerbate skin illnesses like AD [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]. AD symptoms worsen as \\u003cem\\u003eS. aureus\\u003c/em\\u003e colonizes in the skin increases. \\u003cem\\u003eS. aureus\\u003c/em\\u003e toxins, such as enterotoxins A and B, as well as toxic shock syndrome toxin-1, increase AD symptoms [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. Consequently, avoiding \\u003cem\\u003eS. aureus\\u003c/em\\u003e infections may aid in decreasing AD symptoms. To investigate the effect of HA on \\u003cem\\u003eS. aureus\\u003c/em\\u003e infection, we developed a bacterial infection epidermal equivalents. The thickness of the epidermal equivalent was remarkably restored after the addition of HA, which also enhanced the aggregation of HBD2 in the stratum corneum (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB) and decreased inflammatory factors IL6 and TNF-α secretions (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC). The findings mentioned above indicate that HA (0.8 kDa) has some anti-inflammatory properties.\\u003c/p\\u003e\\u003cp\\u003eTLRs recognize PAMP on pathogen surfaces and participating in numerous intracellular signaling pathways that regulate innate and adaptive immunity [\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]. HA can function as a TLR agonist with immunomodulatory effects. HA fragments prepared using different approaches exhibit some discrepancies. CD44, HARE, LYVE, RHAMM, and TLR are examples of common HA receptors, with TLR being involved in microbial response as well as host defense [\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e]. We limited the range to two common TLR receptors, TLR2 and TLR4, for subsequent mechanistic research. In this research, HA (0.8 kDa) promoted HBD2 expression largely via the TLR2/4 and MyD88-mediated signaling pathways, implying that it may activate TLR4. Although the addition of a TLR2 inhibitor reduced HBD2 levels, it was less effective than its levels in the TLR4 inhibitor-treated group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). In general, HA of low molecular weight predominantly activates TLR4 and its contact initiates an inflammatory cascade, such as a complex of signals such as MyD88, IRAK, TRAF-6, and nuclear factor-κB [\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e]. However, our investigation into the mechanism of HA (0.8 kDa) revealed that HA administration led to increased amount of cellular phosphorylation and that HBD2 production and associated effects may be mediated via the ERK signaling pathway (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). Therefore, HA can be applied as a cosmetic ingredient, such as in AD and acne, to inhibit secondary infections of lesions.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"4. Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.1. Experimental materials\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eAll sodium hyaluronates; molecular weight is 0.8 kDa to 40 kDa were commercially obtained from Bloomage Biotechnology Co., Ltd. (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). The human epidermal keratinocytes were procured from the American Type Culture Collection.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eInformation about the test hyaluronic acid sample\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eAcronyms\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eItem\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eMolecular Weight(Da)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHA1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eHybloom\\u0026trade; Minture\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e800\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHA2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eHybloom\\u0026trade; NANO HA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e7521\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHA3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eHybloom\\u0026trade;Oligo Hyaluronic Acid\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e7294\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHA4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003emicroHA\\u0026trade; Super Active Hyaluronic Acid\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e2682\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHA5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eHybloom\\u0026trade; Hydrolyzed Hyaluronic Acid\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e40000\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHA6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eHybloom\\u0026trade; Hyaluronic Acid\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1000\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003e \\u003csup\\u003e1\\u003c/sup\\u003e All products provided by Bloomage Biotechnology Co., Ltd.