{"paper_id":"169836ef-fd93-4cd9-b019-4af37f6b46bf","body_text":"Comparative Approaches to Microbial Profiling in Odontogenic Sinusitis with Periapical Lesions | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Comparative Approaches to Microbial Profiling in Odontogenic Sinusitis with Periapical Lesions Marta Aleksandra Kwiatkowska, Alicja Trębińska-Stryjewska, Katarzyna Andrejuk, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8067667/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Odontogenic sinusitis (ODS) is a common cause of unilateral maxillary sinusitis, and it arises from periapical lesions (PAL) or other odontogenic foci. This infection is polymicrobial and anaerobe-rich, thus standard culture methods often underestimate its diversity. Molecular techniques such as quantitative polymerase chain reaction (QPCR) and next-generation sequencing (NGS) may better characterize the microbial burden and composition. Methods Paired sinus mucosal biopsy (SIN) and the tissue scrapings from periapical lesion (PAL) specimens were collected from 28 patients with ODS. Bacterial detection was performed using conventional culture, and QPCR targeting ten clinically relevant taxa. For paired sampled from three randomly selected patients 16S rRNA amplicon sequencing was performed. Microbial load, taxa richness, and the similarity of bacterial communities between the two anatomically connected sites were compared across the molecular methods. Statistical analysis included the Wilcoxon signed-rank, McNemar, and Bray–Curtis dissimilarity testing. Results Culture yielded low detection rates, identifying only a limited set of pathogens ( Staphylococcus aureus , Streptococcus anginosus , and Fusobacterium nucleatum ) in a minority of samples. In contrast, QPCR demonstrated significantly higher detection frequencies, particularly in PAL specimens. Porphyromonas gingivalis (96.8%), F. nucleatum (90.3%), and the S. anginosus group (90.3%) were highly prevalent in PAL, while SIN samples showed lower but overlapping positivity (89.3%, 67.9%, and 50.0%, respectively). Overall, PAL samples harbored significantly higher bacterial loads and taxa richness than SIN specimens (Wilcoxon p = 0.0004). 16S rRNA amplicon sequencing confirmed the presence of polymicrobial communities in both sites and revealed additional taxa beyond those included in the QPCR panel. Jaccard distance and Bray–Curtis analyses revealed patient-specific overlap: some PAL and SIN pairs shared nearly identical microbiota, while others exhibited marked divergence. Conclusions PALs represent a reservoir of mostly anaerobic bacterial species that may translocate into the maxillary sinus, establishing ODS. While there is overlap in bacterial communities, sinus samples exhibit a lower burden and site-specific shifts in taxa composition. Culture alone underestimates ODS microbial complexity, whereas QPCR and 16S rRNA amplicon sequencing provide much deeper insights. Combined molecular approaches are essential for accurate pathogen detection and for guiding effective management of ODS. Health sciences/Diseases Health sciences/Medical research Biological sciences/Microbiology odontogenic sinusitis polymerase chain reaction endoscopic sinus surgery periapical lesion next generation sequencing oroantral communication Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Odontogenic sinusitis (ODS) is a distinct form of primarily maxillary sinusitis, arising from dental infections like periodontitis, periapical lesions, and complications of dental procedures such as extractions or implant placements ( 1 – 3 ). Unlike rhinogenic chronic sinusitis (CRS), which is primarily associated with viral or allergic etiologies, ODS is often polymicrobial, with a predominance of anaerobic bacteria originating from the oral cavity ( 4 – 6 ). Understanding the microbial load and composition in ODS is crucial for accurate diagnosis and effective treatment, particularly in an era of rising antimicrobial resistance ( 7 – 9 ). ODS can also serve as a portal for systemic dissemination of oral pathogens, which have been implicated in complications such as orbital cellulitis, intracranial abscess, and bacteremia, with life-threatening consequences ( 10 – 12 ). Traditional culture-based microbiological methods have long been the gold standard for identifying bacterial pathogens in clinical samples. However, culture techniques are inherently limited in detecting fastidious and anaerobic bacteria, which are frequently implicated in odontogenic infections ( 4 , 9 ). Anaerobic organisms commonly found in ODS often exhibit resistance to empirical antibiotics used for rhinogenic CRS. Without proper microbial identification, treatment failures and chronicity are common, necessitating repeated interventions ( 4 , 8 ). To date, international European guidelines recommend antibiotic treatment for sinusitis without considering the potential underlying odontogenic cause ( 22 ). Specific antibiotics that target mainly the upper respiratory tract pathogens responsible for ‘non-odontogenic’ sinusitis might not be adequate for the anaerobe-dominated microbial profile of ODS. This limitation has driven interest in molecular techniques, such as polymerase chain reaction (PCR) and next-generation sequencing (NGS), which offer enhanced sensitivity and broader microbial profiling capabilities ( 8 , 13 – 15 ). PCR allows for the targeted detection of bacterial species based on their specific genetic markers, such as fragments of the 16S rRNA gene, often enabling the identification of pathogens that are difficult to culture ( 16 ). In contrast, 16S rRNA amplicon sequencing provides a comprehensive overview of the entire microbial community within a sample, allowing for the characterization of both culturable and unculturable bacteria, as well as the assessment of microbial diversity and abundance ( 8 ). Despite these advantages, molecular methods based on microbial DNA targeting present their own challenges, including potential detection of non-viable organisms and susceptibility to environmental contamination ( 14 , 17 ). Recent studies have highlighted the limitations of conventional culture techniques in detecting the full spectrum of bacteria present in odontogenic infections. For instance, a study of purulent aspirate from the sinus cavity and sequencing the V1-V2 regions of the 16S rRNA gene identified a predominantly polymicrobial spectrum with many genera of anaerobic bacteria, notably Fusobacterium, Prevotella , and Porphyromonas , associated with periodontal disease ( 18 , 19 ). This underscores the importance of precise microbiological diagnostics in managing odontogenic abscesses. Another investigation revealed that the sequencing of the 16S rRNA gene hypervariable regions V1-V3 detected considerably more bacterial taxa than conventional cultural methods, even in culture-negative samples, emphasizing the need for updated diagnostic practices ( 20 , 21 ). A comparative analysis of culture, PCR, and 16S rRNA amplicon sequencing results in clinically confirmed ODS has not yet been done. Similarly, studies are needed that directly compare the microbial communities of ODS in the samples taken from the maxillary sinus and corresponding periapical lesions. This comparison would help elucidate the microbial continuum between periapical infections and sinus involvement. One approach for this analysis could involve examining restricted-length DNA fragments of the chosen pathogens using pulsed-field electrophoresis. However, it is important to note that such a comparison would focus only on culturable and well-grown bacterial strains, which are typically aerobic and belong to just one species. To compare the numerous species, present in these two anatomical sites, whose natural separation is disrupted by infection, we employed culture-based microbiological methods and compared them to two molecular techniques: targeted PCR and NGS. We sought to evaluate the efficiency of detecting pathogenic bacterial taxa using these methods. Candidate pathogens for PCR were selected through an extensive literature review, which identified taxa most strongly implicated in odontogenic sinusitis ( 22 – 24 ) and the ones more likely associated with non-odontogenic CRS, such as Pseudomonas aeruginosa and Staphylococcus aureus ( 22 ). We designed primers accordingly and performed both qualitative and quantitative analyses with targeted PCR. For three patients, we additionally analyzed material from both sites using 16S rRNA amplicon sequencing. Our results showed that conventional culture was less effective than molecular techniques at capturing the full range of bacteria present in ODS infections and were also biased towards aerobic taxa. QPCR and 16S rRNA amplicon sequencing revealed a high degree of heterogeneity within the ODS patient group, with strong overlap between the bacterial communities of the maxillary sinus and the corresponding periapical lesions in some patients, and discordant results in others. A comparison of QPCR and 16S rRNA amplicon sequencing revealed varying degrees of correlation. More concordant results were obtained for sinus mucosal biopsies than for samples from periapical lesions, demonstrating the suitability of the taxa selected for the QPCR analysis, which targeted ODS-associated bacteria present in the maxillary sinus. However, in one out of the three patients analyzed by NGS, ten pathogenic taxa chosen for targeted PCR failed to capture the diversity, representing only a small fraction of the taxa detected in sinus biopsies. These findings suggest that although targeted PCR may be a rapid, cost-effective and clinically valuable option, deeper analysis with NGS to obtain a complete microbiological profile should be considered in patients who do not respond to treatment guided by targeted PCR results. Although our study involved a relatively small cohort, it was prospective in nature and highlights the need for further research into the diagnosis of odontogenic sinusitis. Material and methods Study setting, design and participants Twenty-eight adult patients presented with the clinical and radiological symptoms of chronic odontogenic sinusitis (ODS) and periapical lesion (PAL) around maxillary molars or premolars and scheduled for endoscopic sinus surgery (ESS) were included in the study. ODS was confirmed by otolaryngologist and dentist as follows: the otolaryngologist assessed nasal endoscopy for mucopurulence or edema in middle meatus or sinuses on endoscopy, whereas dental specialist assessed the pulp vitality with cold pulp testing, and checked the tooth with percussion, palpation and mobility test. The computed-tomography (CT) or cone-beam computed tomography (CBCT) scans were evaluated by both specialists to properly establish the diagnosis. Patients with bilateral sinusitis and bilateral PALs, possible coexistence of fungal ball with ODS and patients with primary immunodeficiency and the ones with just maxillary sinus mucosal thickening were excluded from the study. Sample collection Samples for the microbiological, quantitative QPCR, and 16S rRNA sequencing analysis were collected at the beginning of endoscopic sinus surgery (ESS), coinciding with the extraction of the causative tooth. After performing a standard maxillary antrostomy, a curved suction was introduced into the ostium of maxillary sinus. Following the irrigation with 250cc of 0.9% solution of NaCl, the purulent fluid was suctioned out and immediately stored in a sterile container. A mucosal biopsy was then taken from the floor of the MS using curved forceps. Following the extraction of causative teeth, a sterile swab was collected from the tooth socket with a periapical lesion, and tissue scrapings were obtained from curettage of the remaining periapical lesion. The maxillary sinus rinses and tooth socket swabs were immediately sent for culturing to the Department of Laboratory Diagnostics, Military Institute of Medicine – National Research Institute. Samples from sinus mucosal biopsy (SIN) and the tissue scrapings from periapical lesion (PAL) were immediately stored in separate 1 ml vials with DNAgard Tissue and Cells (®Biomatrica) sterile solution and stored at 4°C. Microbiological analysis The culture and bacterial species identification were performed in accordance with routine diagnostic procedures at the Department of Laboratory Diagnostics, Military Institute of Medicine – National Research Institute. The material was promptly cultured on nonselective media (Columbia agar supplemented with 5% sheep blood, McConkey agar, Chapman agar, and Sabouraud agar), as well as the selective medium for Haemophilus species, and Schaedler agar for the cultivation of anaerobic bacteria. All plates were incubated for 24–48 hours at 37°C under a 5% CO 2 atmosphere, except for Schaedler agar plates, which were cultured at the same temperature but under anaerobic conditions. The isolated colonies were accurately identified using Matrix-Assisted Laser Desorption Ionization-Time of Flight mass spectrometry (MALDI-TOF) (VITEK MS, bioMérieux, France) according to the manufacturer’s instructions. DNA isolation Prior to DNA isolation, PAL and SIN samples were sonicated twice for 30 s at room temperature in an ultrasonic washer (Polsonic). Freshly prepared lysozyme (100 µl, stock 100 mg/ml, Thermo Fisher Scientific), RNase A (10 µl, from DNA Extraction Genomic Mini, Blirt) and freshly prepared lysostaphin (8 µl, stock 10 mg/ml, Sigma-Aldrich) were added and the samples were incubated for 40 min at 37°C. DNA was extracted using DNA Extraction Genomic Mini kit (Blirt). Following the addition of GL Lysis Buffer (750 µl) and proteinase K (50 µl), the samples were incubated for 30 min at 55°C and later transferred to BashingBead Lysis Tubes (Zymo Research). They were vortexed for 5 min at 3,000 rpm and subsequently centrifuged for 2 min at 14,500 rpm using an Eppendorf Mini Spin centrifuge. The supernatants were then subjected to on-column DNA purification following the manufacturer’s instructions. DNA was eluted from the columns using 50 µl Elution buffer. Human DNA was not removed from the samples. DNA concentration was determined using QuantiFluor ONE dsDNA System (Promega) and Quantus Fluorometer (Promega). DNA was aliquoted and frozen at -80C° until further use. Primer design for quantitative PCR Primer pairs were designed to amplify the fragments of the 16S rRNA gene. The following bacterial species were selected: Eikenella corrodens , F. nucleatum , Peptostreptococcus anaerobiu s, Porphyromonas endodontalis , Porphyromonas gingivalis , Prevotella intermedia , Prevotella nigrescens , Pseudomonas aeruginosa , and S. aureus . First, the eHOMD 16S rRNA Reference Sequence Tree from the Human Oral Microbiome Database website ( 25 ) was used to identify the closest relatives of each bacterial species analyzed. Then, the 16S rRNA gene sequences from each group were retrieved from the ATCC Genome Portal ( 26 ), NCBI Reference Sequence Database ( 27 , 28 ) and GenBank ( 28 ). Multiple alignments were performed using Clustal Omega with default settings ( 29 , 30 ), and visualized with Jalview version 2.11.1.3 ( 30 ). Regions in which all retrieved 16S rRNA sequences from selected bacterial species were identical and the sequences from their closest relatives exhibited mismatches were selected for primer design with Primer-BLAST ( 31 ). The main Primer-BLAST parameters were as follows: primer length, 15–25 nt; PCR product length, 100–200 bp; primer melting temperature, 57–63°C (optimal: 60°C). Primer pairs were screened with Primer-BLAST for self-complementarity and self-3’-complementarity. Each primer pair’s specificity was checked in silico against Bacteria (taxid:2) RefSeq representative genomes, Homo sapiens (taxid:9606) reference genome sequence, and the RefSeq human mitochondrial DNA sequence (NC_012920.1). Primers used for the simultaneous detection of S. anginosus group ( Streptococcus anginosus, Streptococcus constellatus , and Streptococcus intermedius ) 16S rRNA were described previously by Olson et al. ( 16 ). Prior to QPCR on patients’ samples, primers were experimentally tested, and the best-performing primer pairs were used for further experiments. Primer sequences, product lengths, and the results of the in-silico specificity analyses are provided in Table 1 and Supplementary Table 1. Table 1 Characteristics of primers used in the study: taxon specificity, sequence and product length. Taxon specificity Forward primer sequence Reverse primer sequence Product length [bp] Eikenella corrodens GTGGCGAACGGGTGAGTAAT AATAACGCGAGGTCTTGCGA 124 Fusobacterium spp. CCGCGGTAATACGTATGTCAC CGCAATACAGAGTTGAGCCCT 110 Peptostreptococcus anaerobius AGGAAGCCCCGGCTAACTA CTCAAGTCTTCCAGTTTCGGA 161 Porphyromonas endodontalis CGTAACGCGTATGCAACCTG CTTTCCGTCCTCCTCCATGC 100 Porphyromonas gingivalis CGACCGGATGCGAATCTCTA GAACGTATTCACCGCGCCAT 116 Prevotella intermedia CTGTTAGCGCCTGGCGTTA GTCAACATCTCTGTATCCTGCG 191 Prevotella nigrescens CGCCATTGCATGTACCTCAT TCACAACACGCTTAACAGACC 134 Pseudomonas aeruginosa GCTAATACCGCATACGTCCTGA GCCTTGGTAGGCCTTTACCC 110 Staphylococcus aureus ACGAGAAGCTTGCTTCTCTGAT GCAGCGCGGATCCATCTAT 176 Streptococcus anginosus group CCACACTGGGACTGAGACAC ( 16 ) AGCCGTCCCTTTCTGGTTAAG ( 16 ) 199 Quantitative PCR (QPCR) Quantitative polymerase chain reaction (QPCR) was employed for absolute quantification. The standard curves were prepared using reference genomic DNA from type strains. Bacterial DNA reference samples were obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ, https://www.dsmz.de/ ), see Supplementary Table 2. The Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent) was used for the QPCR. Each reaction contained 10 µl of 2× SYBR Green QPCR master mix, 30 nM ROX (reference dye), 200 nM of each primer, and 1 µl of DNA template, resulting in a final reaction volume of 20 µl. To generate the standard curves, serial dilutions of the reference DNA were prepared (10 ng/µl, 1 ng/µl, 100 pg/µl, 10 pg/µl, 1 pg/µl, 100 fg/µl, 10 fg/µl), and 1 µl from each dilution was used as the template for the QPCR reaction. To assess the potential for unspecific primer binding to human DNA, genomic DNA from human fibroblasts (1 ng/reaction) was employed. To ascertain the specificity of primer pairs for a particular bacterial species, namely Prevotella spp. and Porphyromonas spp., genomic DNA (1 ng/reaction) from other species within the same genus was incorporated as a control (results are provided in Supplementary Table 1). Two technical replicates were prepared for each DNA sample. The Agilent Aria Mx instrument was employed, and the QPCR conditions were as follows: a hot start for 3 min at 95°C, denaturation for 5 s at 95°C, primer annealing/extension for 10 s at 60°C, and 45 cycles in total. Following the QPCR, a melt curve analysis was conducted with a resolution of 0.5°C and a soak time of 5 s. Quantitative PCR results analysis QPCR results below the lowest point on the standard curve and/or with an incorrect melting curve were excluded from further analysis. DNA mass in each standard curve point was converted into the number of bacterial genomes (Supplementary Table 2). The following data were used for the calculations: genome size in base pairs and GC content retrieved from the ATCC Genome Portal (Supplementary Table 2); GC base pair molecular weight of 616.4 g/mol and a mass of 1.024 × 10 − 6 fg; AT base pair molecular weight of 615.4 g/mol and a mass of 1.022 × 10 − 6 fg. The dissociation of hydrogen ions from phosphate groups in DNA at the physiological pH was accounted for in the calculations ( 32 ). Based on the standard curve, the number of bacterial genomes of each analyzed taxon were calculated for every sample. The results were then converted into percentages of the total. 