{"paper_id":"1561baa9-2b6f-4070-803a-e60882361827","body_text":"Endothelial and neuronal engagement by AAV-BR1 gene therapy alleviates neurological symptoms and lipid deposition in a mouse model of Niemann-Pick type C2 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Endothelial and neuronal engagement by AAV-BR1 gene therapy alleviates neurological symptoms and lipid deposition in a mouse model of Niemann-Pick type C2 Charlotte Laurfelt Munch Rasmussen, Signe Frost Frederiksen, Christian Würtz Heegaard, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5245293/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 31 Jan, 2025 Read the published version in Fluids and Barriers of the CNS → Version 1 posted 11 You are reading this latest preprint version Abstract Background: Patients with the genetic disorder Niemann-Pick type C2 disease (NP-C2) suffer from lysosomal accumulation of cholesterol causing both systemic and severe neurological symptoms. In a murine NP-C2 model, otherwise successful intravenous Niemann-Pick C2 protein (NPC2) replacement therapy fails to alleviate progressive neurodegeneration as infused NPC2 cannot cross the blood-brain barrier (BBB). Genetic modification of brain endothelial cells (BECs) is thought to enable secretion of recombinant proteins thereby overcoming the restrictions of the BBB. We hypothesized that an adeno-associated virus (AAV-BR1) encoding the Npc2 gene could cure neurological symptoms in Npc2 -/- mice through transduction of BECs, and possibly neurons via viral passage across the BBB. Methods: Six weeks old Npc2 -/- mice were intravenously injected with the AAV-BR1-NPC2 vector. Composite phenotype scores and behavioral tests were assessed for the following six weeks and visually documented. Post-mortem analyses included gene expression analyses, verification of neurodegeneration in Purkinje cells, determination of NPC2 transduction in the CNS, assessment of neuroinflammation, quantification of gangliosides and co-detection of cholesterol with NPC2 in degenerating neurons. Results: Treatment with the AAV-BR1-NPC2 vector improved motor functions, reduced neocortical inflammation, and preserved Purkinje cells in most of the mice, referred to as high-responders. The vector exerted tropism for BECs and neurons resulting in a widespread NPC2 distribution in the brain with a concomitant reduction of cholesterol in adjacent neurons, presumably not transduced by the vector. Mass spectrometry imaging revealed distinct lipid alterations in the brains of Npc2 -/- mice, with increased GM2 and GM3 ganglioside accumulation in the cerebellum and hippocampus. AAV-BR1-NPC2 treatment partially normalized these ganglioside distributions in high responders, including restoration of lipid profiles towards those of Npc2 +/+ controls. Conclusion: The data suggests cross-correcting gene therapy to the brain via delivery of NPC2 from BECs and neurons. AAV-BR1 blood-brain barrier viral gene therapy Niemann-Pick type C2 disease NPC2 cross-correction gangliosides cholesterol. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Background Niemann-Pick type C disease (NP-C) is a rare autosomal recessive lysosomal lipid storage disease caused by mutations in either the Npc1 or Npc2 gene [ 1 , 2 ] leading to neurodegeneration. NP-C is thus divided into two subtypes depending on the gene affected. Deficiency in the Niemann-Pick C1 protein (NPC1) accounts for 95% of the disease cases, and Niemann-Pick C2 protein (NPC2) for the remaining 5% [ 3 , 4 ]. Both proteins are essential for the transport and redistribution of cholesterol from the lysosomes to other organelles, e.g., the endoplasmic reticulum and plasma membranes. The loss of one of the two proteins results in a lysosomal accumulation of cholesterol [ 5 , 6 ] and secondary changes in sphingolipids including sphingosine and sphingomyelin, gangliosides (GM2 and GM3), and glycolipids, such as glucosylceramide [ 7 – 9 ]. The clinical manifestations of NP-C are diverse. The age of onset ranges from neonatal to adulthood, with an earlier onset indicating a more severe disease progression, depending on the type of mutation. Hepatosplenomegaly is among the first clinical findings, followed by the development of neurological symptoms with the most prominent being cerebellar ataxia [ 2 , 4 , 10 , 11 ]. The progressive nature of the disease has a fatal outcome, and most patients die between 10 and 25 years of age [ 4 ]. Effective treatment of NP-C is currently unavailable, and the glucosylceramide synthase inhibitor Miglustat (Zavesca) is the only approved disease-modifying therapeutic [ 12 ]. The heterogeneous clinical manifestation results in variations between symptom development and timing of exact diagnosis [ 12 , 13 ]. Development of new effective treatments, including the use of viral gene therapies, is therefore highly warranted [ 14 ]. NPC1 is transmembrane-bound and integrated into the lysosomal membrane [ 5 , 6 ] whereas NPC2 is a ~ 17 kDa soluble mannose 6-phosphate tagged glycoprotein found in lysosomes and secretory fluids [ 15 ]. Secreted NPC2 is endocytosed in peripheral tissues via the ubiquitous mannose-6-phosphate receptor (M6PR) pathway [ 16 ]. However, the entry of NPC2 from the blood into the brain parenchyma is restricted at the blood-brain barrier (BBB) due to a developmental decline in M6PR during the maturation of brain endothelial cells (BECs) [ 17 , 18 ]. Previous in vitro studies have shown that genetic modification of BECs forming the BBB results in a bi-directional secretion of recombinant proteins [ 16 , 19 – 22 ], suggesting that proteins released from BECs subsequently can be accessible for both peripheral organs as well as the brain. The potential of cross-correcting cells within the central nervous system (CNS) makes NP-C2 a good candidate for gene therapy [ 23 – 25 ]. AAV-BR1, a capsid-modified AAV vector, known for its robust tropism for BECs, when applied intravenously, has been shown to confer long-lasting transgene expression in the brain with a minimum of transduction of peripheral organs except for the lungs [ 21 , 26 – 29 ]. The therapeutic potential of AAV-BR1 has recently been proven in different mouse models with neurodegeneration, e.g., Incontinentia pigmenti, Sandhoff disease, and Allan-Herndon-Dudley syndrome [ 26 – 29 ], where successful treatment was enabled by alteration of gene expression in BECs. We recently showed that systemic administration of this putative BEC-specific AAV-BR1, when encoding the Npc2 gene, somewhat surprisingly led to successful transduction of both BECs and neurons [ 21 ], which suggests that AAV-BR1 to some extent can pass the BBB, and transduce neurons in vivo . Accordingly, we hypothesized that BBB-directed gene therapy using the AAV-BR1-NPC2 vector would effectively transduce both BECs and neurons with subsequent delivery of NPC2, leading to alleviation of both neurological and non-neurological symptoms in a mouse model of NP-C2. The present study demonstrates that a single intravenous injection of the AAV-BR1 vector at six weeks of age in NPC2-deficient mice leads to a widespread distribution of NPC2 in both BECs and neurons causing a reduction of neurological symptoms, possibly due to a lowering of neuronal cholesterol and gangliosides. Materials and methods Production of recombinant viral vectors The plasmid pAAV-CAG-NPC2 was generated following the procedure described earlier [ 28 ]. The recombinant AAV-BR1-NPC2 vector used in the present study was produced by co-infection of Sf9 cells using the baculovirus expression system as previously described [ 21 ]. In short, Sf9 cells were infected with two different recombinant baculoviruses; one carrying the AAV2 rep gene and a brain-endothelial cell-specific AAV2-BR1 cap gene, and one containing the CAG promoter and the mouse Npc2 gene flanked by inverted terminal repeats from AAV2. Four days after the co-infection, the viral particles were harvested from the Sf9 cells by repeated freeze/thaw cycles and digested with 50 U/mL Benzonase Nuclease to remove unpackaged DNA. The viral vectors were purified using iodixanol density-gradient ultracentrifugation and extracted from the 40% iodixanol layer. Genomic titers were determined by quantitative real-time PCR (qPCR) using CAG-specific primers (Table I). The SYBR Green-based FastStart Essential DNA Green Master (Merck KGaA, #06402712001 Roche) with the Light Cycler 96 System (Roche) was used to determine the vector copy numbers. The reactions were run with an initial denaturation for 10 min at 95°C followed by 40 cycles of denaturation for 30 s at 95°C, then annealing for 30 s at 67°C, and extension for 30 s at 72°C, followed by a melt curve analysis (60–97°C, 0.1°C/s). Transduction of a primary in vitro blood-brain barrier model and immunocytochemistry The transduction efficiency of the AAV-BR1-NPC2 vector was initially tested in vitro . Primary mouse brain endothelial cells (mBECs) were isolated from 8-week-old female BALB/cJRj mice, and primary mixed glial cells (consisting of astrocytes and some microglia [ 30 ] were isolated from brains of 2-days old C57BL/6 mice of both sexes as previously described [ 30 , 31 ]. mBECs were seeded on hanging culture insert and co-cultured with primary mixed glial cells to establish a BBB non-contact co-culture model. After seeding, the barrier integrity was induced by adding CTP-cAMP (250 µM), hydrocortisone (550 nM), and RO (17.5 µM). The integrity of the in vitro BBB model was evaluated through measurements of transendothelial electrical resistance (TEER) using a MiliCell ERS-2 epithelial volt-ohm Meter and a STX01 chopstick electrode (Merck Millipore) as previously described [ 31 ]. TEER was measured before transduction, the day after transduction, and at the end of the study. Two days after the seeding of mBECs, when they expressed a high TEER (> 150 Ω*cm 2 ) [ 31 ], the cells were transduced with a dose of 10 10 viral genomes (vg)/well. 24 hours after transduction the medium was changed. Three days later, the cells were fixed in 4% paraformaldehyde (PFA) and immunostained with rabbit anti-NPC2 (Novusbio, #NBP1-84012) diluted 1:250 in combination with goat anti-mouse/rat CD31/PECAM-1 (Bio-Techne, #AF3628) diluted 1:500. The secondary antibodies donkey anti-goat Alexa 488 (Invitrogen, #A11055) was used in combined with a donkey anti-rabbit Alexa 594 (Invitrogen, #A21207) both diluted 1:250. Nuclei were stained with 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) diluted 1:500. For further immunocytochemical specifications see [ 21 ]. Images were acquired using an AxioObserver Z1 fluorescence microscope equipped with ApoTome and Axiocam MR camera using a 40x/1.3na oil Objective. Animal study approval and reporting The animal studies were performed according to the Danish Animal Experimentation Act (BEK no. 2028 of 14/12/2020) and the European directive (2010/63/EU) and carried out by licensed staff. The Danish Animal Experiments Inspectorate under the Ministry of Food, Fisheries, and Agriculture has approved all animal experiments and breeding of NPC2-deficient mice (license no. 2018-15-0201-01467 and 2019-15-0202-00056). The animal study is reported according to the ARRIVE guidelines [ 32 ]. Animals The 129P2/OlaHsd- Npc2 Gt(LST105)BygNya mouse strain [ 33 ] was rederived using in vitro fertilization, and the strain established on a BALB/cJRj background (supplied by Janvier Labs, Le Genest-Saint‐Isle, France). Heterozygous Npc2 +/- mice were mated to obtain offspring homozygous for the mutation ( Npc2 -/-) and wild-type (WT) control littermates ( Npc2+/+ ). The breeding was established using continuous trio-breeding (two Npc2 +/- female mice were housed with one Npc2 +/- male mouse) [ 34 ]. The housing and breeding were carried out at the animal facility at Aarhus University, Aarhus, Denmark, under specific pathogen-free conditions. Health monitoring was followed according to FELASA recommendations [ 35 ], and the mice were free of all pathogens listed. Both female and male mice were included in the study. The mice were group-housed with up to five mice per cage in standard IVC cages (GM500, Tecniplast) under controlled conditions (ambient temperature 20–24°C, 55 ± 10% humidity, and a 12-hour light/dark cycle with the light on at 6:00 am). They were provided with environmental enrichment consisting of Tapvei bedding material, sizzle nesting material, aspen bricks, biodegradable cardboard houses, tunnels, and peanuts as food enrichment. The cages were changed once a week. Offspring were weaned at 21 days of age and separated according to sex. Mice were provided with a standard chow diet (Altromin #1324, Brogaarden, Lynge, Denmark) and reverse osmosis water ad libitum . Genotyping Genotyping of mice was performed on postnatal days 10–14 based on ear punching [ 34 ], which was also used for individual identification. DNA from ear punches was purified using the Quick-DNA mini prep plus kit (Zymo Research # D4068) according to the manufacturer’s protocol. DNA quantity and purity were determined with a DeNovix Spectrophotometer DS-11. The Npc2 -/- genotype was determined by qPCRs using Maxima SYBR Green Master Mix, with ROX as a reference (Thermo Fisher Scientific, #K0223) and two sets of primers. The primer sequences are shown in Table I. All samples were analyzed in duplicates. The qPCR reaction was performed using the QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific). In short, the qPCR reaction was initiated with denaturation of the samples at 95°C for 10 minutes followed by 40 cycles of denaturation at 95°C for 15 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds. Finally, a melt curve analysis was performed (60°C to 95°C with 0.05°C/s). In vivo study design A total of 30 mice were used in the study. Offspring from the trio breeding of heterozygote Npc2 +/- were divided into three groups (n = 10/group) (Fig. 1 ). The Npc2 -/- mice were randomly allocated to their respective group (treated vs. untreated) using a computer-based random order generator [ 36 ]. The study director was blinded to treatment status during the entire study period and blinded to genotype and treatment group during the histopathological evaluation. In the first and second groups, six weeks old Npc2 -/- mice were intravenously injected with sterile phosphate-buffered saline (PBS) or AAV-BR1-NPC2 vectors diluted in PBS (dose at 1.6x10 11 viral vectors/mouse) in the tail vein. Both groups were injected with the same volume (200 µl). The vector dose and route of administration are based on previous studies [ 21 , 28 ]. The third group included age-matched untreated wild-type (WT) littermates used as controls. The experimental unit is the individual mouse, and since only 1 in 7 mice is born with the Npc2 -/- genotype [ 34 ], the study was conducted in seven cohorts. Whenever possible, all experimental groups were represented in each of the cages. During the study period, the mice were monitored daily for their clinical condition. The body weight was measured weekly, but from 60 days of age until the end of the study (day 84), the body weight was measured twice a week. At 12 weeks of age, before reaching the end stage of the disease, the study was terminated (Fig. 1 ). To test our hypothesis, the primary outcome measures were body weight and behavior (rotarod performance, composite phenotype score, and gait analysis). Post-mortem analysis included quantification of total cholesterol, mass spectrometry imaging of gangliosides, and histopathological evaluation of brain and visceral organs. No inclusion or exclusion criteria were set before the beginning of the study, but at the time point of treatment (6 weeks of age), a single male Npc2 -/- mouse was excluded due to lower body weight and trouble with coordination and balance compared with cage mates. At the time of unblinding, it was revealed that this mouse was designated for the PBS group resulting in only nine mice in this group. Behavioral analysis Before the start of the experiment (from 3 weeks of age), the mice were socialized and habituated to the experiment handler (10 minutes per cage for three consecutive days). Whenever possible, mice were handled using either tunnel or cupping to minimize stress induced by handling [ 37 ]. All behavioral experiments were conducted by female researchers. To study the efficacy of the AAV-BR1-NPC2 therapy on the cerebellar function (e.g. motor coordination, ataxia, and tremor), two different behavioral assessments were performed; rotarod performance and a composite phenotype score (adapted from [ 38 – 41 ]) where the following parameters were included: grooming, kyphosis (body position), tremor, ledge test, gait, hind limb clasping, and explorative behavior (activity). Each mouse was given a score of 0–2 for each parameter evaluated. Thus, a higher score indicates a more severe disease progression (see supplemental Table 1 for the scoring scheme). The mice were scored at 6, 9, and 12 weeks of age. Rotarod Motor coordination and balance were assessed weekly from 5 weeks of age using an accelerating Rotarod (LE 8200, Panlab, Harvard Apparatus, Barcelona, Spain) as previously described [ 42 ]. Briefly, the rotating drum (3 cm in diameter) accelerated at a constant rate from 4–40 rpm over 5 minutes. The latency to fall (seconds), as well as the speed at fall (revolutions per minute), was measured automatically when the mouse fell onto the underlying lever, which was equipped with a switch that detects time. The mice were tested once a week in a random order, always at the same time of the day (8–11 a.m.) during the entire study period. Before the test session, the mice were acclimatized to the experimental room for 15 minutes. The test session consisted of three trials with a 15-minute inter-trial interval. The data from the three trials were averaged and used for statistical analysis. If a mouse fell before 5 seconds, the mouse received a fourth trial. If a mouse completed a passive rotation, the timer was manually stopped, the latency to fall was recorded, and the mouse was replaced in the cage. Mice falling off the rotarod before 5 seconds more than two times in a row or before the timer was started were assessed as unable to perform on the rotarod, and they were recorded for 0 seconds, which were used for the statistical analysis. At four weeks of age, the mice were trained before the test sessions with three trials for four consecutive days. During the first trial, the mice were habituated to the rotarod test system and were allowed to walk on the rotating drum at a speed of 4 rpm for up to 4 minutes. On the second day, each mouse was trained at a speed of 10 rpm for 2 minutes. If a mouse fell during the training session, they were replaced on the rotating drum until the end of the set trial period. For the next two days, the mice were habituated to the acceleration test protocol, as previously mentioned. The mice were not replaced on the drum during the last two training sessions. Gait analysis A thorough gait analysis was performed every third week from 6 weeks of age until euthanasia at 12 weeks of age. The paws of the mouse were dipped in non-toxic water-based paints (front paws in red, hind paws in blue). The mice were trained to walk down a runway lined with white paper. During the training sessions, the mice underwent three trials for three consecutive days. Humane endpoints Based on knowledge of disease progression and manifestations from a previous study using similar Npc2-/- mice [ 33 , 34 ], the mice were euthanized at 12 weeks of age (six weeks post-injection) or whenever humane endpoints were reached. The humane endpoints were as follows: inability to drink or eat, dehydration, severe tremors, and ataxia resulting in repeated falling or reluctance to move, weighing 20% less compared to WT mice of identical age and sex, and penile prolapse. Tissue collection and processing At 12 weeks of age, the mice were deeply anesthetized with 5% isoflurane (1L/min O 2 ), and once reflexes were absent, the thoracic cavity was opened, and intracardiac blood samples were collected in clean 1.5 ml Eppendorf-tubes. The serum samples were prepared as follows; the blood was allowed to clot at room temperature for 30 minutes and then centrifuged at 1300 ×g for 10 minutes. Serum samples were stored at -70°C until further analysis. The animals were transcardiacally perfused with a manual injection of 20 ml cold PBS. Brain, liver, spleen, and lung tissue were harvested from every animal (n = 9–10/group) and weighed using a precision scale. Afterward, the visceral organs were divided in two; one half was snap-frozen on dry ice and stored at -70°C for biochemical analysis, and the other half was post-fixated in 4% PFA overnight at 4°C. The brain and cerebellum were likewise divided in two, one-half snap-frozen on dry ice and stored at -70°C for biochemical analysis (n = 3/group) or snap-frozen for mass spectrometry imaging (MSI) (n = 6–7/group), and the other half was post-fixated in 4% PFA overnight at 4°C (n = 9–10/group). Post-fixated organs were subsequently thoroughly washed in potassium-containing phosphate-buffered saline (PPBS) and stored at 4°C in PPBS with 0.1% sodium azide. Morphological and immunohistochemical investigations 40 µm cryosections of brain tissue were prepared as previously described [ 21 ]. Free-floating brain sections were incubated in 3% porcine serum with 0.3% Triton X-100 diluted in 0.1 M PPBS (blocking buffer) for 30 minutes at room temperature to block unspecific binding and permeabilize cell membranes. Then the sections were incubated overnight at 4°C with the following primary antibodies diluted in blocking buffer; anti-glial fibrillary acidic protein (GFAP) (Dako, #ZO334) (1:500), anti-ionized calcium-binding adaptor molecule 1 (IBA1) (Wako, #PDF3116) (1:5,000), anti-calbindin CD28K (Invitrogen, #PAS-85669) (1:500), Neuronal nuclei antigen (NeuN) (Chemicon, #MAB377) (1:500) and anti-bovine NPC2 (Immuno-affinity purified antibody derived from anti-NPC2 IgG positive rabbit serum produced by subcutaneous injections of native bovine NPC2 [ 33 ] (1:2,000). After three washes in blocking buffer diluted 1:50 in PPBS (washing buffer), most sections were incubated with biotinylated goat anti-rabbit IgG (Vector, #BA-1000) diluted 1:200 in blocking buffer for one hour. Sections were washed twice in washing buffer and once in PPBS. For visualization, the sections were incubated in an Avidin-Biotin Complex (ABComplex)-system (VECTASTAIN® Elite ABC-HRP Kit, Vector laboratories, #PK6100) diluted in PPBS and finally in 3,3′-diaminobenzidine tetrahydrochloride (DAB). The sections were mounted with Pertex. Sections double stained for NeuN and/or NPC2 were visualized using goat anti-mouse Alexa 594 (Invitrogen #A11032) (1:200), and biotinylated goat anti-rabbit (1:200). For tyramide enhancement of NPC2 [ 21 ], ABComplex Vectastain were added for 30 minutes and washed in PPBS. The Tyramide Signal Amplification (TSA) Biotin kit (AKOYA Biosciences, #NEL700A001KT) was added for five minutes, and the sections were washed in PPBS and incubated with the ABComplex Vectastain for 30 minutes. The sections were again washed in PPBS and visualized using an anti-streptavidin Alexa 488 (Invitrogen, #S32354) (1:200) antibody for one hour. Sections stained with NPC2 were counterstained with Lycopersicon Esculentum (Tomato) Lectin, DyLight® 594 (Vector Laboratories, #DL-1177-1) diluted 1:100 in PPBS (10mg/ml) for 30 min at room temperature. Tomato lectin labels the vasculature and microglia cells [ 43 ]. Sections stained with NeuN and NPC2 were double stained with Filipin, as explained below. Cholesterol staining on brain sections was performed using Filipin complex III (Sigma-Aldrich, #F4767) modified from [ 24 ]. Filipin stock solution in dimethyl sulfoxide (1mg/ml) was diluted in PBS for a final working solution of 50 µg/ml. The free-floating brain sections were washed twice in PPBS, followed by two times washing in 0.02% saponin in PBS. Sections were then incubated in a quenching solution consisting of 1.5 mg/ml glycine, 1% bovine serum albumin, and 0.02% saponin/PBS at room temperature for 30 minutes. Finally, the sections were incubated in Filipin working solution for three hours in the dark under agitation, washed twice in 0.02% saponin in PBS, and mounted with DAKO fluorescent mounting media (#S3023). Visceral tissue samples used for histopathological analysis were prepared as previously described [ 34 ] and paraffin-embedded and cut into three µm sections on a microtome, then stained with Mayer’s Hematoxylin (MHS 16, Sigma-Aldrich) and Eosin Y (HT110116, Sigma-Aldrich) solution (H&E). Images of DAB and H&E stainings were acquired using an Axioplan 2 microscope equipped with an Axiocam MRc camera (Carl Zeiss). NeuN/NPC2 combined with Filipin stainings were imaged using an Olympus IX83 inverted microscope with a Yokogawa confocal CSU-W1 spinning disk unit equipped with a Hamamatsu ORCAFlash 4.0 v3 grayscale camera using an Olympus UPlanSApo 60x/1.35na oil Objective. NPC2/Tomato Lectin stainings were analyzed using an LSM900 confocal microscope using a Plan-Apochromat 20x/0.8 or 40x/1.4 Oil objective. All images were generated using the same acquisition settings, analyzed with ImageJ software [ 44 ], and adjusted for brightness and contrast. Quantitative analysis of GFAP and IBA1 positive cells Using the Axioplan 2 microscope DAB-stained brain slices from WT, untreated, and AAV-BR1-NPC2-treated Npc2-/- mice were examined, with a focus on the cerebral cortex and hippocampus. The slides were blinded to the examinator TM by co-author ABL. Cells were counted using a standardized protocol for estimating cell density [ 45 ], which involved counting the number of immunoreactive cells with labeled somata using a 10 mm x 10 mm frame overlying the cerebral cortex or hippocampus x 250 times magnification, equivalent to an area of 10,000 µm 2 (Fig S1 ). Cholesterol analysis Lipids from the liver, spleen, and lung tissue were extracted using the lipid extraction kit (ab211044, Abcam) according to the manufacturer’s instructions. Briefly, 20–30 mg tissue was homogenized in extraction buffer using a Qiagen TissueLyser II (30 Hz for 5 min) followed by centrifugation at 10,000 ×g for 5 minutes. The supernatant was collected and dried in a vacuum concentrator overnight. The lipid pellet was then dissolved in 200 µl assay buffer. Total cholesterol consisting of free cholesterol and cholesterol esters was then quantified using a colorimetric assay kit (Cholesterol/Cholesteryl Ester Assay Kit, ab65359, Abcam) according to the manufacturer’s protocol. Total cholesterol from serum was quantified using the colorimetric assay without further sample preparation. Absorbance was measured at OD 570 nm. The cholesterol levels were quantified based on a standard curve and normalized to the wet weight of the specific tissue analyzed. Quantification of viral genomes in tissue Approximately 10–20 mg tissue from the cerebrum, lung, liver, and spleen was homogenized in RNeasy Lysis Buffer with β-mercaptoethanol, and the DNA and RNA (gene expression analysis, see next section) were purified using the AllPrep DNA/RNA Mini Kit (Qiagen, #80204) according to the manufacturer’s protocol. The purity and quantity of the DNA and RNA were assessed by a spectrophotometer DS-11 (DeNovix). To analyze the organ distribution of the AAV-BR1-NPC2 vector, absolute qPCR was used to quantify the number of vg. See the section “Production of recombinant viral vectors” for the qPCR protocol. 100 ng DNA was used for each sample, which was run in triplicates. The quantification of vg was generated using a standard curve based on plasmid DNA encoding the CAG promoter as previously described [ 21 ]. Data are reported as vg/100ng total DNA. Npc2 gene expression analysis RNA, extracted from the cerebrum, liver, lung, and spleen as described above, was treated with DNase I enzyme (Thermo Fischer Scientific, #EN0521) to remove genomic DNA contamination. 