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.2. Reagents\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eThe reagents used were as follows: phosphate buffer saline (PBS), Eplife Medium, human keratinocyte growth supplement (HKGS) was obtained through Gibco (Gibco Life Technologies, USA). Potato dextrose agar (PDA) medium, bicinchoninic acid (BCA) solution, dimethyl sulfoxide (DMSO), 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide (MTT), antifade mounting media (VECTASHIELD, H1200, USA), fluorescein isothiocyanate (FITC)-conjugated secondary antibody glucose, peptone procured from Sigma-Aldrich (St.Louis, USA). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was procured from Santa-Curz Biotechnology (Santa Cruz, USA). TRIzol reagent (Invitrogen, Carlsbad, CA, USA). ERK inhibitor PD98059, TLR2 inhibitor C29, myeloid differentiation primary response protein 88 (MyD88) inhibitor T6167923 obtained through Selleck (Selleck, USA). Anti-HBD2 antibody (ab9871), anti-β-actin antibody (ab6276), goat anti-rabbit IgG H\\u0026amp;L (HRP) (ab6721), goat anti-mouse IgG H\\u0026amp;L (ab6789), horseradish peroxidase-conjugated rabbit anti-goat IgG H\\u0026amp;L (ab6741) from Abcam (Abcam, Cambridge, UK); anti-ERK antibody (4695), anti-p-ERK (Thr202/Tyr204) antibody (4370), anti-p38 antibody (8690), anti-p-p38 (Thr180/Tyr182) antibody (4511), anti-Jun N-terminal kinase (anti-JNK) antibody (9252), anti-p-JNK (Thr183/Tyr185) antibody (9251), anti-p65 antibody (8242), anti-p-p65 antibody (3033) obtained from CST (Cell Signaling Technology, Boston, USA); ECL reagent (Thermo Fisher Scientific, Pittsburgh, USA).\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.3. Cell Culture\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eKeratinocytes were cultured in a 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e humid environment at 37℃ in EpiLife medium supplemented with calcium, employing cells from passages two to three. Prior to experimentation, the cells were acclimatized for 24 h in a supplement-free medium (without HKGS).\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.4. Quantitative reverse transcription polymerase chain reaction\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eAfter plating in a 6-well plate, keratinocytes (2\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e cells/well) were cultivated for a full day. After that, the cells given a PBS-wash and left in a medium devoid of supplements for 24 h. This medium may contain either a vehicle or six different forms of HA at varying concentrations (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). Following this therapy, TRIzol reagent was used to extract total RNA samples from the cells, and a microspectrophotometer (Merinton Instrument, SMA4000, CHN) was used to quantify the samples. Next, in accordance with the manufacturer's recommendations, an equivalent volume of each RNA sample was used to prepare cDNA (complementary DNA) employing Maxima Reverse Transcriptase (Thermo Scientific, USA). Employing a CFX Real-Time System (Bio-Rad, USA), quantitative PCR was performed in 20 \\u0026micro;L final volume, comprising 10 \\u0026micro;L of Universal SYBR Green Supermix (Bio-Rad, USA), 0.6 \\u0026micro;M per primer, and 50 ng of template cDNA. The reference gene used to normalize gene expression was GAPDH. The following primers were employed (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e):\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePrimers (and their sequences) used for rt-PCR\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer target\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eSequence Forward\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eSequence Reverse\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHBD2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTTTGGTGGTATAGGCGATCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGAGGGAGCCCTTTCTGAATC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGAPDH\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGATTCCACCCATGGCAAATTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCTGGAAGATGGTGATGGGATT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.5. Cell Viability Assessment\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eUsing MTT reduction tests, cell viability was evaluated in accordance with Hansen and Nielsen\\u0026rsquo;s protocol [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. After being sown at 2\\u0026times;10\\u003csup\\u003e4\\u003c/sup\\u003e cells/well into a 96-well plate, keratinocytes were left to attach for the entire night. The cells were then treated with HA (0.8 kDa) at concentrations ranging from 0.0025% to 2% for a minimum of 24 h while they were incubated. DMSO was used to dissolve the purple formazan that resulted after removing the culture supernatants. Absorbance values were measured at 550 nm employing a microplate spectrophotometer, MULTISKAN-Sky (Thermo Fisher Scientific, USA), absorbance values were measured at 550 nm. Calculations of cell viability were made with respect to the absorbance of the negative control group.