16S rRNA amplicon library preparation and sequencing Bacterial 16S rRNA gene fragments were amplified using primers targeting the V3–V4 hypervariable regions, following the standard Illumina 16S Metagenomic Sequencing Library Preparation protocol. Amplicon libraries were prepared using Nextera XT chemistry and sequenced on the Illumina MiSeq platform with a MiSeq Reagent Kit v3 (2 × 300 bp paired-end reads). All steps were performed according to the manufacturer's instructions. Sequencing was conducted on DNA extracted from PAL and SIN samples collected from three arbitrarily chosen patients diagnosed with odontogenic sinusitis. The same DNA extracts were also used for quantitative PCR analysis. Bioinformatic Analysis of 16S rRNA amplicon sequencing results Raw sequencing data were processed using the QIIME 2 pipeline (QIIME2 v. 2023.9) ( 33 ). Demultiplexed reads were denoised and dereplicated using the deblur plugin with default parameters ( 34 ). Taxonomic classification was assigned at the genus level using a pre-trained Naïve Bayes classifier ( 35 ) based on the SILVA 16S rRNA gene reference database (SILVA 138.1 SSURef Nr 99) ( 35 ). Prior to beta diversity analysis, the feature table was rarefied to a depth of 10,000 sequences per sample to normalize sequencing depth across samples. Bray–Curtis dissimilarity metrics were calculated, and Principal Coordinates Analysis (PCoA) was performed to visualize differences in microbial community structure. Subsequent statistical analyses and visualizations were conducted in R Studio (version 2024.04.2 + 764) ( 36 ) using the phyloseq , dplyr , and ggplot2 packages. The raw sequencing data (FASTQ files) are publicly available in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under BioProject accession number PRJNA1333631. Statistical analysis of QPCR results Data visualization and statistical analysis of QPCR results were performed with GraphPad Prism version 10.3.0 for Windows. The Wilcoxon matched pairs test was used to compare the number of detected taxa between paired SIN and PAL samples. The Jaccard distance was calculated between paired SIN and PAL samples, based on binary detected/undetected data for each identified bacterial taxon. The Wilcoxon signed-rank test was used to determine whether the Jaccard distances differed significantly from zero. These statistical analyses were performed in Python using pandas , scipy , and seaborn libraries. Jaccard distances were calculated with scipy.spatial.distance.jaccard , and the Wilcoxon test was implemented using scipy.stats.wilcoxon . A statistical significance level in all tests was set to α = 0.05. Results Conventional culture detected nine pathogenic bacterial taxa in 31 tooth socket swabs and 28 ipsilateral maxillary sinus irrigation samples from 28 ODS patients (Table 2 , Supplementary Table 3). Pathogens such as S. aureus, S. anginosus , and Fusobacterium spp. were recovered; however, the overall detection rate was low, with many samples yielding no culturable pathogens. Furthermore, there was only a small overlap in the taxa between tooth socket swabs and maxillary sinus irrigation isolates, highlighting the limited sensitivity of culture methods in samples from patients with ODS. Table 2 Culturable pathogenic bacteria in ODS patients’ tooth socket swabs (n = 31) and ipsilateral sinus irrigation specimens (n = 28). Taxon % of positive tooth socket swabs % of positive sinus irrigation samples No. of paired positive tooth socket swabs and sinus irrigation samples Fusobacterium spp. 0.0 3.6 0 Hafnia spp. 3.2 3.6 1 Prevotella spp. 0.0 3.6 0 Routella spp. 0.0 3.6 0 Staphylococcus aureus 3.2 7.1 1 Streptococcus anginosus 0.0 10.7 0 Streptococcus pneumoniae 3.2 0.0 0 Streptococcus pyogenes 0.0 3.6 0 Veilonella spp. 3.2 0.0 0 On the other hand, quantitative PCR (QPCR) markedly outperformed culture methods in detecting bacterial taxa (Table 3 , Supplementary Table 4). High prevalence rates were observed in tissue scrapings from periapical lesion (PAL) for P. gingivalis (96.8%), Fusobacterium spp. (90.3%), and the S. anginosus group (90.3%). Although sinus mucosal biopsy specimens (SIN) were less frequently positive, they still showed notable detection rates for the same taxa, with rates 89.3%, 67.9%, and 50.0%, respectively. Additionally, E. corrodens , P. endodentalis , and P. nigrescens were frequently detected in both PAL and SIN samples in several instances. In contrast, some species such as P. anaerobius and S. aureus were rarely detected or completely absent. Table 3 Bacterial taxa detected by QPCR in ODS patients’ periapical lesions (PAL, n = 31) and sinus biopsy specimens (SIN, n = 28). Taxon % of positive PAL samples % of positive SIN samples No. of paired positive PAL and SIN samples Eikenella corrodens 83.9 39.3 9 Fusobacterium 90.3 67.9 19 Peptostreptococcus anaerobius 0.0 0.0 0 Porphyromonas endodontalis* 74.2 46.4 12 Porphyromonas gingivalis 96.8 89.3 24 Prevotella intermedia 41.9 21.4 5 Prevotella nigrescens 77.4 35.7 7 Pseudomonas aeruginosa** 77.4 57.1 15 Staphylococcus aureus 0.0 3.6 0 Streptococcus anginosus group 90.3 50.0 12 *Results determined for 27 out of 28 patients. ** Results determined for 24 out of 28 patients. QPCR performed for the whole study group and 16S rRNA amplicon sequencing for three arbitrary chosen ODS patients provided complementary insights into the microbial composition of SIN and PAL samples. QPCR quantification of ten targeted bacterial taxa revealed substantial bacterial loads in both SIN and PAL samples. The number of bacterial genomes per sample was consistently higher in PAL than in SIN specimens (Fig. 1 A–B, Supplementary Table 4). Additionally, the number of detected taxa per sample was significantly higher in PAL compared to the paired SIN samples (Wilcoxon matched-pairs test, p = 0.0004; Fig. 1 C). The highest median number of bacterial genomes was detected for Fusobacterium spp. in the analyzed panel of PAL samples, followed by the S. anginosus group, E. corrodens , and P. gingivalis (Fig. 1 B). In SIN samples, Fusobacterium spp. genomes were the most dominant, with a lower load of the S. anginosus group, P. gingivalis and P. endodontalis (Fig. 1 A). The 16S rRNA sequencing further confirmed the polymicrobial nature of ODS, demonstrating complex bacterial communities in both SIN and PAL sites. Comparative analysis of raw read counts and relative abundances across three randomly chosen patients (P6, P15, P25) showed inter-individual variability in microbial load and dominant taxa (Fig. 2 A–D). At the genus level, both SIN and PAL samples were dominated by anaerobic genera (e.g., Prevotella , Porphyromonas ), with their relative contributions varying by individual (Fig. 2 D). When normalized to 100%, the top 10 genera accounted for most reads, while the “Other” category reflected additional microbial diversity (Fig. 2 D). To assess the detection capacity and utility of targeted QPCR for characterizing the microbial burden in SIN and PAL samples from patients with ODS, we directly compared the outcomes of QPCR and 16S rRNA sequencing for patients P6, P15, and P25. We examined the proportional contribution of the taxa selected for targeted PCR relative to their representation in the 16S rRNA amplicon sequencing data, as shown in Figs. 3 A and 3 B (se also Supplementary Table 4). In SIN samples from patients P6 and P15, targeted qPCR accounted for over 90% of the microbial burden detected by NGS, whereas in their PAL samples this proportion decreased to 40–50%. For patient P25, targeted PCR detected less than 30% of the bacteria in both sample types. The most notable discrepancy between the two approaches was the underrepresentation of Fusobacterium in the sequencing results, despite its consistent detection by QPCR. Analysis of similarity between paired SIN and PAL samples revealed both concordance and heterogeneity. Jaccard distance analysis of PCR results on bacteria absence or presence (Fig. 4 A) indicated that while certain patients exhibited nearly identical microbial profiles between sites (e.g., P9, P12, P25, P27: distance 0.00), others showed notable dissimilarity (e.g., P2: distance 1.00; P22: distance 0.88). The median Jaccard distance for the whole group was 0.46. Overall, Wilcoxon signed-rank testing confirmed that microbial communities between SIN and PAL were significantly different (p < 0.0001). Principal Coordinates Analysis (PCoA) based on Bray–Curtis dissimilarity further supported these findings. It demonstrated clear clustering of SIN and PAL samples for Patient P25, while also revealing patient-specific variations in microbial composition for Patients P6 and P15 (Fig. 4 B). Interestingly, these results were concordant with Jaccard distance analysis, despite the broader range of taxa detected in NGS. These findings indicate that while there is significant overlap between the microbiota of the periapical area and the sinuses in cases of odontogenic sinusitis, the microbial community in these two anatomical sites are not identical. It also shows a distinct enrichment of certain anaerobic species. This suggests that the microbial composition in the sinus is not simply an extension of the periapical microbiota; rather, it reflects additional ecological pressures and specific selection processes related to the unique environment of the sinus. Moreover, the use of targeted PCR as a diagnostic method for assessing microbial burden in ODS, compared to 16S rRNA sequencing, showed promising results. In two out of the three patients studied here, the selected primers detected nearly 90% of the bacterial taxa present in the sinus found by 16S rRNA sequencing. It is important to note that these primers were specifically designed based on taxa commonly found in sinus samples, rather than those from the dental microbiota of patients with ODS. This distinction is clearly reflected in our findings. However, in the third patient, whose sinus and dental microbiota were highly similar, the primers designed for sinus-dominant taxa detected less than 30% of the bacterial burden in the sinus samples. These results, presented here for the first time, emphasize the significant diversity of microbiomes in ODS patients and highlight the diagnostic challenges associated with selecting the most appropriate technique. Discussion Despite being a well-established clinical entity, ODS is less characterized compared to other subtypes of chronic rhinosinusitis (CRS), such as CRS with nasal polyps (CRSwNP) and CRS without nasal polyps (CRSsNP). The European Position Paper on Rhinosinusitis and Nasal Polyps (EPOS) includes ODS in its classification framework, but it remains a marginally studied subset with unique pathophysiological and microbiological features that are not thoroughly addressed by the broader CRS framework ( 37 ). One of the most significant knowledge gaps relates to the microbial etiology of ODS. Most of the existing research on CRS has focused on inflammatory mechanisms and microbiota linked to sinonasal dysbiosis, biofilm formation, and host-microbe interactions in the nasal cavity and paranasal sinuses ( 38 – 41 ). In contrast, the microbial landscape of ODS is less understood, largely because it originates from a different anatomical and ecological niche: the oral cavity. The translocation of oral pathogens into the maxillary sinuses creates a distinct polymicrobial environment, often dominated by anaerobic species and biofilm-forming microorganisms that are difficult to isolate using standard culture methods ( 9 , 42 ) . Several studies have compared microbial detection techniques, such as culture-based methods, next-generation sequencing (NGS), and polymerase chain reaction (PCR) in CRS diagnostics, but in ODS it remains understudied ( 4 , 8 , 9 , 23 , 39 , 43 , 44 ). Anaerobic bacteria are the predominant microorganisms found in odontogenic lesions, and they exhibit greater diversity than what traditional cultural diagnostics suggest ( 8 ). To date, only a few studies have provided data on microbiome specific for ODS ( 20 , 45 ), and none have analyzed the material using three methods simultaneously: classical microbiology culture, targeted QPCR, and NGS. Due to the logistical challenges and the need for an interdisciplinary approach to ODS patients, existing data have primarily focused on microbial diversity in either sinus or periapical regions ( 20 , 45 – 50 ). This is the first study to compare these three diagnostic techniques while profiling microbial load in both locations of patients with clinically and radiologically confirmed ODS. In our QPCR analysis, high bacterial load in PAL samples was detected for Fusobacterium spp., Porphyromonas spp., Prevotella spp., and members of the S. anginosus group. These anaerobic and microaerophilic species are typical of periodontal infections and play established pathogenic roles in the spread of infection to deeper tissues ( 4 , 10 , 24 , 51 ). The results are partly consistent with published QPCR analysis on the composition of the microbiota outside root canal, with the main bacteria identified as Actinomyces spp., Propionibacterium, Prevotella spp., oral streptococci, P. endodontalis , and Burkholderia ( 44 , 52 ). In the literature review by Craig et al. ( 53 ) Prevotella , Fusobacterium , and Peptostreptococcus were the most commonly isolated species, although Peptostreptococcus was not detected in the cohort described in the presented study. Oral microbiome composition varies across populations and clinical settings, possibly explaining why some cohorts detect Peptostreptococcus while others do not. Fusobacterium nucleatum , consistently detected at high loads in our qPCR analysis, is considered an organism that facilitates co-aggregation of diverse oral taxa and stabilizes biofilm communities. Its dominance may suppress or ecologically displace Peptostreptococcus in some periapical lesions, accounting for the variability in detection across studies ( 54 ). While QPCR demonstrated high specificity for targeted pathogens, 16S rRNA sequencing provided a broader ecological overview, detecting a greater number of taxa. Correlation analysis between relative abundance of species identified by QPCR and the sequencing technique showed moderate alignment, indicating that both methods may serve complementary roles in microbiological assessment. In our study, most of the genera detected using 16S rRNA amplicon sequencing, such as Fusobacterium , Porphyromonas , Prevotella , Streptococcus , Veillonella , Capnocytophaga , Tannerella , Treponema , and Lactobacillus , are well-known members of the oral microbiota and have been associated with odontogenic infections. In contrast, Pseudoalteromonas is a genus typically found in marine environments and is not usually linked to the oral cavity or odontogenic sinusitis. However, since it was absent from our negative controls, its presence in patient samples may still be worth considering. A notable discrepancy in our results between QPCR and 16S rRNA amplicon sequencing was the different detection rate of Fusobacterium spp. While qPCR consistently identified Fusobacterium with high prevalence in both PAL and sinus samples, the sequencing technique frequently underrepresented or classified these reads under broader taxonomic categories. This discrepancy is consistent with previous reports highlighting primer bias and classification limitations in 16S rRNA amplicon sequencing ( 55 , 56 ). The universal primers used in 16S rRNA amplicon sequencing do not function equally well across all taxa, and Fusobacterium often exhibit mismatches at conserved primer-binding regions, leading to reduced amplification. Furthermore, taxonomic assignment pipelines can misclassify Fusobacterium reads into higher-level categories, particularly when sequence similarity is high within oral anaerobe clades. In contrast, the group-specific QPCR method used in this study ensured targeted and sensitive detection and quantification even at low abundance levels. These findings emphasize the complementary roles of QPCR and NGS: while QPCR offers high sensitivity for selected pathogens, NGS provides a more comprehensive community profile but may overlook certain clinically relevant taxa, such as Fusobacterium . The current hypothesis suggests that ODS arises from the translocation of pathogenic bacteria from periapical lesions into the maxillary sinus. This process leads to a distinct yet overlapping microbial community between the two sites. While PAL samples contain a higher bacterial burden and greater microbial diversity, certain anaerobic species are consistently found in both the sinus microbiota and the PAL samples. The sinus environment further modifies this microbial composition, leading to selective enrichment or depletion of particular taxa ( 57 , 58 ). Our study corroborated the finding of greater microbial diversity in PAL compared to sinus samples. QPCR analysis revealed a significantly higher number of selected taxa in PAL samples (Wilcoxon test: p = 0.0009). Furthermore, 16S rRNA amplicon sequencing revealed greater microbial diversity in the analyzed PAL samples, as evidenced by an increased relative abundance of taxa other than the ten most abundant. Comparison of microbiota from the dental socket (post-extraction site) and maxillary sinus using Jaccard distance calculation revealed significant differences between these sites (p < 0.0001). While some patients exhibited nearly identical microbial profiles, others showed only partial overlap and individualized patterns of bacterial colonization. These results emphasize the importance of dual site sampling to capture the full microbiological landscape of ODS. It also indicates that ODS is not simply the result of passive migration of oral bacteria, but rather a complex, host-modulated infectious process. These findings challenge previous assumptions and point toward a more dynamic microbial exchange between dental and sinonasal environments, which is