100 ng DNA-free RNA was used as the template for the cDNA synthesis, which was performed as previously described [ 21 ]. The Npc2 gene expression was analyzed using a probe-based multiplex RT-qPCR with Taqman Fast Advanced Master Mix (Thermo Fischer Scientific, #4444556), FAM conjugated mouse Npc2 primer-probe mix (Thermo Fischer Scientific, #4331182, assay ID: Mm00499230_m1), and VIC-conjugated mouse hypoxanthine phosphoribosyltransferase ( Hprt1) primer-probe mix (Thermo Fischer Scientific, #4448490, assay ID: Hs02800695_m1). Hprt1 was used as the reference gene. 5 ng cDNA was used in the PCR reaction, for qPCR specifications see [ 21 ]. Finally, the relative gene expression ratios of Npc2 were calculated using the delta-delta threshold cycle (Ct) method with the WT control mice as the reference sample. MALDI mass spectrometry imaging The halved mouse brains selected for MALDI MSI were initially wrapped in aluminum foil and snap-frozen in 70% ethanol on a dry ice bath. The high lipid content of Npc2 -/- mouse brains made them extremely soft, preventing them from adhering to the Optimal Cutting Temperature compound (OCT, VWR chemicals), thereby making them prone to damage during sectioning. This resulted in the loss of some brains and consequently a reduction in the samples analyzed (from n = 6–7/group to n = 4–5/group). To address these challenges, the brains were embedded to facilitate effective sectioning. The frozen brains were submerged in a precooled 4% w/v carboxymethyl cellulose gel (CMC, Mw ~ 700,000, Sigma-Aldrich) to provide the necessary structural support for sectioning. The embedded brains were then re-frozen in 70% ethanol on a dry ice bath and stored at -80°C until further use. The CMC-embedded half brains were sectioned at 10 µm thickness using a cryostat (Leica CM1860, Leica Biosystems) at a chamber temperature of -27°C. Individual sections were thaw-mounted onto IntelliSlides (Bruker Daltonics, Bremen, Germany). The glass slides were stored at -80°C until further use. The matrix, 2.5-dihydroxy acetophenone (DHAP) (70% ethanol, 0.1% TFA), was sprayed using a HTX sprayer. The spraying parameters are detailed in Supplementary Table SII. Data were acquired on a timsTOF flex MALDI-2 mass spectrometer (Bruker Daltonics, Bremen, Germany), operated in negative mode, in tims-ON mode. The mass range was set between 500–2300 m/z with a spatial resolution of 20 µm and 180 laser shots per pixel. The tims mobility scan range was set to 0.13–2.68 1/k0 with a ramp time of 300 ms. For all experiments, the laser was operated in MALDI mode with a repetition rate of 10 kHz. All data were directly uploaded and processed in SCiLS Lab (version 2024b Pro). All data shown (ion images and spectra) were normalized to the root mean square (RMS). Feature annotation was done through Metaboscape (Bruker Daltonics, Bremen, Germany) using exact mass (< 10 ppm mass error) and collisional cross-section (CCS) values for identification. Statistical analysis The sample size was calculated by power analysis using the G*Power software (version 3.1.9.2). The sample size was calculated using an effect size of 1.5, which was based on previous studies evaluating the effect of gene therapy on motor coordination in NP-C mice [ 24 , 46 ]. The power and significance level of the experiment was set to 80% and 0.05, respectively. Nine mice per group were considered necessary. A loss of 10% of the mice was expected based on the humane endpoints, and therefore 10 mice were included in each group. All data sets were analyzed by the D’Agostino-Pearson test to verify if the data followed a Gaussian distribution and tested for equal variances by the Brown-Forsythe test. If the data sets passed these tests, a one-way ANOVA with Tukey’s post hoc analysis was applied. Otherwise, the data sets were log-transformed. If the data sets still did not pass the parametric criteria, the Kruskal-Wallis test with Dunn’s multiple comparisons was applied. The details of the specific statistical analysis used are reported in figure legends. All statistical analyses were two-sided. A p-value of ≤ 0.05 was considered statistically significant. Data are reported as mean ± standard deviation (SD) if not stated otherwise. All statistical analyses were done using GraphPad Prism version 9.4.1. Results The AAV-BR1-NPC2 vector effectively transduces mBECs in vitro The function of the AAV-BR1-NPC2 viral vector was assessed in a murine in vitro BBB non-contact co-culture model. The expression of NPC2 was examined four days after AAV-BR1-NPC2 transduction of mBECs using immunocytochemistry (Fig. S2 A). A high expression of NPC2 was evident in transduced mBECs. In contrast, it was not possible to detect NPC2 in non-transduced mBECs. Furthermore, the integrity of the in vitro BBB model was evaluated before the transduction, 24 hours later, and at the end of the study (four days after transduction). There was no significant difference in the TEER values when comparing the mBECs transduced with the AAV-BR1-NPC2 vector to non-transduced mBECs (Fig. S2 B), showing that neither viral transduction itself nor expression of NPC2 did affect the barrier integrity of primary BECs. Growth retardation is evident in Npc2 -/- mice. A single intravenous dose of 1.6 x 10 11 vg of the AAV-BR1-NPC2 vector was administered to six-week-old Npc2 -/- mice. At the time of treatment, there was no visible difference between WT ( Npc2 +/+) and Npc2 -/- mice. The body weight was comparable, and none of the NPC2-deficient mice had developed any clinical symptoms (Fig. 2 ). Furthermore, until the time point of treatment, all Npc2 -/- mice showed normal growth by increasing their body weight by more than 30% from 4–6 weeks of age, similar to their WT littermates (Fig. 2 A and B), which is in line with previous reports [ 33 , 34 ]. From six to 12 weeks of age, both untreated and AAV-BR1-NPC2-treated Npc2 -/- mice revealed growth retardation with only an 8% increase in body weight compared to 22% in WT mice ( Npc2 -/- mean = 8.2 ± 7.5%, AAV-BR1-NPC2-treated Npc2 -/- mean = 8.5 ± 7.8%, Npc2 +/+ mean = 22.8 ± 4.2%) (Fig. 2 A and B). At the end of the study, at 12 weeks of age, untreated Npc2 -/- and AAV-BR1-treated Npc2 -/- mice weighed 15% and 12% less than WT mice (Fig. 2 A and B). AAV-BR1-NPC2-treatment did not improve growth retardation associated with the NPC2 deficiency. A single untreated female Npc2 -/- mouse was euthanized at 10½ weeks of age due to a 20% weight loss, defined as humane endpoints, meaning that the data set from 11 weeks of age only includes n = 8 Npc2 -/- mice in the untreated group. AAV-BR1-NPC2 gene therapy improves motor impairment To evaluate the effect of the AAV-BR1-NPC2 treatment on the NP-C2 phenotype, locomotor impairment, and disease progression, a composite phenotype score, rotarod performance, and gait analysis were performed (Figs. 2 C-G). The composite phenotype score was evaluated when the mice were 6, 9, and 12 weeks of age. The following seven parameters were included in the phenotype scoring scheme: ledge test, hind limb clasping, kyphosis, tremor, gait, grooming, and explorative behavior (Supplemental Table 1). As mentioned earlier, it was impossible to distinguish between Npc2 -/- and Npc2+/+ mice when comparing the gait pattern and phenotype at six weeks of age when the treatment was initiated. At six weeks of age, all mice received a composite phenotype score of 0 or 1 (Fig. 2 C), and the gait analysis for all three groups revealed a normal walking pattern with the hind paws placed close to the front paws, and all mice were walking in a straight line (Fig. 2 E). At eight weeks of age, the first neurological symptoms characterized by tremors appeared in untreated and AAV-BR1-NPC2-treated Npc2 -/- mice. Even though the symptoms were mild and not present in all NPC2-deficient mice, all Npc2 -/- mice had trouble walking on the cage’s ledge at eight weeks of age (data not shown, but similar to what has been reported previously [ 34 ]). The tremor became more visible at nine weeks of age for both untreated and treated Npc2 -/- mice, which were visualized during the gait (Fig. 2 E). The gait was characterized by the paws pointing away from the body during locomotion, also known as “duck-feet”. The symptoms became more pronounced from nine to 12 weeks of age. At 12 weeks of age, the AAV-BR1-NPC2-treated Npc2 -/-mice showed a less severe disease phenotype compared to the untreated Npc2 -/- mice, resulting in only the untreated mice being significantly different from the WT mice (Fig. 2 C). The untreated Npc2 -/- mice were severely challenged concerning coordination and balance. This became evident, especially during the ledge test (all receiving a score of 2) and gait analysis, where the mice dragged their hind limbs, and severe ataxia was present (Fig. 2 C-E, 12 weeks). Untreated 12 weeks old Npc2 -/- mice received a higher composite phenotype score compared to AAV-BR1-NPC2 treated Npc2 -/- mice ( Npc2 -/-: median 7.5 (IQR 7–8), AAV-BR1-NPC2-treated Npc2 -/-: median 4.5 (IQR 4-5.75), Npc2 +/+: median 0 (IQR 0-0.75)), where 50% of the treated mice only received a score of 1 in the ledge test, revealing a beneficial effect of the AAV-BR1-NPC2 treatment (Fig. 2 C-E). The therapeutic potential of gene therapy on the disease phenotype is also shown in videos 1–5 (supplemental information) and depicted using video stills of the aforementioned videos comparing the Npc2 -/- and the AAV-BR1-NPC2-treated Npc2 -/- mice’s performance on the ledge test to their WT littermates (all receiving the score of 0 in the ledge test) (Fig. 2 D). Even though severe neurological symptoms were evident at 12 weeks of age, none of the Npc2 -/- mice developed limb clasping during the study period, which usually is a pathological hallmark for NP-C mouse models [ 47 ]. As the disease approached the end stage, the motor symptoms became progressively more severe, especially in untreated Npc2 -/- mice, and euthanasia was performed at 12 weeks of age for humane reasons. NPC2 deficiency is associated with severe locomotor impairment. To assess the therapeutic effect of the AAV-BR1 gene therapy, rotarod performance was evaluated once a week from five weeks of age. The average time each group spent on the rotarod is indicated in Fig. 2 F. Until eight weeks of age, there was no significant difference in the time spent on the rotarod when comparing the Npc2 -/-, AAV-BR1-NPC2-treated Npc2 -/-, and Npc2 +/+ mice. However, at eight weeks of age, all Npc2 -/- mice started to develop mild tremors independent of treatment status, which correlated with their performance on the rotarod. Even though there were no significant differences between untreated and AAV-BR1-NPC2-treated Npc2 -/- mice when comparing their performance on the rotarod over time, only one out of eight Npc2 -/- mice was able to walk on the rotarod at 12 weeks of age (latency to fall: 1.5 ± 4.24 sec). However, six out of 10 AAV-BR1-NPC2-treated Npc2 -/- mice could perform on the rotarod at the end of the study (latency to fall: 11.8 ± 12.22 sec) indicating a positive effect of the AAV-BR1-NPC2 treatment (Fig. 2 G). Based on these observations the AAV-BR1-NPC2-treated Npc2 -/- mice were divided into a high (6/10 mice) and a low (4/10 mice) responder group. Distribution of the AAV-BR1 vector and recombinant NPC2 expression Our previous study in healthy BALB/cJRj mice found that the AAV-BR1-NPC2-eGFP vector was primarily distributed to the brain and lung tissue [ 21 ]. We, therefore, analyzed the presence of the AAV-BR1 vector in the AAV-BR1 NPC2-treated Npc2 -/- mice in different organs and found that the AAV-BR1 vector accumulated in the brain, lung, and splenic tissue after intravenous injection (Fig. 3 A). We subsequently measured the Npc2 gene expression in these organs and compared it to the levels found in untreated Npc2 -/- and WT littermates. No detectable increase in Npc2 gene expression was seen in the spleen when compared to untreated Npc2 -/- mice (data not shown), suggesting unspecific uptake of the AAV-BR1 vectors in the reticuloendothelial system as previously described [ 28 ]. The high accumulation of the AAV-BR1-NPC2 vector in the brain resulted in an increase in the Npc2 gene expression in the brain of AAV-BR1-NPC2-treated Npc2 -/- mice to a level no longer significantly different from the Npc2+/+ mice (Fig. 3 B). In contrast, only a slight increase in the Npc2 gene expression was seen in the lung tissue after AAV-BR1 treatment, despite high accumulation of the AAV-BR1 vector in the lung (Fig. 3 A and B). BBB-directed gene therapy is unable to alleviate visceral pathology. It has previously been shown that transduction of the BECs in vitro results in a bi-directional secretion of the therapeutic protein of interest, meaning that the protein potentially is available for the peripheral organs [ 16 , 20 , 21 ]. Additionally, as just described we observed accumulation of the AAV-BR1 vector in the lung tissue (Fig. 3 A), resulting in an increased Npc2 gene expression (Fig. 3 B). Thus, the visceral pathology of the organs severely affected by the NPC2 deficiency was investigated. First, the weight of the brain, liver, lung, and spleen was analyzed to assess whether gene therapy at the BBB can reverse the disease-related manifestations, e.g., brain atrophy and hepatosplenomegaly, often associated with the NP-C2 [ 2 , 48 , 49 ]. Despite a higher Npc2 gene expression, the AAV-BR1-NPC2 treatment could not hinder atrophy of the brain (Fig. 3 C). The brain size of untreated Npc2 -/- and AAV-BR1-NPC2-treated Npc2 -/- mice were significantly reduced by 12.3% ( p < 0.0001) and 9.0% ( p = 0.0003), respectively, compared to age-matched Npc2 +/+ littermates (Fig. 3 C). No significant difference in the size of the liver was seen when comparing the three groups, meaning that hepatomegaly was not present at 12 weeks of age (Fig. 3 C). However, the lung and spleen were severely enlarged in Npc2 -/- mice independent of treatment status compared to WT mice. No obvious relationship was observed concerning organ sizes between high and low-responder animals. Severe accumulation of cholesterol, a hallmark of NP-C, has previously been reported in the liver, spleen, and lung tissue of NPC2-deficient mice [ 33 , 34 , 50 ]. We, therefore, also evaluated whether gene therapy could reduce cholesterol storage in the dissected visceral organs and in serum using quantitative measurements. There was no significant difference in total cholesterol in the liver and lung when comparing the untreated Npc2 -/- mice with AAV-BR1-NPC2-treated Npc2 -/- mice, however, both groups had significantly higher cholesterol levels compared to their WT littermate (Fig. 3 D). The total cholesterol levels in the spleen were significantly lower in NPC2-deficient mice receiving AAV-BR1-NPC2 treatment compared to untreated Npc2 -/- mice ( p = 0.0089), though not reaching levels comparable to the WT littermates (Fig. 3 D). In addition, the increased weight of the lung and spleen of untreated and AAV-BR1-NPC2-treated Npc2 -/- mice correlated with an increase in cholesterol storage (Fig. 3 C-D). Despite no significant difference observed in the weight of the liver when comparing the three groups; WT, untreated Npc2 -/- and AAV-BR1-NPC2-treated Npc2 -/- mice, the liver cholesterol concentration was significantly increased in untreated and AAV-BR1-NPC2-treated Npc2 -/- mice ( p < 0.0001) (Fig. 3 D). This corresponded well with the macroscopic findings of the liver tissue, e.g., being more friable upon dissection (data not shown). In general, however, there seem to be lower cholesterol levels in the liver and spleen in the high responder group (3/4 high responder mice) compared to the low responder group (3 mice) (Fig. 3 D), suggesting some visceral effects of the secreted NPC2. No differences were observed in serum cholesterol concentrations between the three groups (Fig. 3 E). The total cholesterol concentrations measured corresponded well with the pathology seen in the same peripheral organs evaluated with hematoxylin and eosin staining (Fig. 3 F). During the blind evaluation of tissue cholesterol storage, it was not possible to distinguish between untreated and AAV-BR1-NPC2-treated Npc2 -/- mice (both high and low responders), and all organs were severely affected compared to WT littermates. In both groups of NPC2-deficient mice, an accumulation of foam cells in the liver, spleen, and lung was observed. The liver pathology in Npc2 -/- mice varied, with changes ranging from a few clusters of foamy macrophages scattered in the liver tissue to severe accumulation of foam cells, independent of the treatment group (Fig. 3 F, top panel). The lung tissue in Npc2 -/- mice was characterized by intra-alveolar accumulation of foam cells and eosinophilic material corresponding to alveolar proteinosis (Fig. 3 F mid panel). The spleen tissue was also severely affected, with massive infiltration of foam cells disturbing the typical histoanatomical architecture (Fig. 3 F, bottom panel). Recombinant NPC2 distribution in the brain The distribution of NPC2 in the brain after transduction with the AAV-BR1-NPC2 vector was then evaluated with immunohistochemistry. As expected, it was not possible to detect NPC2 in the brain of untreated Npc2 -/- mice (Fig. 4 A-B). Oppositely, intravenous injection with the AAV-BR1-NPC2 vector resulted in a substantial number of NPC2-positive cells, especially in the cerebral cortex, the hippocampus, as well as in the deep cerebellar nuclei. In addition, NPC2-immunoreactive neurons were also observed in the striatum, thalamus, hypothalamus, red nucleus in the midbrain, pons, and medulla (data not shown). Mainly neuronal cells were intensively stained, but weak staining of several brain capillaries was also apparent in all brain regions (Fig. 4 A, bottom panel). In the cerebellum of AAV-BR1-NPC2-treated Npc2 -/- mice, NPC2 immunoreactivity was generally seen in the few remaining Purkinje cells, whereas higher NPC2 immunoreactivity was observed in neurons of the deep cerebellar nuclei (Fig. 4 B). The neuronal labeling was characterized by a perinuclear appearance with labeling extending into the axons and proximal dendrites. In comparison, Purkinje cells and neurons in the deep cerebellar nuclei were only weakly labeled in the Npc2 +/+ mice. More intense granular staining was seen in cells in close vicinity to the Purkinje cells, probably corresponding to Bergmann glial cells [ 51 ] (Fig. 4 B). NPC2-immunoreactive cells with morphology corresponding to astrocytes, microglia, or oligodendrocytes were not observed. When looking further into the seemingly low number of NPC2 positive capillaries, using fluorescent immunostaining with tyramid enhancement of NPC2 and counterstaining these with tomato lectin to label the vasculature, areas with many NPC2 positive capillaries are scattered throughout the brain, but especially obvious in the cerebral cortex and striatum (Fig. 4 C). However, several areas of NPC2-positive neuronal cells and NPC2-negative capillaries are also evident, especially in cortex cerebri, hippocampus, and cerebellum. Tomato lectin also labels microglia, which is especially evident in the cerebellar cortex (Fig. 4 C). Purkinje cell degeneration is delayed after AAV-BR1-NPC2 treatment. The motor impairment seen in NP-C correlates to Purkinje cell degeneration [ 52 ]. The immunoreactivity of the Purkinje cell marker, Calbindin D-28k, was evaluated at the end-stage of the disease to assess the effect of gene therapy on Purkinje cell survival. In 12-week-old untreated Npc2 -/- mice, an extensive loss of Purkinje cells in the cerebellum was observed compared to age-matched WT mice (Fig. 5 A-B). Axonal swellings were seen in the remaining Purkinje cells of both untreated and treated Npc2 -/- mice (Fig. 5 B, arrowheads). Purkinje cells in lobules IX and X were preserved. When analyzing cerebellar sections from AAV-BR1-NPC2-treated Npc2 -/- mice belonging to the high responder group (4 out of 8 mice assessed), more Purkinje cells could be detected, especially in the flocculus and paraflocculus (Fig. 5 A, bottom panel), indicating delayed Purkinje cell degeneration in the high responder group. The low responders were indistinguishable from the untreated Npc2 -/- mice. Neuroinflammation in the cerebral cortex and hippocampus is reduced after AAV-BR1-NPC2 treatment. Neuroinflammation in the cerebral cortex and hippocampus, assessed by immunolabeling of astrocytes and microglial cells, was diminished in the majority of the AAV-BR1-NPC2-treated Npc2 -/- mice (high responders) (4 out of 7 mice assessed) when compared to untreated Npc2 -/- mice (Fig. 6 A). It was especially evident in neocortical regions situated just above the corpus callosum. This distribution pattern was apparent for both astrocytes and microglia as evaluated using the astrocytic and microglial markers GFAP and IBA1, respectively, and indicates that AAV-BR1-NPC2 gene therapy could induce a localized reduction in both astrogliosis and reactive microglia. In the hippocampus, the tendency was identical with seemingly fewer astrocytes and microglia in the hippocampal cortical areas CA1-CA4 and dentate gyrus in the high responder group. When determining the density of astrocytes and microglia in both the cerebral cortex (neocortical region) and the hippocampus (CA3 region) we found an increased number of both astrocytes and microglia in both regions compared to the WT littermates (Fig. 6 B and C). When the Npc2 -/- mice were treated with the AAV-BR1 vector, the neuroinflammation was reduced compared to untreated Npc2 -/- mice. The density of the astrocytes was generally lower in the high-responder mice compared to the low-responder mice in both the cortex and hippocampus (Fig. 6 B). However, the increased number of astrocytes and microglia did not reflect the neuroinflammatory status alone, as the neuroinflammatory cells also underwent morphological changes. The GFAP-positive astrocytes underwent hypertrophy of their peripheral processes, and microglia characteristically displayed an enlarged soma with short and thickened processes characteristically of activation (Fig. 6 A and S3) [ 53 ]. In the cerebellum, the Purkinje cell degeneration was accompanied by severe neuroinflammation in both groups of Npc2 -/- mice (Fig. S3 ). Diffuse astrogliosis and microgliosis were evident in both untreated and AAV-BR1-NPC2-treated Npc2 -/- groups, and it was not possible to distinguish untreated and treated Npc2 -/- mice concerning neuroinflammation in the cerebellum and deep cerebellar nuclei. No evidence of neuroinflammation was seen in WT mice (Fig. 6 A and S3). Neuronal cholesterol accumulation in the cerebral cortex and hippocampus is reduced after AAV-BR1-NPC2 treatment. Cholesterol accumulation in the cerebral cortex, hippocampus, and cerebellum was visualized using Filipin, a fluorescent antibiotic that specifically binds unesterified cholesterol [ 54 ]. Compared to untreated Npc2 -/- mice, the cholesterol accumulation was reduced in the cerebral cortex and the CA3 region of the hippocampus in 3/4 AAV-BR1-NPC2-treated Npc2 -/- mice (Fig. 7 ) leading to an appearance with great similarity to that found in the WT littermates. Cellular cholesterol accumulation in the untreated Npc2 -/- mice was primarily seen in the perinuclear cytoplasmic region, corresponding to the lysosomal compartment. However, in the WT littermates and AAV-BR1-NPC2-treated Npc2-/- mice, the cellular localization of cholesterol was primarily distributed to the cellular membrane, which was especially obvious in the hippocampus (Fig. 7 ). It was not possible to differentiate between the untreated and the AAV-BR1-NPC2-treated Npc2 -/- mice when assessing cholesterol accumulation in cortex cerebelli, as cholesterol material was seen in all layers of the cerebellum. However, in the deep cerebellar nucleus, the cellular localization of cholesterol again seemed to have redistributed to the cellular membrane in the AAV-BR1-NPC2-treated Npc2-/- mice, instead of the perinuclear region as seen in the untreated mice. None to low levels of cholesterol was observed in WT mice (Fig. 7 ). As reduced cholesterol accumulation seems to be highly correlated to areas with a high presence of NPC2-positive cells, we aimed for co-detection of cholesterol and NPC2 combining Filipin detection and immunohistochemistry with a focus on the cerebral cortex and CA3 region of the hippocampus in the high responder group (Fig. 8 ). In the cortex cerebri of untreated Npc2 -/- mice, NeuN-positive neurons had a high accumulation of cholesterol. In the AAV-BR1-NPC2-treated Npc2 -/- mice, NPC2 immunoreactivity was verified in neurons judged from the simultaneous appearance of NeuN-labeling. Superimposing the immunolabeled images with Filipin staining, it was evident that neurons were cholesterol-containing, but to a much lower extent than seen in untreated Npc2 -/- mice (Fig. 8 ). Correspondingly, the high number of NPC2-positive neurons found in the CA3 region of the hippocampus in the high responder AAV-BR1-NPC2-treated Npc2 -/- mice almost completely reversed the cholesterol accumulation after treatment (Fig. 8 ). Of note, the number of NPC2-labeled neurons after treatment was obviously lower than that of cholesterol-negative cells in both the cerebral cortex and hippocampus. This suggests that secreted NPC2 from AAV-BR1-NPC2 transduced neurons and BECs alleviated cholesterol accumulation in non-transduced neighboring cells, equivalent to neuronal cross-correction [ 23 , 26 ]. The latter is concurrent with the previous observation that NPC2 is taken up and rescues NPC2 deficient cells in the liver, spleen, and other peripheral organs after intravenous administration [ 33 ]. Ingested NPC2 might mobilize excess cholesterol from lysosomes, e.g. by facilitating lysosomal exocytosis, release of extracellular vesicles, and efflux to apoproteins, as has been shown in cell cultures [ 55 , 56 ]. Therapeutic impact of AAV-BR1-NPC2 treatment on ganglioside composition in the brain In addition to cholesterol accumulation, intracellular accumulation of the gangliosides GM2 and GM3 in NP-C has previously been shown to contribute to the neuropathological cascade that ultimately leads to cell death [ 50 , 57 , 58 ]. These earlier studies focused on NPC1-deficient mice, whereas alterations in glycosphingolipids in the NPC2-mutant background are poorly characterized. MSI was therefore used to evaluate the GM2 and GM3 ganglioside profiles in all three experimental groups. Using an unsupervised bi-sectioning k-means segmentation model, distinct regions in the mouse brain were identified based on unique lipid profiles. The tissue sections exhibited clear segmentation patterns, with regions of interest (ROIs) distinctly marked by orange and green segments (Fig. 9 A). These segments revealed notable differences in lipid compositions between Npc2 +/+ and Npc2 -/- mice, with altered profiles particularly prominent in regions commonly affected by NP-C2 pathology, such as the cerebellum and hippocampus [ 51 ]. In AAV-BR1-NPC2-treated Npc2 -/- mice, high responders (first four brains from the left) showed partial normalization of ganglioside distribution and lipid profiles, with a MALDI mass spectra more closely resembling those of Npc2 +/+ WT (Fig. 9 A). In contrast, the low-responder mouse (first from the right) and a single high-responder mouse (second from the right) displayed segmentation patterns more closely aligned with untreated Npc2-/- mice, indicating a reduced therapeutic effect, with minimal changes in lipid composition observed in these mice (Fig. 9 A). Segmentation analysis further revealed similarities between the brains of high responders (3/4 mice) and Npc2 +/+ mice in the orange and green segmentations (Fig. 9 A), suggesting a reversal of some lipid alterations and potentially mitigating an inflammatory and neurodegenerative process [ 59 , 60 ]. Mass spectra extracted from these segmented regions highlighted significant lipid differences between genotypes and treatment groups. Npc2 -/- mice exhibited distinct lipid signatures, with elevated levels of GM2 and GM3 gangliosides. Specifically, GM2 species at m/z 1381.81 (d18:1/18:0) and 1410.84 (d20:1/18:0), along with GM3 species at m/z 1207.76 (d20:1/18:0), were markedly increased in ROIs (Fig. 9 B), a phenotype previously associated with neuroinflammation and neurodegeneration in other lysosomal storage disorders [ 61 , 62 ]. These alterations can be visualized in the MALDI images, where ganglioside accumulation is mapped across the cortex, hippocampus, and cerebellum (Fig. 9 C). WT Npc2+/+ mice show low to no accumulation of gangliosides in the cortex, hippocampus, and cerebellum, compared to untreated Npc2-/- mice, where high accumulation is present in all three brain regions, corresponding well to previous observations in Npc1-/- mice [ 63 ]. The low-responder mice likewise show an accumulation of gangliosides in all three brain areas, while high-responders (3/4 mice) show less accumulation, especially in the cortex and hippocampus (Fig. 9 C). Quantification of ganglioside intensities further confirmed these differences. Significant increases in GM2 and GM3 levels were observed in all untreated Npc2-/- mice compared to WT Npc2+/+ mice. AAV-BR1-NPC2 treatment highly reduced ganglioside accumulation in three out of four high responders in all three areas of the brain (9D), while one of the high responders was comparable to the low-responder mice and non-treated Npc2-/- mice, highlighting the variability in treatment efficacy (Fig. 9 D). Discussion We show that BBB-directed gene therapy using the AAV-BR1 vector was able to delay disease progression in the NPC2-deficient mouse model. The slower progression of neurological symptoms was shown by improved locomotor function and lower composite phenotype score in AAV-BR1-NPC2-treated Npc2 -/- mice compared to untreated Npc2 -/- mice. This was evident in the high responder group corresponding to 60% of the AAV-BR1-NPC2-treated mice. The behavioral findings corresponded well to a widespread expression of NPC2 in the brain, a delay in Purkinje cell degeneration, and a reduction in neuroinflammation and partial reversal of some lipid alterations (cholesterol and gangliosides) in the neocortex. The AAV-BR1-NPC2 vector both transduces BECs and passes the BBB The distribution pattern of NPC2 in the neurons was similar to our previous study investigating the AAV-BR1-NPC2 in healthy BALB/cJRj mice [ 21 ]. Here the AAV-BR1 vector was designed to produce two separate proteins; enhanced green fluorescent protein (eGFP) and NPC2, where the eGFP accumulated intracellularly as an indicator of cellular transduction. However, also neuronal cells expressed eGFP, indicating that some of the systemically injected AAV-BR1 vector undergoes transport across the BBB leading to neuronal transduction [ 21 ]. In our previous study in healthy mice, we further examined the possibility of AAV-BR1 vector transport across other brain barriers, e.g., the blood-cerebrospinal fluid barrier (BCSFB), but found no evidence to support this [ 21 ]. Furthermore, it seems unlikely that the widespread distribution of NPC2 throughout the brain, including the cerebral cortex, could be achieved through BCSFB transport. Comparable with the previous study in healthy mice, we here show a presence of NPC2 in neuronal cells of the cerebral cortex and hippocampus, and in several neurons in the brainstem, including pons and medulla oblongata. The latter deviates from our previous study that observed only weak eGFP staining or complete absence in neurons in the brainstem [ 21 ], which indicates that the widespread neuronal NPC2 distribution could be caused by the uptake of NPC2 from adjacent genetically modified cells or specific transduction of these neurons by the AAV-BR1 vector. Despite the high occurrence of NPC2-positive neurons, areas with many NPC2-positive BECs were also observed, suggesting that the AAV-BR1 vector is indeed specific toward the BBB. Interestingly though, in areas with many NPC2-positive neurons, we rarely observed a high occurrence of NPC2-positive capillaries, suggesting that the vector had transversed the BBB to transduce neurons in these areas. The mechanism of this BBB passage remains unknown. We are, in this study not able to distinguish between genetically modified cells, that produce NPC2, and enzyme-deficient cells that have taken up NPC2, but it seems unlikely that the uptake of NPC2 would be so heterogeneous and high in some neurons that it would mask transduced BECs expected to have a high production of NPC2. Furthermore, when examining the correlation between the distribution of NPC2 and cholesterol storage in both the cerebral cortex and hippocampus, a clear reduction in cholesterol accumulation was seen in NPC2-positive neurons but also neighboring NPC2-negative cells, emphasizing the possibility of cross-correction after BBB-directed gene therapy. The heterogeneous, albeit substantial, neuronal presence of NPC2, might also be a reflection of cation-independent M6PR mediated uptake of the mannose 6-phosphate tagged NPC2 [ 25 ], as the cation-independent M6PR also distributes to neurons quite heterogeneously in the brain with a predominantly high occurrence in deep layers of the cortex (e.g., pyramidal neurons in layer V), neurons of the hippocampus, striatum, selected nuclei in the thalamus, Purkinje cells of the cerebellum, the deep cerebellar nuclei, red nucleus, pontine nucleus, and motor neurons of the brainstem [ 64 ], corresponding well to the areas where NPC2-positive neurons are observed. AAV-BR1 gene therapy lowers brain deposition of lipids, and neuroinflammation and improves behavioral outcome In the present study, treatment of Npc2 -/- mice did not hinder the development of tremors but slowed the disease progression. Six out of ten of the AAV-BR1-NPC2-treated Npc2 -/- mice maintained the capability to perform on the accelerating rotarod at the end-stage of the disease compared to only one out of eight in the untreated Npc2 -/- group. This has also been observed in other studies using the AAV-BR1 vector to treat BBB-associated diseases, e.g., Incontinentia pigmenti and the lysosomal storage disorder Sandhoff disease [ 26 , 27 ]. Using the brain-specific AAV-BR1 vector, it was possible to avoid the development of epileptic seizures in one-third of the treated mice suffering from Incontinentia pigmenti [ 27 ]. Likewise, 4/8 of the AAV-BR1 treated HEXb-/- mice showed no impairment in motor function evaluated using rotarod at a constant speed (5 r/min for 5 minutes) [ 26 ]. The variability in the treatment efficacy amongst the Npc2 -/- mice corresponds to the variability in the transduction rate. Subsequently, the high responders, with an improved phenotype, also showed multiple NPC2-positive neurons and BECs, in contrast to the low responders, with only a few NPC2-positive cells in the brain. Widespread Purkinje cell degeneration is a hallmark of brain pathology in patients with NP-C [ 65 ] which is associated with the motor impairment observed [ 52 ]. Purkinje cell degeneration was also evident in the NPC2-deficient mouse model used in the present study [ 34 ] and correlated well with the inability to perform on the rotarod at the end-stage of the disease. The AAV-BR1-NPC2 treatment initiated at six weeks of age resulted in the preservation of Purkinje cells in half of the assessed Npc2 -/- mice (high responders) (4/8 mice), which was especially evident in the paraflocculus and flocculus. In contrast, an almost complete loss of Purkinje cells was seen in the paraflocculus and flocculus of untreated Npc2 -/- mice. Interestingly, these areas together with lobules IX and X are known to degenerate late in the disease [ 65 – 67 ], suggesting that the preservation of Purkinje cells in these particular areas after treatment with the AAV-BR1 vector is due to a delay in the disease progression. There was a clear correlation between the preservation of Purkinje cells, better performance on the rotarod, and a lower ledge test score. The ledge test is an important parameter when evaluating the therapeutic potential of the AAV-BR1-NPC2 vector as it provides the most direct comparison to human signs of cerebellar ataxia, another hallmark of the disease [ 10 , 40 , 47 , 48 ]. Therapies affecting the ataxia phenotype in mice positively correlate to a reduction in the disease progression in patients [ 47 ]. Thus, the lower ledge test score and improved gait pattern seen in the Npc2 -/- mice receiving gene therapy indicate a behaviorally therapeutic effect of the BBB-directed gene therapy. The Purkinje cell degeneration in the treated Npc2 -/- mice was accompanied by widespread cerebellar gliosis, cholesterol storage, and ganglioside accumulation. In contrast, reduced neuroinflammation was seen in the cerebral cortex and hippocampus of the AAV-BR1-NPC2-treated Npc2 -/- mice (high responders). In addition, this particular group also showed normalization of cholesterol and GM2 and GM3 ganglioside levels, aligning more closely with the WT mice. This reduction in lipid accumulation likely reflects a therapeutic effect of NPC2, which helps restore lysosomal function, facilitating cholesterol and ganglioside clearance. The subsequent decrease in neuroinflammation in regions like the cerebral cortex and hippocampus in the high responder group suggests that the restoration of lipid homeostasis may mitigate the neurodegenerative processes, potentially slowing disease progression and improving motor function. Npc2-/- mice from the low responders, however, did not