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.6. Cellular Immunohistochemical Analysis\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eThe method of cell immunofluorescence was utilized to quantify the amount of HBD2. After reaching a density of 70%\\u0026ndash;80%, keratinocytes were digested and seeded into a 24-well plate. Afterwards, HA (0.8 kDa) was added singly at a concentration of 0.001%\\u0026ndash;0.1% (wt%). Keratinocytes were fixed for 15 min with cold methyl alcohol following a 48-h incubation period. The supernatant was removed and keratinocytes underwent a saline (phosphate-buffered saline) wash. A blocking solution of 5% bovine serum albumin (BSA) was added, and the mixture was kept at room temperature (RT) for an hour. Subsequently, the blocking solution-diluted anti-HBD2 antibody was added, and the mixture was incubated at 4℃ for the whole night. After being washed with PBS the next day, keratinocytes were incubated with the secondary antibody for 90 min at RT. The keratinocytes were coated with DAPI-containing mounting media. Images were captured using a fluorescence microscope.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.7. Detection and Determination of Protein Concentration\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eIn T25 cell culture flasks, keratinocytes (1\\u0026times;10\\u003csup\\u003e6\\u003c/sup\\u003e cells/well) were added and cultured for a duration of 24 h. Every medium was eliminated and the medium devoid of supplements was added. After that, the cells were cultivated for 30 min with either a vehicle or 0.01% or 0.1% of HA (0.8 kDa). Subsequently, the cells were isolated and lysed utilizing a protein extraction solution for radio immunoprecipitation assay (RIPA, Thermo Fisher, USA). Proteins in the lysates were separated by SDS-PAGE and transferred onto a Whatman nitrocellulose membrane (Dassel, Germany) following centrifugation at 13,000\\u0026times;g at 4\\u0026deg;C. After 2 h of incubation in tris-buffer saline containing 0.05% Tween 20 and 5% BSA, the membranes were left to overnight at 4\\u0026deg;C to be treated with primary antibodies. Next, an ECL reagent was used to identify the secondary antibody that had been coupled with horseradish peroxidase after it had reacted for 2 h at RT. Using ImageJ, the discovered band was densitometrically estimated.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.8. Generation of epidermal skin equivalents\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eAs previously mentioned [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e], epidermal skin models were created. In summary, 24 well plates were seeded with 2\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e keratinocytes from a secondary culture using Epilife media on a filter insert (diameter 6.5 mm; Costar; Corning). Three days post-seeding, the keratinocytes were exposed to air after the apical medium was aspirated, with only the filter insert remaining in contact with the medium. During the liquid cultivation stage, a 0.1% (wt%) HA (0.8 kDa) solution was added to the culture media until the air-liquid culture was finished. The media was replaced with keratinocyte medium devoid of penicillin and streptomycin prior to the introduction of bacteria. Seven-day air-exposed cultures were used for the experimentation.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.9. Bacterial inoculum preparation\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eThe ATCC25923 strain of \\u003cem\\u003eS. aureus\\u003c/em\\u003e was employed. Long-term preservation of the bacteria was achieved at -80\\u0026deg;C in nutritional broth containing 20% (v/v) glycerol. On blood agar plates, inocula from frozen cultures were cultivated over night at 37℃ (BioM\\u0026eacute;rieux). The bacterium was grown for 2.5 h at 37℃ in Luria-Bertani (LB) medium (10 g bactotryptone, 5 g of yeast extract, and 5 g of sodium chloride in 1 L distilled water) under vigorous shaking. Standard vital counts were used to confirm that the concentration of this suspension, which was determined by measuring its absorbance at 600 nm, was approximately 3\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e CFU/mL in PBS (pH 7.4).\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.10. Infection of epidermal skin equivalents by the bacterium\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eSkin equivalents were incubated along with 50 \\u0026micro;L of the bacterial suspension at 37 ℃ in CO\\u003csub\\u003e2\\u003c/sub\\u003e (7.3%). Vehicle and 0.1% HA (0.8 kDa) were used separately before adding the bacterial stimulus. The supernatant post-stimulation was collected after 24 h. To examine the endogenous antimicrobial capacity, two skin equivalents made into a homogenious mixture in PBS employing a glass Potter-Elvehjem tissue homogenizer, and the homogenate proteins were then extracted.