influenced by factors such as host immunity, mucosal barrier function, and environmental conditions like oxygen availability ( 57 )( 59 ). Importantly, molecular profiling has implications for treatment. The high prevalence of anaerobes and mixed infections identified through molecular methods suggests that empiric antibiotic regimens used in CRS may be suboptimal for ODS. This condition often requires antibiotics that specifically target oral anaerobes, such as Fusobacterium , Prevotella , and Porphyromonas . Therefore, molecular diagnostics may serve as a basis for personalized therapeutic strategies, especially in cases that are recurrent or refractory to standard therapies. Although 16S rRNA sequencing provided the most comprehensive insight into the microbial diversity of ODS, it is expensive and requires advanced technical and bioinformatic expertise, which may limit its routine application in smaller hospital laboratories. Our proposal to use ten primer pairs in QPCR could accelerate the diagnostic process and support underfunded hospital settings in managing the complex etiology of ODS, ultimately improving the management of sinus infections. Classical microbial culture proved to be the least effective method here, mainly due to the anaerobic physiology of the predominant pathogens and the diagnostic challenges associated with this. However, without pure isolates, the detection of multidrug-resistant strains remains impossible unless whole-genome sequencing is performed, which further increases both the cost and workload. Conclusions With this study, we also aim to draw attention to the microbiology of ODS, which is etiologically distinct from other forms of CRS and has not yet received proportionate scientific attention. While there is overlap in bacterial communities, sinus samples exhibit a lower burden and site-specific shifts in taxa composition. Culture alone underestimates ODS microbial complexity, whereas QPCR and 16S rRNA amplicon sequencing provide much deeper insights. Molecular microbiology offers modern tools that can help assess the microbial complexity of this condition and fill the knowledge gap. Our research was carried out on a relatively small patient cohort; therefore, further multicenter studies are necessary to confirm our findings. Nevertheless, this approach may open new diagnostic possibilities for these complicated cases of upper respiratory tract infections, which are by no means rare. Abbreviations ODS odontogenic sinusitis CRS chronic rhinosinusitis CT computed tomography CBCT cone-beam computed tomography PAL periapical lesion RCT root-canal treatment ESS endoscopic sinus surgery MS maxillary sinus QPCR quantitative polymerase chain reaction OAC oroantral communication NGS next generation DNA sequencing Declarations Ethics approval and consent to participate This study has been carried out in accordance with “The Code of Ethics of the World Medical Association (Declaration of Helsinki)” for experiments involving humans. It was approved by the Ethics Committee of the Military Institute of Medicine (protocol No 43/WIM/2019), and written informed consent was obtained from each participant. Consent for publication The manuscript contains anonymized data of involved patients. All included participant signed informed consent for publication. Funding The study was partially founded by Institutional Grant number 565 of Military Institute of Medicine – National Research Institute. Data availability statement Newly Generated Data The Conventional Culture Data was newly generated for this study. Details of this dataset can be found in Supplementary Table 3. The QPCR Quantification Data was also newly generated. Further information is available in Supplementary Table 1 and Supplementary Table 2. The 16S rRNA Amplicon Sequencing Data is included in this study. This dataset is available for the reviewers in the NCBI Sequence Read Archive with the DOI or accession ID: https://dataview.ncbi.nlm.nih.gov/object/PRJNA1333631?reviewer=1gdtd4aenfnq1b6h29d6a3hkr5 The QPCR Primer Pairs Data is part of the newly generated data for this research. It is detailed in Supplementary Table 1. The Comparative Culture Pathogen Data was generated during this study and is detailed in Supplementary Table 3. The QPCR Results Data was newly generated and is detailed in Supplementary Table 4. Reused Data The Reference Genomic Bacterial DNA Data was reused in this study. Details of this dataset can be found in Supplementary Table 2. Acknowledgemen ts Not applicable. Authors contribution statement M.A.K., E.A.T., A.T.-S. D.J., and A.G. have made substantial contributions to the conception and design of the work; E.A.T, A.T.-S., K.A. and A.G. performed the analysis and interpretation of data; M.A.K. and D.J. were responsible for acquisition of data and funding , M.A.K., E.A.T and A.T-S. wrote the main manuscript text, A.G. and D.J. have revised the manuscript. All authors approved the final version of the manuscript. References Craig, J. R. Odontogenic sinusitis: A state-of-the-art review. Vol. 8, World Journal of Otorhinolaryngology - Head and Neck Surgery. John Wiley and Sons Inc; 8–15. (2022). Brook, I. Sinusitis of odontogenic origin. Vol. 135, Otolaryngology - Head and Neck Surgery. pp. 349–55. (2006). Little, R. E., Long, C. M., Loehrl, T. A. & Poetker, D. M. Odontogenic sinusitis: A review of the current literature Vol. 3, p. 110–114 (John Wiley and Sons Inc, 2018). Laryngoscope Investigative Otolaryngology. Puglisi, S. et al. Bacteriological findings and antimicrobial resistance in odontogenic and non-odontogenic chronic maxillary sinusitis. J. Med. Microbiol. 60 (9), 1353–1359 (2011). Craig, J. R. & Hopkins, C. Sinus Pathophysiology of Odontogenic Sinusitis. Otolaryngol Clin North Am [Internet]. ;57(6):1007–18. (2024). Available from: https://linkinghub.elsevier.com/retrieve/pii/S0030666524000914 Micaela, C. M. & Paula, C. B. Pineda Álvarez David. Odontogenic sinusitis, a differential diagnosis: Literature review. World J. Adv. Res. Reviews . 18 (1), 1241–1247 (2023). Workman, A. D., Granquist, E. J. & Adappa, N. D. Odontogenic sinusitis: Developments in diagnosis, microbiology, and treatment. Vol. 26, Current Opinion in Otolaryngology and Head and Neck Surgery. Lippincott Williams and Wilkins; 27–33. (2018). Thol, F., Warwas, F. B., Spuck, N., Kramer, F. J. & Heim, N. Microbial spectrum and resistance of odontogenic abscesses - microbiological analysis using next generation sequencing. Clin. Oral Investig ; 29 (1). (2025). Rapoport, S. K. et al. Determining the utility of standard hospital microbiology testing: Comparing standard microbiology cultures with DNA sequence analysis in patients with chronic sinusitis. World J. Otorhinolaryngol. Head Neck Surg. 5 (2), 82–87 (2019). Yu, A. J., Espinosa, M., Adappa, N. D. & Douglas, J. E. Complicated Odontogenic Sinusitis: Extrasinus Infectious Spread. Otolaryngologic Clinics of North America (W.B. Saunders, 2024). Palomo López, N. & Freire Aragón, M. D. Rivera Fernández V. Subdural empyema as a complication of odontogenic maxillary sinusitis. Med. Intensiva (English Edition) . 42 (8), e21–e22 (2018). Campbell, A. P., Bergmark, R. W. & Metson, R. Orbital complications of acute sinusitis. Operative Techniques Otolaryngol. - Head Neck Surg. 28 (4), 213–219 (2017). Zirk, M. et al. Odontogenic sinusitis maxillaris: A retrospective study of 121 cases with surgical intervention. J. Cranio-Maxillofacial Surg. 45 (4), 520–525 (2017). Takahashi, H., Matsuyama, T., Kawabata-Iwakawa, R., Kawamoto, T. & Chikamatsu, K. Comprehensive profiling of the heterogeneity of molecular endotypic traits in chronic rhinosinusitis. Hum. Immunol. ; 86 (3). (2025). Böttger, S. et al. Clinical relevance of the microbiome in odontogenic abscesses. Biology (Basel) ; 10 (9). (2021). Development of Real-. Time PCR Assays for Detection of the Streptococcus milleri Group from Cystic Fibrosis Clinical Specimens by Targeting the cpn60 and 16S rRNA Genes. Dufkova, K. et al. Sequencing Independent Molecular Typing of Staphylococcus aureus Isolates: Approach for Infection Control and Clonal Characterization. Microbiol. Spectr. ; 10 (1). (2022). Haider, A. A., Marino, M. J., Yao, W. C., Citardi, M. J. & Luong, A. U. The Potential of High-Throughput DNA Sequencing of the Paranasal Sinus Microbiome in Diagnosing Odontogenic Sinusitis. Otolaryngology - Head and Neck Surgery. (United States) . 161 (6), 1043–1047 (2019). Wu, J. et al. Bacterial Diversity and Community Characteristics of the Sinus and Dental Regions in Adults with Odontogenic Sinusitis [Internet]. (2023). Available from: https://www.researchsquare.com/article/rs-2562730/v1 Ping, Y., Wang, J. & Liang, J. Pyrosequencing analysis of apical microbiota of teeth with persistent apical periodontitis. J. Dent. Sci. 10 (4), 365–371 (2015). Lin, J. et al. Expert consensus on odontogenic maxillary sinusitis multi-disciplinary treatment Vol. 16 (Springer Nature, 2024). International Journal of Oral Science. Yassin-Kassab, A. et al. Comparison of bacterial maxillary sinus cultures between odontogenic sinusitis and chronic rhinosinusitis. Int. Forum Allergy Rhinol . 11 (1), 40–47 (2021). Areizaga-Madina, M., Pardal-Peláez, B. & Montero, J. Microbiology of Maxillary Sinus Infections: Systematic Review on the Relationship of Infectious Sinus Pathology with Oral Pathology. Oral 3 (1), 134–145 (2023). Saibene, A. M. et al. Odontogenic and rhinogenic chronic sinusitis: A modern microbiological comparison. Int. Forum Allergy Rhinol . 6 (1), 41–45 (2016). Escapa, I. F. et al. New Insights into Human Nostril Microbiome from the Expanded Human Oral Microbiome Database (eHOMD): a Resource for the Microbiome of the Human Aerodigestive Tract. mSystems ; 3 (6). (2018). Yarmosh, D. A. et al. Comparative Analysis and Data Provenance for 1,113 Bacterial Genome Assemblies. mSphere ; 7 (3). (2022). O’Leary, N. A. et al. Reference sequence (RefSeq) database at NCBI: Current status, taxonomic expansion, and functional annotation. Nucleic Acids Res. 44 (D1), D733–D745 (2016). Sayers, E. W. et al. GenBank Nucleic Acids Res. ; 48 (D1):D84–D86. (2020). Madeira, F. et al. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Res. 52 (W1), W521–W525 (2024). Waterhouse, A. M., Procter, J. B., Martin, D. M. A., Clamp, M. & Barton, G. J. Jalview Version 2-A multiple sequence alignment editor and analysis workbench. Bioinformatics 25 (9), 1189–1191 (2009). Ye, J. et al. -BLAST: A tool to design target-specific primers for polymerase chain reaction [Internet]. (2012). Available from: http://www.biomedcentral.com/1471-2105/13/134 Nuclear, D. N. A. Content and Genome Size of Trout and Human. Bolyen, E. et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2 Vol. 37, p. 852–857 (Nature Publishing Group, 2019). Nature Biotechnology. Bokulich, N. A. et al. Optimizing taxonomic classification of marker-gene amplicon sequences with QIIME 2’s q2-feature-classifier plugin. Microbiome ; 6 (1). (2018). Quast, C. et al. The SILVA ribosomal RNA gene database project: Improved data processing and web-based tools. Nucleic Acids Res. 41 , D1 (2013). Posit Team. RStudio: Integrated Development Environment for R. Posit Software (PBC, 2024). http://www.posit.co/ Fokkens, W. J. et al. European Position Paper on Rhinosinusitis and Nasal Polyps 2020. Vol. 103, Dieudonné Nyenbue Tshipukane. Sivasubramaniam, R. & Douglas, R. The microbiome and chronic rhinosinusitis. Vol. 4, World Journal of Otorhinolaryngology - Head and Neck Surgery. KeAi Communications Co.; 216–221. (2018). Michalik, M. & Krawczyk, B. Chronic Rhinosinusitis—Microbiological Etiology, Potential Genetic Markers, and Diagnosis Vol. 25 (Multidisciplinary Digital Publishing Institute (MDPI), 2024). International Journal of Molecular Sciences. Stryjewska-Makuch, G., Janik, M. A., Lisowska, G. & Kolebacz, B. Bacteriological analysis of isolated chronic sinusitis without polyps. Postepy Dermatol. Alergol . 35 (4), 375–380 (2018). Kim, D., Assiri, A. M. & Kim, J. H. Recent trends in bacteriology of adult patients with chronic rhinosinusitis. J. Clin. Med. ; 8 (11). (2019). Brook, I. Microbiology of acute and chronic maxillary sinusitis associated with an odontogenic origin. Laryngoscope 115 (5), 823–825 (2005). Urbán, E., Gajdács, M. & Torkos, A. The incidence of anaerobic bacteria in adult patients with chronic sinusitis: A prospective, single-centre microbiological study. Eur. J. Microbiol. Immunol. (Bp) . 10 (2), 107–114 (2020). Wu, J. et al. Bacterial diversity and community characteristics of the sinus and dental regions in adults with odontogenic sinusitis. BMC Microbiol. ; 23 (1). (2023). Lu, Y. T. et al. Microbiota dysbiosis in odontogenic rhinosinusitis and its association with anaerobic bacteria. Sci. Rep. ; 12 (1). (2022). Maruyama, N. et al. Intraindividual variation in core microbiota in peri-implantitis and periodontitis. Sci. Rep. ; 4 . (2014). Siqueira, J. F. & RôÇas, I. N. Distinctive features of the microbiota associated with different forms of apical periodontitis. 1 , J. Oral Microbiol. (2009). Qian, W. et al. Microbiota in the apical root canal system of tooth with apical periodontitis. BMC Genom. ; 20 . (2019). Mussano, F. et al. Apical periodontitis: Preliminary assessment of microbiota by 16S rRNA high throughput amplicon target sequencing. BMC Oral Health ; 18 (1). (2018). Chen, W. P. et al. Composition Analysis and Feature Selection of the Oral Microbiota Associated with Periodontal Disease. Biomed Res Int. ;2018. (2018). Böttger, S. et al. Clinical relevance of the microbiome in odontogenic abscesses. Biology (Basel) ; 10 (9). (2021). Bordagaray, M. J. et al. Systemic and Extraradicular Bacterial Translocation in Apical Periodontitis. Front. Cell. Infect. Microbiol. ; 11 . (2021). Craig, J. R. et al. Diagnosing odontogenic sinusitis of endodontic origin: A multidisciplinary literature review Vol. 42 (W.B. Saunders, 2021). American Journal of Otolaryngology - Head and Neck Medicine and Surgery. Brennan, C. A. & Garrett, W. S. Fusobacterium nucleatum — symbiont, opportunist and oncobacterium Vol. 17, p. 156–166 (Nature Publishing Group, 2019). Nature Reviews Microbiology. Brooks, J. P. et al. The truth about metagenomics: Quantifying and counteracting bias in 16S rRNA studies Ecological and evolutionary microbiology. BMC Microbiol. ; 15 (1). (2015). Abusleme, L. et al. The subgingival microbiome in health and periodontitis and its relationship with community biomass and inflammation. ISME J. 7 (5), 1016–1025 (2013). Man, W. H., De Steenhuijsen Piters, W. A. A. & Bogaert, D. The microbiota of the respiratory tract: Gatekeeper to respiratory health Vol. 15, p. 259–270 (Nature Publishing Group, 2017). Nature Reviews Microbiology. Bouillaguet, S. et al. Root microbiota in primary and secondary apical periodontitis. Front Microbiol. ;9(OCT). (2018). Yoshida, H. et al. Relationship between infected tooth extraction and improvement of odontogenic maxillary sinusitis. Laryngoscope Investig Otolaryngol. 7 (2), 335–341 (2022). Additional Declarations No competing interests reported. Supplementary Files SupplementaryTable1.docx Supplementary Table 1. Primer pairs used for QPCR. The sequences of primers, the length of primers and PCR products, and the specificity of primer pairs that have been analyzed both in silico and experimentally. SupplementaryTable2.docx Supplementary Table 2. Reference genomic bacterial DNA used for the standard curve generation in QPCR. Information regarding the source of the reference genomic bacterial DNA, accompanied by the DMSZ reference number, the size, and the GC content of the genome (retrieved from the ATCC Genome Portal). Additionally, the calculated number of genomes per indicated mass of genomic DNA are provided. SupplementaryTable3.docx Supplementary Table 3. Comparative summary of pathogens cultured from ODS patients' sinus irrigation and periapical lesions (PAL) using conventional microbiological culture methods. supplementarytable4.pdf Supplementary Table 4. Results of QPCR performed on DNA isolated from ODS patients' sinus biopsy specimens and periapical lesions (PAL) samples. QPCR primers were designed to amplify 16S rRNA of 10 selected bacterial taxa. The QPCR results are presented as: detected (1) / undetected (0), the number of bacterial genomes or the relative abundance in sample (%). ND: not determined. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-8067667\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":550732407,\"identity\":\"3e0148d0-bbcd-42cd-b12d-34057c0604d7\",\"order_by\":0,\"name\":\"Marta Aleksandra Kwiatkowska\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9klEQVRIiWNgGAWjYDACHgaGAwwMCUAWG5CqAPGBIg8YGGTwa0mAanlwBqolgQHCwKWFAaaF8WEbVBSfFt2eM4YHfv5IkzM4fyzxQ+K8wzK6DdyJQFvu4NRidrbH4GBPQo6xwY20wxKJ2w7zmB3g3QDU8gy3lvNABTwJFYnbbrA3ALXchmk5jFfLwT8gLeePN/9InEOMlrO9Gw7zJOQkbjuQdkwisYEYLWfOfzgsk5ZmbH8jLc0i4dh/HrPDIC0GePxyJi354xubZDnJ/mPGN3/UpNmbHe/d/OFDxR05XFqwAGYQYXCABB1QQIaWUTAKRsEoGK4AAJT7ZwRKeZj+AAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Military Institute of Medicine – National Research Institute\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Marta\",\"middleName\":\"Aleksandra\",\"lastName\":\"Kwiatkowska\",\"suffix\":\"\"},{\"id\":550732408,\"identity\":\"3038fde2-6621-43c9-82d4-8137cacc97f2\",\"order_by\":1,\"name\":\"Alicja Trębińska-Stryjewska\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Military University of Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Alicja\",\"middleName\":\"\",\"lastName\":\"Trębińska-Stryjewska\",\"suffix\":\"\"},{\"id\":550732409,\"identity\":\"73633458-240a-42f8-a26a-e4acf4692cf0\",\"order_by\":2,\"name\":\"Katarzyna Andrejuk\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Military University of Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Katarzyna\",\"middleName\":\"\",\"lastName\":\"Andrejuk\",\"suffix\":\"\"},{\"id\":550732410,\"identity\":\"434d2254-163b-4073-b5e7-79a5ba5c6b89\",\"order_by\":3,\"name\":\"Dariusz Jurkiewicz\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Military Institute of Medicine – National Research Institute\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dariusz\",\"middleName\":\"\",\"lastName\":\"Jurkiewicz\",\"suffix\":\"\"},{\"id\":550732411,\"identity\":\"3d9cca0e-9ba4-4832-98fe-7b5283da8d42\",\"order_by\":4,\"name\":\"Elżbieta Anna Trafny\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Military University of Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Elżbieta\",\"middleName\":\"Anna\",\"lastName\":\"Trafny\",\"suffix\":\"\"},{\"id\":550732412,\"identity\":\"5e7f08a3-8995-4295-9ef0-0139540c4959\",\"order_by\":5,\"name\":\"Aneta Guzek\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Military Institute of Medicine – National Research Institute\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Aneta\",\"middleName\":\"\",\"lastName\":\"Guzek\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-11-09 07:53:19\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-8067667/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-8067667/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":97142944,\"identity\":\"21e46944-aac7-4992-a107-7bc22e8cb56d\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 10:08:09\",\"extension\":\"docx\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":2507128,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"EATATSKACulturePCRandNGSclean2.