exhibit significant changes in lipid levels or neuroinflammation, further emphasizing the critical role of NPC2 delivery efficiency in determining therapeutic success. In our previous study, where the distribution of the AAV-BR1 vector was assessed in healthy BALB/cJRj mice after intravenous injection, most of the viral vectors were distributed to the cerebrum [ 21 ], which may explain why only a slight correction was seen in the cerebellum compared to, e.g., the cerebral cortex. Distribution of NPC2 in the brain of AAV-BR1-NPC2-treated Npc2 -/- mice was evident in pyramidal neurons in the cerebral cortex and CA3 neurons in the hippocampus, accompanied by reduced neuroinflammation and lipid storage. These non-cerebellar areas, previously described as regions with severe neurodegeneration in both mouse models of NP-C and human NP-C [ 11 , 68 – 70 ], display intracellular storage of lipids, especially in large pyramidal neurons in the cortex and CA3 neurons of the hippocampus [ 70 , 71 ]. In a healthy brain, the NPC2 concentration is high in neurons of the cerebral neocortex, hippocampus, cerebellum, and deep cerebellar nuclei, indicating that these areas are particularly vulnerable to the disease [ 51 ]. Therefore, an increase in NPC2 in these regions could explain why the AAV-BR1-NPC2-treated Npc2 -/- mice have a less severe phenotype compared to the untreated Npc2 -/- mice, despite the treatment not completely reversing the Purkinje cell degeneration. It is also assumed that even though severe Purkinje cell loss is evident, compensatory mechanisms in the deep cerebellar nuclei can result in only mild ataxia [ 67 , 72 ]. A high NPC2 expression was seen in the cerebellar nuclei after treatment with the AAV-BR1-NPC2 vector, suggesting that the function of the neurons in the cerebellar nuclei is maintained. Due to impairment in the inhibitory signal from Purkinje cells, neuronal plasticity in the cerebellar nuclei could consequently enhance the intranuclear inhibition in the deep cerebellar nuclei resulting in improvement in motor performance [ 72 ]. This could explain why only mild ataxic gait was seen in AAV-BR1-NPC2-treated Npc2 -/- mice. Variations were also observed in the high responder group with respect to the quantitative measurement of visceral cholesterol levels, and ganglioside accumulation in the brain. One of the high responder mice showed total cholesterol levels in the liver, lung, and spleen comparable to the low responder group and untreated Npc2-/- mice (Fig. 3 D). The same mouse showed brain lipid profiles comparable to untreated Npc2-/- mice (Fig. 9 A) when analyzed by MSI. Despite no improvement in lipid accumulation, this mouse was able to perform on the rotarod at 12 weeks of age (Fig. 2 G), probably due to the same reasons why one of the untreated Npc2-/- mice was still able to walk on the rotarod at 12 weeks, underlining the variability observed in this study. Viral transduction with the AAV-BR1 vector fails to improve non-neurological symptoms. Previous in vitro studies showed that transduction or transfection of primary BECs resulted in a bi-directional secretion of proteins [ 16 , 20 , 21 ]. Viral gene therapy introduced to the brain by stereotactic injection of AAV2 and AAV4 viruses to the ependyma of the lateral ventricle enabled therapeutic efficacy of the brain with secretion to the cerebrospinal fluid of further relevance for excretion to the peripheral blood with beneficial effects on visceral organs [ 73 , 74 ]. In the present study, besides the spleen, no significant effect was seen in the prevention of cholesterol storage in the liver and lung, which challenges a strategy of BBB-directed gene therapy being able to treat symptoms from both the CNS and the periphery. In consequence, the AAV-BR1-NPC2 treatment was not able to reverse the growth retardation seen in the Npc2 -/- mice, which could be related to the severe pathology with cholesterol storage and inflammation observed in the visceral organs of both the AAV-BR1-NPC2-treated and untreated Npc2 -/- mice. When the plasma NPC2 concentration was investigated after AAV-BR1-transduction of BECs in healthy mice [ 21 ], it was not possible to detect an increase in blood NPC2 concentrations, substantiating the findings of the present study. However, in 3/4 high responder AAV-BR1-Npc2-/- treated mice, a prominent reduction in liver cholesterol was obvious, indicating some visceral effect perhaps due to higher NPC2 blood concentration. The same tendency was observed in the spleen, but not in the lungs of the same animals. The transduction efficacy of the AAV-BR1 vector was limited to the BECs, neurons, and the lungs underlining that any potential therapeutic effect observed in the liver could have originated from NPC2 secretion into the blood. Transduction of lung tissue was considered advantageous in treating NP-C2 due to the severe lung involvement in NP-C2 patients [ 10 , 75 ]. However, the presence of viral vectors in the lung tissue only resulted in an inadequate increase in the Npc2 gene expression, which did not reverse the severe lung pathology with pulmonary alveolar proteinosis and accumulation of foam cells. Intravenous injection with NPC2 purified from bovine milk was able to ameliorate the visceral pathology, including lung tissue, in Npc2 -/- mice [ 33 ]. Hence, a combination of NPC2 injections and a single injection with the AAV-BR1 vector intravenously might improve the therapeutic outcome by reversing both visceral and neuronal pathology in these mice. Study limitations One could question whether the onset of treatment was too late. At six weeks of age, no symptoms were visible in the Npc2 -/- mice, however, it has previously been shown that cerebellar pathology, including Purkinje cell degeneration and neuroinflammation, is evident weeks before symptom development in NPC1-deficient mouse models [ 65 , 67 , 76 – 78 ]. Despite a more severe disease progression in the NP-C1 mouse model, the pathological findings are comparable in NP-C2 [ 34 , 50 , 79 ]., which is also supported by our previous findings investigating disease progression in these Npc2 -/- mice. At six weeks of age, the Purkinje cells were affected or even lost in some of the mice, although there were large variations [ 34 ]. It is therefore expected that Purkinje cells might already be irreversibly damaged at the time of treatment, which challenges the treatment even further. Studies treating NP-C1 mouse models using gene therapy have seen improvement in survival, neurological symptoms, and brain pathology after the administration of different serotypes of AAVs [ 46 , 80 – 83 ], however, all studies treat pre-symptomatically [ 80 , 81 ], including the present study. The translational value is therefore questionable, due to the heterogeneity of the disease, where the age of onset and the clinical symptoms in humans vary. NP-C is often not diagnosed until after the onset of neurological symptoms [ 4 , 80 , 82 , 84 ], why initiating treatment earlier than six weeks of age will not increase the translational value of the results. The NP-C2 mouse model is of great value due to its similarity with the pathology seen in patients suffering from NP-C2 presenting with both Purkinje cell degeneration, neuroinflammation, splenomegaly, and pulmonary alveolar proteinosis, all hallmarks of NP-C2 [ 10 , 48 , 65 , 69 , 75 ]. However, the AAV-BR1 vector might not be the most optimal vector for treating NP-C2, since the vector more efficiently transduces cells of the cerebrum, instead of the cerebellum. The strategy of BBB-directed gene therapy has previously been questioned due to the potential side effects of the resulting high recombinant protein concentration in blood, which in cases with e.g., neurotropic factors, could result in pancreatic cancer [ 85 ]. However, no obvious reduction of peripheral clinical manifestations was evident, except for a lower cholesterol accumulation in the spleen and the liver in most of the high-responder animals, suggesting that the amount of recombinant protein secreted into the bloodstream might be insignificant. Directing the secretion of recombinant protein primarily to the abluminal side would however be of great value. Since the AAV-BR1 vector is highly brain-specific, able to cross the BBB, and transduce both BECs and neurons, especially in the cortex and hippocampus, it could have the potential to cure a range of other neurological diseases affecting the cerebral cortex and hippocampus, like Alzheimer's disease, even in conditions with an intact BBB. It should not be overlooked though that the brain-directed tropism of AAV-BR1 is specific to the mouse, necessitating further attempts to develop an equivalent viral vector for translational purposes in higher species, including humans [ 28 ]. Conclusion In conclusion, a single intravenous injection with the AAV-BR1-NPC2 vector resulted in widespread NPC2 distribution throughout the brain, consequently improving the locomotor impairment and disease phenotype in a mouse model of NP-C2. This was particularly evident in the high responder group corresponding to 60% of the AAV-BR1-NPC2-treated Npc2-/- mice. The AAV-BR1-NPC2 vector is likely to enter the brain bifold, i.e., by viral transduction of BECs with subsequent protein secretion to the brain interior and by BBB passage of the AAV-BR1 vector followed by neuronal transduction and protein delivery. Particular high transduction efficiency was seen in the cerebral cortex and especially the hippocampus, which was associated with reduced neuroinflammation but also reduced accumulation of lipids in both genetically modified cells and enzyme-deficient cells, suggesting cross-correcting gene therapy via delivery of NPC2 from BECs and neurons. Abbreviations AAV-BR1 : Brain-specific adeno-associated virus, BBB : Blood-brain barrier, BCSFB : blood-cerebrospinal fluid barrier, BECs : Brain endothelial cells, CNS : central nervous system, eGFP : enhanced green fluorescent protein, GFAP : Glial fibrillary acidic protein, IBA1 : Ionized calcium-binding adaptor molecule 1, MSI : Mass spectrometry imaging; M6PR : Mannose-6-phosphate receptor, NeuN : Neuronal nuclei antigen, NPC1 : Niemann-Pick C1 protein, NPC2 : Niemann-Pick C2 protein, NP-C : Niemann-Pick type C disease, NP-C1 : Niemann-Pick type C1 disease, NP-C2 : Niemann-Pick type C2 disease, TEER : Trans-endothelial electrical resistance, PBS : phosphate-buffered saline, PFA : Paraformaldehyde, PPBS : potassium-containing phosphate-buffered saline, Vg : Viral genomes, WT : Wild-type. Declarations Ethics approval and consent for publication The animal studies were performed according to the Danish Animal Experimentation Act (BEK no. 2028 of 14/12/2020) and the European directive (2010/63/EU) and carried out by licensed staff. The Danish Animal Experiments Inspectorate under the Ministry of Food, Agriculture and Fisheries has approved all animal experiments and breeding of NPC2-deficient mice (license no. 2018-15-0201-01467 and 2019-15-0202-00056). Consent for publication Not applicable Availability of data and materials All data generated and analyzed during this study are included in this published paper. All datasets are available from the corresponding author upon reasonable request. Competing interests: JK is listed as an inventor on a patent on AAV-BR1, held by Boehringer Ingelheim International. All other authors have no competing interests to declare. Funding This work was funded by Fonden til Lægevidenskabens Fremme, Direktør Emil C. Hertz og hustru Inger Hertz' Fond, Dagmar Marshalls Fond, Lundbeck Foundation ((Research Initiative on Blood-Brain Barriers and Drug Delivery Grant no. 2013-14113), and Grant no. R366-2021-226), Hørslev-Fonden, Læge Sophus Carl Emil Friis og Hustru Olga Doris Friis Legat, Scleroseforeningen (Grant no. A41926), the Danish Research Council (Grant no. 2024-00136B), and Svend Andersen Fonden as well as the German Research Foundation (DFG, SFB1328 - A13, Grant no. 335447717). The Biological Mass Spectrometry Research at SDU is supported by a generous grant from the Novo Nordisk Foundation (grant no. NNF20OC0061575 to O.N.J.) to establish mass spectrometry imaging technology as part of the INTEGRA research infrastructure. Author Contributions Conceptualization: CLMR, JK, TM, AB; Methodology: CLMR, CWH, EH, JK, AB; Investigation: CLMR, SFF, MST, EH, BL, LBT, TM, AB; Resources: CLMR, CWH, EH, JK, DW, MS, ONJ, TM, AB; Writing – Original Draft: CLMR, AB; Writing – Review & Editing: CLMR, SFF, CWH, MST, EH, BL, JK, DW, LBT, MS, ONJ, TM, AB; Visualization: CLMR, SFF, AB; Supervision: MST, CWH, DW, LBT, ONJ, TM, AB; Funding Acquisition: CLMR, JK, DW, OJN, TM, AB Acknowledgments The authors thank laboratory technicians Merete Fredsgaard, Hanne Krone Nielsen, Ditte Bech Laursen, and Louise Hvilshøj Madsen, Aalborg University, Denmark, and animal technicians Karina Lassen Holm and Dorte Hermansen, Aarhus University, Denmark, for excellent technical assistance during the study. Associate Professor Anders Olsen and Helene Halkjær Jensen, Department of Chemistry and Bioscience, Aalborg University are acknowledged for assistance with the use of the Olympus IX83 inverted microscope equipped with Yokogawa confocal CSU-W1 spinning disk. References Platt FM. Emptying the stores: lysosomal diseases and therapeutic strategies. Nat Rev Drug Discov [Internet]. 2018;17:133–50. https://pubmed.ncbi.nlm.nih.gov/29147032/ Verot L, Chikh K, Freydière E, Honoré R, Vanier MT, Millat G. Niemann–Pick C disease: functional characterization of three NPC2 mutations and clinical and molecular update on patients with NPC2. Clin Genet [Internet]. 2007;71:320–30. https://onlinelibrary.wiley.com/doi/full/ 10.1111/j.1399-0004.2007.00782.x Geberhiwot T, Moro A, Dardis A, Ramaswami U, Sirrs S, Marfa MP et al. Consensus clinical management guidelines for Niemann-Pick disease type C. Orphanet J Rare Dis [Internet]. 2018;13:50. https://pubmed.ncbi.nlm.nih.gov/29625568/ Vanier MT. Niemann-Pick disease type C. Orphanet J Rare Dis. 2010;5:16. Berzina Z, Solanko LM, Mehadi AS, Jensen MLV, Lund FW, Modzel M, et al. Niemann-Pick C2 protein regulates sterol transport between plasma membrane and late endosomes in human fibroblasts. Chem Phys Lipids. 2018;213:48–61. Li X, Saha P, Lib J, Blobel G, Pfeffer SR. Clues to the mechanism of cholesterol transfer from the structure of NPC1 middle lumenal domain bound to NPC2. Proc Natl Acad Sci U S A [Internet]. 2016;113:10079–84. https://www.pnas.org/doi/abs/ 10.1073/pnas.1611956113 Hammond N, Munkacsi AB, Sturley SL. The complexity of a monogenic neurodegenerative disease: More than two decades of therapeutic driven research into Niemann-Pick type C disease [Internet]. Biochim. Biophys. Acta - Mol. Cell Biol. Lipids. Elsevier B.V.; 2019 [cited 2024 Oct 3]. pp. 1109–23. https://pubmed.ncbi.nlm.nih.gov/31002946/ Vanier MT. Lipid changes in Niemann-Pick disease type C brain: Personal experience and review of the literature. Neurochem Res [Internet]. Kluwer Academic/Plenum Publishers; 1999 [cited 2024 Oct 3];24:481–9. https://pubmed.ncbi.nlm.nih.gov/10227680/ Walkley SU, Vanier MT. Secondary lipid accumulation in lysosomal disease. Biochim Biophys Acta - Mol Cell Res. 2009. pp. 726–36. Bjurulf B, Spetalen S, Erichsen A, Vanier MT, Strøm EH, Strømme P. Niemann-Pick disease type C2 presenting as fatal pulmonary alveolar lipoproteinosis: morphological findings in lung and nervous tissue. Med Sci Monit. 2008;14. Klünemann HH, Elleder M, Kaminski WE, Snow K, Peyser JM, O’Brien JF et al. Frontal lobe atrophy due to a mutation in the cholesterol binding protein HE1/NPC2. Ann Neurol [Internet]. 2002;52:743–9. https://onlinelibrary.wiley.com/doi/full/ 10.1002/ana.10366 Patterson MC, Mengel E, Wijburg FA, Muller A, Schwierin B, Drevon H, et al. Disease and patient characteristics in NP-C patients: findings from an international disease registry. Orphanet J Rare Dis. 2013;8:12. Vanier MT, Gissen P, Bauer P, Coll MJ, Burlina A, Hendriksz CJ, et al. Diagnostic tests for Niemann-Pick disease type C (NP-C): A critical review. Mol Genet Metab. 2016;118:244–54. Muramatsu K, Muramatsu S. ichi. Adeno-associated virus vector-based gene therapies for pediatric diseases [Internet]. Pediatr. Neonatol. Elsevier (Singapore) Pte Ltd; 2023 [cited 2024 Oct 4]. pp. S3–9. https://pubmed.ncbi.nlm.nih.gov/36266189/ Xu Y, Zhang Q, Tan L, Xie X, Zhao Y. The characteristics and biological significance of NPC2: Mutation and disease. Mutat Res Mutat Res. 2019;782:108284. Hede E, Christiansen CB, Heegaard CW, Moos T, Burkhart A. Gene therapy to the blood-brain barrier with resulting protein secretion as a strategy for treatment of Niemann Picks type C2 disease. J Neurochem [Internet]. 2021;156:290–308. https://pubmed.ncbi.nlm.nih.gov/32072649/ Lin Y, Wang X, Rose KP, Dai M, Han J, Xin M et al. miR-143 Regulates Lysosomal Enzyme Transport across the Blood-Brain Barrier and Transforms CNS Treatment for Mucopolysaccharidosis Type I. Mol Ther [Internet]. Elsevier Ltd.; 2020;28:2161–76. https://doi.org/10.1016/j.ymthe.2020.06.011 Urayama A, Grubb JH, Sly WS, Banks WA. Developmentally regulated mannose 6-phosphate receptor-mediated transport of a lysosomal enzyme across the blood-brain barrier. Proc Natl Acad Sci U S A. 2004;101:12658–63. Thomsen LB, Lichota J, Kim KS, Moos T. Gene delivery by pullulan derivatives in brain capillary endothelial cells for protein secretion. J Control Release. 2011;151:45–50. Burkhart A, Andresen TL, Aigner A, Thomsen LB, Moos T. Transfection of primary brain capillary endothelial cells for protein synthesis and secretion of recombinant erythropoietin: a strategy to enable protein delivery to the brain. Cell Mol Life Sci. 2017;74:2467–85. Rasmussen CLM, Hede E, Routhe LJ, Körbelin J, Helgudottir SS, Thomsen LB et al. A novel strategy for delivering Niemann-Pick type C2 proteins across the blood–brain barrier using the brain endothelial-specific AAV-BR1 virus. J Neurochem [Internet]. 2023;164:6–28. https://onlinelibrary.wiley.com/doi/full/ 10.1111/jnc.15621 Jiang C, Koyabu N, Yonemitsu Y, Shimazoe T, Watanabe S, Naito M, et al. In vivo delivery of glial cell-derived neurotrophic factor across the blood-brain barrier by gene transfer into brain capillary endothelial cells. Hum Gene Ther. 2003;14:1181–91. Sands MS, Davidson BL. Gene therapy for lysosomal storage diseases. Mol Ther. 2006;13:839–49. Markmann S, Christie-Reid J, Rosenberg J, De JB, Kaminsky BP, Crystal SM. Attenuation of the Niemann-Pick type C2 disease phenotype by intracisternal administration of an AAVrh.10 vector expressing Npc2. Exp Neurol. 2018;306:22–33. Willenborg M, Schmidt CK, Braun P, Landgrebe J, Von Figura K, Saftig P et al. Mannose 6-phosphate receptors, Niemann-Pick C2 protein, and lysosomal cholesterol accumulation. J Lipid Res [Internet]. 2005;46:2559–69. https://pubmed.ncbi.nlm.nih.gov/16177447/ Dogbevia G, Grasshoff H, Othman A, Penno A, Schwaninger M. Brain endothelial specific gene therapy improves experimental Sandhoff disease. J Cereb Blood Flow Metab [Internet]. 2020;40:1338–50. http://www.ncbi.nlm.nih.gov/pubmed/31357902 Dogbevia GK, Töllner K, Körbelin J, Bröer S, Ridder DA, Grasshoff H, et al. Gene therapy decreases seizures in a model of Incontinentia pigmenti. Ann Neurol. 2017;82:93–104. Körbelin J, Dogbevia G, Michelfelder S, Ridder DA, Hunger A, Wenzel J, et al. A brain microvasculature endothelial cell-specific viral vector with the potential to treat neurovascular and neurological diseases. EMBO Mol Med. 2016;8:609–25. Sundaram SM, Arrulo Pereira A, Müller-Fielitz H, Köpke H, De Angelis M, Müller TD et al. Gene therapy targeting the blood–brain barrier improves neurological symptoms in a model of genetic MCT8 deficiency. Brain [Internet]. 2022;145:4264–4274. https://academic.oup.com/brain/advance-article/doi/ 10.1093/brain/awac243/6656100 Thomsen MS, Birkelund S, Burkhart A, Stensballe A, Moos T. Synthesis and deposition of basement membrane proteins by primary brain capillary endothelial cells in a murine model of the blood-brain barrier. J Neurochem [Internet]. 2017 [cited 2018 Feb 19];140:741–54. http://www.ncbi.nlm.nih.gov/pubmed/27456748 Thomsen MS, Humle N, Hede E, Moos T, Burkhart A, Bohn Thomsen L. The blood-brain barrier studied in vitro across species. PLoS One [Internet]. 2021 [cited 2022 Sep 25];16:e0236770. https://doi.org/10.1371/journal.pone.0236770 Percie du Sert N, Hurst V, Ahluwalia A, Alam S, Avey MT, Baker M, et al. The ARRIVE guidelines 2.0: updated guidelines for reporting animal research. J Physiol. 2020;598:3793–801. Nielsen GK, Dagnaes-Hansen F, Holm IE, Meaney S, Symula D, Andersen NT, et al. Protein replacement therapy partially corrects the cholesterol-storage phenotype in a mouse model of Niemann-Pick type C2 disease. PLoS ONE. 2011;6:e27287. Rasmussen CLM, Thomsen LB, Heegaard CW, Moos T, Burkhart A. The Npc2Gt(LST105)BygNya mouse signifies pathological changes comparable to human Niemann-Pick type C2 disease. Mol Cell Neurosci [Internet]. Elsevier Inc.; 2023;126:103880. https://doi.org/10.1016/j.mcn.2023.103880 Berard M, Feinstein R, Gallagher A, Illgen-Wilcke B, Pritchett-Corning K, Raspa M. FELASA recommendations for the health monitoring of mouse, rat, hamster, guinea pig and rabbit colonies in breeding and experimental units. Lab Anim [Internet]. 2014 [cited 2022 Jun 29];48:178–92. http://lan.rsmjournals Urbaniak GC, Plous S. Research Randomizer [Internet]. 2013. https://www.randomizer.org/ Gouveia K, Hurst JL. Improving the practicality of using non-aversive handling methods to reduce background stress and anxiety in laboratory mice. Sci Rep [Internet]. 2019 [cited 2022 May 9];9. https://doi.org/10.1038/s41598-019-56860-7 Alam MS, Getz M, Haldar K. Chronic administration of an HDAC inhibitor treats both neurological and systemic Niemann-Pick type C disease in a mouse model. Sci Transl Med [Internet]. 2016;8:326ra23. https://pubmed.ncbi.nlm.nih.gov/26888431/ Carroll RW, Wainwright MS, Kim KY, Kidambi T, Gómez ND, Taylor T et al. A Rapid Murine Coma and Behavior Scale for Quantitative Assessment of Murine Cerebral Malaria. PLoS One [Internet]. 2010 [cited 2022 Jan 13];5:e13124. https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0013124 Guyenet SJ, Furrer SA, Damian VM, Baughan TD, La Spada AR, Garden GA. A simple composite phenotype scoring system for evaluating mouse models of cerebellar ataxia. J Vis Exp. 2010;1787. Kojic M, Gaik M, Kiska B, Salerno-Kochan A, Hunt S, Tedoldi A et al. Elongator mutation in mice induces neurodegeneration and ataxia-like behavior. Nat Commun [Internet]. 2018;9:1–13. https://www.nature.com/articles/s41467-018-05765-6 Hung YH, Walterfang M, Churilov L, Bray L, Jacobson LH, Barnham KJ, et al. Neurological Dysfunction in Early Maturity of a Model for Niemann–Pick C1 Carrier Status. Neurother [Internet]. 2016;13:614–22. Available from: /pmc/articles/PMC4965399/. Brawek B, Olmedillas del Moral M, Garaschuk O. In Vivo Visualization of Microglia Using Tomato Lectin. Methods Mol Biol [Internet]. Humana Press Inc.; 2019 [cited 2024 Oct 3]. pp. 165–75. https://pubmed.ncbi.nlm.nih.gov/31392684/ Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T et al. Fiji: an open-source platform for biological-image analysis. Nat Methods [Internet]. 2012;9:676–82. https://www.nature.com/articles/nmeth.2019 Mirza B, Hadberg H, Thomsen P, Moos T. The absence of reactive astrocytosis is indicative of a unique inflammatory process in Parkinson’s disease. Neuroscience. 1999;95:425–32. Xie C, Gong X-M, Luo J, Li B-L, Song B-L. AAV9-NPC1 significantly ameliorates Purkinje cell death and behavioral abnormalities in mouse NPC disease. J Lipid Res [Internet]. 2017;58:512–8. http://www.ncbi.nlm.nih.gov/pubmed/28053186 Yerger J, Cougnoux AC, Abbott CB, Luke R, Clark TS, Cawley NX, et al. Phenotype assessment for neurodegenerative murine models with ataxia and application to Niemann-Pick disease, type C1. Biol Open. 2022;11:bio059052. Jahnova H, Dvorakova L, Vlaskova H, Hulkova H, Poupetova H, Hrebicek M, et al. Observational, retrospective study of a large cohort of patients with Niemann-Pick disease type C in the Czech Republic: a surprisingly stable diagnostic rate spanning almost 40 years. Orphanet J Rare Dis. 2014;9:140. Sheth J, Joseph JJ, Shah K, Muranjan M, Mistri M, Sheth F. Pulmonary manifestations in Niemann-Pick type C disease with mutations in NPC2 gene: case report and review of literature. BMC Med Genet [Internet]. 2017;18, 5. /pmc/articles/PMC5240394/ Sleat DE, Wiseman JA, El-Banna M, Price SM, Verot L, Shen MM et al. Genetic evidence for nonredundant functional cooperativity between NPC1 and NPC2 in lipid transport. Proc Natl Acad Sci U S A [Internet]. Proc Natl Acad Sci U S A; 2004 [cited 2024 Oct 3];101:5886–91. https://pubmed.ncbi.nlm.nih.gov/15071184/ Ong WY, Sundaram RK, Huang E, Ghoshal S, Kumar U, Pentchev PG, et al. Neuronal localization and association of Niemann Pick C2 protein (HE1/NPC2) with the postsynaptic density. Neuroscience. 2004;128:561–70. White JJ, Bosman LWJ, Blot FGC, Osório C, Kuppens BW, Krijnen WHJJ et al. Region-specific preservation of Purkinje cell morphology and motor behavior in the ATXN1[82Q] mouse model of spinocerebellar ataxia 1. Brain Pathol [Internet]. 2021;31:e12946. https://onlinelibrary.wiley.com/doi/full/ 10.1111/bpa.12946 Kavetsky L, Green KK, Boyle BR, Yousufzai FAK, Padron ZM, Melli SE et al. Increased interactions and engulfment of dendrites by microglia precede Purkinje cell degeneration in a mouse model of Niemann Pick Type-C. Sci Rep [Internet]. 2019 [cited 2022 Jan 4];9:14722. https://doi.org/10.1038/s41598-019-51246-1 Maxfield FR, Wüstner D. Analysis of Cholesterol Trafficking with Fluorescent Probes. Methods Cell Biol. 2012;108:367–93. Ilnytska O, Jeziorek M, Lai K, Altan-Bonnet N, Dobrowolski R, Storch J. Lysobisphosphatidic acid (LBPA) enrichment promotes cholesterol egress via exosomes in Niemann Pick type C1 deficient cells. Biochim Biophys Acta - Mol Cell Biol Lipids [Internet]. Elsevier B.V.; 2021 [cited 2024 Oct 3];1866. https://pubmed.ncbi.nlm.nih.gov/33716137/ Juhl AD, Lund FW, Jensen MLV, Szomek M, Heegaard CW, Guttmann P et al. Niemann Pick C2 protein enables cholesterol transfer from endo-lysosomes to the plasma membrane for efflux by shedding of extracellular vesicles. Chem Phys Lipids [Internet]. Elsevier Ireland Ltd; 2021 [cited 2024 Oct 3];235. https://pubmed.ncbi.nlm.nih.gov/33422548/ Tobias F, Pathmasiri KC, Cologna SM. Mass spectrometry imaging reveals ganglioside and ceramide localization patterns during cerebellar degeneration in the Npc1 –/– mouse model. Anal Bioanal Chem [Internet]. Springer Verlag; 2019 [cited 2024 Oct 3];411:5659–68. https://pubmed.ncbi.nlm.nih.gov/31254056/ Zhou S, Davidson C, McGlynn R, Stephney G, Dobrenis K, Vanier MT, et al. Endosomal/lysosomal processing of gangliosides affects neuronal cholesterol sequestration in Niemann-pick disease type C. Am J Pathol. 2011;179:890–902. Cougnoux A, Yerger JC, Fellmeth M, Serra-Vinardell J, Martin K, Navid F et al. Single cell transcriptome analysis of niemann–pick disease, type c1 cerebella. Int J Mol Sci [Internet]. MDPI AG; 2020 [cited 2024 Oct 11];21:1–23. https://pubmed.ncbi.nlm.nih.gov/32731618/ Cougnoux A, Drummond RA, Collar AL, Iben JR, Salman A, Westgarth H et al. Microglia activation in Niemann-Pick disease, type C1 is amendable to therapeutic intervention. Hum Mol Genet [Internet]. Oxford University Press; 2018 [cited 2024 Oct 11];27:2076–89. https://pubmed.ncbi.nlm.nih.gov/29617956/ Demir SA, Timur ZK, Ateş N, Martínez LA, Seyrantepe V. GM2 ganglioside accumulation causes neuroinflammation and behavioral alterations in a mouse model of early onset Tay-Sachs disease. J Neuroinflammation [Internet]. BioMed Central Ltd; 2020 [cited 2024 Oct 11];17. https://pubmed.ncbi.nlm.nih.gov/32951593/ Ou L, Przybilla MJ, Whitley CB. Metabolomics profiling reveals profound metabolic impairments in mice and patients with Sandhoff disease. Mol Genet Metab [Internet]. Academic Press Inc.; 2019 [cited 2024 Oct 11];126:151–6. https://pubmed.ncbi.nlm.nih.gov/30236619/ Tobias F, Pathmasiri KC, Cologna SM. Mass spectrometry imaging reveals ganglioside and ceramide localization patterns during cerebellar degeneration in the Npc1 –/– mouse model. Anal Bioanal Chem [Internet]. Springer Verlag; 2019 [cited 2024 Oct 11];411:5659–68. https://pubmed.ncbi.nlm.nih.gov/31254056/ Hawkes C, Kar S. Insulin-like growth factor-II/mannose-6-phosphate receptor: Widespread distribution in neurons of the central nervous system including those expressing cholinergic phenotype. J Comp Neurol [Internet]. 2003;458:113–27. https://onlinelibrary.wiley.com/doi/full/10.1002/cne.10578 Sarna JR, Larouche M, Marzban H, Sillitoe RV, Rancourt DE, Hawkes R. Patterned Purkinje cell degeneration in mouse models of Niemann-Pick type C disease. J Comp Neurol [Internet]. 2003;456:279–91. https://onlinelibrary.wiley.com/doi/full/ 10.1002/cne.10522 Higashi Y, Murayama S, Pentchev PG, Suzuki K. Cerebellar degeneration in the Niemann-Pick type C mouse. Acta Neuropathol. 1993;85:175–84. Ko DC, Milenkovic L, Beier SM, Manuel H, Buchanan JA, Scott MP. Cell-Autonomous Death of Cerebellar Purkinje Neurons with Autophagy in Niemann-Pick Type C Disease. PLOS Genet [Internet]. 2005;1:81–95. https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.0010007 German DC, Matthew Quintero E, Liang CL, Ng B, Punia S, Xie C, et al. Selective Neurodegeneration, Without Neurofibrillary Tangles, in a Mouse Model of Niemann-Pick C Disease. J Comp Neurol. 2001;433:415. Walterfang M, Patenaude B, Abel LA, Kluenemann H, Bowman EA, Fahey MC, et al. Subcortical volumetric reductions in adult Niemann-Pick disease type C: a cross-sectional study. Am J Neuroradiol. 2013;34:1334–40. Zervas M, Dobrenis K, Walkley SU. Neurons in Niemann-Pick Disease Type C Accumulate Gangliosides as Well as Unesterified Cholesterol and Undergo Dendritic and Axonal Alterations. J Neuropathol Exp Neurol [Internet]. 2001;60:49–64. https://academic.oup.com/jnen/article/60/1/49/2917938 Lopez ME, Klein AD, Dimbil UJ, Scott MP. Anatomically Defined Neuron-Based Rescue of Neurodegenerative Niemann–Pick Type C Disorder. J Neurosci [Internet]. 2011;31:4367–78. https://www.jneurosci.org/content/31/12/4367 Grüsser-Cornehls U, Bäurle J. Mutant mice as a model for cerebellar ataxia. Prog Neurobiol. 2001;63:489–540. Chen Y, Zheng S, Tecedor L, Davidson BL. Overcoming Limitations Inherent in Sulfamidase to Improve Mucopolysaccharidosis IIIA Gene Therapy. Mol Ther [Internet]. Elsevier Ltd.; 2018;26:1118–26. https://doi.org/10.1016/j.ymthe.2018.01.010 Katz ML, Tecedor L, Chen Y, Williamson BG, Lysenko E, Wininger FA, Young WM, Johnson GC, Whiting RE, Coates DB JR. AAV gene transfer delays disease onset in a TPP1-deficient canine model of the late infantile form of Batten disease. Sci Transl Med. 2015;7:313ra180. Griese M, Brasch F, Aldana VR, Cabrera MM, Goelnitz U, Ikonen E et al. Respiratory disease in Niemann-Pick type C2 is caused by pulmonary alveolar proteinosis. Clin Genet [Internet]. 2010;77:119–30. https://onlinelibrary.wiley.com/doi/full/ 10.1111/j.1399-0004.2009.01325.x Baudry M, Yao Y, Simmons D, Liu J, Bi X. Postnatal development of inflammation in a murine model of Niemann–Pick type C disease: immunohistochemical observations of microglia and astroglia. Exp Neurol. 2003;184:887–903. Li H, Repa JJ, Valasek MA, Beltroy EP, Turley SD, German DC et al. Molecular, anatomical, and biochemical events associated with neurodegeneration in mice with Niemann-Pick type C disease. J Neuropathol Exp Neurol [Internet]. 2005 [cited 2022 Mar 3];64:323–33. https://pubmed.ncbi.nlm.nih.gov/15835268/ Santiago-Mujica E, Flunkert S, Rabl R, Neddens J, Loeffler T, Hutter-Paier B et al. Hepatic and neuronal phenotype of NPC1 -/- mice. Heliyon [Internet]. 2019 [cited 2022 Jan 13];5:e01293. https://doi.org/10.1016/j.heliyon.2019.e01293 Dixit SS, Jadot M, Sohar I, Sleat DE, Stock AM, Lobel P. Loss of Niemann-Pick C1 or C2 Protein Results in Similar Biochemical Changes Suggesting That These Proteins Function in a Common Lysosomal Pathway. PLoS ONE. 2011;6:23677. Chandler RJ, Williams IM, Gibson AL, Davidson CD, Incao AA, Hubbard BT et al. Systemic AAV9 gene therapy improves the lifespan of mice with Niemann-Pick disease, type C1. Hum Mol Genet [Internet]. 2017;26:52–64. http://www.ncbi.nlm.nih.gov/pubmed/27798114 Davidson CD, Gibson AL, Gu T, Baxter LL, Deverman BE, Beadle K et al. Improved systemic AAV gene therapy with a neurotrophic capsid in Niemann–Pick disease type C1 mice. Life Sci Alliance [Internet]. 2021;4:e202101040. https://www.life-science-alliance.org/content/4/10/e202101040 Hughes MP, Smith DA, Morris L, Fletcher C, Colaco A, Huebecker M, et al. AAV9 intracerebroventricular gene therapy improves lifespan, locomotor function and pathology in a mouse model of Niemann–Pick type C1 disease. Hum Mol Genet. 