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.11. Enzyme-linked immunosorbent assay (ELISA)\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eThe supernatant was collected after 48 h of incubation and centrifuged for 5 min at 1000 rpm. The TNF-α ELISA Kit (Lianke) was then used to measure the amount of TNF-α in the supernatant in accordance with the protocol. The RIPA buffer (Solarbio) was used to extract all proteins from the cells. Quantification of the total protein content was done using a ThermoFisher Scientific BCA kit. The total protein content served as a reference for the quantity of TNF-α and IL6 secreted by each group. An unpaired t-test was utilized to assess all the data, and a statistical difference was defined as p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.12. Histology and immunohistochemical analysis\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eFollowing the air-liquid cultivation, 4% paraformaldehyde (PFA) was used to fix the skin equivalents. Gradient ethanol was used to dehydrate the material, and paraffin embedding was the next step. After sectioning the material into 5 \\u0026micro;m slices, the pieces were arranged on glass slides. After the tissue slices were deparaffinized with methylcyclohexane and rehydrated with ethanol that was graded in decreasing strength, hematoxylin and eosin (H\\u0026amp;E) staining was performed. Under a microscope, photography and observation were carried out. Skin equivalents were coated with O.C.T, sliced into 5 \\u0026micro;m thick pieces, and then mounted onto glass slides for immuno-histochemical assessment. For 0.25 h, the parts were glued with cold methyl alcohol. The BSA (5%) and the blocking solution was added and incubated at RT for 1 h. Subsequently, the blocking solution-diluted anti-HBD2 antibody was added individually, and it was incubated at 4 ℃ for the entire night. The slices were then coated with a mounting solution with DAPI after PBS-wash the next day, and treated for 1.5 h at RT with the conjugated secondary antibody. A fluorescence microscope was employed for imaging.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.13. Antimicrobial Assay\\u003c/h2\\u003e \\u003cp\\u003eKeratinocytes were seeded on a 6-well plate, and HA (0.8 kDa; pre-treated for 24 h). Then, antibiotic-free media were added to the original medium, and the mixture was kept humid and at 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e in an incubator. Following a 24-h incubation period, the cells underwent three DPBS washes before being lysed using RIPA-lysed cell centrifugation. The supernatant was then collected to evaluate the inhibitory effect on \\u003cem\\u003eS. aureus.\\u003c/em\\u003e The test group for the antimicrobial assay was created by completely combining the lysis sample and bacterial inoculum in a 10:1 ratio. The bacterial suspension was used as a negative control in place of the sample solution in the mixture, which was sterilized PBS. For 3 h, the test group and the negative control were incubated concurrently. Each group's mixture was put out separately on a dish. Following a 37\\u0026deg;C overnight incubation period, the CFU was estimated.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.14. Statistical analysis\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eThe Student's t-test was applied to acquire the p-values. Statistical significance was deemed at p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, with p-values denoted as: **p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, *p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05. The values are calculated from a minimum of three replicates and expressed as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"5. Conclusions\",\"content\":\"\\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eTo conclude, this research indicates that novel HA with a low molecular weight of 0.8 kDa can simultaneously stimulate HBD2 production through the TLRs-MyD88-ERK pathway (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e) concurrently suppressing \\u003cem\\u003eS. aureus\\u003c/em\\u003e-induced secretion of cytokines IL6 and TNF-α that cause HA inflammation. This strong improvement in bacterial infection and structural strength via many mechanisms has the potential to improve inherent skin immunity. This work provides new pathways to investigate the biological activities of HA and creates the theoretical foundation for the development of novel immunological and micro-ecological skincare products, even if more in-depth mechanism research is necessary.