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/448b15e4aed09c442f8c2810.docx\"},{\"id\":97127190,\"identity\":\"1bbb3f4b-596e-4249-882a-9e5ffa3c176e\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 08:27:02\",\"extension\":\"json\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":9537,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"d69c8397c5d74340b312d4c7ad23dc0c.json\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/68b163f7f46dbfd9a21359ac.json\"},{\"id\":97127187,\"identity\":\"ff9cb4dc-dd29-4706-b281-5d2632008858\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 08:27:02\",\"extension\":\"docx\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":18086,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryTable1.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/d5bf4a119074ab8fcfa77fa2.docx\"},{\"id\":97127192,\"identity\":\"dfca364f-833f-4281-b903-2d6d6138dde2\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 08:27:02\",\"extension\":\"docx\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":17293,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryTable2.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/8dee3bd72129b71670086ca2.docx\"},{\"id\":97142651,\"identity\":\"6ed9ae7a-4e0b-4a5d-89e7-1976cc1e9b79\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 10:07:48\",\"extension\":\"docx\",\"order_by\":4,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":19440,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryTable3.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/38973c5a7d1bfd6299dd4e28.docx\"},{\"id\":97127197,\"identity\":\"c78c768f-2a4b-472f-a90d-e96ab74eb596\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 08:27:02\",\"extension\":\"pdf\",\"order_by\":5,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":108436,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"supplementarytable4.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/9deb60e98435f452cab8feb9.pdf\"},{\"id\":97127206,\"identity\":\"bd56fd6c-6b7e-4dc2-8016-ecd22137083a\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 08:27:02\",\"extension\":\"xml\",\"order_by\":6,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":144620,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"d69c8397c5d74340b312d4c7ad23dc0c1enriched.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/f66aea23b5e3bbc299b5f01a.xml\"},{\"id\":97127203,\"identity\":\"a744e550-bc1d-4d1e-9692-bde6bb03b8b3\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 08:27:02\",\"extension\":\"jpeg\",\"order_by\":7,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":655892,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage1.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/4ff44be35f78e5b3113f9788.jpeg\"},{\"id\":97127201,\"identity\":\"f94dea04-7d8a-4085-b404-124dbd313bd7\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 08:27:02\",\"extension\":\"jpeg\",\"order_by\":8,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":511622,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage2.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/2fb7b05e7f6122b572724add.jpeg\"},{\"id\":97127209,\"identity\":\"77f27c17-139a-4819-9ebd-a2a949add666\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 08:27:02\",\"extension\":\"jpeg\",\"order_by\":9,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":595716,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage3.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/2ff4c054c513cb7ce9ca3b4e.jpeg\"},{\"id\":97127205,\"identity\":\"f9377f7a-02c4-465e-91e4-f0cb36f29a3c\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 08:27:02\",\"extension\":\"jpeg\",\"order_by\":10,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":371102,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage4.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/852884fb36e7f7ff72e42765.jpeg\"},{\"id\":97127198,\"identity\":\"df67778e-d3f5-4813-bc96-655e07fb185e\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 08:27:02\",\"extension\":\"png\",\"order_by\":11,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":110290,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/cb77ab0c43cbe856b0bc9034.png\"},{\"id\":97142374,\"identity\":\"fd79da41-0dd7-4dd7-ad08-130ef56205d0\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 10:07:33\",\"extension\":\"png\",\"order_by\":12,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":51795,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/2754bd4e5259c6591b491beb.png\"},{\"id\":97127208,\"identity\":\"25bed0fd-8ddd-4d60-9f77-051cd4b0f0a8\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 08:27:02\",\"extension\":\"png\",\"order_by\":13,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":87676,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/173a6f94c589f8a82e42d9f4.png\"},{\"id\":97142272,\"identity\":\"56c8882d-056f-4107-96fa-883afeb92e54\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 10:07:28\",\"extension\":\"png\",\"order_by\":14,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":49242,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/95b9806d682b7ef6a44259a2.png\"},{\"id\":97127210,\"identity\":\"e82d16be-0889-4a4c-8aff-5f9852b843ef\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 08:27:02\",\"extension\":\"xml\",\"order_by\":15,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":144028,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"d69c8397c5d74340b312d4c7ad23dc0c1structuring.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/53fe560ad89ac149edc2c93a.xml\"},{\"id\":97142928,\"identity\":\"d0b17a9e-8fed-4872-a336-271da06d1599\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 10:08:07\",\"extension\":\"html\",\"order_by\":16,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":159819,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"earlyproof.html\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/90088d4a5b9284a23fc54bd4.html\"},{\"id\":97127185,\"identity\":\"f5c88f51-936e-4007-b47c-4066eb0aa673\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 08:27:02\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":127709,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eA number of bacterial genomes and taxa detected by QPCR in ODS patients’ sinus biopsy specimens (SIN) and periapical lesion samples (PAL). \\u003c/strong\\u003eQPCR was performed on DNA isolated from ODS patients’ SIN and PAL samples with primers designed to amplify 16S rRNA fragments of 10 selected bacterial taxa. The results were compared to the specific standard curves constructed from reference bacterial DNA. (\\u003cstrong\\u003eA, B) \\u003c/strong\\u003eThe number of bacterial genomes per sample\\u003cstrong\\u003e \\u003c/strong\\u003ein\\u003cstrong\\u003e (A) \\u003c/strong\\u003eSIN and (\\u003cstrong\\u003eB)\\u003c/strong\\u003e PAL samples. Median with interquartile range and individual values are shown. (\\u003cstrong\\u003eC\\u003c/strong\\u003e) The number of detected taxa per sample presented on a box plot (box: median with interquartile range, whiskers: 5\\u003csup\\u003eth\\u003c/sup\\u003e and 95\\u003csup\\u003eth\\u003c/sup\\u003e percentile, open circle: results outside of the 5\\u003csup\\u003eth\\u003c/sup\\u003e and 95\\u003csup\\u003eth\\u003c/sup\\u003e percentile range). The number of taxa between paired SIN and PAL samples was compared using the Wilcoxon matched pairs test (p=0.0004). \\u003cem\\u003eStreptococcus anginosus\\u003c/em\\u003e group: \\u003cem\\u003eS. anginosus\\u003c/em\\u003e, \\u003cem\\u003eS. constellatus\\u003c/em\\u003e, \\u003cem\\u003eS. intermedius\\u003c/em\\u003e.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/61af93ea35d873bdcf330777.png\"},{\"id\":97127186,\"identity\":\"40f2175b-835c-402c-b5ac-21afcb87aa66\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 08:27:02\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":107663,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eComparison of the raw read counts and the relative abundance of the 10 most abundant bacterial genera detected by 16S rRNA amplicon sequencing in sinus biopsy specimens (SIN) and periapical lesion samples (PAL) from three ODS patients. \\u003c/strong\\u003e(A-C)\\u003cstrong\\u003e \\u003c/strong\\u003eThe number of\\u003cstrong\\u003e \\u003c/strong\\u003eraw reads in the SIN and PAL samples of (A) Patient 6, (B) Patient 15, and (C) Patient 25. (D) The relative abundance at the genus level for the top 10 bacterial taxa, normalized to 100%, based on raw reads obtained from 16S rRNA amplicon sequencing. The \\\"Other\\\" category includes bacterial genera, which are not among the top 10 most abundant taxa.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/9355ad51b4149789641c3d27.png\"},{\"id\":97127194,\"identity\":\"5e0a8abf-0743-43e8-abf1-1d730f1d4519\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 08:27:02\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":131684,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eComparison of relative abundance of 10 selected bacterial taxa detected by QPCR and 16S rRNA sequencing (NGS) in sinus biopsy specimens (SIN) and periapical lesion samples (PAL) from three ODS patients. (A) \\u003c/strong\\u003eRelative abundance (%) in QPCR was calculated considering the total number of bacterial genomes from 10 selected taxa listed; the relative abundances of other taxa potentially present in the samples are unknown.\\u003cstrong\\u003e (B)\\u003c/strong\\u003e Relative abundance at the genus level for the selected 10 bacterial taxa, normalized to 100%. The category \\\"Other\\\" includes bacterial genera not among the 10 taxa quantified by QPCR. This comparison is based on raw reads obtained from 16S rRNA amplicon sequencing. \\u003cem\\u003eStreptococcus anginosus\\u003c/em\\u003e group: \\u003cem\\u003eS. anginosus\\u003c/em\\u003e, \\u003cem\\u003eS. constellatus\\u003c/em\\u003e, and \\u003cem\\u003eS. intermedius.\\u003c/em\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/cc4398d88c2dadd70078b8d7.png\"},{\"id\":97141426,\"identity\":\"ee49d509-a0b2-4a57-97c8-dc23db61d94f\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 10:06:42\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":114788,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eComparison between bacterial profiles in sinus biopsy specimens (SIN) and periapical lesion samples (PAL) of ODS patients. (A) \\u003c/strong\\u003eResults from QPCR\\u003cstrong\\u003e \\u003c/strong\\u003eon the presence or absence of 10 selected bacterial taxa were used to calculate Jaccard distance between SIN and PAL sample for each ODS patient. The data are plotted on a histogram, where 0 indicates identical samples and 1 represents completely dissimilar samples. To evaluate if the Jaccard distances were statistically different from zero, the Wilcoxon signed-rank test was employed (p\\u0026lt;0.0001). Jaccard distances for patients analyzed in (B): P6=0.29, P15=0.38, P25=0.00. (\\u003cstrong\\u003eB\\u003c/strong\\u003e) Principal Coordinates Analysis (PCoA) based on Bray–Curtis dissimilarity, showing microbial community structure in paired SIN and PAL samples from three ODS patients (P6, P15, P25). Each line connects SIN and PAL samples from the same patient. Percentages on axes indicate the variance explained by the first two principal coordinates.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/a1eaac8e8c42b0584c03026a.png\"},{\"id\":99789328,\"identity\":\"fc78308a-93a6-41b1-8562-3c2584d53fce\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:49:24\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1750700,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/d75e2502-3ad3-4dbe-aa1a-992216288f2d.pdf\"},{\"id\":97140924,\"identity\":\"b54e8c05-6034-4162-93a1-50a8dc8f2823\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 10:05:56\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":18086,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Table 1.\\u003c/strong\\u003e\\u003cbr\\u003e\\nPrimer pairs used for QPCR. The sequences of primers, the length of primers and PCR products, and the specificity of primer pairs that have been analyzed both in silico and experimentally.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"SupplementaryTable1.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/79639e3c8708463941d38d65.docx\"},{\"id\":97127189,\"identity\":\"2e4890eb-a276-4de2-bd98-e99b2e18a4fb\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 08:27:02\",\"extension\":\"docx\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":17293,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Table 2.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eReference genomic bacterial DNA used for the standard curve generation in QPCR.\\u003c/p\\u003e\\n\\u003cp\\u003eInformation regarding the source of the reference genomic bacterial DNA, accompanied by the DMSZ reference number, the size, and the GC content of the genome (retrieved from the ATCC Genome Portal). Additionally, the calculated number of genomes per indicated mass of genomic DNA are provided.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"SupplementaryTable2.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/c871670d3136d74d5130061a.docx\"},{\"id\":97142123,\"identity\":\"dc601873-a0f6-4c81-b5f6-46186c4ec6f3\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 10:07:22\",\"extension\":\"docx\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":19440,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Table 3.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eComparative summary of pathogens cultured from ODS patients' sinus irrigation and periapical lesions (PAL) using conventional microbiological culture methods.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"SupplementaryTable3.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/1ec61c5d81afa190aad84e14.docx\"},{\"id\":97141508,\"identity\":\"e874f2ff-c8aa-446b-a6d5-3776b83391d0\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 10:06:46\",\"extension\":\"pdf\",\"order_by\":4,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":108436,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Table 4.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eResults of QPCR performed on DNA isolated from ODS patients' sinus biopsy specimens and periapical lesions (PAL) samples.\\u003c/p\\u003e\\n\\u003cp\\u003eQPCR primers were designed to amplify 16S rRNA of 10 selected bacterial taxa. The QPCR results are presented as: detected (1) / undetected (0), the number of bacterial genomes or the relative abundance in sample (%). ND: not determined.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"supplementarytable4.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8067667/v1/7228634eb4687e8fb1f62c7c.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Comparative Approaches to Microbial Profiling in Odontogenic Sinusitis with Periapical Lesions\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eOdontogenic sinusitis (ODS) is a distinct form of primarily maxillary sinusitis, arising from dental infections like periodontitis, periapical lesions, and complications of dental procedures such as extractions or implant placements (\\u003cspan additionalcitationids=\\\"CR2\\\" citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e). Unlike rhinogenic chronic sinusitis (CRS), which is primarily associated with viral or allergic etiologies, ODS is often polymicrobial, with a predominance of anaerobic bacteria originating from the oral cavity (\\u003cspan additionalcitationids=\\\"CR5\\\" citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e). Understanding the microbial load and composition in ODS is crucial for accurate diagnosis and effective treatment, particularly in an era of rising antimicrobial resistance (\\u003cspan additionalcitationids=\\\"CR8\\\" citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e). ODS can also serve as a portal for systemic dissemination of oral pathogens, which have been implicated in complications such as orbital cellulitis, intracranial abscess, and bacteremia, with life-threatening consequences (\\u003cspan additionalcitationids=\\\"CR11\\\" citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eTraditional culture-based microbiological methods have long been the gold standard for identifying bacterial pathogens in clinical samples. However, culture techniques are inherently limited in detecting fastidious and anaerobic bacteria, which are frequently implicated in odontogenic infections (\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e). Anaerobic organisms commonly found in ODS often exhibit resistance to empirical antibiotics used for rhinogenic CRS. Without proper microbial identification, treatment failures and chronicity are common, necessitating repeated interventions (\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e). To date, international European guidelines recommend antibiotic treatment for sinusitis without considering the potential underlying odontogenic cause (\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e). Specific antibiotics that target mainly the upper respiratory tract pathogens responsible for \\u0026lsquo;non-odontogenic\\u0026rsquo; sinusitis might not be adequate for the anaerobe-dominated microbial profile of ODS. This limitation has driven interest in molecular techniques, such as polymerase chain reaction (PCR) and next-generation sequencing (NGS), which offer enhanced sensitivity and broader microbial profiling capabilities (\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e, \\u003cspan additionalcitationids=\\\"CR14\\\" citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003ePCR allows for the targeted detection of bacterial species based on their specific genetic markers, such as fragments of the 16S rRNA gene, often enabling the identification of pathogens that are difficult to culture (\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e). In contrast, 16S rRNA amplicon sequencing provides a comprehensive overview of the entire microbial community within a sample, allowing for the characterization of both culturable and unculturable bacteria, as well as the assessment of microbial diversity and abundance (\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e). Despite