2018;27:3079–98. Kurokawa Y, Osaka H, Kouga T, Jimbo E, Muramatsu K, Nakamura S, et al. Gene Therapy in a Mouse Model of Niemann–Pick Disease Type C1. Hum Gene Ther [Internet]. 2021;32:589–98. Available from: /pmc/articles/PMC8236559/. Pineda M, Juríčková K, Karimzadeh P, Kolnikova M, Malinova V, Insua JL et al. Disease characteristics, prognosis and miglustat treatment effects on disease progression in patients with Niemann-Pick disease Type C: an international, multicenter, retrospective chart review. Orphanet J Rare Dis [Internet]. 2019;14:32. /pmc/articles/PMC6367842/ Ohshima-Hosoyama S, Simmons HA, Goecks N, Joers V, Swanson CR, Bondarenko V et al. A Monoclonal Antibody-GDNF Fusion Protein Is Not Neuroprotective and Is Associated with Proliferative Pancreatic Lesions in Parkinsonian Monkeys. Mosley RL, editor. PLoS One [Internet]. Public Library of Science; 2012 [cited 2018 Feb 19];7:e39036. http://dx.plos.org/10.1371/journal.pone.0039036 Tables Table I. Overview of the primers used in the study. Gene Forward Reverse CAG AACGCCAATAGGGACTTTC GTAGGAAAGTCCCATAAGGTC Npc2 mutant CCAGGCAGCACGGATGTC GCCAGGGTTTTCCCAGTCA Npc2 wild-type TGTGGCTCAGTGGCTTAGG CCAGGAAGGGATTTCACACA Additional Declarations Competing interest reported. JK is listed as an inventor on a patent on AAV-BR1, held by Boehringer Ingelheim International. All other authors have no competing interests to declare. Supplementary Files SUPPLEMENTALINFORMATION.pdf Video1.mov Video2.mov Video3.mov Video4.mov Video5.mov Cite Share Download PDF Status: Published Journal Publication published 31 Jan, 2025 Read the published version in Fluids and Barriers of the CNS → Version 1 posted Editorial decision: Revision requested 03 Dec, 2024 Reviews received at journal 30 Nov, 2024 Reviews received at journal 30 Nov, 2024 Reviewers agreed at journal 19 Nov, 2024 Reviews received at journal 15 Nov, 2024 Reviewers agreed at journal 27 Oct, 2024 Reviewers agreed at journal 22 Oct, 2024 Reviewers invited by journal 22 Oct, 2024 Editor assigned by journal 21 Oct, 2024 Submission checks completed at journal 21 Oct, 2024 First submitted to journal 11 Oct, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-5245293\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":385729500,\"identity\":\"ea616768-7b51-457b-80ce-bc69827366b1\",\"order_by\":0,\"name\":\"Charlotte Laurfelt Munch Rasmussen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Aalborg University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Charlotte\",\"middleName\":\"Laurfelt Munch\",\"lastName\":\"Rasmussen\",\"suffix\":\"\"},{\"id\":385729501,\"identity\":\"3ed00634-f183-4972-a03e-9073bf10fb06\",\"order_by\":1,\"name\":\"Signe Frost Frederiksen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Southern Denmark\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Signe\",\"middleName\":\"Frost\",\"lastName\":\"Frederiksen\",\"suffix\":\"\"},{\"id\":385729502,\"identity\":\"d8dd4e83-0495-4616-af8a-3d4cf2a6f10b\",\"order_by\":2,\"name\":\"Christian Würtz Heegaard\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Aarhus University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Christian\",\"middleName\":\"Würtz\",\"lastName\":\"Heegaard\",\"suffix\":\"\"},{\"id\":385729503,\"identity\":\"ba2b9622-e43a-41f7-8830-b516efe56506\",\"order_by\":3,\"name\":\"Maj Schneider Thomsen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Aalborg University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Maj\",\"middleName\":\"Schneider\",\"lastName\":\"Thomsen\",\"suffix\":\"\"},{\"id\":385729504,\"identity\":\"6fd648fd-d2be-46dc-89e4-89c60d1f55b4\",\"order_by\":4,\"name\":\"Eva Hede\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Aalborg University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Eva\",\"middleName\":\"\",\"lastName\":\"Hede\",\"suffix\":\"\"},{\"id\":385729505,\"identity\":\"d6c1b159-5245-4f9e-968a-67439b9f2c85\",\"order_by\":5,\"name\":\"Bartosz Laczek\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Aalborg University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Bartosz\",\"middleName\":\"\",\"lastName\":\"Laczek\",\"suffix\":\"\"},{\"id\":385729506,\"identity\":\"f8bd4f9b-8af7-437c-9063-273919c4f1db\",\"order_by\":6,\"name\":\"Jakob Körbelin\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University Medical Center Hamburg-Eppendorf\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jakob\",\"middleName\":\"\",\"lastName\":\"Körbelin\",\"suffix\":\"\"},{\"id\":385729507,\"identity\":\"f6cdb171-3085-46c9-9300-6fbb7c4b19f6\",\"order_by\":7,\"name\":\"Daniel Wüstner\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Southern Denmark\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Daniel\",\"middleName\":\"\",\"lastName\":\"Wüstner\",\"suffix\":\"\"},{\"id\":385729508,\"identity\":\"9d8056b3-d13f-4986-8998-5be0a7556826\",\"order_by\":8,\"name\":\"Louiza Bohn Thomsen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Aalborg University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Louiza\",\"middleName\":\"Bohn\",\"lastName\":\"Thomsen\",\"suffix\":\"\"},{\"id\":385729509,\"identity\":\"2fbc4411-5b73-4a41-8c36-c9bf4bf3b4b6\",\"order_by\":9,\"name\":\"Markus Schwaninger\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Lübeck\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Markus\",\"middleName\":\"\",\"lastName\":\"Schwaninger\",\"suffix\":\"\"},{\"id\":385729510,\"identity\":\"47d04f57-7121-4f4c-80b7-c483495aba62\",\"order_by\":10,\"name\":\"Ole N. Jensen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Southern Denmark\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ole\",\"middleName\":\"N.\",\"lastName\":\"Jensen\",\"suffix\":\"\"},{\"id\":385729511,\"identity\":\"9d6d2cdf-c83f-41f1-acad-0cbc3a881a71\",\"order_by\":11,\"name\":\"Torben Moos\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Aalborg University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Torben\",\"middleName\":\"\",\"lastName\":\"Moos\",\"suffix\":\"\"},{\"id\":385729512,\"identity\":\"dd5fdf1c-2c7c-47eb-861a-13820cbee45a\",\"order_by\":12,\"name\":\"Annette Burkhart\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAsElEQVRIiWNgGAWjYDACCebGx3AOzwGitDA2GzMwGJCmpU2aNC38sxvbqgv+/GHgbz9jwPDmDDGW3DnYdntmmwGDxJkcA8Y5N4hx2I3Ettu8DUCHHcgxYOb5QIQOeaCWYp4/Bgzy598QqcUAqIWZh80AyADZQozDDO8cbJbmbTPmMbzxrODgHGK8L3e7+eBnnj9ycnLnkzc+eHOMCC0wwAMiDpCgYRSMglEwCkYBPgAAGHw3ofKTZ8UAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Aalborg University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Annette\",\"middleName\":\"\",\"lastName\":\"Burkhart\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-10-11 10:23:12\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-5245293/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-5245293/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1186/s12987-025-00621-4\",\"type\":\"published\",\"date\":\"2025-01-31T15:56:58+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":71873980,\"identity\":\"a4dc8197-bbbf-4aff-acb0-e4a9c18829df\",\"added_by\":\"auto\",\"created_at\":\"2024-12-19 10:43:25\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":608690,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eStudy design\\u003c/strong\\u003e. After weaning, at three weeks of age, all mice were socialized (S). At four weeks of age, the mice were trained in the rotarod protocol. The first rotarod test was conducted at five weeks of age, and afterwards once a week until the end of the study (12 weeks). The NPC2-deficient mice (\\u003cem\\u003eNpc2-/-\\u003c/em\\u003e) mice were randomly allocated to the treatment group, and at six weeks of age, the \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e mice were either injected in the tail vein with the brain-specific adeno-associated viral vector encoding the \\u003cem\\u003eNpc2\\u003c/em\\u003e gene (AAV-BR1-NPC2) or with phosphate-buffered saline (PBS). Untreated wild-type (\\u003cem\\u003eNpc2+/+\\u003c/em\\u003e) mice were included as controls. At six, nine, and 12 weeks of age, gait and phenotype score was evaluated. At 12 weeks of age, the mice were euthanized, a blood sample was drawn, and organs of interest (brain, lung, spleen, and liver), were weighed and collected for further analyses. Created with BioRender.com.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5245293/v1/50b0c6cb3396a07bd0d5e20f.png\"},{\"id\":71874785,\"identity\":\"752eef67-b9a9-4f3d-8f4d-5e6512ed4ea7\",\"added_by\":\"auto\",\"created_at\":\"2024-12-19 10:51:25\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":3890018,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eEffects of AAV-BR1-NPC2 on the Niemann Pick type C2 disease phenotype. A)\\u003c/strong\\u003e The body weight was assessed weekly in wild-type (\\u003cem\\u003eNpc2\\u003c/em\\u003e+/+), \\u003cem\\u003eNpc2\\u003c/em\\u003e-/-, and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice. There was no significant difference in body weight between the three groups at any time point during the study period analyzed with a REML mixed-effects model with Greenhouse-Geisser correction (F[2,26] = 2.073, p = 0.1461). \\u003cstrong\\u003eB)\\u003c/strong\\u003e From 4-6 weeks of age, all mice increased their body weight, and there was no difference between the three groups (one-way ANOVA (F[2,26] = 0.0891, p = 0.9151). When examined from the time-point of treatment (6 weeks of age) until the time of euthanasia (12 weeks of age), the \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice had a significantly lower increase in body weight compared to \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ mice (one-way ANOVA (F[2,25] = 12.88, \\u003csup\\u003e***\\u003c/sup\\u003ep ≤ 0.005). \\u003cstrong\\u003eC)\\u003c/strong\\u003e Composite phenotype scores were assessed at 6, 9, and 12 weeks of age. The data were analyzed using the Kruskal-Wallis test (6 weeks: H(2) = 1.022, p = 0.5998, 9 weeks: H(2) = 17.95, p = 0.0001, 12 weeks: H(2) = 20.08, p \\u0026lt; 0.0001). Dunn’s multiple comparisons test with Bonferroni correction (due to multiple tests being carried out) was used for the data sets from 9 and 12 weeks. Significant differences between \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ and untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/-, and \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice are reported with # and § respectively, § p = 0.0483, ### p ≤ 0.0003. Data are presented with a median with interquartile ranges, n = 8 mice/group. \\u003cstrong\\u003eD)\\u003c/strong\\u003e Video Stills (see supplemental video material) of \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+, \\u003cem\\u003eNpc2\\u003c/em\\u003e-/-, and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice performing on the ledge test at 12 weeks of age, included as a part of the composite phenotype score. Wild-type mice receive a score of 0, as these mice can walk along the ledge without losing their balance. However, \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice struggle to keep their balance, move forward, and are nearly falling off the ledge, and therefore receive a score of 2. 4/8 AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice receive a score of 1, due to some trouble keeping their balance, and not using their hindlimbs effectively. However, the mice can still walk along the ledge.\\u003cstrong\\u003e E)\\u003c/strong\\u003e Gait analysis was performed at 6, 9, and 12 weeks of age. The front paws were painted with red dye, and the hind paws in blue dye. Representative images are shown for \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ n = 8/8 mice, \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- n = 8/8, and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- n = 6/8 mice. \\u003cstrong\\u003eF)\\u003c/strong\\u003e Rotarod's performance was assessed weekly from 5 weeks of age until the end of the study at 12 weeks of age. From 8 weeks of age, the time the \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice spent on the rotarod (sec) was significantly lower compared to the age-matched \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ mice (REML mixed-effects model with Greenhouse-Geisser correction (F[2,26] = 13.89, p \\u0026lt; 0.0001)). Significant differences between \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ and untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/-, and \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice are reported with # and § respectively, #, § p \\u0026lt; 0.05, ## p \\u0026lt; 0.005. The rotarod performance at 12 weeks of age is visualized with individuals and exact p-values in \\u003cstrong\\u003eG) \\u003c/strong\\u003e(\\u003csup\\u003e***\\u003c/sup\\u003ep = 0.0007, \\u003csup\\u003e**\\u003c/sup\\u003ep = 0.002). The results in A-B and F-G, are presented as mean ± SD, and the number in each group are as follows: \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ = 10 mice, \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- = 9 mice, from 11 weeks of age n = 8 mice, AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice = 10 mice. 6/10 AAV-BR1 treated mice (high responders) can perform on the rotarod at 12 weeks of age (individual high-responder mice are indicated with green/black triangles).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5245293/v1/2ff1b80e15b8df81a746a58d.png\"},{\"id\":71873982,\"identity\":\"ad885d2f-7517-48bc-8384-1b1be775c426\",\"added_by\":\"auto\",\"created_at\":\"2024-12-19 10:43:25\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":7729915,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eAAV-BR1 vector distribution and its effect on organ weight and cholesterol accumulation in peripheral tissue.\\u003c/strong\\u003e \\u003cstrong\\u003eA)\\u003c/strong\\u003e Biodistribution of AAV-BR1-NPC2 (viral genomes (vg)) in brain, lung, liver, and spleen, analyzed by quantitative qPCR at 12 weeks of age. \\u003cstrong\\u003eB)\\u003c/strong\\u003e Relative \\u003cem\\u003eNpc2\\u003c/em\\u003e gene expression in the cerebrum and lung tissue was analyzed by RT-qPCR. The \\u003cem\\u003eNpc2\\u003c/em\\u003e gene expression was significantly lower in the cerebrum of untreated\\u003cem\\u003e Npc2\\u003c/em\\u003e-/- compared to \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+, whereas no significant difference was seen between AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice and \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+. The \\u003cem\\u003eNpc2\\u003c/em\\u003e gene expression in the lungs of treated and untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice was significantly lower compared to wild-type littermates. Data are analyzed with a one-way ANOVA (F\\u003csub\\u003eCerebrum\\u003c/sub\\u003e[2,6] = 9.64, \\u003cem\\u003ep\\u003c/em\\u003e = 0.013, F\\u003csub\\u003eLung\\u003c/sub\\u003e[2,6] = 74.52, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.0001) with Tukey's multiple comparisons test (* \\u003cem\\u003ep\\u003c/em\\u003e = 0.011, *** \\u003cem\\u003ep\\u003c/em\\u003e ≤ 0.0001). A+B: Data are presented as mean ± SD (n = 3 mice/group). High responders (n=2) are indicated with green/black triangles, while low responders (n = 1) are indicated with green triangles.\\u003cstrong\\u003e C) \\u003c/strong\\u003eInjection with the AAV-BR1-NPC2 vector had no significant effect on organ size, and both \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- (n = 9 mice) and AAV-BR1 treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (n = 10 mice) had significantly lower brain weight and a significantly larger lung and spleen compared to wild-type (WT) mice (\\u003cem\\u003eNpc2\\u003c/em\\u003e+/+) (n = 10 mice) analyzed with a one-way ANOVA (F\\u003csub\\u003eBrain\\u003c/sub\\u003e[2,26] = 20.00, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.0001, F\\u003csub\\u003eLung\\u003c/sub\\u003e[2,26] = 19.49, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.0001), F\\u003csub\\u003eSpleen\\u003c/sub\\u003e[2,26] = 24.34, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.0001) with Tukey's multiple comparisons tests (*** \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.001, **** \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.0001). There was no significant difference in the size of the liver between the three groups (F\\u003csub\\u003eLiver\\u003c/sub\\u003e[2,26] = 20.1866, \\u003cem\\u003ep\\u003c/em\\u003e = 0.8309). Data for the brain, liver, and spleen are presented as mean ± SD, whereas data for the lungs are presented as geometric mean with a 95 % confidence interval. \\u003cstrong\\u003eD+E\\u003c/strong\\u003e) Cholesterol concentrations were evaluated in the liver, lung, spleen, and serum in the three groups (n = 7 mice/group). The cholesterol levels in the investigated organs were significantly higher in \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice compared to \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ age-matched controls (****\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.0001). However, the cholesterol concentration in the spleen of treated mice was significantly lower compared to untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (**\\u003cem\\u003ep \\u003c/em\\u003e= 0.0089). No significant differences were observed in serum. All data were analyzed with one-way ANOVA (F\\u003csub\\u003eLiver\\u003c/sub\\u003e[2,18] = 36.37, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.0001), F\\u003csub\\u003eLung\\u003c/sub\\u003e[2,18] = 23.93, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.0001, F\\u003csub\\u003eSpleen\\u003c/sub\\u003e[2,18] = 83.17, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.0001, F\\u003csub\\u003eSerum\\u003c/sub\\u003e[2,18] = 0.31, \\u003cem\\u003ep\\u003c/em\\u003e = 0.7351) with Tukey's multiple comparisons test. Data are presented as geometric mean with a 95 % confidence interval for D) and as mean ± SD for E). High responders (n = 4) are indicated with green/black triangles, while low responders (n = 3) are indicated with green triangles. \\u003cstrong\\u003eF)\\u003c/strong\\u003e Visceral pathology was analyzed with hematoxylin and eosin staining. Images are representative of n = 5-7 mice/group. Arrows point to lipid-laden macrophages in the liver (top panel), lung (mid panel), and spleen (bottom panel). Asterisks indicate the accumulation of eosinophilic granular material in the alveolar lumen, shown in higher magnification in the black boxes. Scale bars are 100 µm and 20 µm (black box).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5245293/v1/fb6869c939651d9569eb1253.png\"},{\"id\":71873988,\"identity\":\"481e6978-e996-4efe-bc4d-2b85ae388d17\",\"added_by\":\"auto\",\"created_at\":\"2024-12-19 10:43:25\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":39620425,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eNPC2 distribution in the brain after brain-endothelial-directed gene therapy. \\u003c/strong\\u003eImmunohistochemical stainings reveal NPC2-positive cells in the brain of \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice after AAV-BR1-NPC2 gene therapy. \\u003cstrong\\u003eA)\\u003c/strong\\u003eNPC2 is particularly prominent in neurons of the cortex cerebri (ctxc) and the hippocampus (hp) (CA3 region) in the AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice. Although not intensely stained, NPC2 was also seen in brain capillaries (arrows). \\u003cstrong\\u003eB)\\u003c/strong\\u003e A high expression of NPC2 is also found in the deep cerebellar nuclei (dcn) of AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice. Only sparse NPC2-positive cells are seen in the cortex cerebelli (ctxcb) of the treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- group. No NPC2-positive cells are seen in untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice. Granular labeling is seen in Bergmann glia (arrowheads) in \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ mice. Asterisks indicate Purkinje cells. \\u003cstrong\\u003eC) \\u003c/strong\\u003eAAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice were further stained with NPC2, and counterstained with tomato lectin to label the vasculature and analyzed with confocal microscopy. Transduced capillaries are seen throughout the brain, however more pronounced in certain areas like ctxc and striatum. Throughout the brain areas with a high occurrence of NPC2 positive neurons and NPC2 negative capillaries can likewise be found, especially the cortex, and cerebellum. All Images are representative of n = 4 mice in \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ and n = 3/5 in \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- AAV-BR1-NPC2-treated group (high responders) and n = 5 in the non-treated \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e group. Scale bar = 50 µm (cortex cerebri and hippocampus), 25 µm (capillaries in the cortex cerebri), 20 µm (cerebellum, and all images in C), 10 µm (Purkinje cells (magnification)).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5245293/v1/d987ae90f790b6ecdc8148f8.png\"},{\"id\":71873985,\"identity\":\"19bde5ed-bfff-4859-b1c9-d31e42ba44cb\",\"added_by\":\"auto\",\"created_at\":\"2024-12-19 10:43:25\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":5187822,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eEffect of the AAV-BR1-NPC2 gene therapy on Purkinje cell pathology. \\u003c/strong\\u003eCerebellar sections evaluated using immunohistochemical staining for the Purkinje cell marker calbindin. \\u003cstrong\\u003eA)\\u003c/strong\\u003e The wild-type (\\u003cem\\u003eNpc2\\u003c/em\\u003e+/+) mice exhibit normal Purkinje cell patterns (a, e). In contrast, severe Purkinje cell degeneration is seen in untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (b, f). In AAV-BR1-NPC2 treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, the Purkinje cell degeneration is variable (c, d, g, h), but in 4/8 mice assessed, preservation of Purkinje cells is clearly visualized (arrows), especially in the flocculus (F) and paraflocculus (PF) (h) (high responders). Purkinje cell preservation is seen in lobules IX and X of \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice independent of treatment (b, c, d). \\u003cstrong\\u003eB)\\u003c/strong\\u003eThe Purkinje cell degeneration in both \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice is accompanied by axonal swellings (arrowheads) caused by storage accumulation. Images are representative of n = 8 \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ mice, n = 5 \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, and n = 8 AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, Scale bar = A: 300 µm (a-h), B: 50 µm (i-k), 25 µm (l-n).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5245293/v1/cda5f03dbb04d0ff726d101d.png\"},{\"id\":71873987,\"identity\":\"f35b7750-93cc-4f91-b51d-5da1a0215d96\",\"added_by\":\"auto\",\"created_at\":\"2024-12-19 10:43:25\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":10467887,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eEffect of the AAV-BR1-NPC2 gene therapy on neuroinflammation in the cortex cerebri and hippocampus\\u003c/strong\\u003e. \\u003cstrong\\u003eA) \\u003c/strong\\u003eBrain sections evaluated using immunohistochemical staining of the astrocytic marker GFAP (a-l) and microglial marker IBA1 (m-x). In wild-type mice (\\u003cem\\u003eNpc2\\u003c/em\\u003e+/+) only sparse GFAP-positive astrocytes (a, e, i) and resting ramified microglia (m, q, u) are seen in cortex cerebri (ctxc), and hippocampus (hp). Diffuse astrogliosis is seen in untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (b, f, j), whereas a reduction in GFAP-positive astrocytes is visualized in some of the AAV-BR1-NPC2-treated mice (high responders) (d, h, l), especially in neocortical regions just above corpus callosum (cc). The same pattern is evident for the distribution of reactive microglia in the cortex cerebri and hippocampus (p, t, x). Images are representative of n = 4 \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ mice, n = 4 \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, and n = 7 AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, where 4 out of 7 mice presented with lower neuroinflammation (high responders) compared with untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice. Scale bar = 100 µm (a-d and m-p), 50 µm (e-l and q-x). \\u003cstrong\\u003eB+C) \\u003c/strong\\u003eThe density of astrocytes (B) and microglia (C) cells per 10,000 µm\\u003csup\\u003e2\\u003c/sup\\u003e in ctxc and hp.\\u003cstrong\\u003e \\u003c/strong\\u003e\\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ mice (black circles) (n=4), \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (n=4) (red squares), and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice categorized as high responders (n=5) (black/green triangles) and low responders (n=2-3) (green triangles). The data were analyzed with a one-way ANOVA (F\\u003csub\\u003eGFAP Ctxc\\u003c/sub\\u003e[2,12] = 7.694, \\u003cem\\u003ep\\u003c/em\\u003e = 0.007, F\\u003csub\\u003eIBA1 Ctxc\\u003c/sub\\u003e[2,13] = 3.220, \\u003cem\\u003ep\\u003c/em\\u003e = 0.073, F\\u003csub\\u003eIBA1 Hp\\u003c/sub\\u003e[2,13] = 2.380, \\u003cem\\u003ep\\u003c/em\\u003e = 0.1316) with Tukey's multiple comparisons test (** \\u003cem\\u003ep\\u003c/em\\u003e = 0.005) except for GFAP in hp were the Kruskal-Wallis test was used (H(2) = 5,645, \\u003cem\\u003ep\\u003c/em\\u003e = 0,0510). Data for astrocytes in ctxc, microglia in ctxc, and hp are presented as mean ± SD, whereas data for GFAP in hp, are presented as median with IQR.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5245293/v1/7e886121b61fd99e7144ab18.png\"},{\"id\":71873983,\"identity\":\"b9cb6c7b-b92e-4046-a041-bd2fbda968d2\",\"added_by\":\"auto\",\"created_at\":\"2024-12-19 10:43:25\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":6146737,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eCholesterol storage in the brain after AAV-BR1-directed gene therapy.\\u003c/strong\\u003e The cholesterol accumulation (visualized using Filipin staining) is reduced in the cortex cerebri (a-c) and the CA3 region of the hippocampus (d-f) of AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (c, f, i, l) compared to untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (b, e, h, k). There is no obvious difference when comparing cholesterol storage in the cortex cerebelli (g-i) and deep cerebellar nucleus (j-l) of the treated vs. untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- groups. No cholesterol storage is seen in \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ control littermates (a, d, g, j). Images are representative of n = 4 mice/group. Scalebar = 50µm and 20µm (white boxes).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5245293/v1/3c1dc9e5bda89d1cf6873182.png\"},{\"id\":71873984,\"identity\":\"58bd0921-2789-4a8b-b15b-1300a8896652\",\"added_by\":\"auto\",\"created_at\":\"2024-12-19 10:43:25\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":7747065,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eReduced cholesterol in the cortex cerebri and hippocampus corresponds to areas with many NPC2-positive cells.\\u003c/strong\\u003e The high occurrence of NPC2-positive neurons (visualized with neuronal nuclei antigen (NeuN) immunolabeling (red) and NPC2 immunolabeling (green)) observed in the cortex cerebri (a-i) and the CA3 region of the hippocampus (j-k)\\u003cstrong\\u003e \\u003c/strong\\u003ecorrespond with lower levels of cholesterol accumulation (visualized using Filipin staining (white)) in the high responder group of AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice in both brain regions assessed. In comparison untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice show extensive neuronal accumulation of cholesterol (only shown in high magnifications). Reduced cholesterol accumulation in the high responder AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice is not limited to the NPC2 expressing cells, but also obvious in neighboring cells, suggesting uptake of secreted NPC2 in these cells, equivalent to cross-correction. Representative images from cortex cerebri and CA3 region of the hippocampus of the high responder group (n = 3). Scale bar = 25µm.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5245293/v1/bba10928aea1a5cad90a0808.png\"},{\"id\":71873991,\"identity\":\"2b9c1e55-e5c0-4263-82de-8dbdfb4f750f\",\"added_by\":\"auto\",\"created_at\":\"2024-12-19 10:43:26\",\"extension\":\"png\",\"order_by\":9,\"title\":\"Figure 9\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1413445,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSegmentation and differential ganglioside expression in the brain using MALDI-MS. A)\\u003c/strong\\u003e Unsupervised statistical analysis employing bi-sectioning k-means in SCiLS Lab reveals distinct regions in mouse brains, with segmentation analysis identifying green and orange regions of interest (ROIs) characterized by unique lipid profiles between wildtype \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ and untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/-. High responder AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice show lipid profiles comparable to \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+, while low responders are comparable to the untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice. \\u003cstrong\\u003eB)\\u003c/strong\\u003e Average spectra from the green and orange segmented regions, normalized for RMS intensity, highlight distinct lipid profiles characteristic of each segment. \\u003cstrong\\u003eC)\\u003c/strong\\u003e Spatial distribution maps of gangliosides GM3(d20:1/18:0) at 1207.76 m/z (a), GM2(d18:1/18:0) at 1381.81 m/z (b), and GM2(d20:1/18:0) at 1410.84 m/z (c) illustrate their presence in the cortex, hippocampus, and cerebellum across different genotypes and treatment groups. Representative images are shown for \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ (n =4), \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- (n = 5), and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- high responders (n=3/4), Low responders (n=1) mice. \\u003cstrong\\u003eD)\\u003c/strong\\u003e Quantitative analysis of average ganglioside intensities: (a) GM3 (1207.76 m/z) in the cortex, (b) GM2 (1381.81 m/z) in the hippocampus, (c) GM2 (1410.84 m/z) in the cerebellum. Significant differences (*\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05) are observed between \\u003cem\\u003eNpc2+/+\\u003c/em\\u003e and \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e mice. No significant differences are observed between \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e mice, indicating a therapeutic impact of AAV-BR1 treatment and that the variation in ganglioside accumulation is influenced by genotype and treatment efficiency. All data were analyzed with one-way ANOVA (F\\u003csub\\u003eGM3 (20) (1207.76 m/z)\\u003c/sub\\u003e [2,11] = 4.394, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.0396), F\\u003csub\\u003eGM2 (18) (1381.81 m/z)\\u003c/sub\\u003e [2,11] = 4.735, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.0328, F\\u003csub\\u003e GM2(18) (1410.84 m/z)\\u003c/sub\\u003e [2,11] =5.067, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.0276, with Tukey's multiple comparisons test. Data are presented as mean ± SD (n= 4-5). High responders (n = 4) are indicated with green/black triangles, while low responders (n = 1) are indicated with green triangles.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig9.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5245293/v1/ed816a7a2cfad9b73899ac07.png\"},{\"id\":75351161,\"identity\":\"c363fe61-4c92-408a-86be-ec879980868d\",\"added_by\":\"auto\",\"created_at\":\"2025-02-03 16:06:30\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":105107273,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5245293/v1/e9b0509e-0192-49db-8581-247b9a482948.pdf\"},{\"id\":71873989,\"identity\":\"56970368-1684-41e3-80fa-436cf650a68d\",\"added_by\":\"auto\",\"created_at\":\"2024-12-19 10:43:25\",\"extension\":\"pdf\",\"order_by\":11,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":871769,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SUPPLEMENTALINFORMATION.