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAuthor Contributions:\\u003c/strong\\u003e Conceptualization, Y.J.L. and Y.W.; methodology,Y.J.L., Y.W.\\u0026nbsp;and F.C.; investigation,Y.J.L.; resources, Y.W.; writing\\u0026mdash;original draft preparation, Y.J.L.; writing\\u0026mdash;review and editing, Y.J.L.\\u0026nbsp;and Y.W.; visualization, Y.J.L., Y.W.\\u0026nbsp;and F.C.; supervision, Y.W.\\u0026nbsp;and F.C.; project administration, Y.J.L; funding acquisition, Y.J.L. and Y.W.\\u0026nbsp;All authors have read and agreed to the published version of the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding:\\u003c/strong\\u003e These studies were a sponsored research collaboration with Bloomage Biotechnology Corporation Limited, which provided research support for the hyaluronic acid samples.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eInstitutional Review Board Statement:\\u0026nbsp;\\u003c/strong\\u003eNot applicable. No human or animal subjects were use.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eInformed Consent Statement:\\u0026nbsp;\\u003c/strong\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData Availability Statement:\\u003c/strong\\u003e The study\\u0026apos;s supporting data are not publicly available because they contain information that might compromise Bloomage Biotechnology Co., Ltd.\\u0026apos;s privacy. However, the corresponding author can provide the data upon request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments:\\u003c/strong\\u003e The authors are appreciative of \\u0026nbsp;Bloomage Biotechnology Co., Ltd.\\u0026apos;s financial support. We thank the American Type Culture Collection for providing the cell lines and bacterial strain.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflicts of Interest:\\u003c/strong\\u003e The authors declare no conflicts of interest. The funders had no role in the design of the study, in the collection, analysis, or interpretation of data, or in the writing of the manuscript. The submission and publication of the manuscript were authorized by Bloomage Biotechnology Co., Ltd.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eHarris-Tryon, Tamia, A. E. A. \\u0026amp; Grice Microbiota and maintenance of skin barrier function [J]. \\u003cem\\u003eScience\\u003c/em\\u003e \\u003cb\\u003e376\\u003c/b\\u003e, 940\\u0026ndash;945 (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGaofeng \\u0026amp; Wang Zhen Lin,Yue Li. Colonizing microbiota is associated with clinical outcomes in diabetic wound healing [J]. \\u003cem\\u003eAdv. Drug Deliv. Rev.\\u003c/em\\u003e \\u003cb\\u003e194\\u003c/b\\u003e, 114727 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHannigan, G. D. et al. The human skin double-stranded DNA virome: Topographical and temporal diversity, genetic enrichment, and dynamic associations with the host microbiome [J]. \\u003cem\\u003emBio\\u003c/em\\u003e \\u003cb\\u003e6\\u003c/b\\u003e (5), e01578\\u0026ndash;e01515 (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOh, J. et al. NISC Comparative Sequencing Program, Temporal stability of the human skin microbiome [J]. \\u003cem\\u003eCell\\u003c/em\\u003e \\u003cb\\u003e165\\u003c/b\\u003e (4), 854\\u0026ndash;866 (2016).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCorrales-Garcia, L. L., Serrano-Carreon, L. \\u0026amp; Corzo, G. Improving the heterologous expression of human beta-defensin 2 (HBD2) using an experimental design [J]. \\u003cem\\u003eProtein Expr Purif.\\u003c/em\\u003e \\u003cb\\u003e167\\u003c/b\\u003e, 105539 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDi Cagno, R. F. et al. Synthesis of γ-aminobutyric acid (GABA) by \\u003cem\\u003eLactobacillus plantarum\\u003c/em\\u003e DSM19463: functional grape must beverage and dermatological applications [J]. \\u003cem\\u003eAppl. Microbiol. Biotechnol.\\u003c/em\\u003e \\u003cb\\u003e86\\u003c/b\\u003e (2), 731\\u0026ndash;741 (2009).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJia, L. et al. Porphyromonas gingivalis and \\u003cem\\u003eLactobacillus rhamnosus GG\\u003c/em\\u003e regulate the Th17/Treg balance in colitis via TLR4 and TLR2 [J]. \\u003cem\\u003eClin. Transl Immunol.\\u003c/em\\u003e \\u003cb\\u003e9\\u003c/b\\u003e (11), e1213 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLudwig, I. S. et al. \\u003cem\\u003eLactobacillus rhamnosus GG\\u003c/em\\u003e-Derived Soluble Mediators Modulate Adaptive Immune Cells [J]. \\u003cem\\u003eFront. Immunol.\\u003c/em\\u003e \\u003cb\\u003e9\\u003c/b\\u003e, 1546 (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNatividad, B. et al. Human Milk Oligosaccharides and Lactose Differentially Affect Infant Gut Microbiota and Intestinal Barrier In Vitro [J]. \\u003cem\\u003eNutrients\\u003c/em\\u003e, \\u003cb\\u003e14\\u003c/b\\u003e(12). (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eStrandwitz, P. et al. GABA-modulating bacteria of the human gut microbiota [J]. \\u003cem\\u003eNat. Microbiol.