these advantages, molecular methods based on microbial DNA targeting present their own challenges, including potential detection of non-viable organisms and susceptibility to environmental contamination (\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eRecent studies have highlighted the limitations of conventional culture techniques in detecting the full spectrum of bacteria present in odontogenic infections. For instance, a study of purulent aspirate from the sinus cavity and sequencing the V1-V2 regions of the 16S rRNA gene identified a predominantly polymicrobial spectrum with many genera of anaerobic bacteria, notably \\u003cem\\u003eFusobacterium, Prevotella\\u003c/em\\u003e, and \\u003cem\\u003ePorphyromonas\\u003c/em\\u003e, associated with periodontal disease (\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e). This underscores the importance of precise microbiological diagnostics in managing odontogenic abscesses. Another investigation revealed that the sequencing of the 16S rRNA gene hypervariable regions V1-V3 detected considerably more bacterial taxa than conventional cultural methods, even in culture-negative samples, emphasizing the need for updated diagnostic practices (\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eA comparative analysis of culture, PCR, and 16S rRNA amplicon sequencing results in clinically confirmed ODS has not yet been done. Similarly, studies are needed that directly compare the microbial communities of ODS in the samples taken from the maxillary sinus and corresponding periapical lesions. This comparison would help elucidate the microbial continuum between periapical infections and sinus involvement. One approach for this analysis could involve examining restricted-length DNA fragments of the chosen pathogens using pulsed-field electrophoresis. However, it is important to note that such a comparison would focus only on culturable and well-grown bacterial strains, which are typically aerobic and belong to just one species. To compare the numerous species, present in these two anatomical sites, whose natural separation is disrupted by infection, we employed culture-based microbiological methods and compared them to two molecular techniques: targeted PCR and NGS. We sought to evaluate the efficiency of detecting pathogenic bacterial taxa using these methods. Candidate pathogens for PCR were selected through an extensive literature review, which identified taxa most strongly implicated in odontogenic sinusitis (\\u003cspan additionalcitationids=\\\"CR23\\\" citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e) and the ones more likely associated with non-odontogenic CRS, such as \\u003cem\\u003ePseudomonas aeruginosa\\u003c/em\\u003e and \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e (\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e). We designed primers accordingly and performed both qualitative and quantitative analyses with targeted PCR. For three patients, we additionally analyzed material from both sites using 16S rRNA amplicon sequencing.\\u003c/p\\u003e\\u003cp\\u003eOur results showed that conventional culture was less effective than molecular techniques at capturing the full range of bacteria present in ODS infections and were also biased towards aerobic taxa. QPCR and 16S rRNA amplicon sequencing revealed a high degree of heterogeneity within the ODS patient group, with strong overlap between the bacterial communities of the maxillary sinus and the corresponding periapical lesions in some patients, and discordant results in others. A comparison of QPCR and 16S rRNA amplicon sequencing revealed varying degrees of correlation. More concordant results were obtained for sinus mucosal biopsies than for samples from periapical lesions, demonstrating the suitability of the taxa selected for the QPCR analysis, which targeted ODS-associated bacteria present in the maxillary sinus. However, in one out of the three patients analyzed by NGS, ten pathogenic taxa chosen for targeted PCR failed to capture the diversity, representing only a small fraction of the taxa detected in sinus biopsies. These findings suggest that although targeted PCR may be a rapid, cost-effective and clinically valuable option, deeper analysis with NGS to obtain a complete microbiological profile should be considered in patients who do not respond to treatment guided by targeted PCR results. Although our study involved a relatively small cohort, it was prospective in nature and highlights the need for further research into the diagnosis of odontogenic sinusitis.\\u003c/p\\u003e\"},{\"header\":\"Material and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eStudy setting, design and participants\\u003c/h2\\u003e\\u003cp\\u003eTwenty-eight adult patients presented with the clinical and radiological symptoms of chronic odontogenic sinusitis (ODS) and periapical lesion (PAL) around maxillary molars or premolars and scheduled for endoscopic sinus surgery (ESS) were included in the study. ODS was confirmed by otolaryngologist and dentist as follows: the otolaryngologist assessed nasal endoscopy for mucopurulence or edema in middle meatus or sinuses on endoscopy, whereas dental specialist assessed the pulp vitality with cold pulp testing, and checked the tooth with percussion, palpation and mobility test. The computed-tomography (CT) or cone-beam computed tomography (CBCT) scans were evaluated by both specialists to properly establish the diagnosis.\\u003c/p\\u003e\\u003cp\\u003ePatients with bilateral sinusitis and bilateral PALs, possible coexistence of fungal ball with ODS and patients with primary immunodeficiency and the ones with just maxillary sinus mucosal thickening were excluded from the study.\\u003c/p\\u003e\\u003c/div\\u003e\\n\\u003ch3\\u003eSample collection\\u003c/h3\\u003e\\n\\u003cp\\u003eSamples for the microbiological, quantitative QPCR, and 16S rRNA sequencing analysis were collected at the beginning of endoscopic sinus surgery (ESS), coinciding with the extraction of the causative tooth. After performing a standard maxillary antrostomy, a curved suction was introduced into the ostium of maxillary sinus. Following the irrigation with 250cc of 0.9% solution of NaCl, the purulent fluid was suctioned out and immediately stored in a sterile container. A mucosal biopsy was then taken from the floor of the MS using curved forceps. Following the extraction of causative teeth, a sterile swab was collected from the tooth socket with a periapical lesion, and tissue scrapings were obtained from curettage of the remaining periapical lesion. The maxillary sinus rinses and tooth socket swabs were immediately sent for culturing to the Department of Laboratory Diagnostics, Military Institute of Medicine \\u0026ndash; National Research Institute.\\u003c/p\\u003e\\u003cp\\u003eSamples from sinus mucosal biopsy (SIN) and the tissue scrapings from periapical lesion (PAL) were immediately stored in separate 1 ml vials with DNAgard Tissue and Cells (\\u0026reg;Biomatrica) sterile solution and stored at 4\\u0026deg;C.\\u003c/p\\u003e\\n\\u003ch3\\u003eMicrobiological analysis\\u003c/h3\\u003e\\n\\u003cp\\u003eThe culture and bacterial species identification were performed in accordance with routine diagnostic procedures at the Department of Laboratory Diagnostics, Military Institute of Medicine \\u0026ndash; National Research Institute. The material was promptly cultured on nonselective media (Columbia agar supplemented with 5% sheep blood, McConkey agar, Chapman agar, and Sabouraud agar), as well as the selective medium for \\u003cem\\u003eHaemophilus\\u003c/em\\u003e species, and Schaedler agar for the cultivation of anaerobic bacteria. All plates were incubated for 24\\u0026ndash;48 hours at 37\\u0026deg;C under a 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e atmosphere, except for Schaedler agar plates, which were cultured at the same temperature but under anaerobic conditions. The isolated colonies were accurately identified using Matrix-Assisted Laser Desorption Ionization-Time of Flight mass spectrometry (MALDI-TOF) (VITEK MS, bioM\\u0026eacute;rieux, France) according to the manufacturer\\u0026rsquo;s instructions.\\u003c/p\\u003e\\n\\u003ch3\\u003eDNA isolation\\u003c/h3\\u003e\\n\\u003cp\\u003ePrior to DNA isolation, PAL and SIN samples were sonicated twice for 30 s at room temperature in an ultrasonic washer (Polsonic). Freshly prepared lysozyme (100 \\u0026micro;l, stock 100 mg/ml, Thermo Fisher Scientific), RNase A (10 \\u0026micro;l, from DNA Extraction Genomic Mini, Blirt) and freshly prepared lysostaphin (8 \\u0026micro;l, stock 10 mg/ml, Sigma-Aldrich) were added and the samples were incubated for 40 min at 37\\u0026deg;C. DNA was extracted using DNA Extraction Genomic Mini kit (Blirt). Following the addition of GL Lysis Buffer (750 \\u0026micro;l) and proteinase K (50 \\u0026micro;l), the samples were incubated for 30 min at 55\\u0026deg;C and later transferred to BashingBead Lysis Tubes (Zymo Research). They were vortexed for 5 min at 3,000 rpm and subsequently centrifuged for 2 min at 14,500 rpm using an Eppendorf Mini Spin centrifuge. The supernatants were then subjected to on-column DNA purification following the manufacturer\\u0026rsquo;s instructions. DNA was eluted from the columns using 50 \\u0026micro;l Elution buffer. Human DNA was not removed from the samples. DNA concentration was determined using QuantiFluor ONE dsDNA System (Promega) and Quantus Fluorometer (Promega). DNA was aliquoted and frozen at -80C\\u0026deg; until further use.\\u003c/p\\u003e\\n\\u003ch3\\u003ePrimer design for quantitative PCR\\u003c/h3\\u003e\\n\\u003cp\\u003ePrimer pairs were designed to amplify the fragments of the 16S rRNA gene. The following bacterial species were selected: \\u003cem\\u003eEikenella corrodens\\u003c/em\\u003e, \\u003cem\\u003eF. nucleatum\\u003c/em\\u003e, \\u003cem\\u003ePeptostreptococcus anaerobiu\\u003c/em\\u003es, \\u003cem\\u003ePorphyromonas endodontalis\\u003c/em\\u003e, \\u003cem\\u003ePorphyromonas gingivalis\\u003c/em\\u003e, \\u003cem\\u003ePrevotella intermedia\\u003c/em\\u003e, \\u003cem\\u003ePrevotella nigrescens\\u003c/em\\u003e, \\u003cem\\u003ePseudomonas aeruginosa\\u003c/em\\u003e, and \\u003cem\\u003eS. aureus\\u003c/em\\u003e. First, the eHOMD 16S rRNA Reference Sequence Tree from the Human Oral Microbiome Database website (\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e) was used to identify the closest relatives of each bacterial species analyzed. Then, the 16S rRNA gene sequences from each group were retrieved from the ATCC Genome Portal (\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e), NCBI Reference Sequence Database (\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e) and GenBank (\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e). Multiple alignments were performed using Clustal Omega with default settings (\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e), and visualized with Jalview version 2.11.1.3 (\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e). Regions in which all retrieved 16S rRNA sequences from selected bacterial species were identical and the sequences from their closest relatives exhibited mismatches were selected for primer design with Primer-BLAST (\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e). The main Primer-BLAST parameters were as follows: primer length, 15\\u0026ndash;25 nt; PCR product length, 100\\u0026ndash;200 bp; primer melting temperature, 57\\u0026ndash;63\\u0026deg;C (optimal: 60\\u0026deg;C). Primer pairs were screened with Primer-BLAST for self-complementarity and self-3\\u0026rsquo;-complementarity. Each primer pair\\u0026rsquo;s specificity was checked \\u003cem\\u003ein silico\\u003c/em\\u003e against Bacteria (taxid:2) RefSeq representative genomes, \\u003cem\\u003eHomo sapiens\\u003c/em\\u003e (taxid:9606) reference genome sequence, and the RefSeq human mitochondrial DNA sequence (NC_012920.1). Primers used for the simultaneous detection of \\u003cem\\u003eS. anginosus\\u003c/em\\u003e group (\\u003cem\\u003eStreptococcus anginosus, Streptococcus constellatus\\u003c/em\\u003e, and \\u003cem\\u003eStreptococcus intermedius\\u003c/em\\u003e) 16S rRNA were described previously by Olson et al. (\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e). Prior to QPCR on patients\\u0026rsquo; samples, primers were experimentally tested, and the best-performing primer pairs were used for further experiments. Primer sequences, product lengths, and the results of the \\u003cem\\u003ein-silico\\u003c/em\\u003e specificity analyses are provided in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e and Supplementary Table\\u0026nbsp;1.\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eCharacteristics of primers used in the study: taxon specificity, sequence and product length.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"4\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eTaxon specificity\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eForward primer sequence\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eReverse primer sequence\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eProduct length [bp]\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eEikenella corrodens\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eGTGGCGAACGGGTGAGTAAT\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eAATAACGCGAGGTCTTGCGA\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e124\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eFusobacterium\\u003c/em\\u003e spp.\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCCGCGGTAATACGTATGTCAC\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eCGCAATACAGAGTTGAGCCCT\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e110\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003ePeptostreptococcus anaerobius\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eAGGAAGCCCCGGCTAACTA\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eCTCAAGTCTTCCAGTTTCGGA\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e161\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003ePorphyromonas endodontalis\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCGTAACGCGTATGCAACCTG\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eCTTTCCGTCCTCCTCCATGC\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e100\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003ePorphyromonas gingivalis\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCGACCGGATGCGAATCTCTA\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGAACGTATTCACCGCGCCAT\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e116\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003ePrevotella intermedia\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCTGTTAGCGCCTGGCGTTA\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGTCAACATCTCTGTATCCTGCG\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e191\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003ePrevotella nigrescens\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCGCCATTGCATGTACCTCAT\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eTCACAACACGCTTAACAGACC\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e134\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003ePseudomonas aeruginosa\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eGCTAATACCGCATACGTCCTGA\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGCCTTGGTAGGCCTTTACCC\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e110\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eACGAGAAGCTTGCTTCTCTGAT\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGCAGCGCGGATCCATCTAT\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e176\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eStreptococcus anginosus\\u003c/em\\u003e group\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCCACACTGGGACTGAGACAC (\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eAGCCGTCCCTTTCTGGTTAAG (\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e199\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eQuantitative PCR (QPCR)\\u003c/h2\\u003e\\u003cp\\u003eQuantitative polymerase chain reaction (QPCR) was employed for absolute quantification. The standard curves were prepared using reference genomic DNA from type strains. Bacterial DNA reference samples were obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ, \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.dsmz.de/\\u003c/span\\u003e\\u003cspan address=\\\"https://www.dsmz.de/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e), see Supplementary Table\\u0026nbsp;2. The Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent) was used for the QPCR. Each reaction contained 10 \\u0026micro;l of 2\\u0026times; SYBR Green QPCR master mix, 30 nM ROX (reference dye), 200 nM of each primer, and 1 \\u0026micro;l of DNA template, resulting in a final reaction volume of 20 \\u0026micro;l. To generate the standard curves, serial dilutions of the reference DNA were prepared (10 ng/\\u0026micro;l, 1 ng/\\u0026micro;l, 100 pg/\\u0026micro;l, 10 pg/\\u0026micro;l, 1 pg/\\u0026micro;l, 100 fg/\\u0026micro;l, 10 fg/\\u0026micro;l), and 1 \\u0026micro;l from each dilution was used as the template for the QPCR reaction. To assess the potential for unspecific primer binding to human DNA, genomic DNA from human fibroblasts (1 ng/reaction) was employed. To ascertain the specificity of primer pairs for a particular bacterial species, namely \\u003cem\\u003ePrevotella\\u003c/em\\u003e spp. and \\u003cem\\u003ePorphyromonas\\u003c/em\\u003e spp., genomic DNA (1 ng/reaction) from other species within the same genus was incorporated as a control (results are provided in Supplementary Table\\u0026nbsp;1). Two technical replicates were prepared for each DNA sample. The Agilent Aria Mx instrument was employed, and the QPCR conditions were as follows: a hot start for 3 min at 95\\u0026deg;C, denaturation for 5 s at 95\\u0026deg;C, primer annealing/extension for 10 s at 60\\u0026deg;C, and 45 cycles in total. Following the QPCR, a melt curve analysis was conducted with a resolution of 0.5\\u0026deg;C and a soak time of 5 s.\\u003c/p\\u003e\\u003c/div\\u003e\\n\\u003ch3\\u003eQuantitative PCR results analysis\\u003c/h3\\u003e\\n\\u003cp\\u003eQPCR results below the lowest point on the standard curve and/or with an incorrect melting curve were excluded from further analysis. DNA mass in each standard curve point was converted into the number of bacterial genomes (Supplementary Table\\u0026nbsp;2). The following data were used for the calculations: genome size in base pairs and GC content retrieved from the ATCC Genome Portal (Supplementary Table\\u0026nbsp;2); GC base pair molecular weight of 616.4 g/mol and a mass of 1.024 \\u0026times; 10\\u003csup\\u003e\\u0026minus;\\u0026thinsp;6\\u003c/sup\\u003e fg; AT base pair molecular weight of 615.4 g/mol and a mass of 1.022 \\u0026times; 10\\u003csup\\u003e\\u0026minus;\\u0026thinsp;6\\u003c/sup\\u003e fg. The dissociation of hydrogen ions from phosphate groups in DNA at the physiological pH was accounted for in the calculations (\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e). Based on the standard curve, the number of bacterial genomes of each analyzed taxon were calculated for every sample. The results were then converted into percentages of the total.