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5245293/v1/feb34fc7e61989800a9f9979.pdf\"},{\"id\":71873990,\"identity\":\"02197a4b-9361-459a-b26b-5fdab95cdb02\",\"added_by\":\"auto\",\"created_at\":\"2024-12-19 10:43:26\",\"extension\":\"mov\",\"order_by\":12,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":5891072,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Video1.mov\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5245293/v1/bf427269e6c2353c0c995da2.mov\"},{\"id\":71873992,\"identity\":\"6c454db1-90f6-4c5a-9de1-daadc768a056\",\"added_by\":\"auto\",\"created_at\":\"2024-12-19 10:43:26\",\"extension\":\"mov\",\"order_by\":13,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":49648640,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Video2.mov\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5245293/v1/d706cec9a2e1d400c53468bf.mov\"},{\"id\":71873995,\"identity\":\"e9b030c9-e716-4c2d-a8ff-a5de2c51214b\",\"added_by\":\"auto\",\"created_at\":\"2024-12-19 10:43:27\",\"extension\":\"mov\",\"order_by\":14,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":139164160,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Video3.mov\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5245293/v1/f76a330cc4b0d96f7f9688f1.mov\"},{\"id\":71873994,\"identity\":\"d1b3a46a-1dae-47f2-916f-712341c536ef\",\"added_by\":\"auto\",\"created_at\":\"2024-12-19 10:43:27\",\"extension\":\"mov\",\"order_by\":15,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":104869888,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Video4.mov\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5245293/v1/e760ac736fd26ddbdadbab6d.mov\"},{\"id\":71874786,\"identity\":\"e45f02dc-1268-4829-ae5f-f04a835d7ec0\",\"added_by\":\"auto\",\"created_at\":\"2024-12-19 10:51:26\",\"extension\":\"mov\",\"order_by\":16,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":65868288,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Video5.mov\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5245293/v1/373bc74e107d5892d1de1d02.mov\"}],\"financialInterests\":\"Competing interest reported. JK is listed as an inventor on a patent on AAV-BR1, held by Boehringer Ingelheim International. All other authors have no competing interests to declare.\",\"formattedTitle\":\"Endothelial and neuronal engagement by AAV-BR1 gene therapy alleviates neurological symptoms and lipid deposition in a mouse model of Niemann-Pick type C2\",\"fulltext\":[{\"header\":\"Background\",\"content\":\"\\u003cp\\u003eNiemann-Pick type C disease (NP-C) is a rare autosomal recessive lysosomal lipid storage disease caused by mutations in either the \\u003cem\\u003eNpc1\\u003c/em\\u003e or \\u003cem\\u003eNpc2\\u003c/em\\u003e gene [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e] leading to neurodegeneration. NP-C is thus divided into two subtypes depending on the gene affected. Deficiency in the Niemann-Pick C1 protein (NPC1) accounts for 95% of the disease cases, and Niemann-Pick C2 protein (NPC2) for the remaining 5% [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Both proteins are essential for the transport and redistribution of cholesterol from the lysosomes to other organelles, e.g., the endoplasmic reticulum and plasma membranes. The loss of one of the two proteins results in a lysosomal accumulation of cholesterol [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e] and secondary changes in sphingolipids including sphingosine and sphingomyelin, gangliosides (GM2 and GM3), and glycolipids, such as glucosylceramide [\\u003cspan additionalcitationids=\\\"CR8\\\" citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eThe clinical manifestations of NP-C are diverse. The age of onset ranges from neonatal to adulthood, with an earlier onset indicating a more severe disease progression, depending on the type of mutation. Hepatosplenomegaly is among the first clinical findings, followed by the development of neurological symptoms with the most prominent being cerebellar ataxia [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. The progressive nature of the disease has a fatal outcome, and most patients die between 10 and 25 years of age [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Effective treatment of NP-C is currently unavailable, and the glucosylceramide synthase inhibitor Miglustat (Zavesca) is the only approved disease-modifying therapeutic [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. The heterogeneous clinical manifestation results in variations between symptom development and timing of exact diagnosis [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. Development of new effective treatments, including the use of viral gene therapies, is therefore highly warranted [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eNPC1 is transmembrane-bound and integrated into the lysosomal membrane [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e] whereas NPC2 is a\\u0026thinsp;~\\u0026thinsp;17 kDa soluble mannose 6-phosphate tagged glycoprotein found in lysosomes and secretory fluids [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. Secreted NPC2 is endocytosed in peripheral tissues via the ubiquitous mannose-6-phosphate receptor (M6PR) pathway [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. However, the entry of NPC2 from the blood into the brain parenchyma is restricted at the blood-brain barrier (BBB) due to a developmental decline in M6PR during the maturation of brain endothelial cells (BECs) [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. Previous \\u003cem\\u003ein vitro\\u003c/em\\u003e studies have shown that genetic modification of BECs forming the BBB results in a bi-directional secretion of recombinant proteins [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e, \\u003cspan additionalcitationids=\\\"CR20 CR21\\\" citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e], suggesting that proteins released from BECs subsequently can be accessible for both peripheral organs as well as the brain.\\u003c/p\\u003e \\u003cp\\u003eThe potential of cross-correcting cells within the central nervous system (CNS) makes NP-C2 a good candidate for gene therapy [\\u003cspan additionalcitationids=\\\"CR24\\\" citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. AAV-BR1, a capsid-modified AAV vector, known for its robust tropism for BECs, when applied intravenously, has been shown to confer long-lasting transgene expression in the brain with a minimum of transduction of peripheral organs except for the lungs [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e, \\u003cspan additionalcitationids=\\\"CR27 CR28\\\" citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. The therapeutic potential of AAV-BR1 has recently been proven in different mouse models with neurodegeneration, e.g., Incontinentia pigmenti, Sandhoff disease, and Allan-Herndon-Dudley syndrome [\\u003cspan additionalcitationids=\\\"CR27 CR28\\\" citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e], where successful treatment was enabled by alteration of gene expression in BECs. We recently showed that systemic administration of this putative BEC-specific AAV-BR1, when encoding the \\u003cem\\u003eNpc2\\u003c/em\\u003e gene, somewhat surprisingly led to successful transduction of both BECs and neurons [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e], which suggests that AAV-BR1 to some extent can pass the BBB, and transduce neurons \\u003cem\\u003ein vivo\\u003c/em\\u003e. Accordingly, we hypothesized that BBB-directed gene therapy using the AAV-BR1-NPC2 vector would effectively transduce both BECs and neurons with subsequent delivery of NPC2, leading to alleviation of both neurological and non-neurological symptoms in a mouse model of NP-C2. The present study demonstrates that a single intravenous injection of the AAV-BR1 vector at six weeks of age in NPC2-deficient mice leads to a widespread distribution of NPC2 in both BECs and neurons causing a reduction of neurological symptoms, possibly due to a lowering of neuronal cholesterol and gangliosides.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eProduction of recombinant viral vectors\\u003c/h2\\u003e \\u003cp\\u003eThe plasmid pAAV-CAG-NPC2 was generated following the procedure described earlier [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. The recombinant AAV-BR1-NPC2 vector used in the present study was produced by co-infection of Sf9 cells using the baculovirus expression system as previously described [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. In short, Sf9 cells were infected with two different recombinant baculoviruses; one carrying the AAV2 \\u003cem\\u003erep\\u003c/em\\u003e gene and a brain-endothelial cell-specific AAV2-BR1 \\u003cem\\u003ecap\\u003c/em\\u003e gene, and one containing the CAG promoter and the mouse \\u003cem\\u003eNpc2\\u003c/em\\u003e gene flanked by inverted terminal repeats from AAV2. Four days after the co-infection, the viral particles were harvested from the Sf9 cells by repeated freeze/thaw cycles and digested with 50 U/mL Benzonase Nuclease to remove unpackaged DNA. The viral vectors were purified using iodixanol density-gradient ultracentrifugation and extracted from the 40% iodixanol layer. Genomic titers were determined by quantitative real-time PCR (qPCR) using CAG-specific primers (Table I). The SYBR Green-based FastStart Essential DNA Green Master (Merck KGaA, #06402712001 Roche) with the Light Cycler 96 System (Roche) was used to determine the vector copy numbers. The reactions were run with an initial denaturation for 10 min at 95\\u0026deg;C followed by 40 cycles of denaturation for 30 s at 95\\u0026deg;C, then annealing for 30 s at 67\\u0026deg;C, and extension for 30 s at 72\\u0026deg;C, followed by a melt curve analysis (60\\u0026ndash;97\\u0026deg;C, 0.1\\u0026deg;C/s).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eTransduction of a primary\\u003c/b\\u003e \\u003cb\\u003ein vitro\\u003c/b\\u003e \\u003cb\\u003eblood-brain barrier model and immunocytochemistry\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eThe transduction efficiency of the AAV-BR1-NPC2 vector was initially tested \\u003cem\\u003ein vitro\\u003c/em\\u003e. Primary mouse brain endothelial cells (mBECs) were isolated from 8-week-old female BALB/cJRj mice, and primary mixed glial cells (consisting of astrocytes and some microglia [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e] were isolated from brains of 2-days old C57BL/6 mice of both sexes as previously described [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. mBECs were seeded on hanging culture insert and co-cultured with primary mixed glial cells to establish a BBB non-contact co-culture model. After seeding, the barrier integrity was induced by adding CTP-cAMP (250 \\u0026micro;M), hydrocortisone (550 nM), and RO (17.5 \\u0026micro;M). The integrity of the \\u003cem\\u003ein vitro\\u003c/em\\u003e BBB model was evaluated through measurements of transendothelial electrical resistance (TEER) using a MiliCell ERS-2 epithelial volt-ohm Meter and a STX01 chopstick electrode (Merck Millipore) as previously described [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. TEER was measured before transduction, the day after transduction, and at the end of the study. Two days after the seeding of mBECs, when they expressed a high TEER (\\u0026gt;\\u0026thinsp;150 Ω*cm\\u003csup\\u003e2\\u003c/sup\\u003e) [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e], the cells were transduced with a dose of 10\\u003csup\\u003e10\\u003c/sup\\u003e viral genomes (vg)/well. 24 hours after transduction the medium was changed. Three days later, the cells were fixed in 4% paraformaldehyde (PFA) and immunostained with rabbit anti-NPC2 (Novusbio, #NBP1-84012) diluted 1:250 in combination with goat anti-mouse/rat CD31/PECAM-1 (Bio-Techne, #AF3628) diluted 1:500. The secondary antibodies donkey anti-goat Alexa 488 (Invitrogen, #A11055) was used in combined with a donkey anti-rabbit Alexa 594 (Invitrogen, #A21207) both diluted 1:250. Nuclei were stained with 4\\u0026prime;,6-Diamidino-2-phenylindole dihydrochloride (DAPI) diluted 1:500. For further immunocytochemical specifications see [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Images were acquired using an AxioObserver Z1 fluorescence microscope equipped with ApoTome and Axiocam MR camera using a 40x/1.3na oil Objective.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eAnimal study approval and reporting\\u003c/h3\\u003e\\n\\u003cp\\u003e The animal studies were performed according to the Danish Animal Experimentation Act (BEK no. 2028 of 14/12/2020) and the European directive (2010/63/EU) and carried out by licensed staff. The Danish Animal Experiments Inspectorate under the Ministry of Food, Fisheries, and Agriculture has approved all animal experiments and breeding of NPC2-deficient mice (license no. 2018-15-0201-01467 and 2019-15-0202-00056). The animal study is reported according to the ARRIVE guidelines [\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e].\\u003c/p\\u003e\\n\\u003ch3\\u003eAnimals\\u003c/h3\\u003e\\n\\u003cp\\u003eThe 129P2/OlaHsd-\\u003cem\\u003eNpc2\\u003c/em\\u003e\\u003csup\\u003e\\u003cem\\u003eGt(LST105)BygNya\\u003c/em\\u003e\\u003c/sup\\u003e mouse strain [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e] was rederived using \\u003cem\\u003ein vitro\\u003c/em\\u003e fertilization, and the strain established on a BALB/cJRj background (supplied by Janvier Labs, Le Genest-Saint‐Isle, France). Heterozygous \\u003cem\\u003eNpc2\\u003c/em\\u003e+/- mice were mated to obtain offspring homozygous for the mutation (\\u003cem\\u003eNpc2\\u003c/em\\u003e-/-) and wild-type (WT) control littermates (\\u003cem\\u003eNpc2+/+\\u003c/em\\u003e). The breeding was established using continuous trio-breeding (two \\u003cem\\u003eNpc2\\u003c/em\\u003e+/- female mice were housed with one \\u003cem\\u003eNpc2\\u003c/em\\u003e+/- male mouse) [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. The housing and breeding were carried out at the animal facility at Aarhus University, Aarhus, Denmark, under specific pathogen-free conditions. Health monitoring was followed according to FELASA recommendations [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e], and the mice were free of all pathogens listed. Both female and male mice were included in the study. The mice were group-housed with up to five mice per cage in standard IVC cages (GM500, Tecniplast) under controlled conditions (ambient temperature 20\\u0026ndash;24\\u0026deg;C, 55\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;10% humidity, and a 12-hour light/dark cycle with the light on at 6:00 am). They were provided with environmental enrichment consisting of Tapvei bedding material, sizzle nesting material, aspen bricks, biodegradable cardboard houses, tunnels, and peanuts as food enrichment. The cages were changed once a week. Offspring were weaned at 21 days of age and separated according to sex. Mice were provided with a standard chow diet (Altromin #1324, Brogaarden, Lynge, Denmark) and reverse osmosis water \\u003cem\\u003ead libitum\\u003c/em\\u003e.\\u003c/p\\u003e\\n\\u003ch3\\u003eGenotyping\\u003c/h3\\u003e\\n\\u003cp\\u003eGenotyping of mice was performed on postnatal days 10\\u0026ndash;14 based on ear punching [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e], which was also used for individual identification. DNA from ear punches was purified using the Quick-DNA mini prep plus kit (Zymo Research # D4068) according to the manufacturer\\u0026rsquo;s protocol. DNA quantity and purity were determined with a DeNovix Spectrophotometer DS-11. The \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- genotype was determined by qPCRs using Maxima SYBR Green Master Mix, with ROX as a reference (Thermo Fisher Scientific, #K0223) and two sets of primers. The primer sequences are shown in Table I. All samples were analyzed in duplicates. The qPCR reaction was performed using the QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific). In short, the qPCR reaction was initiated with denaturation of the samples at 95\\u0026deg;C for 10 minutes followed by 40 cycles of denaturation at 95\\u0026deg;C for 15 seconds, annealing at 60\\u0026deg;C for 30 seconds, and extension at 72\\u0026deg;C for 30 seconds. Finally, a melt curve analysis was performed (60\\u0026deg;C to 95\\u0026deg;C with 0.05\\u0026deg;C/s).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eIn vivo\\u003c/b\\u003e \\u003cb\\u003estudy design\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eA total of 30 mice were used in the study. Offspring from the trio breeding of heterozygote \\u003cem\\u003eNpc2\\u003c/em\\u003e+/- were divided into three groups (n\\u0026thinsp;=\\u0026thinsp;10/group) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). The \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice were randomly allocated to their respective group (treated vs. untreated) using a computer-based random order generator [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. The study director was blinded to treatment status during the entire study period and blinded to genotype and treatment group during the histopathological evaluation. In the first and second groups, six weeks old \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice were intravenously injected with sterile phosphate-buffered saline (PBS) or AAV-BR1-NPC2 vectors diluted in PBS (dose at 1.6x10\\u003csup\\u003e11\\u003c/sup\\u003e viral vectors/mouse) in the tail vein. Both groups were injected with the same volume (200 \\u0026micro;l). The vector dose and route of administration are based on previous studies [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. The third group included age-matched untreated wild-type (WT) littermates used as controls. The experimental unit is the individual mouse, and since only 1 in 7 mice is born with the \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- genotype [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e], the study was conducted in seven cohorts. Whenever possible, all experimental groups were represented in each of the cages. During the study period, the mice were monitored daily for their clinical condition. The body weight was measured weekly, but from 60 days of age until the end of the study (day 84), the body weight was measured twice a week. At 12 weeks of age, before reaching the end stage of the disease, the study was terminated (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). To test our hypothesis, the primary outcome measures were body weight and behavior (rotarod performance, composite phenotype score, and gait analysis). Post-mortem analysis included quantification of total cholesterol, mass spectrometry imaging of gangliosides, and histopathological evaluation of brain and visceral organs.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eNo inclusion or exclusion criteria were set before the beginning of the study, but at the time point of treatment (6 weeks of age), a single male \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mouse was excluded due to lower body weight and trouble with coordination and balance compared with cage mates. At the time of unblinding, it was revealed that this mouse was designated for the PBS group resulting in only nine mice in this group.\\u003c/p\\u003e\\n\\u003ch3\\u003eBehavioral analysis\\u003c/h3\\u003e\\n\\u003cp\\u003eBefore the start of the experiment (from 3 weeks of age), the mice were socialized and habituated to the experiment handler (10 minutes per cage for three consecutive days). Whenever possible, mice were handled using either tunnel or cupping to minimize stress induced by handling [\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]. All behavioral experiments were conducted by female researchers.\\u003c/p\\u003e \\u003cp\\u003eTo study the efficacy of the AAV-BR1-NPC2 therapy on the cerebellar function (e.g. motor coordination, ataxia, and tremor), two different behavioral assessments were performed; rotarod performance and a composite phenotype score (adapted from [\\u003cspan additionalcitationids=\\\"CR39 CR40\\\" citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e]) where the following parameters were included: grooming, kyphosis (body position), tremor, ledge test, gait, hind limb clasping, and explorative behavior (activity). Each mouse was given a score of 0\\u0026ndash;2 for each parameter evaluated. Thus, a higher score indicates a more severe disease progression (see supplemental Table\\u0026nbsp;1 for the scoring scheme). The mice were scored at 6, 9, and 12 weeks of age.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eRotarod\\u003c/h2\\u003e \\u003cp\\u003eMotor coordination and balance were assessed weekly from 5 weeks of age using an accelerating Rotarod (LE 8200, Panlab, Harvard Apparatus, Barcelona, Spain) as previously described [\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e]. Briefly, the rotating drum (3 cm in diameter) accelerated at a constant rate from 4\\u0026ndash;40 rpm over 5 minutes. The latency to fall (seconds), as well as the speed at fall (revolutions per minute), was measured automatically when the mouse fell onto the underlying lever, which was equipped with a switch that detects time. The mice were tested once a week in a random order, always at the same time of the day (8\\u0026ndash;11 a.m.) during the entire study period. Before the test session, the mice were acclimatized to the experimental room for 15 minutes. The test session consisted of three trials with a 15-minute inter-trial interval. The data from the three trials were averaged and used for statistical analysis. If a mouse fell before 5 seconds, the mouse received a fourth trial. If a mouse completed a passive rotation, the timer was manually stopped, the latency to fall was recorded, and the mouse was replaced in the cage. Mice falling off the rotarod before 5 seconds more than two times in a row or before the timer was started were assessed as unable to perform on the rotarod, and they were recorded for 0 seconds, which were used for the statistical analysis.\\u003c/p\\u003e \\u003cp\\u003eAt four weeks of age, the mice were trained before the test sessions with three trials for four consecutive days. During the first trial, the mice were habituated to the rotarod test system and were allowed to walk on the rotating drum at a speed of 4 rpm for up to 4 minutes. On the second day, each mouse was trained at a speed of 10 rpm for 2 minutes. If a mouse fell during the training session, they were replaced on the rotating drum until the end of the set trial period. For the next two days, the mice were habituated to the acceleration test protocol, as previously mentioned. The mice were not replaced on the drum during the last two training sessions.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eGait analysis\\u003c/h3\\u003e\\n\\u003cp\\u003eA thorough gait analysis was performed every third week from 6 weeks of age until euthanasia at 12 weeks of age. The paws of the mouse were dipped in non-toxic water-based paints (front paws in red, hind paws in blue). The mice were trained to walk down a runway lined with white paper. During the training sessions, the mice underwent three trials for three consecutive days.\\u003c/p\\u003e\\n\\u003ch3\\u003eHumane endpoints\\u003c/h3\\u003e\\n\\u003cp\\u003eBased on knowledge of disease progression and manifestations from a previous study using similar \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e mice [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e], the mice were euthanized at 12 weeks of age (six weeks post-injection) or whenever humane endpoints were reached. The humane endpoints were as follows: inability to drink or eat, dehydration, severe tremors, and ataxia resulting in repeated falling or reluctance to move, weighing 20% less compared to WT mice of identical age and sex, and penile prolapse.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eTissue collection and processing\\u003c/h2\\u003e \\u003cp\\u003eAt 12 weeks of age, the mice were deeply anesthetized with 5% isoflurane (1L/min O\\u003csub\\u003e2\\u003c/sub\\u003e), and once reflexes were absent, the thoracic cavity was opened, and intracardiac blood samples were collected in clean 1.5 ml Eppendorf-tubes. The serum samples were prepared as follows; the blood was allowed to clot at room temperature for 30 minutes and then centrifuged at 1300 \\u0026times;g for 10 minutes. Serum samples were stored at -70\\u0026deg;C until further analysis. The animals were transcardiacally perfused with a manual injection of 20 ml cold PBS. Brain, liver, spleen, and lung tissue were harvested from every animal (n\\u0026thinsp;=\\u0026thinsp;9\\u0026ndash;10/group) and weighed using a precision scale. Afterward, the visceral organs were divided in two; one half was snap-frozen on dry ice and stored at -70\\u0026deg;C for biochemical analysis, and the other half was post-fixated in 4% PFA overnight at 4\\u0026deg;C. The brain and cerebellum were likewise divided in two, one-half snap-frozen on dry ice and stored at -70\\u0026deg;C for biochemical analysis (n\\u0026thinsp;=\\u0026thinsp;3/group) or snap-frozen for mass spectrometry imaging (MSI) (n\\u0026thinsp;=\\u0026thinsp;6\\u0026ndash;7/group), and the other half was post-fixated in 4% PFA overnight at 4\\u0026deg;C (n\\u0026thinsp;=\\u0026thinsp;9\\u0026ndash;10/group). Post-fixated organs were subsequently thoroughly washed in potassium-containing phosphate-buffered saline (PPBS) and stored at 4\\u0026deg;C in PPBS with 0.1% sodium azide.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eMorphological and immunohistochemical investigations\\u003c/h2\\u003e \\u003cp\\u003e40 \\u0026micro;m cryosections of brain tissue were prepared as previously described [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Free-floating brain sections were incubated in 3% porcine serum with 0.3% Triton X-100 diluted in 0.1 M PPBS (blocking buffer) for 30 minutes at room temperature to block unspecific binding and permeabilize cell membranes. Then the sections were incubated overnight at 4\\u0026deg;C with the following primary antibodies diluted in blocking buffer; anti-glial fibrillary acidic protein (GFAP) (Dako, #ZO334) (1:500), anti-ionized calcium-binding adaptor molecule 1 (IBA1) (Wako, #PDF3116) (1:5,000), anti-calbindin CD28K (Invitrogen, #PAS-85669) (1:500), Neuronal nuclei antigen (NeuN) (Chemicon, #MAB377) (1:500) and anti-bovine NPC2 (Immuno-affinity purified antibody derived from anti-NPC2 IgG positive rabbit serum produced by subcutaneous injections of native bovine NPC2 [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e] (1:2,000). After three washes in blocking buffer diluted 1:50 in PPBS (washing buffer), most sections were incubated with biotinylated goat anti-rabbit IgG (Vector, #BA-1000) diluted 1:200 in blocking buffer for one hour. Sections were washed twice in washing buffer and once in PPBS. For visualization, the sections were incubated in an Avidin-Biotin Complex (ABComplex)-system (VECTASTAIN\\u0026reg; Elite ABC-HRP Kit, Vector laboratories, #PK6100) diluted in PPBS and finally in 3,3\\u0026prime;-diaminobenzidine tetrahydrochloride (DAB). The sections were mounted with Pertex.\\u003c/p\\u003e \\u003cp\\u003eSections double stained for NeuN and/or NPC2 were visualized using goat anti-mouse Alexa 594 (Invitrogen #A11032) (1:200), and biotinylated goat anti-rabbit (1:200). For tyramide enhancement of NPC2 [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e], ABComplex Vectastain were added for 30 minutes and washed in PPBS. The Tyramide Signal Amplification (TSA) Biotin kit (AKOYA Biosciences, #NEL700A001KT) was added for five minutes, and the sections were washed in PPBS and incubated with the ABComplex Vectastain for 30 minutes. The sections were again washed in PPBS and visualized using an anti-streptavidin Alexa 488 (Invitrogen, #S32354) (1:200) antibody for one hour. Sections stained with NPC2 were counterstained with Lycopersicon Esculentum (Tomato) Lectin, DyLight\\u0026reg; 594 (Vector Laboratories, #DL-1177-1) diluted 1:100 in PPBS (10mg/ml) for 30 min at room temperature. Tomato lectin labels the vasculature and microglia cells [\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e]. Sections stained with NeuN and NPC2 were double stained with Filipin, as explained below.\\u003c/p\\u003e \\u003cp\\u003eCholesterol staining on brain sections was performed using Filipin complex III (Sigma-Aldrich, #F4767) modified from [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. Filipin stock solution in dimethyl sulfoxide (1mg/ml) was diluted in PBS for a final working solution of 50 \\u0026micro;g/ml. The free-floating brain sections were washed twice in PPBS, followed by two times washing in 0.02% saponin in PBS. Sections were then incubated in a quenching solution consisting of 1.5 mg/ml glycine, 1% bovine serum albumin, and 0.02% saponin/PBS at room temperature for 30 minutes. Finally, the sections were incubated in Filipin working solution for three hours in the dark under agitation, washed twice in 0.02% saponin in PBS, and mounted with DAKO fluorescent mounting media (#S3023).\\u003c/p\\u003e \\u003cp\\u003eVisceral tissue samples used for histopathological analysis were prepared as previously described [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e] and paraffin-embedded and cut into three \\u0026micro;m sections on a microtome, then stained with Mayer\\u0026rsquo;s Hematoxylin (MHS 16, Sigma-Aldrich) and Eosin Y (HT110116, Sigma-Aldrich) solution (H\\u0026amp;E).\\u003c/p\\u003e \\u003cp\\u003eImages of DAB and H\\u0026amp;E stainings were acquired using an Axioplan 2 microscope equipped with an Axiocam MRc camera (Carl Zeiss). NeuN/NPC2 combined with Filipin stainings were imaged using an Olympus IX83 inverted microscope with a Yokogawa confocal CSU-W1 spinning disk unit equipped with a Hamamatsu ORCAFlash 4.0 v3 grayscale camera using an Olympus UPlanSApo 60x/1.35na oil Objective. NPC2/Tomato Lectin stainings were analyzed using an LSM900 confocal microscope using a Plan-Apochromat 20x/0.8 or 40x/1.4 Oil objective. All images were generated using the same acquisition settings, analyzed with ImageJ software [\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e], and adjusted for brightness and contrast.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eQuantitative analysis of GFAP and IBA1 positive cells\\u003c/h2\\u003e \\u003cp\\u003eUsing the Axioplan 2 microscope DAB-stained brain slices from WT, untreated, and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e mice were examined, with a focus on the cerebral cortex and hippocampus. The slides were blinded to the examinator TM by co-author ABL. Cells were counted using a standardized protocol for estimating cell density [\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e], which involved counting the number of immunoreactive cells with labeled somata using a 10 mm x 10 mm frame overlying the cerebral cortex or hippocampus x 250 times magnification, equivalent to an area of 10,000 \\u0026micro;m\\u003csup\\u003e2\\u003c/sup\\u003e (Fig \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCholesterol analysis\\u003c/h2\\u003e \\u003cp\\u003eLipids from the liver, spleen, and lung tissue were extracted using the lipid extraction kit (ab211044, Abcam) according to the manufacturer\\u0026rsquo;s instructions. Briefly, 20\\u0026ndash;30 mg tissue was homogenized in extraction buffer using a Qiagen TissueLyser II (30 Hz for 5 min) followed by centrifugation at 10,000 \\u0026times;g for 5 minutes. The supernatant was collected and dried in a vacuum concentrator overnight. The lipid pellet was then dissolved in 200 \\u0026micro;l assay buffer. Total cholesterol consisting of free cholesterol and cholesterol esters was then quantified using a colorimetric assay kit (Cholesterol/Cholesteryl Ester Assay Kit, ab65359, Abcam) according to the manufacturer\\u0026rsquo;s protocol. Total cholesterol from serum was quantified using the colorimetric assay without further sample preparation. Absorbance was measured at OD 570 nm. The cholesterol levels were quantified based on a standard curve and normalized to the wet weight of the specific tissue analyzed.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eQuantification of viral genomes in tissue\\u003c/h2\\u003e \\u003cp\\u003eApproximately 10\\u0026ndash;20 mg tissue from the cerebrum, lung, liver, and spleen was homogenized in RNeasy Lysis Buffer with β-mercaptoethanol, and the DNA and RNA (gene expression analysis, see next section) were purified using the AllPrep DNA/RNA Mini Kit (Qiagen, #80204) according to the manufacturer\\u0026rsquo;s protocol. The purity and quantity of the DNA and RNA were assessed by a spectrophotometer DS-11 (DeNovix). To analyze the organ distribution of the AAV-BR1-NPC2 vector, absolute qPCR was used to quantify the number of vg. See the section \\u0026ldquo;Production of recombinant viral vectors\\u0026rdquo; for the qPCR protocol. 