\\u003c/em\\u003e \\u003cb\\u003e4\\u003c/b\\u003e (3), 396\\u0026ndash;403 (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eUberoi, A. et al. Commensal microbiota regulates skin barrier function and repair via signaling through the aryl hydrocarbon receptor [J]. \\u003cem\\u003eCell. Host Microbe 2021\\u003c/em\\u003e, \\u003cb\\u003e29\\u003c/b\\u003e(8): 1235\\u0026ndash;1248 e1238.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWeinberg, A. et al. Quantification of Human β-Defensin-2 and \\u0026ndash;\\u0026thinsp;3 in Body Fluids: Application for Studies of Innate Immunity [J]. \\u003cem\\u003eClin. Chem.\\u003c/em\\u003e \\u003cb\\u003e53\\u003c/b\\u003e (4), 757\\u0026ndash;765 (2007).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXiong, W-B. et al. Dehydroandrographolide enhances innate immunity of intestinal tract through up-regulation the expression of hBD-2 [J]. \\u003cem\\u003eDARU J. Pharm. Sci.\\u003c/em\\u003e, \\u003cb\\u003e23\\u003c/b\\u003e(1). (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDonnarumma, G. et al. Malassezia furfur induces the expression of defensin-2 in human keratinocytes in a protein kinase C-dependent manner [J]. \\u003cem\\u003eArch. Dermatol. Res.\\u003c/em\\u003e \\u003cb\\u003e295\\u003c/b\\u003e, 474\\u0026ndash;481 (2004).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJiang, D. J. et al. Regulation of lung injury and repair by Toll-like receptors and hyaluronan [J]. \\u003cem\\u003eNat. Med.\\u003c/em\\u003e \\u003cb\\u003e11\\u003c/b\\u003e, 1173\\u0026ndash;1179 (2005).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKeen, M. A. Hyaluronic Acid in Dermatology [J]. \\u003cem\\u003eSkinmed\\u003c/em\\u003e \\u003cb\\u003e15\\u003c/b\\u003e (6), 441\\u0026ndash;448 (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWitting, M. et al. Interactions of hyaluronic Acid with the skin and implications for the dermal delivery of biomacromolecules [J]. \\u003cem\\u003eMol. Pharm.\\u003c/em\\u003e \\u003cb\\u003e12\\u003c/b\\u003e (5), 1391\\u0026ndash;1401 (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eŠ\\u0026iacute;nov\\u0026aacute;, R. et al. A key player or just a bystander in skin photoaging [J]. \\u003cem\\u003eExp. Dermatol.\\u003c/em\\u003e \\u003cb\\u003e31\\u003c/b\\u003e (4), 442\\u0026ndash;458 (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHong, L. et al. Hyaluronic acid (HA)-based hydrogels for full-thickness wound repairing and skin regeneration [J]. \\u003cem\\u003eJ. Mater. Sci. Mater. Med.\\u003c/em\\u003e \\u003cb\\u003e29\\u003c/b\\u003e (9), 150 (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLitwiniuk, M., Krejner, A. \\u0026amp; Speyrer, M. S. Hyaluronic acid in inflammation and tissue regeneration [J]. \\u003cem\\u003eWounds\\u003c/em\\u003e \\u003cb\\u003e28\\u003c/b\\u003e (3), 78\\u0026ndash;88 (2016).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen, L. H., Xue, J. F. \\u0026amp; Zheng, Z. Y. Hyaluronic acid, an efficient biomacromolecule for treatment of inflammatory skin and joint diseases: a review of recent developments and critical appraisal of preclinical and clinical investigations [J]. \\u003cem\\u003eInt. J. Biol. Macromol.\\u003c/em\\u003e \\u003cb\\u003e116\\u003c/b\\u003e, 572\\u0026ndash;584 (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen, F., Guo, X. \\u0026amp; Wu, Y. Skin antiaging effects of a multiple mechanisms hyaluronan complex [J]. \\u003cem\\u003eSkin. Res. Technol.\\u003c/em\\u003e \\u003cb\\u003e29\\u003c/b\\u003e (6), e13350 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGong, J. Q. et al. Skin colonization by \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e in patients with eczema and atopic dermatitis and relevant combined topical therapy: A double-blind multicentre randomized controlled trial [J]. \\u003cem\\u003eBr. J. Dermatol.\\u003c/em\\u003e \\u003cb\\u003e155\\u003c/b\\u003e, 680\\u0026ndash;687 (2006).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSajić, D., Asiniwasis, R. \\u0026amp; Skotnicki-Grant, S. A look at epidermal barrier function in atopic dermatitis: Physiologic lipid replacement and the role of ceramides [J]. \\u003cem\\u003eSkin. Therapy Lett.\\u003c/em\\u003e \\u003cb\\u003e17\\u003c/b\\u003e, 6\\u0026ndash;9 (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLacey, K. A., Geoghegan, J. A. \\u0026amp; McLoughlin, R. M. The role of \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e virulence factors in skin infection and their potential as vaccine antigens [J]. \\u003cem\\u003ePathogens\\u003c/em\\u003e \\u003cb\\u003e5\\u003c/b\\u003e (1), 22 (2016).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLinz, M. S., Mattappallil, A. \\u0026amp; Parker, D. Clinical Impact of \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e Skin and Soft Tissue Infections. Antibiotics (Basel) [J]. \\u003cb\\u003e12\\u003c/b\\u003e(3): 557. (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHansen, M. B., Nielsen, S. E. \\u0026amp; Berg, K. Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill [J]. \\u003cem\\u003eJ. Immunol. Methods\\u003c/em\\u003e. \\u003cb\\u003e119\\u003c/b\\u003e (2), 203\\u0026ndash;210 (1989).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEl Ghalbzouri, A., Siamari, R., Willemze, R. \\u0026amp; Ponec, M. Leiden reconstructed human epidermal model as a tool for the evaluation of the skin corrosion and irritation potential according to the ECVAM guidelines [J]. Toxicol. \\u003cem\\u003eVitro\\u003c/em\\u003e \\u003cb\\u003e22\\u003c/b\\u003e, 1311\\u0026ndash;1320 (2008).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eThakoersing, V. S. et al. Unraveling barrier properties of three different in-house human skin equivalents [J]. \\u003cem\\u003eTissue Eng. Part. C Methods\\u003c/em\\u003e. \\u003cb\\u003e18\\u003c/b\\u003e (1), 1\\u0026ndash;11 (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eScharf, S. et al. Induction of human β-defensin-2 in pulmonary epithelial cells by Legionella pneumophila: involvement of TLR2 and TLR5, p38 MAPK, JNK, NF-κB, and AP-1 [J]. \\u003cem\\u003eAm. J. Physiology-Lung Cell. Mol. Physiol.\\u003c/em\\u003e \\u003cb\\u003e298\\u003c/b\\u003e (5), L687\\u0026ndash;L695 (2010).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eUberoi, A. et al. Commensal microbiota regulates skin barrier function and repair via signaling through the aryl hydrocarbon receptor [J]. \\u003cem\\u003eCell. Host Microbe 2021\\u003c/em\\u003e, \\u003cb\\u003e29\\u003c/b\\u003e(8): 1235\\u0026ndash;1248 e1238.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSeo, H-S. et al. Adiponectin Attenuates the Inflammation in Atopic Dermatitis-Like Reconstructed Human Epidermis [J]. \\u003cem\\u003eAnn. Dermatol.\\u003c/em\\u003e, \\u003cb\\u003e31\\u003c/b\\u003e(2). (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eValachov\\u0026aacute;, K., Hassan, M. E., Šolt\\u0026eacute;s, L. \\u0026amp; Hyaluronan Sources, Structure, Features and Applications [J]. \\u003cem\\u003eMolecules (Basel Switzerland)\\u003c/em\\u003e. \\u003cb\\u003e29\\u003c/b\\u003e (3), 739 (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLierova, A. et al. Hyaluronic Acid: Known for Almost a Century, but Still in Vogue [J]. \\u003cem\\u003ePharmaceutics\\u003c/em\\u003e \\u003cb\\u003e14\\u003c/b\\u003e (4), 838 (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eClowry, J. et al. Distinct T cell signatures are associated with \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e skin infection in pediatric atopic dermatitis[J]. \\u003cem\\u003eJCI Insight\\u003c/em\\u003e. \\u003cb\\u003e9\\u003c/b\\u003e (9), e178789 (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGimenez-Rivera, V. A. et al. NOD2 Agonism Counter-Regulates Human Type 2 T Cell Functions in Peripheral Blood Mononuclear Cell Cultures: Implications for Atopic Dermatitis[J]. \\u003cem\\u003eBiomolecules\\u003c/em\\u003e \\u003cb\\u003e13\\u003c/b\\u003e (2), 369 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eResko, Z. J., Anderson, C. M. \\u0026amp; Federle, M. J. A Staphylococcal Glucosaminidase Drives Inflammatory Responses by Processing Peptidoglycan Chains to Physiological Lengths[J]. \\u003cem\\u003eInfect. Immun.\\u003c/em\\u003e \\u003cb\\u003e91\\u003c/b\\u003e (2), e0050022 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWeigel, P. H. Planning, evaluating and vetting receptor signaling studies to assess hyaluronan size-dependence and specificity[J]. \\u003cem\\u003eGlycobiology\\u003c/em\\u003e \\u003cb\\u003e27\\u003c/b\\u003e (9), 796\\u0026ndash;799 (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMelrose, J. Hyaluronan hydrates and compartmentalises the CNS/PNS extracellular matrix and provides niche environments conducive to the optimisation of neuronal activity[J]. \\u003cem\\u003eJ. Neurochem\\u003c/em\\u003e. \\u003cb\\u003e166\\u003c/b\\u003e (4), 637\\u0026ndash;653 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXu, C. et al. Hyaluronan ameliorates LPS-induced acute lung injury in mice via Toll-like receptor (TLR) 4-dependent signaling pathways[J]. \\u003cem\\u003eInt. Immunopharmacol.\\u003c/em\\u003e \\u003cb\\u003e28\\u003c/b\\u003e (2), 1050\\u0026ndash;1058 (2015).