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003e16S rRNA amplicon library preparation and sequencing\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eBacterial 16S rRNA gene fragments were amplified using primers targeting the V3\\u0026ndash;V4 hypervariable regions, following the standard Illumina 16S Metagenomic Sequencing Library Preparation protocol. Amplicon libraries were prepared using Nextera XT chemistry and sequenced on the Illumina MiSeq platform with a MiSeq Reagent Kit v3 (2 \\u0026times; 300 bp paired-end reads). All steps were performed according to the manufacturer's instructions. Sequencing was conducted on DNA extracted from PAL and SIN samples collected from three arbitrarily chosen patients diagnosed with odontogenic sinusitis. The same DNA extracts were also used for quantitative PCR analysis.\\u003c/p\\u003e\\n\\u003ch3\\u003eBioinformatic Analysis of 16S rRNA amplicon sequencing results\\u003c/h3\\u003e\\n\\u003cp\\u003eRaw sequencing data were processed using the QIIME 2 pipeline (QIIME2 v. 2023.9) (\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e). Demultiplexed reads were denoised and dereplicated using the deblur plugin with default parameters (\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e). Taxonomic classification was assigned at the genus level using a pre-trained Na\\u0026iuml;ve Bayes classifier (\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e) based on the SILVA 16S rRNA gene reference database (SILVA 138.1 SSURef Nr 99) (\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e). Prior to beta diversity analysis, the feature table was rarefied to a depth of 10,000 sequences per sample to normalize sequencing depth across samples. Bray\\u0026ndash;Curtis dissimilarity metrics were calculated, and Principal Coordinates Analysis (PCoA) was performed to visualize differences in microbial community structure. Subsequent statistical analyses and visualizations were conducted in R Studio (version 2024.04.2\\u0026thinsp;+\\u0026thinsp;764) (\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e) using the \\u003cem\\u003ephyloseq\\u003c/em\\u003e, \\u003cem\\u003edplyr\\u003c/em\\u003e, and \\u003cem\\u003eggplot2\\u003c/em\\u003e packages. The raw sequencing data (FASTQ files) are publicly available in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under BioProject accession number PRJNA1333631.\\u003c/p\\u003e\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eStatistical analysis of QPCR results\\u003c/h2\\u003e\\u003cp\\u003eData visualization and statistical analysis of QPCR results were performed with GraphPad Prism version 10.3.0 for Windows. The Wilcoxon matched pairs test was used to compare the number of detected taxa between paired SIN and PAL samples. The Jaccard distance was calculated between paired SIN and PAL samples, based on binary detected/undetected data for each identified bacterial taxon. The Wilcoxon signed-rank test was used to determine whether the Jaccard distances differed significantly from zero. These statistical analyses were performed in Python using \\u003cem\\u003epandas\\u003c/em\\u003e, \\u003cem\\u003escipy\\u003c/em\\u003e, and \\u003cem\\u003eseaborn\\u003c/em\\u003e libraries. Jaccard distances were calculated with \\u003cem\\u003escipy.spatial.distance.jaccard\\u003c/em\\u003e, and the Wilcoxon test was implemented using \\u003cem\\u003escipy.stats.wilcoxon\\u003c/em\\u003e. A statistical significance level in all tests was set to α\\u0026thinsp;=\\u0026thinsp;0.05.\\u003c/p\\u003e\\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003eConventional culture detected nine pathogenic bacterial taxa in 31 tooth socket swabs and 28 ipsilateral maxillary sinus irrigation samples from 28 ODS patients (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, Supplementary Table\\u0026nbsp;3). Pathogens such as \\u003cem\\u003eS. aureus, S. anginosus\\u003c/em\\u003e, and \\u003cem\\u003eFusobacterium\\u003c/em\\u003e spp. were recovered; however, the overall detection rate was low, with many samples yielding no culturable pathogens. Furthermore, there was only a small overlap in the taxa between tooth socket swabs and maxillary sinus irrigation isolates, highlighting the limited sensitivity of culture methods in samples from patients with ODS.\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eCulturable pathogenic bacteria in ODS patients\\u0026rsquo; tooth socket swabs (n\\u0026thinsp;=\\u0026thinsp;31) and ipsilateral sinus irrigation specimens (n\\u0026thinsp;=\\u0026thinsp;28).\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"4\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eTaxon\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e% of positive tooth socket swabs\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e% of positive sinus irrigation samples\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eNo. of paired positive tooth socket swabs and sinus irrigation samples\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eFusobacterium\\u003c/em\\u003e spp.\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e0.0\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e3.6\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eHafnia\\u003c/em\\u003e spp.\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e3.2\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e3.6\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e1\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003ePrevotella\\u003c/em\\u003e spp.\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e0.0\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e3.6\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eRoutella\\u003c/em\\u003e spp.\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e0.0\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e3.6\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e3.2\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e7.1\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e1\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eStreptococcus anginosus\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e0.0\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e10.7\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eStreptococcus pneumoniae\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e3.2\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e0.0\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eStreptococcus pyogenes\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e0.0\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e3.6\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eVeilonella\\u003c/em\\u003e spp.\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e3.2\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e0.0\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003eOn the other hand, quantitative PCR (QPCR) markedly outperformed culture methods in detecting bacterial taxa (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e, Supplementary Table\\u0026nbsp;4). High prevalence rates were observed in tissue scrapings from periapical lesion (PAL) for \\u003cem\\u003eP. gingivalis\\u003c/em\\u003e (96.8%), \\u003cem\\u003eFusobacterium\\u003c/em\\u003e spp. (90.3%), and the \\u003cem\\u003eS. anginosus\\u003c/em\\u003e group (90.3%). Although sinus mucosal biopsy specimens (SIN) were less frequently positive, they still showed notable detection rates for the same taxa, with rates 89.3%, 67.9%, and 50.0%, respectively. Additionally, \\u003cem\\u003eE. corrodens\\u003c/em\\u003e, \\u003cem\\u003eP. endodentalis\\u003c/em\\u003e, and \\u003cem\\u003eP. nigrescens\\u003c/em\\u003e were frequently detected in both PAL and SIN samples in several instances. In contrast, some species such as \\u003cem\\u003eP. anaerobius\\u003c/em\\u003e and \\u003cem\\u003eS. aureus\\u003c/em\\u003e were rarely detected or completely absent.\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab3\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 3\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eBacterial taxa detected by QPCR in ODS patients\\u0026rsquo; periapical lesions (PAL, n\\u0026thinsp;=\\u0026thinsp;31) and sinus biopsy specimens (SIN, n\\u0026thinsp;=\\u0026thinsp;28).\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"4\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eTaxon\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e% of positive PAL samples\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e% of positive SIN samples\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eNo. of paired positive PAL and SIN samples\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eEikenella corrodens\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e83.9\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e39.3\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e9\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eFusobacterium\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e90.3\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e67.9\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e19\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003ePeptostreptococcus anaerobius\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e0.0\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e0.0\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003ePorphyromonas endodontalis*\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e74.2\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e46.4\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e12\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003ePorphyromonas gingivalis\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e96.8\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e89.3\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e24\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003ePrevotella intermedia\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e41.9\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e21.4\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e5\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003ePrevotella nigrescens\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e77.4\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e35.7\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e7\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003ePseudomonas aeruginosa**\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e77.4\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e57.1\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e15\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e0.0\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e3.6\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eStreptococcus anginosus\\u003c/em\\u003e group\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e90.3\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e50.0\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e12\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e*Results determined for 27 out of 28 patients.\\u003c/p\\u003e\\u003cp\\u003e** Results determined for 24 out of 28 patients.\\u003c/p\\u003e\\u003cp\\u003eQPCR performed for the whole study group and 16S rRNA amplicon sequencing for three arbitrary chosen ODS patients provided complementary insights into the microbial composition of SIN and PAL samples.\\u003c/p\\u003e\\u003cp\\u003eQPCR quantification of ten targeted bacterial taxa revealed substantial bacterial loads in both SIN and PAL samples. The number of bacterial genomes per sample was consistently higher in PAL than in SIN specimens (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA\\u0026ndash;B, Supplementary Table\\u0026nbsp;4). Additionally, the number of detected taxa per sample was significantly higher in PAL compared to the paired SIN samples (Wilcoxon matched-pairs test, p\\u0026thinsp;=\\u0026thinsp;0.0004; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC). The highest median number of bacterial genomes was detected for \\u003cem\\u003eFusobacterium\\u003c/em\\u003e spp. in the analyzed panel of PAL samples, followed by the \\u003cem\\u003eS. anginosus\\u003c/em\\u003e group, \\u003cem\\u003eE. corrodens\\u003c/em\\u003e, and \\u003cem\\u003eP. gingivalis\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB). In SIN samples, \\u003cem\\u003eFusobacterium\\u003c/em\\u003e spp. genomes were the most dominant, with a lower load of the \\u003cem\\u003eS. anginosus\\u003c/em\\u003e group, \\u003cem\\u003eP. gingivalis\\u003c/em\\u003e and \\u003cem\\u003eP. endodontalis\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe 16S rRNA sequencing further confirmed the polymicrobial nature of ODS, demonstrating complex bacterial communities in both SIN and PAL sites. Comparative analysis of raw read counts and relative abundances across three randomly chosen patients (P6, P15, P25) showed inter-individual variability in microbial load and dominant taxa (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA\\u0026ndash;D). At the genus level, both SIN and PAL samples were dominated by anaerobic genera (e.g., \\u003cem\\u003ePrevotella\\u003c/em\\u003e, \\u003cem\\u003ePorphyromonas\\u003c/em\\u003e), with their relative contributions varying by individual (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD). When normalized to 100%, the top 10 genera accounted for most reads, while the \\u0026ldquo;Other\\u0026rdquo; category reflected additional microbial diversity (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eTo assess the detection capacity and utility of targeted QPCR for characterizing the microbial burden in SIN and PAL samples from patients with ODS, we directly compared the outcomes of QPCR and 16S rRNA sequencing for patients P6, P15, and P25. We examined the proportional contribution of the taxa selected for targeted PCR relative to their representation in the 16S rRNA amplicon sequencing data, as shown in Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA and \\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB (se also Supplementary Table\\u0026nbsp;4). In SIN samples from patients P6 and P15, targeted qPCR accounted for over 90% of the microbial burden detected by NGS, whereas in their PAL samples this proportion decreased to 40\\u0026ndash;50%. For patient P25, targeted PCR detected less than 30% of the bacteria in both sample types. The most notable discrepancy between the two approaches was the underrepresentation of \\u003cem\\u003eFusobacterium\\u003c/em\\u003e in the sequencing results, despite its consistent detection by QPCR.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eAnalysis of similarity between paired SIN and PAL samples revealed both concordance and heterogeneity. Jaccard distance analysis of PCR results on bacteria absence or presence (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA) indicated that while certain patients exhibited nearly identical microbial profiles between sites (e.g., P9, P12, P25, P27: distance 0.00), others showed notable dissimilarity (e.g., P2: distance 1.00; P22: distance 0.88). The median Jaccard distance for the whole group was 0.46. Overall, Wilcoxon signed-rank testing confirmed that microbial communities between SIN and PAL were significantly different (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001). Principal Coordinates Analysis (PCoA) based on Bray\\u0026ndash;Curtis dissimilarity further supported these findings. It demonstrated clear clustering of SIN and PAL samples for Patient P25, while also revealing patient-specific variations in microbial composition for Patients P6 and P15 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB). Interestingly, these results were concordant with Jaccard distance analysis, despite the broader range of taxa detected in NGS.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eThese findings indicate that while there is significant overlap between the microbiota of the periapical area and the sinuses in cases of odontogenic sinusitis, the microbial community in these two anatomical sites are not identical. It also shows a distinct enrichment of certain anaerobic species. This suggests that the microbial composition in the sinus is not simply an extension of the periapical microbiota; rather, it reflects additional ecological pressures and specific selection processes related to the unique environment of the sinus.\\u003c/p\\u003e\\u003cp\\u003eMoreover, the use of targeted PCR as a diagnostic method for assessing microbial burden in ODS, compared to 16S rRNA sequencing, showed promising results. In two out of the three patients studied here, the selected primers detected nearly 90% of the bacterial taxa present in the sinus found by 16S rRNA sequencing. It is important to note that these primers were specifically designed based on taxa commonly found in sinus samples, rather than those from the dental microbiota of patients with ODS. This distinction is clearly reflected in our findings. However, in the third patient, whose sinus and dental microbiota were highly similar, the primers designed for sinus-dominant taxa detected less than 30% of the bacterial burden in the sinus samples. These results, presented here for the first time, emphasize the significant diversity of microbiomes in ODS patients and highlight the diagnostic challenges associated with selecting the most appropriate technique.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eDespite being a well-established clinical entity, ODS is less characterized compared to other subtypes of chronic rhinosinusitis (CRS), such as CRS with nasal polyps (CRSwNP) and CRS without nasal polyps (CRSsNP). The European Position Paper on Rhinosinusitis and Nasal Polyps (EPOS) includes ODS in its classification framework, but it remains a marginally studied subset with unique pathophysiological and microbiological features that are not thoroughly addressed by the broader CRS framework (\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eOne of the most significant knowledge gaps relates to the microbial etiology of ODS. Most of the existing research on CRS has focused on inflammatory mechanisms and microbiota linked to sinonasal dysbiosis, biofilm formation, and host-microbe interactions in the nasal cavity and paranasal sinuses (\\u003cspan additionalcitationids=\\\"CR39 CR40\\\" citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e). In contrast, the microbial landscape of ODS is less understood, largely because it originates from a different anatomical and ecological niche: the oral cavity. The translocation of oral pathogens into the maxillary sinuses creates a distinct polymicrobial environment, often dominated by anaerobic species and biofilm-forming microorganisms that are difficult to isolate using standard culture methods (\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e) .