100 ng DNA was used for each sample, which was run in triplicates. The quantification of vg was generated using a standard curve based on plasmid DNA encoding the CAG promoter as previously described [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Data are reported as vg/100ng total DNA.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eNpc2\\u003c/b\\u003e \\u003cb\\u003egene expression analysis\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eRNA, extracted from the cerebrum, liver, lung, and spleen as described above, was treated with DNase I enzyme (Thermo Fischer Scientific, #EN0521) to remove genomic DNA contamination. 100 ng DNA-free RNA was used as the template for the cDNA synthesis, which was performed as previously described [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. The \\u003cem\\u003eNpc2\\u003c/em\\u003e gene expression was analyzed using a probe-based multiplex RT-qPCR with Taqman Fast Advanced Master Mix (Thermo Fischer Scientific, #4444556), FAM conjugated mouse \\u003cem\\u003eNpc2\\u003c/em\\u003e primer-probe mix (Thermo Fischer Scientific, #4331182, assay ID: Mm00499230_m1), and VIC-conjugated mouse hypoxanthine phosphoribosyltransferase (\\u003cem\\u003eHprt1)\\u003c/em\\u003e primer-probe mix (Thermo Fischer Scientific, #4448490, assay ID: Hs02800695_m1). \\u003cem\\u003eHprt1\\u003c/em\\u003e was used as the reference gene. 5 ng cDNA was used in the PCR reaction, for qPCR specifications see [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Finally, the relative gene expression ratios of \\u003cem\\u003eNpc2\\u003c/em\\u003e were calculated using the delta-delta threshold cycle (Ct) method with the WT control mice as the reference sample.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eMALDI mass spectrometry imaging\\u003c/h2\\u003e \\u003cp\\u003eThe halved mouse brains selected for MALDI MSI were initially wrapped in aluminum foil and snap-frozen in 70% ethanol on a dry ice bath. The high lipid content of \\u003cem\\u003eNpc2 -/-\\u003c/em\\u003e mouse brains made them extremely soft, preventing them from adhering to the Optimal Cutting Temperature compound (OCT, VWR chemicals), thereby making them prone to damage during sectioning. This resulted in the loss of some brains and consequently a reduction in the samples analyzed (from n\\u0026thinsp;=\\u0026thinsp;6\\u0026ndash;7/group to n\\u0026thinsp;=\\u0026thinsp;4\\u0026ndash;5/group). To address these challenges, the brains were embedded to facilitate effective sectioning. The frozen brains were submerged in a precooled 4% w/v carboxymethyl cellulose gel (CMC, Mw\\u0026thinsp;~\\u0026thinsp;700,000, Sigma-Aldrich) to provide the necessary structural support for sectioning. The embedded brains were then re-frozen in 70% ethanol on a dry ice bath and stored at -80\\u0026deg;C until further use.\\u003c/p\\u003e \\u003cp\\u003eThe CMC-embedded half brains were sectioned at 10 \\u0026micro;m thickness using a cryostat (Leica CM1860, Leica Biosystems) at a chamber temperature of -27\\u0026deg;C. Individual sections were thaw-mounted onto IntelliSlides (Bruker Daltonics, Bremen, Germany). The glass slides were stored at -80\\u0026deg;C until further use.\\u003c/p\\u003e \\u003cp\\u003eThe matrix, 2.5-dihydroxy acetophenone (DHAP) (70% ethanol, 0.1% TFA), was sprayed using a HTX sprayer. The spraying parameters are detailed in Supplementary Table SII. Data were acquired on a timsTOF flex MALDI-2 mass spectrometer (Bruker Daltonics, Bremen, Germany), operated in negative mode, in tims-ON mode. The mass range was set between 500\\u0026ndash;2300 m/z with a spatial resolution of 20 \\u0026micro;m and 180 laser shots per pixel. The tims mobility scan range was set to 0.13\\u0026ndash;2.68 1/k0 with a ramp time of 300 ms. For all experiments, the laser was operated in MALDI mode with a repetition rate of 10 kHz. All data were directly uploaded and processed in SCiLS Lab (version 2024b Pro). All data shown (ion images and spectra) were normalized to the root mean square (RMS). Feature annotation was done through Metaboscape (Bruker Daltonics, Bremen, Germany) using exact mass (\\u0026lt;\\u0026thinsp;10 ppm mass error) and collisional cross-section (CCS) values for identification.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eThe sample size was calculated by power analysis using the G*Power software (version 3.1.9.2). The sample size was calculated using an effect size of 1.5, which was based on previous studies evaluating the effect of gene therapy on motor coordination in NP-C mice [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e]. The power and significance level of the experiment was set to 80% and 0.05, respectively. Nine mice per group were considered necessary. A loss of 10% of the mice was expected based on the humane endpoints, and therefore 10 mice were included in each group. All data sets were analyzed by the D\\u0026rsquo;Agostino-Pearson test to verify if the data followed a Gaussian distribution and tested for equal variances by the Brown-Forsythe test. If the data sets passed these tests, a one-way ANOVA with Tukey\\u0026rsquo;s post hoc analysis was applied. Otherwise, the data sets were log-transformed. If the data sets still did not pass the parametric criteria, the Kruskal-Wallis test with Dunn\\u0026rsquo;s multiple comparisons was applied. The details of the specific statistical analysis used are reported in figure legends. All statistical analyses were two-sided. A p-value of \\u0026le;\\u0026thinsp;0.05 was considered statistically significant. Data are reported as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation (SD) if not stated otherwise. All statistical analyses were done using GraphPad Prism version 9.4.1.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e \\u003cb\\u003eThe AAV-BR1-NPC2 vector effectively transduces mBECs\\u003c/b\\u003e \\u003cb\\u003ein vitro\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eThe function of the AAV-BR1-NPC2 viral vector was assessed in a murine \\u003cem\\u003ein vitro\\u003c/em\\u003e BBB non-contact co-culture model. The expression of NPC2 was examined four days after AAV-BR1-NPC2 transduction of mBECs using immunocytochemistry (Fig. \\u003cspan refid=\\\"MOESM2\\\" class=\\\"InternalRef\\\"\\u003eS2\\u003c/span\\u003eA). A high expression of NPC2 was evident in transduced mBECs. In contrast, it was not possible to detect NPC2 in non-transduced mBECs. Furthermore, the integrity of the \\u003cem\\u003ein vitro\\u003c/em\\u003e BBB model was evaluated before the transduction, 24 hours later, and at the end of the study (four days after transduction). There was no significant difference in the TEER values when comparing the mBECs transduced with the AAV-BR1-NPC2 vector to non-transduced mBECs (Fig. \\u003cspan refid=\\\"MOESM2\\\" class=\\\"InternalRef\\\"\\u003eS2\\u003c/span\\u003eB), showing that neither viral transduction itself nor expression of NPC2 did affect the barrier integrity of primary BECs.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eGrowth retardation is evident in\\u003c/b\\u003e \\u003cb\\u003eNpc2\\u003c/b\\u003e\\u003cb\\u003e-/- mice.\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eA single intravenous dose of 1.6 x 10\\u003csup\\u003e11\\u003c/sup\\u003e vg of the AAV-BR1-NPC2 vector was administered to six-week-old \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice. At the time of treatment, there was no visible difference between WT (\\u003cem\\u003eNpc2\\u003c/em\\u003e+/+) and \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice. The body weight was comparable, and none of the NPC2-deficient mice had developed any clinical symptoms (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). Furthermore, until the time point of treatment, all \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice showed normal growth by increasing their body weight by more than 30% from 4\\u0026ndash;6 weeks of age, similar to their WT littermates (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA and B), which is in line with previous reports [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. From six to 12 weeks of age, both untreated and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice revealed growth retardation with only an 8% increase in body weight compared to 22% in WT mice (\\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mean\\u0026thinsp;=\\u0026thinsp;8.2\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;7.5%, AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mean\\u0026thinsp;=\\u0026thinsp;8.5\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;7.8%, \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ mean\\u0026thinsp;=\\u0026thinsp;22.8\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;4.2%) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA and B). At the end of the study, at 12 weeks of age, untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- and AAV-BR1-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice weighed 15% and 12% less than WT mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA and B). AAV-BR1-NPC2-treatment did not improve growth retardation associated with the NPC2 deficiency. A single untreated female \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mouse was euthanized at 10\\u0026frac12; weeks of age due to a 20% weight loss, defined as humane endpoints, meaning that the data set from 11 weeks of age only includes n\\u0026thinsp;=\\u0026thinsp;8 \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice in the untreated group.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAAV-BR1-NPC2 gene therapy improves motor impairment\\u003c/h2\\u003e \\u003cp\\u003eTo evaluate the effect of the AAV-BR1-NPC2 treatment on the NP-C2 phenotype, locomotor impairment, and disease progression, a composite phenotype score, rotarod performance, and gait analysis were performed (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC-G). The composite phenotype score was evaluated when the mice were 6, 9, and 12 weeks of age. The following seven parameters were included in the phenotype scoring scheme: ledge test, hind limb clasping, kyphosis, tremor, gait, grooming, and explorative behavior (Supplemental Table\\u0026nbsp;1). As mentioned earlier, it was impossible to distinguish between \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- and \\u003cem\\u003eNpc2+/+\\u003c/em\\u003e mice when comparing the gait pattern and phenotype at six weeks of age when the treatment was initiated. At six weeks of age, all mice received a composite phenotype score of 0 or 1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC), and the gait analysis for all three groups revealed a normal walking pattern with the hind paws placed close to the front paws, and all mice were walking in a straight line (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE). At eight weeks of age, the first neurological symptoms characterized by tremors appeared in untreated and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice. Even though the symptoms were mild and not present in all NPC2-deficient mice, all \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice had trouble walking on the cage\\u0026rsquo;s ledge at eight weeks of age (data not shown, but similar to what has been reported previously [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]). The tremor became more visible at nine weeks of age for both untreated and treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, which were visualized during the gait (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE). The gait was characterized by the paws pointing away from the body during locomotion, also known as \\u0026ldquo;duck-feet\\u0026rdquo;. The symptoms became more pronounced from nine to 12 weeks of age. At 12 weeks of age, the AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/-mice showed a less severe disease phenotype compared to the untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, resulting in only the untreated mice being significantly different from the WT mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC). The untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice were severely challenged concerning coordination and balance. This became evident, especially during the ledge test (all receiving a score of 2) and gait analysis, where the mice dragged their hind limbs, and severe ataxia was present (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC-E, 12 weeks). Untreated 12 weeks old \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice received a higher composite phenotype score compared to AAV-BR1-NPC2 treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (\\u003cem\\u003eNpc2\\u003c/em\\u003e-/-: median 7.5 (IQR 7\\u0026ndash;8), AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/-: median 4.5 (IQR 4-5.75), \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+: median 0 (IQR 0-0.75)), where 50% of the treated mice only received a score of 1 in the ledge test, revealing a beneficial effect of the AAV-BR1-NPC2 treatment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC-E).\\u003c/p\\u003e \\u003cp\\u003eThe therapeutic potential of gene therapy on the disease phenotype is also shown in videos 1\\u0026ndash;5 (supplemental information) and depicted using video stills of the aforementioned videos comparing the \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- and the AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice\\u0026rsquo;s performance on the ledge test to their WT littermates (all receiving the score of 0 in the ledge test) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD). Even though severe neurological symptoms were evident at 12 weeks of age, none of the \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice developed limb clasping during the study period, which usually is a pathological hallmark for NP-C mouse models [\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e]. As the disease approached the end stage, the motor symptoms became progressively more severe, especially in untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, and euthanasia was performed at 12 weeks of age for humane reasons.\\u003c/p\\u003e \\u003cp\\u003eNPC2 deficiency is associated with severe locomotor impairment. To assess the therapeutic effect of the AAV-BR1 gene therapy, rotarod performance was evaluated once a week from five weeks of age. The average time each group spent on the rotarod is indicated in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eF. Until eight weeks of age, there was no significant difference in the time spent on the rotarod when comparing the \\u003cem\\u003eNpc2\\u003c/em\\u003e-/-, AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/-, and \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ mice. However, at eight weeks of age, all \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice started to develop mild tremors independent of treatment status, which correlated with their performance on the rotarod. Even though there were no significant differences between untreated and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice when comparing their performance on the rotarod over time, only one out of eight \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice was able to walk on the rotarod at 12 weeks of age (latency to fall: 1.5\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;4.24 sec). However, six out of 10 AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice could perform on the rotarod at the end of the study (latency to fall: 11.8\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;12.22 sec) indicating a positive effect of the AAV-BR1-NPC2 treatment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eG). Based on these observations the AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice were divided into a high (6/10 mice) and a low (4/10 mice) responder group.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDistribution of the AAV-BR1 vector and recombinant NPC2 expression\\u003c/h2\\u003e \\u003cp\\u003eOur previous study in healthy BALB/cJRj mice found that the AAV-BR1-NPC2-eGFP vector was primarily distributed to the brain and lung tissue [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. We, therefore, analyzed the presence of the AAV-BR1 vector in the AAV-BR1 NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice in different organs and found that the AAV-BR1 vector accumulated in the brain, lung, and splenic tissue after intravenous injection (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). We subsequently measured the \\u003cem\\u003eNpc2\\u003c/em\\u003e gene expression in these organs and compared it to the levels found in untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- and WT littermates. No detectable increase in \\u003cem\\u003eNpc2\\u003c/em\\u003e gene expression was seen in the spleen when compared to untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (data not shown), suggesting unspecific uptake of the AAV-BR1 vectors in the reticuloendothelial system as previously described [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. The high accumulation of the AAV-BR1-NPC2 vector in the brain resulted in an increase in the \\u003cem\\u003eNpc2\\u003c/em\\u003e gene expression in the brain of AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice to a level no longer significantly different from the \\u003cem\\u003eNpc2+/+\\u003c/em\\u003e mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB). In contrast, only a slight increase in the \\u003cem\\u003eNpc2\\u003c/em\\u003e gene expression was seen in the lung tissue after AAV-BR1 treatment, despite high accumulation of the AAV-BR1 vector in the lung (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA and B).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eBBB-directed gene therapy is unable to alleviate visceral pathology.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eIt has previously been shown that transduction of the BECs \\u003cem\\u003ein vitro\\u003c/em\\u003e results in a bi-directional secretion of the therapeutic protein of interest, meaning that the protein potentially is available for the peripheral organs [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Additionally, as just described we observed accumulation of the AAV-BR1 vector in the lung tissue (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA), resulting in an increased \\u003cem\\u003eNpc2\\u003c/em\\u003e gene expression (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB). Thus, the visceral pathology of the organs severely affected by the NPC2 deficiency was investigated. First, the weight of the brain, liver, lung, and spleen was analyzed to assess whether gene therapy at the BBB can reverse the disease-related manifestations, e.g., brain atrophy and hepatosplenomegaly, often associated with the NP-C2 [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e]. Despite a higher \\u003cem\\u003eNpc2\\u003c/em\\u003e gene expression, the AAV-BR1-NPC2 treatment could not hinder atrophy of the brain (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC). The brain size of untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice were significantly reduced by 12.3% (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) and 9.0% (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.0003), respectively, compared to age-matched \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ littermates (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC). No significant difference in the size of the liver was seen when comparing the three groups, meaning that hepatomegaly was not present at 12 weeks of age (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC). However, the lung and spleen were severely enlarged in \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice independent of treatment status compared to WT mice. No obvious relationship was observed concerning organ sizes between high and low-responder animals.\\u003c/p\\u003e \\u003cp\\u003eSevere accumulation of cholesterol, a hallmark of NP-C, has previously been reported in the liver, spleen, and lung tissue of NPC2-deficient mice [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e]. We, therefore, also evaluated whether gene therapy could reduce cholesterol storage in the dissected visceral organs and in serum using quantitative measurements. There was no significant difference in total cholesterol in the liver and lung when comparing the untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice with AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, however, both groups had significantly higher cholesterol levels compared to their WT littermate (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). The total cholesterol levels in the spleen were significantly lower in NPC2-deficient mice receiving AAV-BR1-NPC2 treatment compared to untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.0089), though not reaching levels comparable to the WT littermates (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). In addition, the increased weight of the lung and spleen of untreated and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice correlated with an increase in cholesterol storage (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC-D). Despite no significant difference observed in the weight of the liver when comparing the three groups; WT, untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, the liver cholesterol concentration was significantly increased in untreated and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). This corresponded well with the macroscopic findings of the liver tissue, e.g., being more friable upon dissection (data not shown). In general, however, there seem to be lower cholesterol levels in the liver and spleen in the high responder group (3/4 high responder mice) compared to the low responder group (3 mice) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD), suggesting some visceral effects of the secreted NPC2. No differences were observed in serum cholesterol concentrations between the three groups (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eE).\\u003c/p\\u003e \\u003cp\\u003eThe total cholesterol concentrations measured corresponded well with the pathology seen in the same peripheral organs evaluated with hematoxylin and eosin staining (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eF). During the blind evaluation of tissue cholesterol storage, it was not possible to distinguish between untreated and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (both high and low responders), and all organs were severely affected compared to WT littermates. In both groups of NPC2-deficient mice, an accumulation of foam cells in the liver, spleen, and lung was observed. The liver pathology in \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice varied, with changes ranging from a few clusters of foamy macrophages scattered in the liver tissue to severe accumulation of foam cells, independent of the treatment group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eF, top panel). The lung tissue in \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice was characterized by intra-alveolar accumulation of foam cells and eosinophilic material corresponding to alveolar proteinosis (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eF mid panel). The spleen tissue was also severely affected, with massive infiltration of foam cells disturbing the typical histoanatomical architecture (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eF, bottom panel).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eRecombinant NPC2 distribution in the brain\\u003c/h2\\u003e \\u003cp\\u003eThe distribution of NPC2 in the brain after transduction with the AAV-BR1-NPC2 vector was then evaluated with immunohistochemistry. As expected, it was not possible to detect NPC2 in the brain of untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA-B). Oppositely, intravenous injection with the AAV-BR1-NPC2 vector resulted in a substantial number of NPC2-positive cells, especially in the cerebral cortex, the hippocampus, as well as in the deep cerebellar nuclei. In addition, NPC2-immunoreactive neurons were also observed in the striatum, thalamus, hypothalamus, red nucleus in the midbrain, pons, and medulla (data not shown). Mainly neuronal cells were intensively stained, but weak staining of several brain capillaries was also apparent in all brain regions (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA, bottom panel). In the cerebellum of AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, NPC2 immunoreactivity was generally seen in the few remaining Purkinje cells, whereas higher NPC2 immunoreactivity was observed in neurons of the deep cerebellar nuclei (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB). The neuronal labeling was characterized by a perinuclear appearance with labeling extending into the axons and proximal dendrites. In comparison, Purkinje cells and neurons in the deep cerebellar nuclei were only weakly labeled in the \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ mice. More intense granular staining was seen in cells in close vicinity to the Purkinje cells, probably corresponding to Bergmann glial cells [\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e] (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB). NPC2-immunoreactive cells with morphology corresponding to astrocytes, microglia, or oligodendrocytes were not observed. When looking further into the seemingly low number of NPC2 positive capillaries, using fluorescent immunostaining with tyramid enhancement of NPC2 and counterstaining these with tomato lectin to label the vasculature, areas with many NPC2 positive capillaries are scattered throughout the brain, but especially obvious in the cerebral cortex and striatum (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC). However, several areas of NPC2-positive neuronal cells and NPC2-negative capillaries are also evident, especially in cortex cerebri, hippocampus, and cerebellum. Tomato lectin also labels microglia, which is especially evident in the cerebellar cortex (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003ePurkinje cell degeneration is delayed after AAV-BR1-NPC2 treatment.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe motor impairment seen in NP-C correlates to Purkinje cell degeneration [\\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e]. The immunoreactivity of the Purkinje cell marker, Calbindin D-28k, was evaluated at the end-stage of the disease to assess the effect of gene therapy on Purkinje cell survival. In 12-week-old untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, an extensive loss of Purkinje cells in the cerebellum was observed compared to age-matched WT mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA-B). Axonal swellings were seen in the remaining Purkinje cells of both untreated and treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB, arrowheads). Purkinje cells in lobules IX and X were preserved. When analyzing cerebellar sections from AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice belonging to the high responder group (4 out of 8 mice assessed), more Purkinje cells could be detected, especially in the flocculus and paraflocculus (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA, bottom panel), indicating delayed Purkinje cell degeneration in the high responder group. The low responders were indistinguishable from the untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eNeuroinflammation in the cerebral cortex and hippocampus is reduced after AAV-BR1-NPC2 treatment.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eNeuroinflammation in the cerebral cortex and hippocampus, assessed by immunolabeling of astrocytes and microglial cells, was diminished in the majority of the AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (high responders) (4 out of 7 mice assessed) when compared to untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA). It was especially evident in neocortical regions situated just above the corpus callosum. This distribution pattern was apparent for both astrocytes and microglia as evaluated using the astrocytic and microglial markers GFAP and IBA1, respectively, and indicates that AAV-BR1-NPC2 gene therapy could induce a localized reduction in both astrogliosis and reactive microglia. In the hippocampus, the tendency was identical with seemingly fewer astrocytes and microglia in the hippocampal cortical areas CA1-CA4 and dentate gyrus in the high responder group. When determining the density of astrocytes and microglia in both the cerebral cortex (neocortical region) and the hippocampus (CA3 region) we found an increased number of both astrocytes and microglia in both regions compared to the WT littermates (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eB and C). When the \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice were treated with the AAV-BR1 vector, the neuroinflammation was reduced compared to untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice. The density of the astrocytes was generally lower in the high-responder mice compared to the low-responder mice in both the cortex and hippocampus (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eB). However, the increased number of astrocytes and microglia did not reflect the neuroinflammatory status alone, as the neuroinflammatory cells also underwent morphological changes. The GFAP-positive astrocytes underwent hypertrophy of their peripheral processes, and microglia characteristically displayed an enlarged soma with short and thickened processes characteristically of activation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA and S3) [\\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e53\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eIn the cerebellum, the Purkinje cell degeneration was accompanied by severe neuroinflammation in both groups of \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (Fig. \\u003cspan refid=\\\"MOESM3\\\" class=\\\"InternalRef\\\"\\u003eS3\\u003c/span\\u003e). Diffuse astrogliosis and microgliosis were evident in both untreated and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- groups, and it was not possible to distinguish untreated and treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice concerning neuroinflammation in the cerebellum and deep cerebellar nuclei. No evidence of neuroinflammation was seen in WT mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA and S3).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eNeuronal cholesterol accumulation in the cerebral cortex and hippocampus is reduced after AAV-BR1-NPC2 treatment.