\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"scientific-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"scirep\",\"sideBox\":\"Learn more about [Scientific Reports](http://www.nature.com/srep/)\",\"snPcode\":\"\",\"submissionUrl\":\"\",\"title\":\"Scientific Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Scientific Reports\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"antimicrobial peptides, hyaluronic acid, keratinocytes, reconstructed human epidermis, Staphylococcus aureus, Toll-like receptors\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-8437901/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-8437901/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e \\u003cp\\u003eThe skin serves as a critical barrier against pathogens and infections, and its microbiome plays a vital role in maintaining immune homeostasis. Human beta-defensin 2 (HBD2) is an antimicrobial peptide essential for skin immunity. While hyaluronic acid (HA) is widely used in pharmaceuticals and cosmetics, its antimicrobial properties against \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e (\\u003cem\\u003eS. aureus\\u003c/em\\u003e) infection in skin cells remain understudied. This study investigates the role of low molecular weight HA (0.8 kDa) in promoting HBD2 expression and its potential to combat \\u003cem\\u003eS. aureus\\u003c/em\\u003e infection.\\u003c/p\\u003e\\u003ch2\\u003eMaterials and Methods\\u003c/h2\\u003e \\u003cp\\u003eHA was synthesized and tested for its ability to induce HBD2 expression in human keratinocytes and reconstructed epidermal skin equivalents. The antibacterial activity of HA was evaluated using \\u003cem\\u003eS. aureus\\u003c/em\\u003e infection models, while the underlying signaling pathways were explored through Western blotting and inhibitor studies. Inflammatory cytokines (TNF-α and IL-6) were quantified using ELISA.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e \\u003cp\\u003eHA (0.8 kDa) significantly upregulated HBD2 expression in keratinocytes and reconstructed skin models through the TLR2/4-MyD88-ERK signaling pathway. HA treatment reduced \\u003cem\\u003eS. aureus\\u003c/em\\u003e infection and suppressed the secretion of pro-inflammatory cytokines TNF-α and IL-6. In reconstructed epidermal skin equivalents, HA enhanced structural integrity and endogenous antimicrobial activity, further confirming its potential as an anti-inflammatory and antibacterial agent.\\u003c/p\\u003e\\u003ch2\\u003eConclusion\\u003c/h2\\u003e \\u003cp\\u003eLow molecular weight HA (0.8 kDa) promotes HBD2 expression and exhibits antibacterial and anti-inflammatory effects against \\u003cem\\u003eS. aureus\\u003c/em\\u003e infection. These findings highlight HA's potential applications in skincare products for enhancing innate immunity and managing skin infections.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Sodium hyaluronate fragments promote the expression of human beta-defensin 2 in the skin to alleviate Staphylococcus aureus infection\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-02-11 18:47:13\",\"doi\":\"10.21203/rs.3.rs-8437901/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2026-05-12T15:48:35+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-05-08T10:55:38+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"242283991557929163301808810775435344355\",\"date\":\"2026-04-28T08:57:28+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-03-03T18:14:38+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"191554049057153905665165539406087014014\",\"date\":\"2026-02-09T16:35:15+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2026-02-09T09:54:12+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2026-02-09T09:50:44+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvited\",\"content\":\"\",\"date\":\"2026-01-08T04:36:55+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2026-01-06T01:48:24+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Scientific Reports\",\"date\":\"2026-01-06T01:42:03+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"scientific-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"scirep\",\"sideBox\":\"Learn more about [Scientific Reports](http://www.nature.com/srep/)\",\"snPcode\":\"\",\"submissionUrl\":\"\",\"title\":\"Scientific Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Scientific Reports\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"d20b2c83-604b-4c1c-b17d-86950dbcbc32\",\"owner\":[],\"postedDate\":\"February 11th, 2026\",\"published\":true,\"recentEditorialEvents\":[{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2026-05-12T15:48:35+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-05-08T10:55:38+00:00\",\"index\":95,\"fulltext\":\"\"}],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"in-revision\",\"subjectAreas\":[{\"id\":62623458,\"name\":\"Health sciences/Diseases\"},{\"id\":62623459,\"name\":\"Biological sciences/Drug discovery\"},{\"id\":62623460,\"name\":\"Biological sciences/Immunology\"},{\"id\":62623461,\"name\":\"Biological sciences/Microbiology\"}],\"tags\":[],\"updatedAt\":\"2026-05-12T15:55:35+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-02-11 18:47:13\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-8437901\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-8437901\",\"identity\":\"rs-8437901\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}