\\u003c/p\\u003e\\u003cp\\u003eSeveral studies have compared microbial detection techniques, such as culture-based methods, next-generation sequencing (NGS), and polymerase chain reaction (PCR) in CRS diagnostics, but in ODS it remains understudied (\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e). Anaerobic bacteria are the predominant microorganisms found in odontogenic lesions, and they exhibit greater diversity than what traditional cultural diagnostics suggest (\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e). To date, only a few studies have provided data on microbiome specific for ODS (\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e), and none have analyzed the material using three methods simultaneously: classical microbiology culture, targeted QPCR, and NGS. Due to the logistical challenges and the need for an interdisciplinary approach to ODS patients, existing data have primarily focused on microbial diversity in either sinus or periapical regions (\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e, \\u003cspan additionalcitationids=\\\"CR46 CR47 CR48 CR49\\\" citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e). This is the first study to compare these three diagnostic techniques while profiling microbial load in both locations of patients with clinically and radiologically confirmed ODS.\\u003c/p\\u003e\\u003cp\\u003eIn our QPCR analysis, high bacterial load in PAL samples was detected for \\u003cem\\u003eFusobacterium\\u003c/em\\u003e spp., \\u003cem\\u003ePorphyromonas\\u003c/em\\u003e spp., \\u003cem\\u003ePrevotella\\u003c/em\\u003e spp., and members of the \\u003cem\\u003eS. anginosus\\u003c/em\\u003e group. These anaerobic and microaerophilic species are typical of periodontal infections and play established pathogenic roles in the spread of infection to deeper tissues (\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e). The results are partly consistent with published QPCR analysis on the composition of the microbiota outside root canal, with the main bacteria identified as \\u003cem\\u003eActinomyces\\u003c/em\\u003e spp., \\u003cem\\u003ePropionibacterium, Prevotella\\u003c/em\\u003e spp., oral streptococci, \\u003cem\\u003eP. endodontalis\\u003c/em\\u003e, and \\u003cem\\u003eBurkholderia\\u003c/em\\u003e (\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e). In the literature review by Craig et al. (\\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e53\\u003c/span\\u003e) \\u003cem\\u003ePrevotella\\u003c/em\\u003e, \\u003cem\\u003eFusobacterium\\u003c/em\\u003e, \\u003cem\\u003eand Peptostreptococcus\\u003c/em\\u003e were the most commonly isolated species, although \\u003cem\\u003ePeptostreptococcus\\u003c/em\\u003e was not detected in the cohort described in the presented study. Oral microbiome composition varies across populations and clinical settings, possibly explaining why some cohorts detect \\u003cem\\u003ePeptostreptococcus\\u003c/em\\u003e while others do not. \\u003cem\\u003eFusobacterium nucleatum\\u003c/em\\u003e, consistently detected at high loads in our qPCR analysis, is considered an organism that facilitates co-aggregation of diverse oral taxa and stabilizes biofilm communities. Its dominance may suppress or ecologically displace \\u003cem\\u003ePeptostreptococcus\\u003c/em\\u003e in some periapical lesions, accounting for the variability in detection across studies (\\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e54\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eWhile QPCR demonstrated high specificity for targeted pathogens, 16S rRNA sequencing provided a broader ecological overview, detecting a greater number of taxa. Correlation analysis between relative abundance of species identified by QPCR and the sequencing technique showed moderate alignment, indicating that both methods may serve complementary roles in microbiological assessment.\\u003c/p\\u003e\\u003cp\\u003eIn our study, most of the genera detected using 16S rRNA amplicon sequencing, such as \\u003cem\\u003eFusobacterium\\u003c/em\\u003e, \\u003cem\\u003ePorphyromonas\\u003c/em\\u003e, \\u003cem\\u003ePrevotella\\u003c/em\\u003e, \\u003cem\\u003eStreptococcus\\u003c/em\\u003e, \\u003cem\\u003eVeillonella\\u003c/em\\u003e, \\u003cem\\u003eCapnocytophaga\\u003c/em\\u003e, \\u003cem\\u003eTannerella\\u003c/em\\u003e, \\u003cem\\u003eTreponema\\u003c/em\\u003e, and \\u003cem\\u003eLactobacillus\\u003c/em\\u003e, are well-known members of the oral microbiota and have been associated with odontogenic infections. In contrast, \\u003cem\\u003ePseudoalteromonas\\u003c/em\\u003e is a genus typically found in marine environments and is not usually linked to the oral cavity or odontogenic sinusitis. However, since it was absent from our negative controls, its presence in patient samples may still be worth considering.\\u003c/p\\u003e\\u003cp\\u003eA notable discrepancy in our results between QPCR and 16S rRNA amplicon sequencing was the different detection rate of \\u003cem\\u003eFusobacterium\\u003c/em\\u003e spp. While qPCR consistently identified \\u003cem\\u003eFusobacterium\\u003c/em\\u003e with high prevalence in both PAL and sinus samples, the sequencing technique frequently underrepresented or classified these reads under broader taxonomic categories. This discrepancy is consistent with previous reports highlighting primer bias and classification limitations in 16S rRNA amplicon sequencing (\\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e55\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e56\\u003c/span\\u003e). The universal primers used in 16S rRNA amplicon sequencing do not function equally well across all taxa, and \\u003cem\\u003eFusobacterium\\u003c/em\\u003e often exhibit mismatches at conserved primer-binding regions, leading to reduced amplification. Furthermore, taxonomic assignment pipelines can misclassify \\u003cem\\u003eFusobacterium\\u003c/em\\u003e reads into higher-level categories, particularly when sequence similarity is high within oral anaerobe clades. In contrast, the group-specific QPCR method used in this study ensured targeted and sensitive detection and quantification even at low abundance levels. These findings emphasize the complementary roles of QPCR and NGS: while QPCR offers high sensitivity for selected pathogens, NGS provides a more comprehensive community profile but may overlook certain clinically relevant taxa, such as \\u003cem\\u003eFusobacterium\\u003c/em\\u003e.\\u003c/p\\u003e\\u003cp\\u003eThe current hypothesis suggests that ODS arises from the translocation of pathogenic bacteria from periapical lesions into the maxillary sinus. This process leads to a distinct yet overlapping microbial community between the two sites. While PAL samples contain a higher bacterial burden and greater microbial diversity, certain anaerobic species are consistently found in both the sinus microbiota and the PAL samples. The sinus environment further modifies this microbial composition, leading to selective enrichment or depletion of particular taxa (\\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e57\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR58\\\" class=\\\"CitationRef\\\"\\u003e58\\u003c/span\\u003e). Our study corroborated the finding of greater microbial diversity in PAL compared to sinus samples. QPCR analysis revealed a significantly higher number of selected taxa in PAL samples (Wilcoxon test: p\\u0026thinsp;=\\u0026thinsp;0.0009). Furthermore, 16S rRNA amplicon sequencing revealed greater microbial diversity in the analyzed PAL samples, as evidenced by an increased relative abundance of taxa other than the ten most abundant. Comparison of microbiota from the dental socket (post-extraction site) and maxillary sinus using Jaccard distance calculation revealed significant differences between these sites (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001). While some patients exhibited nearly identical microbial profiles, others showed only partial overlap and individualized patterns of bacterial colonization. These results emphasize the importance of dual site sampling to capture the full microbiological landscape of ODS. It also indicates that ODS is not simply the result of passive migration of oral bacteria, but rather a complex, host-modulated infectious process. These findings challenge previous assumptions and point toward a more dynamic microbial exchange between dental and sinonasal environments, which is influenced by factors such as host immunity, mucosal barrier function, and environmental conditions like oxygen availability (\\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e57\\u003c/span\\u003e)(\\u003cspan citationid=\\\"CR59\\\" class=\\\"CitationRef\\\"\\u003e59\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eImportantly, molecular profiling has implications for treatment. The high prevalence of anaerobes and mixed infections identified through molecular methods suggests that empiric antibiotic regimens used in CRS may be suboptimal for ODS. This condition often requires antibiotics that specifically target oral anaerobes, such as \\u003cem\\u003eFusobacterium\\u003c/em\\u003e, \\u003cem\\u003ePrevotella\\u003c/em\\u003e, and \\u003cem\\u003ePorphyromonas\\u003c/em\\u003e. Therefore, molecular diagnostics may serve as a basis for personalized therapeutic strategies, especially in cases that are recurrent or refractory to standard therapies.\\u003c/p\\u003e\\u003cp\\u003eAlthough 16S rRNA sequencing provided the most comprehensive insight into the microbial diversity of ODS, it is expensive and requires advanced technical and bioinformatic expertise, which may limit its routine application in smaller hospital laboratories. Our proposal to use ten primer pairs in QPCR could accelerate the diagnostic process and support underfunded hospital settings in managing the complex etiology of ODS, ultimately improving the management of sinus infections. Classical microbial culture proved to be the least effective method here, mainly due to the anaerobic physiology of the predominant pathogens and the diagnostic challenges associated with this. However, without pure isolates, the detection of multidrug-resistant strains remains impossible unless whole-genome sequencing is performed, which further increases both the cost and workload.\\u003c/p\\u003e\"},{\"header\":\"Conclusions\",\"content\":\"\\u003cp\\u003eWith this study, we also aim to draw attention to the microbiology of ODS, which is etiologically distinct from other forms of CRS and has not yet received proportionate scientific attention. While there is overlap in bacterial communities, sinus samples exhibit a lower burden and site-specific shifts in taxa composition. Culture alone underestimates ODS microbial complexity, whereas QPCR and 16S rRNA amplicon sequencing provide much deeper insights. Molecular microbiology offers modern tools that can help assess the microbial complexity of this condition and fill the knowledge gap. Our research was carried out on a relatively small patient cohort; therefore, further multicenter studies are necessary to confirm our findings. Nevertheless, this approach may open new diagnostic possibilities for these complicated cases of upper respiratory tract infections, which are by no means rare.\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cdiv class=\\\"DefinitionList\\\"\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eODS\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eodontogenic sinusitis\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eCRS\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003echronic rhinosinusitis\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eCT\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003ecomputed tomography\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eCBCT\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003econe-beam computed tomography\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003ePAL\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eperiapical lesion\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eRCT\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eroot-canal treatment\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eESS\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eendoscopic sinus surgery\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eMS\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003emaxillary sinus\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eQPCR\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003equantitative polymerase chain reaction\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eOAC\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eoroantral communication\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eNGS\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003enext generation DNA sequencing\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis study has been carried out in accordance with \\u0026ldquo;The Code of Ethics of the World Medical Association (Declaration of Helsinki)\\u0026rdquo; for experiments involving humans.\\u003c/p\\u003e\\n\\u003cp\\u003eIt was approved by the Ethics Committee of the Military Institute of Medicine (protocol No 43/WIM/2019), and written informed consent was obtained from each participant.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe manuscript contains anonymized data of involved patients. All included participant signed informed consent for publication.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe study was partially founded by Institutional Grant number 565 of Military Institute of Medicine \\u0026ndash; National Research Institute.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData availability statement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNewly Generated Data\\u003c/p\\u003e\\n\\u003cp\\u003eThe Conventional Culture Data was newly generated for this study. Details of this dataset can be found in Supplementary Table 3.\\u003c/p\\u003e\\n\\u003cp\\u003eThe QPCR Quantification Data was also newly generated. Further information is available in Supplementary Table 1 and Supplementary Table 2.\\u003c/p\\u003e\\n\\u003cp\\u003eThe 16S rRNA Amplicon Sequencing Data is included in this study. This dataset is available for the reviewers in the NCBI Sequence Read Archive with the DOI or accession ID: https://dataview.ncbi.nlm.nih.gov/object/PRJNA1333631?reviewer=1gdtd4aenfnq1b6h29d6a3hkr5\\u003c/p\\u003e\\n\\u003cp\\u003eThe QPCR Primer Pairs Data is part of the newly generated data for this research. It is detailed in Supplementary Table 1.\\u003c/p\\u003e\\n\\u003cp\\u003eThe Comparative Culture Pathogen Data was generated during this study and is detailed in Supplementary Table 3.\\u003c/p\\u003e\\n\\u003cp\\u003eThe QPCR Results Data was newly generated and is detailed in Supplementary Table 4.\\u003c/p\\u003e\\n\\u003cp\\u003eReused Data\\u003c/p\\u003e\\n\\u003cp\\u003eThe Reference Genomic Bacterial DNA Data was reused in this study. Details of this dataset can be found in Supplementary Table 2.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgemen\\u003c/strong\\u003e\\u003cstrong\\u003ets\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors contribution statement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eM.A.K., E.A.T., A.T.-S. D.J., and A.G. have made substantial contributions to the conception and design of the work; \\u0026nbsp; E.A.T, \\u0026nbsp;A.T.-S., K.A. and A.G. performed the \\u0026nbsp;analysis and interpretation of data; \\u0026nbsp;M.A.K. and D.J. were responsible for acquisition of data and funding , M.A.K., E.A.T and A.T-S. wrote the main manuscript text, A.G. and D.J. have revised the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003eAll authors approved the final version of the manuscript.\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eCraig, J. R. Odontogenic sinusitis: A state-of-the-art review. Vol. 8, World Journal of Otorhinolaryngology - Head and Neck Surgery. John Wiley and Sons Inc; 8\\u0026ndash;15. (2022).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBrook, I. Sinusitis of odontogenic origin. Vol. 135, Otolaryngology - Head and Neck Surgery. pp. 349\\u0026ndash;55. (2006).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLittle, R. E., Long, C. M., Loehrl, T. A. \\u0026amp; Poetker, D. M. \\u003cem\\u003eOdontogenic sinusitis: A review of the current literature\\u003c/em\\u003e Vol. 3, p. 110\\u0026ndash;114 (John Wiley and Sons Inc, 2018). Laryngoscope Investigative Otolaryngology.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003ePuglisi, S. et al. Bacteriological findings and antimicrobial resistance in odontogenic and non-odontogenic chronic maxillary sinusitis. \\u003cem\\u003eJ. Med. Microbiol.\\u003c/em\\u003e \\u003cb\\u003e60\\u003c/b\\u003e (9), 1353\\u0026ndash;1359 (2011).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eCraig, J. R. \\u0026amp; Hopkins, C. Sinus Pathophysiology of Odontogenic Sinusitis. Otolaryngol Clin North Am [Internet]. ;57(6):1007\\u0026ndash;18. (2024). Available from: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://linkinghub.elsevier.com/retrieve/pii/S0030666524000914\\u003c/span\\u003e\\u003cspan address=\\\"https://linkinghub.elsevier.com/retrieve/pii/S0030666524000914\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMicaela, C. M. \\u0026amp; Paula, C. B. Pineda \\u0026Aacute;lvarez David. Odontogenic sinusitis, a differential diagnosis: Literature review. \\u003cem\\u003eWorld J. Adv. Res. Reviews\\u003c/em\\u003e. \\u003cb\\u003e18\\u003c/b\\u003e (1), 1241\\u0026ndash;1247 (2023).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eWorkman, A. D., Granquist, E. J. \\u0026amp; Adappa, N. D. Odontogenic sinusitis: Developments in diagnosis, microbiology, and treatment. Vol. 26, Current Opinion in Otolaryngology and Head and Neck Surgery. Lippincott Williams and Wilkins; 27\\u0026ndash;33. (2018).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eThol, F., Warwas, F. B., Spuck, N., Kramer, F. J. \\u0026amp; Heim, N. Microbial spectrum and resistance of odontogenic abscesses - microbiological analysis using next generation sequencing. \\u003cem\\u003eClin. Oral Investig\\u003c/em\\u003e ;\\u003cb\\u003e29\\u003c/b\\u003e(1). (2025).