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eCholesterol accumulation in the cerebral cortex, hippocampus, and cerebellum was visualized using Filipin, a fluorescent antibiotic that specifically binds unesterified cholesterol [\\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e54\\u003c/span\\u003e]. Compared to untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, the cholesterol accumulation was reduced in the cerebral cortex and the CA3 region of the hippocampus in 3/4 AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003e) leading to an appearance with great similarity to that found in the WT littermates. Cellular cholesterol accumulation in the untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice was primarily seen in the perinuclear cytoplasmic region, corresponding to the lysosomal compartment. However, in the WT littermates and AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e mice, the cellular localization of cholesterol was primarily distributed to the cellular membrane, which was especially obvious in the hippocampus (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003e). It was not possible to differentiate between the untreated and the AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice when assessing cholesterol accumulation in cortex cerebelli, as cholesterol material was seen in all layers of the cerebellum. However, in the deep cerebellar nucleus, the cellular localization of cholesterol again seemed to have redistributed to the cellular membrane in the AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e mice, instead of the perinuclear region as seen in the untreated mice. None to low levels of cholesterol was observed in WT mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eAs reduced cholesterol accumulation seems to be highly correlated to areas with a high presence of NPC2-positive cells, we aimed for co-detection of cholesterol and NPC2 combining Filipin detection and immunohistochemistry with a focus on the cerebral cortex and CA3 region of the hippocampus in the high responder group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003e). In the cortex cerebri of untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, NeuN-positive neurons had a high accumulation of cholesterol. In the AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, NPC2 immunoreactivity was verified in neurons judged from the simultaneous appearance of NeuN-labeling. Superimposing the immunolabeled images with Filipin staining, it was evident that neurons were cholesterol-containing, but to a much lower extent than seen in untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003e). Correspondingly, the high number of NPC2-positive neurons found in the CA3 region of the hippocampus in the high responder AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice almost completely reversed the cholesterol accumulation after treatment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003e). Of note, the number of NPC2-labeled neurons after treatment was obviously lower than that of cholesterol-negative cells in both the cerebral cortex and hippocampus. This suggests that secreted NPC2 from AAV-BR1-NPC2 transduced neurons and BECs alleviated cholesterol accumulation in non-transduced neighboring cells, equivalent to neuronal cross-correction [\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. The latter is concurrent with the previous observation that NPC2 is taken up and rescues NPC2 deficient cells in the liver, spleen, and other peripheral organs after intravenous administration [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]. Ingested NPC2 might mobilize excess cholesterol from lysosomes, e.g. by facilitating lysosomal exocytosis, release of extracellular vesicles, and efflux to apoproteins, as has been shown in cell cultures [\\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e55\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e56\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec22\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eTherapeutic impact of AAV-BR1-NPC2 treatment on ganglioside composition in the brain\\u003c/h2\\u003e \\u003cp\\u003eIn addition to cholesterol accumulation, intracellular accumulation of the gangliosides GM2 and GM3 in NP-C has previously been shown to contribute to the neuropathological cascade that ultimately leads to cell death [\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e57\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR58\\\" class=\\\"CitationRef\\\"\\u003e58\\u003c/span\\u003e]. These earlier studies focused on NPC1-deficient mice, whereas alterations in glycosphingolipids in the NPC2-mutant background are poorly characterized. MSI was therefore used to evaluate the GM2 and GM3 ganglioside profiles in all three experimental groups.\\u003c/p\\u003e \\u003cp\\u003eUsing an unsupervised bi-sectioning k-means segmentation model, distinct regions in the mouse brain were identified based on unique lipid profiles. The tissue sections exhibited clear segmentation patterns, with regions of interest (ROIs) distinctly marked by orange and green segments (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003eA). These segments revealed notable differences in lipid compositions between \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ and \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, with altered profiles particularly prominent in regions commonly affected by NP-C2 pathology, such as the cerebellum and hippocampus [\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e]. In AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, high responders (first four brains from the left) showed partial normalization of ganglioside distribution and lipid profiles, with a MALDI mass spectra more closely resembling those of \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ WT (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003eA). In contrast, the low-responder mouse (first from the right) and a single high-responder mouse (second from the right) displayed segmentation patterns more closely aligned with untreated \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e mice, indicating a reduced therapeutic effect, with minimal changes in lipid composition observed in these mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003eA). Segmentation analysis further revealed similarities between the brains of high responders (3/4 mice) and \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ mice in the orange and green segmentations (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003eA), suggesting a reversal of some lipid alterations and potentially mitigating an inflammatory and neurodegenerative process [\\u003cspan citationid=\\\"CR59\\\" class=\\\"CitationRef\\\"\\u003e59\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e60\\u003c/span\\u003e]. Mass spectra extracted from these segmented regions highlighted significant lipid differences between genotypes and treatment groups. \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice exhibited distinct lipid signatures, with elevated levels of GM2 and GM3 gangliosides. Specifically, GM2 species at m/z 1381.81 (d18:1/18:0) and 1410.84 (d20:1/18:0), along with GM3 species at m/z 1207.76 (d20:1/18:0), were markedly increased in ROIs (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003eB), a phenotype previously associated with neuroinflammation and neurodegeneration in other lysosomal storage disorders [\\u003cspan citationid=\\\"CR61\\\" class=\\\"CitationRef\\\"\\u003e61\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR62\\\" class=\\\"CitationRef\\\"\\u003e62\\u003c/span\\u003e]. These alterations can be visualized in the MALDI images, where ganglioside accumulation is mapped across the cortex, hippocampus, and cerebellum (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003eC). WT \\u003cem\\u003eNpc2+/+\\u003c/em\\u003e mice show low to no accumulation of gangliosides in the cortex, hippocampus, and cerebellum, compared to untreated \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e mice, where high accumulation is present in all three brain regions, corresponding well to previous observations in Npc1-/- mice [\\u003cspan citationid=\\\"CR63\\\" class=\\\"CitationRef\\\"\\u003e63\\u003c/span\\u003e]. The low-responder mice likewise show an accumulation of gangliosides in all three brain areas, while high-responders (3/4 mice) show less accumulation, especially in the cortex and hippocampus (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003eC). Quantification of ganglioside intensities further confirmed these differences. Significant increases in GM2 and GM3 levels were observed in all untreated \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e mice compared to WT \\u003cem\\u003eNpc2+/+\\u003c/em\\u003e mice. AAV-BR1-NPC2 treatment highly reduced ganglioside accumulation in three out of four high responders in all three areas of the brain (9D), while one of the high responders was comparable to the low-responder mice and non-treated \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e mice, highlighting the variability in treatment efficacy (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003eD).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eWe show that BBB-directed gene therapy using the AAV-BR1 vector was able to delay disease progression in the NPC2-deficient mouse model. The slower progression of neurological symptoms was shown by improved locomotor function and lower composite phenotype score in AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice compared to untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice. This was evident in the high responder group corresponding to 60% of the AAV-BR1-NPC2-treated mice. The behavioral findings corresponded well to a widespread expression of NPC2 in the brain, a delay in Purkinje cell degeneration, and a reduction in neuroinflammation and partial reversal of some lipid alterations (cholesterol and gangliosides) in the neocortex.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec24\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eThe AAV-BR1-NPC2 vector both transduces BECs and passes the BBB\\u003c/h2\\u003e \\u003cp\\u003eThe distribution pattern of NPC2 in the neurons was similar to our previous study investigating the AAV-BR1-NPC2 in healthy BALB/cJRj mice [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Here the AAV-BR1 vector was designed to produce two separate proteins; enhanced green fluorescent protein (eGFP) and NPC2, where the eGFP accumulated intracellularly as an indicator of cellular transduction. However, also neuronal cells expressed eGFP, indicating that some of the systemically injected AAV-BR1 vector undergoes transport across the BBB leading to neuronal transduction [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. In our previous study in healthy mice, we further examined the possibility of AAV-BR1 vector transport across other brain barriers, e.g., the blood-cerebrospinal fluid barrier (BCSFB), but found no evidence to support this [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Furthermore, it seems unlikely that the widespread distribution of NPC2 throughout the brain, including the cerebral cortex, could be achieved through BCSFB transport.\\u003c/p\\u003e \\u003cp\\u003eComparable with the previous study in healthy mice, we here show a presence of NPC2 in neuronal cells of the cerebral cortex and hippocampus, and in several neurons in the brainstem, including pons and medulla oblongata. The latter deviates from our previous study that observed only weak eGFP staining or complete absence in neurons in the brainstem [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e], which indicates that the widespread neuronal NPC2 distribution could be caused by the uptake of NPC2 from adjacent genetically modified cells or specific transduction of these neurons by the AAV-BR1 vector. Despite the high occurrence of NPC2-positive neurons, areas with many NPC2-positive BECs were also observed, suggesting that the AAV-BR1 vector is indeed specific toward the BBB. Interestingly though, in areas with many NPC2-positive neurons, we rarely observed a high occurrence of NPC2-positive capillaries, suggesting that the vector had transversed the BBB to transduce neurons in these areas. The mechanism of this BBB passage remains unknown. We are, in this study not able to distinguish between genetically modified cells, that produce NPC2, and enzyme-deficient cells that have taken up NPC2, but it seems unlikely that the uptake of NPC2 would be so heterogeneous and high in some neurons that it would mask transduced BECs expected to have a high production of NPC2.\\u003c/p\\u003e \\u003cp\\u003eFurthermore, when examining the correlation between the distribution of NPC2 and cholesterol storage in both the cerebral cortex and hippocampus, a clear reduction in cholesterol accumulation was seen in NPC2-positive neurons but also neighboring NPC2-negative cells, emphasizing the possibility of cross-correction after BBB-directed gene therapy. The heterogeneous, albeit substantial, neuronal presence of NPC2, might also be a reflection of cation-independent M6PR mediated uptake of the mannose 6-phosphate tagged NPC2 [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e], as the cation-independent M6PR also distributes to neurons quite heterogeneously in the brain with a predominantly high occurrence in deep layers of the cortex (e.g., pyramidal neurons in layer V), neurons of the hippocampus, striatum, selected nuclei in the thalamus, Purkinje cells of the cerebellum, the deep cerebellar nuclei, red nucleus, pontine nucleus, and motor neurons of the brainstem [\\u003cspan citationid=\\\"CR64\\\" class=\\\"CitationRef\\\"\\u003e64\\u003c/span\\u003e], corresponding well to the areas where NPC2-positive neurons are observed.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec25\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003eAAV-BR1 gene therapy lowers brain deposition of lipids, and neuroinflammation and improves behavioral outcome\\u003c/h2\\u003e \\u003cp\\u003eIn the present study, treatment of \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice did not hinder the development of tremors but slowed the disease progression. Six out of ten of the AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice maintained the capability to perform on the accelerating rotarod at the end-stage of the disease compared to only one out of eight in the untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- group. This has also been observed in other studies using the AAV-BR1 vector to treat BBB-associated diseases, e.g., Incontinentia pigmenti and the lysosomal storage disorder Sandhoff disease [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. Using the brain-specific AAV-BR1 vector, it was possible to avoid the development of epileptic seizures in one-third of the treated mice suffering from Incontinentia pigmenti [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. Likewise, 4/8 of the AAV-BR1 treated \\u003cem\\u003eHEXb-/-\\u003c/em\\u003e mice showed no impairment in motor function evaluated using rotarod at a constant speed (5 r/min for 5 minutes) [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. The variability in the treatment efficacy amongst the \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice corresponds to the variability in the transduction rate. Subsequently, the high responders, with an improved phenotype, also showed multiple NPC2-positive neurons and BECs, in contrast to the low responders, with only a few NPC2-positive cells in the brain.\\u003c/p\\u003e \\u003cp\\u003eWidespread Purkinje cell degeneration is a hallmark of brain pathology in patients with NP-C [\\u003cspan citationid=\\\"CR65\\\" class=\\\"CitationRef\\\"\\u003e65\\u003c/span\\u003e] which is associated with the motor impairment observed [\\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e]. Purkinje cell degeneration was also evident in the NPC2-deficient mouse model used in the present study [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e] and correlated well with the inability to perform on the rotarod at the end-stage of the disease. The AAV-BR1-NPC2 treatment initiated at six weeks of age resulted in the preservation of Purkinje cells in half of the assessed \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (high responders) (4/8 mice), which was especially evident in the paraflocculus and flocculus. In contrast, an almost complete loss of Purkinje cells was seen in the paraflocculus and flocculus of untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice. Interestingly, these areas together with lobules IX and X are known to degenerate late in the disease [\\u003cspan additionalcitationids=\\\"CR66\\\" citationid=\\\"CR65\\\" class=\\\"CitationRef\\\"\\u003e65\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR67\\\" class=\\\"CitationRef\\\"\\u003e67\\u003c/span\\u003e], suggesting that the preservation of Purkinje cells in these particular areas after treatment with the AAV-BR1 vector is due to a delay in the disease progression. There was a clear correlation between the preservation of Purkinje cells, better performance on the rotarod, and a lower ledge test score. The ledge test is an important parameter when evaluating the therapeutic potential of the AAV-BR1-NPC2 vector as it provides the most direct comparison to human signs of cerebellar ataxia, another hallmark of the disease [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e]. Therapies affecting the ataxia phenotype in mice positively correlate to a reduction in the disease progression in patients [\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e]. Thus, the lower ledge test score and improved gait pattern seen in the \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice receiving gene therapy indicate a behaviorally therapeutic effect of the BBB-directed gene therapy.\\u003c/p\\u003e \\u003cp\\u003eThe Purkinje cell degeneration in the treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice was accompanied by widespread cerebellar gliosis, cholesterol storage, and ganglioside accumulation. In contrast, reduced neuroinflammation was seen in the cerebral cortex and hippocampus of the AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice (high responders). In addition, this particular group also showed normalization of cholesterol and GM2 and GM3 ganglioside levels, aligning more closely with the WT mice. This reduction in lipid accumulation likely reflects a therapeutic effect of NPC2, which helps restore lysosomal function, facilitating cholesterol and ganglioside clearance. The subsequent decrease in neuroinflammation in regions like the cerebral cortex and hippocampus in the high responder group suggests that the restoration of lipid homeostasis may mitigate the neurodegenerative processes, potentially slowing disease progression and improving motor function. \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e mice from the low responders, however, did not exhibit significant changes in lipid levels or neuroinflammation, further emphasizing the critical role of NPC2 delivery efficiency in determining therapeutic success.\\u003c/p\\u003e \\u003cp\\u003eIn our previous study, where the distribution of the AAV-BR1 vector was assessed in healthy BALB/cJRj mice after intravenous injection, most of the viral vectors were distributed to the cerebrum [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e], which may explain why only a slight correction was seen in the cerebellum compared to, e.g., the cerebral cortex. Distribution of NPC2 in the brain of AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice was evident in pyramidal neurons in the cerebral cortex and CA3 neurons in the hippocampus, accompanied by reduced neuroinflammation and lipid storage. These non-cerebellar areas, previously described as regions with severe neurodegeneration in both mouse models of NP-C and human NP-C [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e, \\u003cspan additionalcitationids=\\\"CR69\\\" citationid=\\\"CR68\\\" class=\\\"CitationRef\\\"\\u003e68\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR70\\\" class=\\\"CitationRef\\\"\\u003e70\\u003c/span\\u003e], display intracellular storage of lipids, especially in large pyramidal neurons in the cortex and CA3 neurons of the hippocampus [\\u003cspan citationid=\\\"CR70\\\" class=\\\"CitationRef\\\"\\u003e70\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR71\\\" class=\\\"CitationRef\\\"\\u003e71\\u003c/span\\u003e]. In a healthy brain, the NPC2 concentration is high in neurons of the cerebral neocortex, hippocampus, cerebellum, and deep cerebellar nuclei, indicating that these areas are particularly vulnerable to the disease [\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e]. Therefore, an increase in NPC2 in these regions could explain why the AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice have a less severe phenotype compared to the untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, despite the treatment not completely reversing the Purkinje cell degeneration.\\u003c/p\\u003e \\u003cp\\u003eIt is also assumed that even though severe Purkinje cell loss is evident, compensatory mechanisms in the deep cerebellar nuclei can result in only mild ataxia [\\u003cspan citationid=\\\"CR67\\\" class=\\\"CitationRef\\\"\\u003e67\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR72\\\" class=\\\"CitationRef\\\"\\u003e72\\u003c/span\\u003e]. A high NPC2 expression was seen in the cerebellar nuclei after treatment with the AAV-BR1-NPC2 vector, suggesting that the function of the neurons in the cerebellar nuclei is maintained. Due to impairment in the inhibitory signal from Purkinje cells, neuronal plasticity in the cerebellar nuclei could consequently enhance the intranuclear inhibition in the deep cerebellar nuclei resulting in improvement in motor performance [\\u003cspan citationid=\\\"CR72\\\" class=\\\"CitationRef\\\"\\u003e72\\u003c/span\\u003e]. This could explain why only mild ataxic gait was seen in AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice.\\u003c/p\\u003e \\u003cp\\u003eVariations were also observed in the high responder group with respect to the quantitative measurement of visceral cholesterol levels, and ganglioside accumulation in the brain. One of the high responder mice showed total cholesterol levels in the liver, lung, and spleen comparable to the low responder group and untreated \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). The same mouse showed brain lipid profiles comparable to untreated \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003eA) when analyzed by MSI. Despite no improvement in lipid accumulation, this mouse was able to perform on the rotarod at 12 weeks of age (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eG), probably due to the same reasons why one of the untreated \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e mice was still able to walk on the rotarod at 12 weeks, underlining the variability observed in this study.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eViral transduction with the AAV-BR1 vector fails to improve non-neurological symptoms.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003ePrevious \\u003cem\\u003ein vitro\\u003c/em\\u003e studies showed that transduction or transfection of primary BECs resulted in a bi-directional secretion of proteins [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Viral gene therapy introduced to the brain by stereotactic injection of AAV2 and AAV4 viruses to the ependyma of the lateral ventricle enabled therapeutic efficacy of the brain with secretion to the cerebrospinal fluid of further relevance for excretion to the peripheral blood with beneficial effects on visceral organs [\\u003cspan citationid=\\\"CR73\\\" class=\\\"CitationRef\\\"\\u003e73\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR74\\\" class=\\\"CitationRef\\\"\\u003e74\\u003c/span\\u003e]. In the present study, besides the spleen, no significant effect was seen in the prevention of cholesterol storage in the liver and lung, which challenges a strategy of BBB-directed gene therapy being able to treat symptoms from both the CNS and the periphery. In consequence, the AAV-BR1-NPC2 treatment was not able to reverse the growth retardation seen in the \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, which could be related to the severe pathology with cholesterol storage and inflammation observed in the visceral organs of both the AAV-BR1-NPC2-treated and untreated \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice. When the plasma NPC2 concentration was investigated after AAV-BR1-transduction of BECs in healthy mice [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e], it was not possible to detect an increase in blood NPC2 concentrations, substantiating the findings of the present study. However, in 3/4 high responder AAV-BR1-Npc2-/- treated mice, a prominent reduction in liver cholesterol was obvious, indicating some visceral effect perhaps due to higher NPC2 blood concentration. The same tendency was observed in the spleen, but not in the lungs of the same animals. The transduction efficacy of the AAV-BR1 vector was limited to the BECs, neurons, and the lungs underlining that any potential therapeutic effect observed in the liver could have originated from NPC2 secretion into the blood.\\u003c/p\\u003e \\u003cp\\u003eTransduction of lung tissue was considered advantageous in treating NP-C2 due to the severe lung involvement in NP-C2 patients [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR75\\\" class=\\\"CitationRef\\\"\\u003e75\\u003c/span\\u003e]. However, the presence of viral vectors in the lung tissue only resulted in an inadequate increase in the \\u003cem\\u003eNpc2\\u003c/em\\u003e gene expression, which did not reverse the severe lung pathology with pulmonary alveolar proteinosis and accumulation of foam cells. Intravenous injection with NPC2 purified from bovine milk was able to ameliorate the visceral pathology, including lung tissue, in \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]. Hence, a combination of NPC2 injections and a single injection with the AAV-BR1 vector intravenously might improve the therapeutic outcome by reversing both visceral and neuronal pathology in these mice.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec26\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003eStudy limitations\\u003c/h2\\u003e \\u003cp\\u003eOne could question whether the onset of treatment was too late. At six weeks of age, no symptoms were visible in the \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, however, it has previously been shown that cerebellar pathology, including Purkinje cell degeneration and neuroinflammation, is evident weeks before symptom development in NPC1-deficient mouse models [\\u003cspan citationid=\\\"CR65\\\" class=\\\"CitationRef\\\"\\u003e65\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR67\\\" class=\\\"CitationRef\\\"\\u003e67\\u003c/span\\u003e, \\u003cspan additionalcitationids=\\\"CR77\\\" citationid=\\\"CR76\\\" class=\\\"CitationRef\\\"\\u003e76\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR78\\\" class=\\\"CitationRef\\\"\\u003e78\\u003c/span\\u003e]. Despite a more severe disease progression in the NP-C1 mouse model, the pathological findings are comparable in NP-C2 [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR79\\\" class=\\\"CitationRef\\\"\\u003e79\\u003c/span\\u003e]., which is also supported by our previous findings investigating disease progression in these \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice. At six weeks of age, the Purkinje cells were affected or even lost in some of the mice, although there were large variations [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. It is therefore expected that Purkinje cells might already be irreversibly damaged at the time of treatment, which challenges the treatment even further. Studies treating NP-C1 mouse models using gene therapy have seen improvement in survival, neurological symptoms, and brain pathology after the administration of different serotypes of AAVs [\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e, \\u003cspan additionalcitationids=\\\"CR81 CR82\\\" citationid=\\\"CR80\\\" class=\\\"CitationRef\\\"\\u003e80\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR83\\\" class=\\\"CitationRef\\\"\\u003e83\\u003c/span\\u003e], however, all studies treat pre-symptomatically [\\u003cspan citationid=\\\"CR80\\\" class=\\\"CitationRef\\\"\\u003e80\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR81\\\" class=\\\"CitationRef\\\"\\u003e81\\u003c/span\\u003e], including the present study. The translational value is therefore questionable, due to the heterogeneity of the disease, where the age of onset and the clinical symptoms in humans vary. NP-C is often not diagnosed until after the onset of neurological symptoms [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR80\\\" class=\\\"CitationRef\\\"\\u003e80\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR82\\\" class=\\\"CitationRef\\\"\\u003e82\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR84\\\" class=\\\"CitationRef\\\"\\u003e84\\u003c/span\\u003e], why initiating treatment earlier than six weeks of age will not increase the translational value of the results.\\u003c/p\\u003e \\u003cp\\u003eThe NP-C2 mouse model is of great value due to its similarity with the pathology seen in patients suffering from NP-C2 presenting with both Purkinje cell degeneration, neuroinflammation, splenomegaly, and pulmonary alveolar proteinosis, all hallmarks of NP-C2 [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR65\\\" class=\\\"CitationRef\\\"\\u003e65\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR69\\\" class=\\\"CitationRef\\\"\\u003e69\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR75\\\" class=\\\"CitationRef\\\"\\u003e75\\u003c/span\\u003e]. However, the AAV-BR1 vector might not be the most optimal vector for treating NP-C2, since the vector more efficiently transduces cells of the cerebrum, instead of the cerebellum. The strategy of BBB-directed gene therapy has previously been questioned due to the potential side effects of the resulting high recombinant protein concentration in blood, which in cases with e.g., neurotropic factors, could result in pancreatic cancer [\\u003cspan citationid=\\\"CR85\\\" class=\\\"CitationRef\\\"\\u003e85\\u003c/span\\u003e]. However, no obvious reduction of peripheral clinical manifestations was evident, except for a lower cholesterol accumulation in the spleen and the liver in most of the high-responder animals, suggesting that the amount of recombinant protein secreted into the bloodstream might be insignificant. Directing the secretion of recombinant protein primarily to the abluminal side would however be of great value. Since the AAV-BR1 vector is highly brain-specific, able to cross the BBB, and transduce both BECs and neurons, especially in the cortex and hippocampus, it could have the potential to cure a range of other neurological diseases affecting the cerebral cortex and hippocampus, like Alzheimer's disease, even in conditions with an intact BBB. It should not be overlooked though that the brain-directed tropism of AAV-BR1 is specific to the mouse, necessitating further attempts to develop an equivalent viral vector for translational purposes in higher species, including humans [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e].\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eIn conclusion, a single intravenous injection with the AAV-BR1-NPC2 vector resulted in widespread NPC2 distribution throughout the brain, consequently improving the locomotor impairment and disease phenotype in a mouse model of NP-C2. This was particularly evident in the high responder group corresponding to 60% of the AAV-BR1-NPC2-treated \\u003cem\\u003eNpc2-/-\\u003c/em\\u003e mice. The AAV-BR1-NPC2 vector is likely to enter the brain bifold, i.e., by viral transduction of BECs with subsequent protein secretion to the brain interior and by BBB passage of the AAV-BR1 vector followed by neuronal transduction and protein delivery. Particular high transduction efficiency was seen in the cerebral cortex and especially the hippocampus, which was associated with reduced neuroinflammation but also reduced accumulation of lipids in both genetically modified cells and enzyme-deficient cells, suggesting cross-correcting gene therapy via delivery of NPC2 from BECs and neurons.\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAAV-BR1\\u003c/strong\\u003e: Brain-specific adeno-associated virus, \\u003cstrong\\u003eBBB\\u003c/strong\\u003e: Blood-brain barrier, \\u003cstrong\\u003eBCSFB\\u003c/strong\\u003e: blood-cerebrospinal fluid barrier, \\u003cstrong\\u003eBECs\\u003c/strong\\u003e: Brain endothelial cells, \\u003cstrong\\u003eCNS\\u003c/strong\\u003e: central nervous system, \\u003cstrong\\u003eeGFP\\u003c/strong\\u003e: enhanced green fluorescent protein, \\u003cstrong\\u003eGFAP\\u003c/strong\\u003e: Glial fibrillary acidic protein,\\u003cstrong\\u003eIBA1\\u003c/strong\\u003e:\\u0026nbsp;Ionized calcium-binding adaptor molecule 1,\\u0026nbsp;\\u003cstrong\\u003eMSI\\u003c/strong\\u003e: Mass spectrometry imaging;\\u003cstrong\\u003e\\u0026nbsp;M6PR\\u003c/strong\\u003e: Mannose-6-phosphate receptor, \\u003cstrong\\u003eNeuN\\u003c/strong\\u003e:\\u0026nbsp;Neuronal nuclei antigen,\\u0026nbsp;\\u003cstrong\\u003eNPC1\\u003c/strong\\u003e: Niemann-Pick C1 protein, \\u003cstrong\\u003eNPC2\\u003c/strong\\u003e: Niemann-Pick C2 protein, \\u003cstrong\\u003eNP-C\\u003c/strong\\u003e: Niemann-Pick type C disease, \\u003cstrong\\u003eNP-C1\\u003c/strong\\u003e: Niemann-Pick type C1 disease, \\u003cstrong\\u003eNP-C2\\u003c/strong\\u003e: Niemann-Pick type C2 disease, \\u003cstrong\\u003eTEER\\u003c/strong\\u003e: Trans-endothelial electrical resistance, \\u003cstrong\\u003ePBS\\u003c/strong\\u003e: phosphate-buffered saline, \\u003cstrong\\u003ePFA\\u003c/strong\\u003e: Paraformaldehyde, \\u003cstrong\\u003ePPBS\\u003c/strong\\u003e:\\u0026nbsp;potassium-containing phosphate-buffered saline,\\u0026nbsp;\\u003cstrong\\u003eVg\\u003c/strong\\u003e: Viral genomes, \\u003cstrong\\u003eWT\\u003c/strong\\u003e: Wild-type.