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eRapoport, S. K. et al. Determining the utility of standard hospital microbiology testing: Comparing standard microbiology cultures with DNA sequence analysis in patients with chronic sinusitis. \\u003cem\\u003eWorld J. Otorhinolaryngol. Head Neck Surg.\\u003c/em\\u003e \\u003cb\\u003e5\\u003c/b\\u003e (2), 82\\u0026ndash;87 (2019).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eYu, A. J., Espinosa, M., Adappa, N. D. \\u0026amp; Douglas, J. E. \\u003cem\\u003eComplicated Odontogenic Sinusitis: Extrasinus Infectious Spread. Otolaryngologic Clinics of North America\\u003c/em\\u003e (W.B. Saunders, 2024).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003ePalomo L\\u0026oacute;pez, N. \\u0026amp; Freire Arag\\u0026oacute;n, M. D. Rivera Fern\\u0026aacute;ndez V. Subdural empyema as a complication of odontogenic maxillary sinusitis. \\u003cem\\u003eMed. Intensiva (English Edition)\\u003c/em\\u003e. \\u003cb\\u003e42\\u003c/b\\u003e (8), e21\\u0026ndash;e22 (2018).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eCampbell, A. P., Bergmark, R. W. \\u0026amp; Metson, R. Orbital complications of acute sinusitis. \\u003cem\\u003eOperative Techniques Otolaryngol. - Head Neck Surg.\\u003c/em\\u003e \\u003cb\\u003e28\\u003c/b\\u003e (4), 213\\u0026ndash;219 (2017).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZirk, M. et al. Odontogenic sinusitis maxillaris: A retrospective study of 121 cases with surgical intervention. \\u003cem\\u003eJ. Cranio-Maxillofacial Surg.\\u003c/em\\u003e \\u003cb\\u003e45\\u003c/b\\u003e (4), 520\\u0026ndash;525 (2017).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eTakahashi, H., Matsuyama, T., Kawabata-Iwakawa, R., Kawamoto, T. \\u0026amp; Chikamatsu, K. Comprehensive profiling of the heterogeneity of molecular endotypic traits in chronic rhinosinusitis. \\u003cem\\u003eHum. Immunol.\\u003c/em\\u003e ;\\u003cb\\u003e86\\u003c/b\\u003e(3). (2025).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eB\\u0026ouml;ttger, S. et al. Clinical relevance of the microbiome in odontogenic abscesses. \\u003cem\\u003eBiology (Basel)\\u003c/em\\u003e ;\\u003cb\\u003e10\\u003c/b\\u003e(9). (2021).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eDevelopment of Real-. Time PCR Assays for Detection of the Streptococcus milleri Group from Cystic Fibrosis Clinical Specimens by Targeting the cpn60 and 16S rRNA Genes.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eDufkova, K. et al. Sequencing Independent Molecular Typing of Staphylococcus aureus Isolates: Approach for Infection Control and Clonal Characterization. \\u003cem\\u003eMicrobiol. Spectr.\\u003c/em\\u003e ;\\u003cb\\u003e10\\u003c/b\\u003e(1). (2022).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eHaider, A. A., Marino, M. J., Yao, W. C., Citardi, M. J. \\u0026amp; Luong, A. U. The Potential of High-Throughput DNA Sequencing of the Paranasal Sinus Microbiome in Diagnosing Odontogenic Sinusitis. Otolaryngology - Head and Neck Surgery. \\u003cem\\u003e(United States)\\u003c/em\\u003e. \\u003cb\\u003e161\\u003c/b\\u003e (6), 1043\\u0026ndash;1047 (2019).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eWu, J. et al. Bacterial Diversity and Community Characteristics of the Sinus and Dental Regions in Adults with Odontogenic Sinusitis [Internet]. (2023). Available from: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.researchsquare.com/article/rs-2562730/v1\\u003c/span\\u003e\\u003cspan address=\\\"https://www.researchsquare.com/article/rs-2562730/v1\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003ePing, Y., Wang, J. \\u0026amp; Liang, J. Pyrosequencing analysis of apical microbiota of teeth with persistent apical periodontitis. \\u003cem\\u003eJ. Dent. Sci.\\u003c/em\\u003e \\u003cb\\u003e10\\u003c/b\\u003e (4), 365\\u0026ndash;371 (2015).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLin, J. et al. \\u003cem\\u003eExpert consensus on odontogenic maxillary sinusitis multi-disciplinary treatment\\u003c/em\\u003e Vol. 16 (Springer Nature, 2024). International Journal of Oral Science.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eYassin-Kassab, A. et al. Comparison of bacterial maxillary sinus cultures between odontogenic sinusitis and chronic rhinosinusitis. \\u003cem\\u003eInt. Forum Allergy Rhinol\\u003c/em\\u003e. \\u003cb\\u003e11\\u003c/b\\u003e (1), 40\\u0026ndash;47 (2021).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eAreizaga-Madina, M., Pardal-Pel\\u0026aacute;ez, B. \\u0026amp; Montero, J. Microbiology of Maxillary Sinus Infections: Systematic Review on the Relationship of Infectious Sinus Pathology with Oral Pathology. \\u003cem\\u003eOral\\u003c/em\\u003e \\u003cb\\u003e3\\u003c/b\\u003e (1), 134\\u0026ndash;145 (2023).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSaibene, A. M. et al. Odontogenic and rhinogenic chronic sinusitis: A modern microbiological comparison. \\u003cem\\u003eInt. Forum Allergy Rhinol\\u003c/em\\u003e. \\u003cb\\u003e6\\u003c/b\\u003e (1), 41\\u0026ndash;45 (2016).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eEscapa, I. F. et al. New Insights into Human Nostril Microbiome from the Expanded Human Oral Microbiome Database (eHOMD): a Resource for the Microbiome of the Human Aerodigestive Tract. \\u003cem\\u003emSystems\\u003c/em\\u003e ;\\u003cb\\u003e3\\u003c/b\\u003e(6). (2018).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eYarmosh, D. A. et al. Comparative Analysis and Data Provenance for 1,113 Bacterial Genome Assemblies. \\u003cem\\u003emSphere\\u003c/em\\u003e ;\\u003cb\\u003e7\\u003c/b\\u003e(3). (2022).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eO\\u0026rsquo;Leary, N. A. et al. Reference sequence (RefSeq) database at NCBI: Current status, taxonomic expansion, and functional annotation. \\u003cem\\u003eNucleic Acids Res.\\u003c/em\\u003e \\u003cb\\u003e44\\u003c/b\\u003e (D1), D733\\u0026ndash;D745 (2016).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSayers, E. W. et al. \\u003cem\\u003eGenBank Nucleic Acids Res.\\u003c/em\\u003e ;\\u003cb\\u003e48\\u003c/b\\u003e(D1):D84\\u0026ndash;D86. (2020).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMadeira, F. et al. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. \\u003cem\\u003eNucleic Acids Res.\\u003c/em\\u003e \\u003cb\\u003e52\\u003c/b\\u003e (W1), W521\\u0026ndash;W525 (2024).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eWaterhouse, A. M., Procter, J. B., Martin, D. M. A., Clamp, M. \\u0026amp; Barton, G. J. Jalview Version 2-A multiple sequence alignment editor and analysis workbench. \\u003cem\\u003eBioinformatics\\u003c/em\\u003e \\u003cb\\u003e25\\u003c/b\\u003e (9), 1189\\u0026ndash;1191 (2009).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eYe, J. et al. -BLAST: A tool to design target-specific primers for polymerase chain reaction [Internet]. (2012). Available from: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.biomedcentral.com/1471-2105/13/134\\u003c/span\\u003e\\u003cspan address=\\\"http://www.biomedcentral.com/1471-2105/13/134\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eNuclear, D. N. A. Content and Genome Size of Trout and Human.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBolyen, E. et al. \\u003cem\\u003eReproducible, interactive, scalable and extensible microbiome data science using QIIME 2\\u003c/em\\u003e Vol. 37, p. 852\\u0026ndash;857 (Nature Publishing Group, 2019). Nature Biotechnology.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBokulich, N. A. et al. Optimizing taxonomic classification of marker-gene amplicon sequences with QIIME 2\\u0026rsquo;s q2-feature-classifier plugin. \\u003cem\\u003eMicrobiome\\u003c/em\\u003e ;\\u003cb\\u003e6\\u003c/b\\u003e(1). (2018).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eQuast, C. et al. The SILVA ribosomal RNA gene database project: Improved data processing and web-based tools. \\u003cem\\u003eNucleic Acids Res.\\u003c/em\\u003e \\u003cb\\u003e41\\u003c/b\\u003e, D1 (2013).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003ePosit Team. \\u003cem\\u003eRStudio: Integrated Development Environment for R. Posit Software\\u003c/em\\u003e (PBC, 2024). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.posit.co/\\u003c/span\\u003e\\u003cspan address=\\\"http://www.posit.co/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eFokkens, W. J. et al. European Position Paper on Rhinosinusitis and Nasal Polyps 2020. Vol. 103, Dieudonn\\u0026eacute; Nyenbue Tshipukane.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSivasubramaniam, R. \\u0026amp; Douglas, R. The microbiome and chronic rhinosinusitis. Vol. 4, World Journal of Otorhinolaryngology - Head and Neck Surgery. KeAi Communications Co.; 216\\u0026ndash;221. (2018).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMichalik, M. \\u0026amp; Krawczyk, B. \\u003cem\\u003eChronic Rhinosinusitis\\u0026mdash;Microbiological Etiology, Potential Genetic Markers, and Diagnosis\\u003c/em\\u003e Vol. 25 (Multidisciplinary Digital Publishing Institute (MDPI), 2024). International Journal of Molecular Sciences.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eStryjewska-Makuch, G., Janik, M. A., Lisowska, G. \\u0026amp; Kolebacz, B. Bacteriological analysis of isolated chronic sinusitis without polyps. \\u003cem\\u003ePostepy Dermatol. Alergol\\u003c/em\\u003e. \\u003cb\\u003e35\\u003c/b\\u003e (4), 375\\u0026ndash;380 (2018).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKim, D., Assiri, A. M. \\u0026amp; Kim, J. H. Recent trends in bacteriology of adult patients with chronic rhinosinusitis. \\u003cem\\u003eJ. Clin. Med.\\u003c/em\\u003e ;\\u003cb\\u003e8\\u003c/b\\u003e(11). (2019).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBrook, I. Microbiology of acute and chronic maxillary sinusitis associated with an odontogenic origin. \\u003cem\\u003eLaryngoscope\\u003c/em\\u003e \\u003cb\\u003e115\\u003c/b\\u003e (5), 823\\u0026ndash;825 (2005).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eUrb\\u0026aacute;n, E., Gajd\\u0026aacute;cs, M. \\u0026amp; Torkos, A. The incidence of anaerobic bacteria in adult patients with chronic sinusitis: A prospective, single-centre microbiological study. \\u003cem\\u003eEur. J. Microbiol. Immunol. (Bp)\\u003c/em\\u003e. \\u003cb\\u003e10\\u003c/b\\u003e (2), 107\\u0026ndash;114 (2020).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eWu, J. et al. Bacterial diversity and community characteristics of the sinus and dental regions in adults with odontogenic sinusitis. \\u003cem\\u003eBMC Microbiol.\\u003c/em\\u003e ;\\u003cb\\u003e23\\u003c/b\\u003e(1). (2023).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLu, Y. T. et al. Microbiota dysbiosis in odontogenic rhinosinusitis and its association with anaerobic bacteria. \\u003cem\\u003eSci. Rep.\\u003c/em\\u003e ;\\u003cb\\u003e12\\u003c/b\\u003e(1). (2022).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMaruyama, N. et al. Intraindividual variation in core microbiota in peri-implantitis and periodontitis. \\u003cem\\u003eSci. Rep.\\u003c/em\\u003e ;\\u003cb\\u003e4\\u003c/b\\u003e. (2014).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSiqueira, J. F. \\u0026amp; R\\u0026ocirc;\\u0026Ccedil;as, I. N. Distinctive features of the microbiota associated with different forms of apical periodontitis. \\u003cb\\u003e1\\u003c/b\\u003e, \\u003cem\\u003eJ. Oral Microbiol.\\u003c/em\\u003e (2009).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eQian, W. et al. Microbiota in the apical root canal system of tooth with apical periodontitis. \\u003cem\\u003eBMC Genom.\\u003c/em\\u003e ;\\u003cb\\u003e20\\u003c/b\\u003e. (2019).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMussano, F. et al. Apical periodontitis: Preliminary assessment of microbiota by 16S rRNA high throughput amplicon target sequencing. \\u003cem\\u003eBMC Oral Health\\u003c/em\\u003e ;\\u003cb\\u003e18\\u003c/b\\u003e(1). (2018).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eChen, W. P. et al. Composition Analysis and Feature Selection of the Oral Microbiota Associated with Periodontal Disease. Biomed Res Int. ;2018. (2018).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eB\\u0026ouml;ttger, S. et al. Clinical relevance of the microbiome in odontogenic abscesses. \\u003cem\\u003eBiology (Basel)\\u003c/em\\u003e ;\\u003cb\\u003e10\\u003c/b\\u003e(9). (2021).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBordagaray, M. J. et al. Systemic and Extraradicular Bacterial Translocation in Apical Periodontitis. \\u003cem\\u003eFront. Cell. Infect. Microbiol.\\u003c/em\\u003e ;\\u003cb\\u003e11\\u003c/b\\u003e. (2021).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eCraig, J. R. et al. \\u003cem\\u003eDiagnosing odontogenic sinusitis of endodontic origin: A multidisciplinary literature review\\u003c/em\\u003e Vol. 42 (W.B. Saunders, 2021). American Journal of Otolaryngology - Head and Neck Medicine and Surgery.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBrennan, C. A. \\u0026amp; Garrett, W. S. \\u003cem\\u003eFusobacterium nucleatum \\u0026mdash; symbiont, opportunist and oncobacterium\\u003c/em\\u003e Vol. 17, p. 156\\u0026ndash;166 (Nature Publishing Group, 2019). Nature Reviews Microbiology.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBrooks, J. P. et al. The truth about metagenomics: Quantifying and counteracting bias in 16S rRNA studies Ecological and evolutionary microbiology. \\u003cem\\u003eBMC Microbiol.\\u003c/em\\u003e ;\\u003cb\\u003e15\\u003c/b\\u003e(1). (2015).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eAbusleme, L. et al. The subgingival microbiome in health and periodontitis and its relationship with community biomass and inflammation. \\u003cem\\u003eISME J.\\u003c/em\\u003e \\u003cb\\u003e7\\u003c/b\\u003e (5), 1016\\u0026ndash;1025 (2013).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMan, W. H., De Steenhuijsen Piters, W. A. A. \\u0026amp; Bogaert, D. \\u003cem\\u003eThe microbiota of the respiratory tract: Gatekeeper to respiratory health\\u003c/em\\u003e Vol. 15, p. 259\\u0026ndash;270 (Nature Publishing Group, 2017). Nature Reviews Microbiology.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBouillaguet, S. et al. Root microbiota in primary and secondary apical periodontitis. Front Microbiol. ;9(OCT). (2018).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eYoshida, H. et al. Relationship between infected tooth extraction and improvement of odontogenic maxillary sinusitis. \\u003cem\\u003eLaryngoscope Investig Otolaryngol.\\u003c/em\\u003e \\u003cb\\u003e7\\u003c/b\\u003e (2), 335\\u0026ndash;341 (2022).\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"odontogenic sinusitis, polymerase chain reaction, endoscopic sinus surgery, periapical lesion, next generation sequencing, oroantral communication\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-8067667/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-8067667/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e\\u003cp\\u003eOdontogenic sinusitis (ODS) is a common cause of unilateral maxillary sinusitis, and it arises from periapical lesions (PAL) or other odontogenic foci. This infection is polymicrobial and anaerobe-rich, thus standard culture methods often underestimate its diversity. Molecular techniques such as quantitative polymerase chain reaction (QPCR) and next-generation sequencing (NGS) may better characterize the microbial burden and composition.\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e\\u003cp\\u003ePaired sinus mucosal biopsy (SIN) and the tissue scrapings from periapical lesion (PAL) specimens were collected from 28 patients with ODS. Bacterial detection was performed using conventional culture, and QPCR targeting ten clinically relevant taxa. For paired sampled from three randomly selected patients 16S rRNA amplicon sequencing was performed. Microbial load, taxa richness, and the similarity of bacterial communities between the two anatomically connected sites were compared across the molecular methods. Statistical analysis included the Wilcoxon signed-rank, McNemar, and Bray\\u0026ndash;Curtis dissimilarity testing.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e\\u003cp\\u003eCulture yielded low detection rates, identifying only a limited set of pathogens (\\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e, \\u003cem\\u003eStreptococcus anginosus\\u003c/em\\u003e, and \\u003cem\\u003eFusobacterium nucleatum\\u003c/em\\u003e) in a minority of samples. In contrast, QPCR demonstrated significantly higher detection frequencies, particularly in PAL specimens. \\u003cem\\u003ePorphyromonas gingivalis\\u003c/em\\u003e (96.8%), \\u003cem\\u003eF. nucleatum\\u003c/em\\u003e (90.3%), and the \\u003cem\\u003eS. anginosus\\u003c/em\\u003e group (90.3%) were highly prevalent in PAL, while SIN samples showed lower but overlapping positivity (89.3%, 67.9%, and 50.0%, respectively). Overall, PAL samples harbored significantly higher bacterial loads and taxa richness than SIN specimens (Wilcoxon p\\u0026thinsp;=\\u0026thinsp;0.0004). 16S rRNA amplicon sequencing confirmed the presence of polymicrobial communities in both sites and revealed additional taxa beyond those included in the QPCR panel. Jaccard distance and Bray\\u0026ndash;Curtis analyses revealed patient-specific overlap: some PAL and SIN pairs shared nearly identical microbiota, while others exhibited marked divergence.\\u003c/p\\u003e\\u003ch2\\u003eConclusions\\u003c/h2\\u003e\\u003cp\\u003ePALs represent a reservoir of mostly anaerobic bacterial species that may translocate into the maxillary sinus, establishing ODS. While there is overlap in bacterial communities, sinus samples exhibit a lower burden and site-specific shifts in taxa composition. Culture alone underestimates ODS microbial complexity, whereas QPCR and 16S rRNA amplicon sequencing provide much deeper insights. Combined molecular approaches are essential for accurate pathogen detection and for guiding effective management of ODS.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Comparative Approaches to Microbial Profiling in Odontogenic Sinusitis with Periapical Lesions\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-12-01 08:26:57\",\"doi\":\"10.21203/rs.3.rs-8067667/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"cc56ef5b-aef4-46a3-afb6-130720eeb798\",\"owner\":[],\"postedDate\":\"December 1st, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":58600885,\"name\":\"Health sciences/Diseases\"},{\"id\":58600886,\"name\":\"Health sciences/Medical research\"},{\"id\":58600887,\"name\":\"Biological sciences/Microbiology\"}],\"tags\":[],\"updatedAt\":\"2026-01-02T08:09:36+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-12-01 08:26:57\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-8067667\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-8067667\",\"identity\":\"rs-8067667\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}