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe animal studies were performed according to the Danish Animal Experimentation Act (BEK no. 2028 of 14/12/2020) and the European directive (2010/63/EU) and carried out by licensed staff. The Danish Animal Experiments Inspectorate under the Ministry of Food, Agriculture and Fisheries has approved all animal experiments and breeding of NPC2-deficient mice (license no. 2018-15-0201-01467 and 2019-15-0202-00056).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll data generated and analyzed during this study are included in this published paper. All datasets are available from the corresponding author upon reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests:\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eJK is listed as an inventor on a patent on AAV-BR1, held by Boehringer Ingelheim International. All other authors have no competing interests to declare.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was funded by Fonden til L\\u0026aelig;gevidenskabens Fremme, Direkt\\u0026oslash;r Emil C. Hertz og hustru Inger Hertz\\u0026apos; Fond, Dagmar Marshalls Fond, Lundbeck Foundation ((Research Initiative on Blood-Brain Barriers and Drug Delivery Grant no. 2013-14113), and Grant no. R366-2021-226), H\\u0026oslash;rslev-Fonden, L\\u0026aelig;ge Sophus Carl Emil Friis og Hustru Olga Doris Friis Legat, Scleroseforeningen (Grant no. A41926), the Danish Research Council (Grant no. 2024-00136B), and Svend Andersen Fonden as well as the German Research Foundation (DFG, SFB1328 - A13, Grant no. 335447717). The Biological Mass Spectrometry Research at SDU is supported by a generous grant from the\\u0026nbsp;Novo Nordisk Foundation (grant no.\\u0026nbsp;NNF20OC0061575 to O.N.J.) to establish mass spectrometry imaging technology as part of the INTEGRA research infrastructure.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor Contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eConceptualization: CLMR, JK, TM, AB; Methodology: CLMR, CWH, EH, JK, AB; Investigation: CLMR, SFF, MST, EH, BL, LBT, TM, AB; Resources: CLMR, CWH, EH, JK, DW, MS, ONJ, TM, AB; Writing \\u0026ndash; Original Draft: CLMR, AB; Writing \\u0026ndash; Review \\u0026amp; Editing: CLMR, SFF, CWH, MST, EH, BL, JK, DW, LBT, MS, ONJ, TM, AB; Visualization: CLMR, SFF, AB; Supervision: MST, CWH, DW, LBT, ONJ, TM, AB; Funding Acquisition: CLMR, JK, DW, OJN, TM, AB\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003c/strong\\u003e\\u003cbr\\u003eThe authors thank laboratory technicians Merete Fredsgaard, Hanne Krone Nielsen, Ditte Bech Laursen, and Louise Hvilsh\\u0026oslash;j Madsen, Aalborg University, Denmark, and animal technicians Karina Lassen Holm and Dorte Hermansen, Aarhus University, Denmark, for excellent technical assistance during the study. Associate Professor Anders Olsen and Helene Halkj\\u0026aelig;r Jensen, Department of Chemistry and Bioscience, Aalborg University are acknowledged for assistance with the use of the Olympus IX83 inverted microscope equipped with Yokogawa confocal CSU-W1 spinning disk.\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003ePlatt FM. Emptying the stores: lysosomal diseases and therapeutic strategies. Nat Rev Drug Discov [Internet]. 2018;17:133\\u0026ndash;50. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/29147032/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/29147032/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVerot L, Chikh K, Freydi\\u0026egrave;re E, Honor\\u0026eacute; R, Vanier MT, Millat G. Niemann\\u0026ndash;Pick C disease: functional characterization of three NPC2 mutations and clinical and molecular update on patients with NPC2. Clin Genet [Internet]. 2007;71:320\\u0026ndash;30. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://onlinelibrary.wiley.com/doi/full/\\u003c/span\\u003e\\u003cspan address=\\\"https://onlinelibrary.wiley.com/doi/full/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/j.1399-0004.2007.00782.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1399-0004.2007.00782.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGeberhiwot T, Moro A, Dardis A, Ramaswami U, Sirrs S, Marfa MP et al. Consensus clinical management guidelines for Niemann-Pick disease type C. Orphanet J Rare Dis [Internet]. 2018;13:50. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/29625568/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/29625568/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVanier MT. Niemann-Pick disease type C. Orphanet J Rare Dis. 2010;5:16.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBerzina Z, Solanko LM, Mehadi AS, Jensen MLV, Lund FW, Modzel M, et al. Niemann-Pick C2 protein regulates sterol transport between plasma membrane and late endosomes in human fibroblasts. Chem Phys Lipids. 2018;213:48\\u0026ndash;61.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi X, Saha P, Lib J, Blobel G, Pfeffer SR. Clues to the mechanism of cholesterol transfer from the structure of NPC1 middle lumenal domain bound to NPC2. Proc Natl Acad Sci U S A [Internet]. 2016;113:10079\\u0026ndash;84. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.pnas.org/doi/abs/\\u003c/span\\u003e\\u003cspan address=\\\"https://www.pnas.org/doi/abs/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1073/pnas.1611956113\\u003c/span\\u003e\\u003cspan address=\\\"10.1073/pnas.1611956113\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHammond N, Munkacsi AB, Sturley SL. The complexity of a monogenic neurodegenerative disease: More than two decades of therapeutic driven research into Niemann-Pick type C disease [Internet]. Biochim. Biophys. Acta - Mol. Cell Biol. Lipids. Elsevier B.V.; 2019 [cited 2024 Oct 3]. pp. 1109\\u0026ndash;23. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/31002946/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/31002946/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVanier MT. Lipid changes in Niemann-Pick disease type C brain: Personal experience and review of the literature. Neurochem Res [Internet]. Kluwer Academic/Plenum Publishers; 1999 [cited 2024 Oct 3];24:481\\u0026ndash;9. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/10227680/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/10227680/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWalkley SU, Vanier MT. Secondary lipid accumulation in lysosomal disease. Biochim Biophys Acta - Mol Cell Res. 2009. pp. 726\\u0026ndash;36.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBjurulf B, Spetalen S, Erichsen A, Vanier MT, Str\\u0026oslash;m EH, Str\\u0026oslash;mme P. Niemann-Pick disease type C2 presenting as fatal pulmonary alveolar lipoproteinosis: morphological findings in lung and nervous tissue. Med Sci Monit. 2008;14.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKl\\u0026uuml;nemann HH, Elleder M, Kaminski WE, Snow K, Peyser JM, O\\u0026rsquo;Brien JF et al. Frontal lobe atrophy due to a mutation in the cholesterol binding protein HE1/NPC2. Ann Neurol [Internet]. 2002;52:743\\u0026ndash;9. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://onlinelibrary.wiley.com/doi/full/\\u003c/span\\u003e\\u003cspan address=\\\"https://onlinelibrary.wiley.com/doi/full/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/ana.10366\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/ana.10366\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePatterson MC, Mengel E, Wijburg FA, Muller A, Schwierin B, Drevon H, et al. Disease and patient characteristics in NP-C patients: findings from an international disease registry. Orphanet J Rare Dis. 2013;8:12.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVanier MT, Gissen P, Bauer P, Coll MJ, Burlina A, Hendriksz CJ, et al. Diagnostic tests for Niemann-Pick disease type C (NP-C): A critical review. Mol Genet Metab. 2016;118:244\\u0026ndash;54.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMuramatsu K, Muramatsu S. ichi. Adeno-associated virus vector-based gene therapies for pediatric diseases [Internet]. Pediatr. Neonatol. Elsevier (Singapore) Pte Ltd; 2023 [cited 2024 Oct 4]. pp. S3\\u0026ndash;9. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/36266189/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/36266189/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXu Y, Zhang Q, Tan L, Xie X, Zhao Y. The characteristics and biological significance of NPC2: Mutation and disease. Mutat Res Mutat Res. 2019;782:108284.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHede E, Christiansen CB, Heegaard CW, Moos T, Burkhart A. Gene therapy to the blood-brain barrier with resulting protein secretion as a strategy for treatment of Niemann Picks type C2 disease. J Neurochem [Internet]. 2021;156:290\\u0026ndash;308. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/32072649/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/32072649/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLin Y, Wang X, Rose KP, Dai M, Han J, Xin M et al. miR-143 Regulates Lysosomal Enzyme Transport across the Blood-Brain Barrier and Transforms CNS Treatment for Mucopolysaccharidosis Type I. Mol Ther [Internet]. Elsevier Ltd.; 2020;28:2161\\u0026ndash;76. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.ymthe.2020.06.011\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.ymthe.2020.06.011\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eUrayama A, Grubb JH, Sly WS, Banks WA. Developmentally regulated mannose 6-phosphate receptor-mediated transport of a lysosomal enzyme across the blood-brain barrier. Proc Natl Acad Sci U S A. 2004;101:12658\\u0026ndash;63.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eThomsen LB, Lichota J, Kim KS, Moos T. Gene delivery by pullulan derivatives in brain capillary endothelial cells for protein secretion. J Control Release. 2011;151:45\\u0026ndash;50.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBurkhart A, Andresen TL, Aigner A, Thomsen LB, Moos T. Transfection of primary brain capillary endothelial cells for protein synthesis and secretion of recombinant erythropoietin: a strategy to enable protein delivery to the brain. Cell Mol Life Sci. 2017;74:2467\\u0026ndash;85.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRasmussen CLM, Hede E, Routhe LJ, K\\u0026ouml;rbelin J, Helgudottir SS, Thomsen LB et al. A novel strategy for delivering Niemann-Pick type C2 proteins across the blood\\u0026ndash;brain barrier using the brain endothelial-specific AAV-BR1 virus. J Neurochem [Internet]. 2023;164:6\\u0026ndash;28. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://onlinelibrary.wiley.com/doi/full/\\u003c/span\\u003e\\u003cspan address=\\\"https://onlinelibrary.wiley.com/doi/full/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/jnc.15621\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/jnc.15621\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJiang C, Koyabu N, Yonemitsu Y, Shimazoe T, Watanabe S, Naito M, et al. In vivo delivery of glial cell-derived neurotrophic factor across the blood-brain barrier by gene transfer into brain capillary endothelial cells. Hum Gene Ther. 2003;14:1181\\u0026ndash;91.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSands MS, Davidson BL. Gene therapy for lysosomal storage diseases. Mol Ther. 2006;13:839\\u0026ndash;49.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMarkmann S, Christie-Reid J, Rosenberg J, De JB, Kaminsky BP, Crystal SM. Attenuation of the Niemann-Pick type C2 disease phenotype by intracisternal administration of an AAVrh.10 vector expressing Npc2. Exp Neurol. 2018;306:22\\u0026ndash;33.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWillenborg M, Schmidt CK, Braun P, Landgrebe J, Von Figura K, Saftig P et al. Mannose 6-phosphate receptors, Niemann-Pick C2 protein, and lysosomal cholesterol accumulation. J Lipid Res [Internet]. 2005;46:2559\\u0026ndash;69. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/16177447/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/16177447/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDogbevia G, Grasshoff H, Othman A, Penno A, Schwaninger M. Brain endothelial specific gene therapy improves experimental Sandhoff disease. J Cereb Blood Flow Metab [Internet]. 2020;40:1338\\u0026ndash;50. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.ncbi.nlm.nih.gov/pubmed/31357902\\u003c/span\\u003e\\u003cspan address=\\\"http://www.ncbi.nlm.nih.gov/pubmed/31357902\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDogbevia GK, T\\u0026ouml;llner K, K\\u0026ouml;rbelin J, Br\\u0026ouml;er S, Ridder DA, Grasshoff H, et al. Gene therapy decreases seizures in a model of Incontinentia pigmenti. Ann Neurol. 2017;82:93\\u0026ndash;104.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eK\\u0026ouml;rbelin J, Dogbevia G, Michelfelder S, Ridder DA, Hunger A, Wenzel J, et al. A brain microvasculature endothelial cell-specific viral vector with the potential to treat neurovascular and neurological diseases. EMBO Mol Med. 2016;8:609\\u0026ndash;25.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSundaram SM, Arrulo Pereira A, M\\u0026uuml;ller-Fielitz H, K\\u0026ouml;pke H, De Angelis M, M\\u0026uuml;ller TD et al. Gene therapy targeting the blood\\u0026ndash;brain barrier improves neurological symptoms in a model of genetic MCT8 deficiency. Brain [Internet]. 2022;145:4264\\u0026ndash;4274. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://academic.oup.com/brain/advance-article/doi/\\u003c/span\\u003e\\u003cspan address=\\\"https://academic.oup.com/brain/advance-article/doi/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/brain/awac243/6656100\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/brain/awac243/6656100\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eThomsen MS, Birkelund S, Burkhart A, Stensballe A, Moos T. Synthesis and deposition of basement membrane proteins by primary brain capillary endothelial cells in a murine model of the blood-brain barrier. J Neurochem [Internet]. 2017 [cited 2018 Feb 19];140:741\\u0026ndash;54. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.ncbi.nlm.nih.gov/pubmed/27456748\\u003c/span\\u003e\\u003cspan address=\\\"http://www.ncbi.nlm.nih.gov/pubmed/27456748\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eThomsen MS, Humle N, Hede E, Moos T, Burkhart A, Bohn Thomsen L. The blood-brain barrier studied in vitro across species. PLoS One [Internet]. 2021 [cited 2022 Sep 25];16:e0236770. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1371/journal.pone.0236770\\u003c/span\\u003e\\u003cspan address=\\\"10.1371/journal.pone.0236770\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePercie du Sert N, Hurst V, Ahluwalia A, Alam S, Avey MT, Baker M, et al. The ARRIVE guidelines 2.0: updated guidelines for reporting animal research. J Physiol. 2020;598:3793\\u0026ndash;801.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNielsen GK, Dagnaes-Hansen F, Holm IE, Meaney S, Symula D, Andersen NT, et al. Protein replacement therapy partially corrects the cholesterol-storage phenotype in a mouse model of Niemann-Pick type C2 disease. PLoS ONE. 2011;6:e27287.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRasmussen CLM, Thomsen LB, Heegaard CW, Moos T, Burkhart A. The Npc2Gt(LST105)BygNya mouse signifies pathological changes comparable to human Niemann-Pick type C2 disease. Mol Cell Neurosci [Internet]. Elsevier Inc.; 2023;126:103880. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.mcn.2023.103880\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.mcn.2023.103880\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBerard M, Feinstein R, Gallagher A, Illgen-Wilcke B, Pritchett-Corning K, Raspa M. FELASA recommendations for the health monitoring of mouse, rat, hamster, guinea pig and rabbit colonies in breeding and experimental units. Lab Anim [Internet]. 2014 [cited 2022 Jun 29];48:178\\u0026ndash;92. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://lan.rsmjournals\\u003c/span\\u003e\\u003cspan address=\\\"http://lan.rsmjournals\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eUrbaniak GC, Plous S. Research Randomizer [Internet]. 2013. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.randomizer.org/\\u003c/span\\u003e\\u003cspan address=\\\"https://www.randomizer.org/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGouveia K, Hurst JL. Improving the practicality of using non-aversive handling methods to reduce background stress and anxiety in laboratory mice. Sci Rep [Internet]. 2019 [cited 2022 May 9];9. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1038/s41598-019-56860-7\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41598-019-56860-7\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAlam MS, Getz M, Haldar K. Chronic administration of an HDAC inhibitor treats both neurological and systemic Niemann-Pick type C disease in a mouse model. Sci Transl Med [Internet]. 2016;8:326ra23. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/26888431/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/26888431/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCarroll RW, Wainwright MS, Kim KY, Kidambi T, G\\u0026oacute;mez ND, Taylor T et al. A Rapid Murine Coma and Behavior Scale for Quantitative Assessment of Murine Cerebral Malaria. PLoS One [Internet]. 2010 [cited 2022 Jan 13];5:e13124. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://journals.plos.org/plosone/article?id=10.1371/journal.pone.0013124\\u003c/span\\u003e\\u003cspan address=\\\"https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0013124\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGuyenet SJ, Furrer SA, Damian VM, Baughan TD, La Spada AR, Garden GA. A simple composite phenotype scoring system for evaluating mouse models of cerebellar ataxia. J Vis Exp. 2010;1787.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKojic M, Gaik M, Kiska B, Salerno-Kochan A, Hunt S, Tedoldi A et al. Elongator mutation in mice induces neurodegeneration and ataxia-like behavior. Nat Commun [Internet]. 2018;9:1\\u0026ndash;13. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.nature.com/articles/s41467-018-05765-6\\u003c/span\\u003e\\u003cspan address=\\\"https://www.nature.com/articles/s41467-018-05765-6\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHung YH, Walterfang M, Churilov L, Bray L, Jacobson LH, Barnham KJ, et al. Neurological Dysfunction in Early Maturity of a Model for Niemann\\u0026ndash;Pick C1 Carrier Status. Neurother [Internet]. 2016;13:614\\u0026ndash;22. Available from: /pmc/articles/PMC4965399/.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBrawek B, Olmedillas del Moral M, Garaschuk O. In Vivo Visualization of Microglia Using Tomato Lectin. Methods Mol Biol [Internet]. Humana Press Inc.; 2019 [cited 2024 Oct 3]. pp. 165\\u0026ndash;75. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/31392684/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/31392684/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSchindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T et al. Fiji: an open-source platform for biological-image analysis. Nat Methods [Internet]. 2012;9:676\\u0026ndash;82. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.nature.com/articles/nmeth.2019\\u003c/span\\u003e\\u003cspan address=\\\"https://www.nature.com/articles/nmeth.2019\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMirza B, Hadberg H, Thomsen P, Moos T. The absence of reactive astrocytosis is indicative of a unique inflammatory process in Parkinson\\u0026rsquo;s disease. Neuroscience. 1999;95:425\\u0026ndash;32.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXie C, Gong X-M, Luo J, Li B-L, Song B-L. AAV9-NPC1 significantly ameliorates Purkinje cell death and behavioral abnormalities in mouse NPC disease. J Lipid Res [Internet]. 2017;58:512\\u0026ndash;8. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.ncbi.nlm.nih.gov/pubmed/28053186\\u003c/span\\u003e\\u003cspan address=\\\"http://www.ncbi.nlm.nih.gov/pubmed/28053186\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYerger J, Cougnoux AC, Abbott CB, Luke R, Clark TS, Cawley NX, et al. Phenotype assessment for neurodegenerative murine models with ataxia and application to Niemann-Pick disease, type C1. Biol Open. 2022;11:bio059052.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJahnova H, Dvorakova L, Vlaskova H, Hulkova H, Poupetova H, Hrebicek M, et al. Observational, retrospective study of a large cohort of patients with Niemann-Pick disease type C in the Czech Republic: a surprisingly stable diagnostic rate spanning almost 40 years. Orphanet J Rare Dis. 2014;9:140.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSheth J, Joseph JJ, Shah K, Muranjan M, Mistri M, Sheth F. Pulmonary manifestations in Niemann-Pick type C disease with mutations in NPC2 gene: case report and review of literature. BMC Med Genet [Internet]. 2017;18, 5. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e/pmc/articles/PMC5240394/\\u003c/span\\u003e\\u003cspan address=\\\"http:///pmc/articles/PMC5240394/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSleat DE, Wiseman JA, El-Banna M, Price SM, Verot L, Shen MM et al. Genetic evidence for nonredundant functional cooperativity between NPC1 and NPC2 in lipid transport. Proc Natl Acad Sci U S A [Internet]. Proc Natl Acad Sci U S A; 2004 [cited 2024 Oct 3];101:5886\\u0026ndash;91. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/15071184/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/15071184/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOng WY, Sundaram RK, Huang E, Ghoshal S, Kumar U, Pentchev PG, et al. Neuronal localization and association of Niemann Pick C2 protein (HE1/NPC2) with the postsynaptic density. Neuroscience. 2004;128:561\\u0026ndash;70.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWhite JJ, Bosman LWJ, Blot FGC, Os\\u0026oacute;rio C, Kuppens BW, Krijnen WHJJ et al. Region-specific preservation of Purkinje cell morphology and motor behavior in the ATXN1[82Q] mouse model of spinocerebellar ataxia 1. Brain Pathol [Internet]. 2021;31:e12946. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://onlinelibrary.wiley.com/doi/full/\\u003c/span\\u003e\\u003cspan address=\\\"https://onlinelibrary.wiley.com/doi/full/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/bpa.12946\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/bpa.12946\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKavetsky L, Green KK, Boyle BR, Yousufzai FAK, Padron ZM, Melli SE et al. Increased interactions and engulfment of dendrites by microglia precede Purkinje cell degeneration in a mouse model of Niemann Pick Type-C. Sci Rep [Internet]. 2019 [cited 2022 Jan 4];9:14722. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1038/s41598-019-51246-1\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41598-019-51246-1\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMaxfield FR, W\\u0026uuml;stner D. Analysis of Cholesterol Trafficking with Fluorescent Probes. Methods Cell Biol. 2012;108:367\\u0026ndash;93.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eIlnytska O, Jeziorek M, Lai K, Altan-Bonnet N, Dobrowolski R, Storch J. Lysobisphosphatidic acid (LBPA) enrichment promotes cholesterol egress via exosomes in Niemann Pick type C1 deficient cells. Biochim Biophys Acta - Mol Cell Biol Lipids [Internet]. Elsevier B.V.; 2021 [cited 2024 Oct 3];1866. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/33716137/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/33716137/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJuhl AD, Lund FW, Jensen MLV, Szomek M, Heegaard CW, Guttmann P et al. Niemann Pick C2 protein enables cholesterol transfer from endo-lysosomes to the plasma membrane for efflux by shedding of extracellular vesicles. Chem Phys Lipids [Internet]. Elsevier Ireland Ltd; 2021 [cited 2024 Oct 3];235. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/33422548/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/33422548/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTobias F, Pathmasiri KC, Cologna SM. Mass spectrometry imaging reveals ganglioside and ceramide localization patterns during cerebellar degeneration in the Npc1 \\u0026ndash;/\\u0026ndash; mouse model. Anal Bioanal Chem [Internet]. Springer Verlag; 2019 [cited 2024 Oct 3];411:5659\\u0026ndash;68. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/31254056/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/31254056/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhou S, Davidson C, McGlynn R, Stephney G, Dobrenis K, Vanier MT, et al. Endosomal/lysosomal processing of gangliosides affects neuronal cholesterol sequestration in Niemann-pick disease type C. Am J Pathol. 2011;179:890\\u0026ndash;902.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCougnoux A, Yerger JC, Fellmeth M, Serra-Vinardell J, Martin K, Navid F et al. Single cell transcriptome analysis of niemann\\u0026ndash;pick disease, type c1 cerebella. Int J Mol Sci [Internet]. MDPI AG; 2020 [cited 2024 Oct 11];21:1\\u0026ndash;23. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/32731618/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/32731618/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCougnoux A, Drummond RA, Collar AL, Iben JR, Salman A, Westgarth H et al. Microglia activation in Niemann-Pick disease, type C1 is amendable to therapeutic intervention. Hum Mol Genet [Internet]. Oxford University Press; 2018 [cited 2024 Oct 11];27:2076\\u0026ndash;89. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/29617956/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/29617956/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDemir SA, Timur ZK, Ateş N, Mart\\u0026iacute;nez LA, Seyrantepe V. GM2 ganglioside accumulation causes neuroinflammation and behavioral alterations in a mouse model of early onset Tay-Sachs disease. J Neuroinflammation [Internet]. BioMed Central Ltd; 2020 [cited 2024 Oct 11];17. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/32951593/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/32951593/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOu L, Przybilla MJ, Whitley CB. Metabolomics profiling reveals profound metabolic impairments in mice and patients with Sandhoff disease. Mol Genet Metab [Internet]. Academic Press Inc.; 2019 [cited 2024 Oct 11];126:151\\u0026ndash;6. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/30236619/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/30236619/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTobias F, Pathmasiri KC, Cologna SM. Mass spectrometry imaging reveals ganglioside and ceramide localization patterns during cerebellar degeneration in the Npc1 \\u0026ndash;/\\u0026ndash; mouse model. Anal Bioanal Chem [Internet]. Springer Verlag; 2019 [cited 2024 Oct 11];411:5659\\u0026ndash;68. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/31254056/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/31254056/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHawkes C, Kar S. Insulin-like growth factor-II/mannose-6-phosphate receptor: Widespread distribution in neurons of the central nervous system including those expressing cholinergic phenotype. J Comp Neurol [Internet]. 2003;458:113\\u0026ndash;27. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://onlinelibrary.wiley.com/doi/full/10.1002/cne.10578\\u003c/span\\u003e\\u003cspan address=\\\"https://onlinelibrary.wiley.com/doi/full/10.1002/cne.10578\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSarna JR, Larouche M, Marzban H, Sillitoe RV, Rancourt DE, Hawkes R. Patterned Purkinje cell degeneration in mouse models of Niemann-Pick type C disease. J Comp Neurol [Internet]. 2003;456:279\\u0026ndash;91. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://onlinelibrary.wiley.com/doi/full/\\u003c/span\\u003e\\u003cspan address=\\\"https://onlinelibrary.wiley.com/doi/full/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/cne.10522\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/cne.10522\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHigashi Y, Murayama S, Pentchev PG, Suzuki K. Cerebellar degeneration in the Niemann-Pick type C mouse. Acta Neuropathol. 1993;85:175\\u0026ndash;84.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKo DC, Milenkovic L, Beier SM, Manuel H, Buchanan JA, Scott MP. Cell-Autonomous Death of Cerebellar Purkinje Neurons with Autophagy in Niemann-Pick Type C Disease. PLOS Genet [Internet]. 2005;1:81\\u0026ndash;95. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.0010007\\u003c/span\\u003e\\u003cspan address=\\\"https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.0010007\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGerman DC, Matthew Quintero E, Liang CL, Ng B, Punia S, Xie C, et al. Selective Neurodegeneration, Without Neurofibrillary Tangles, in a Mouse Model of Niemann-Pick C Disease. J Comp Neurol. 2001;433:415.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWalterfang M, Patenaude B, Abel LA, Kluenemann H, Bowman EA, Fahey MC, et al. Subcortical volumetric reductions in adult Niemann-Pick disease type C: a cross-sectional study. Am J Neuroradiol. 2013;34:1334\\u0026ndash;40.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZervas M, Dobrenis K, Walkley SU. Neurons in Niemann-Pick Disease Type C Accumulate Gangliosides as Well as Unesterified Cholesterol and Undergo Dendritic and Axonal Alterations. J Neuropathol Exp Neurol [Internet]. 2001;60:49\\u0026ndash;64. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://academic.oup.com/jnen/article/60/1/49/2917938\\u003c/span\\u003e\\u003cspan address=\\\"https://academic.oup.com/jnen/article/60/1/49/2917938\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLopez ME, Klein AD, Dimbil UJ, Scott MP. Anatomically Defined Neuron-Based Rescue of Neurodegenerative Niemann\\u0026ndash;Pick Type C Disorder. J Neurosci [Internet]. 2011;31:4367\\u0026ndash;78. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.jneurosci.org/content/31/12/4367\\u003c/span\\u003e\\u003cspan address=\\\"https://www.jneurosci.org/content/31/12/4367\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGr\\u0026uuml;sser-Cornehls U, B\\u0026auml;urle J. Mutant mice as a model for cerebellar ataxia. Prog Neurobiol. 2001;63:489\\u0026ndash;540.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen Y, Zheng S, Tecedor L, Davidson BL. Overcoming Limitations Inherent in Sulfamidase to Improve Mucopolysaccharidosis IIIA Gene Therapy. Mol Ther [Internet]. Elsevier Ltd.; 2018;26:1118\\u0026ndash;26. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.ymthe.2018.01.010\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.ymthe.2018.01.010\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKatz ML, Tecedor L, Chen Y, Williamson BG, Lysenko E, Wininger FA, Young WM, Johnson GC, Whiting RE, Coates DB JR. AAV gene transfer delays disease onset in a TPP1-deficient canine model of the late infantile form of Batten disease. Sci Transl Med. 2015;7:313ra180.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGriese M, Brasch F, Aldana VR, Cabrera MM, Goelnitz U, Ikonen E et al. Respiratory disease in Niemann-Pick type C2 is caused by pulmonary alveolar proteinosis. Clin Genet [Internet]. 2010;77:119\\u0026ndash;30. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://onlinelibrary.wiley.com/doi/full/\\u003c/span\\u003e\\u003cspan address=\\\"https://onlinelibrary.wiley.com/doi/full/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/j.1399-0004.2009.01325.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1399-0004.2009.01325.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBaudry M, Yao Y, Simmons D, Liu J, Bi X. Postnatal development of inflammation in a murine model of Niemann\\u0026ndash;Pick type C disease: immunohistochemical observations of microglia and astroglia. Exp Neurol. 2003;184:887\\u0026ndash;903.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi H, Repa JJ, Valasek MA, Beltroy EP, Turley SD, German DC et al. Molecular, anatomical, and biochemical events associated with neurodegeneration in mice with Niemann-Pick type C disease. J Neuropathol Exp Neurol [Internet]. 2005 [cited 2022 Mar 3];64:323\\u0026ndash;33. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubmed.ncbi.nlm.nih.gov/15835268/\\u003c/span\\u003e\\u003cspan address=\\\"https://pubmed.ncbi.nlm.nih.gov/15835268/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSantiago-Mujica E, Flunkert S, Rabl R, Neddens J, Loeffler T, Hutter-Paier B et al. Hepatic and neuronal phenotype of NPC1 -/- mice. Heliyon [Internet]. 2019 [cited 2022 Jan 13];5:e01293. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.heliyon.2019.e01293\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.heliyon.2019.e01293\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDixit SS, Jadot M, Sohar I, Sleat DE, Stock AM, Lobel P. Loss of Niemann-Pick C1 or C2 Protein Results in Similar Biochemical Changes Suggesting That These Proteins Function in a Common Lysosomal Pathway. PLoS ONE. 2011;6:23677.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChandler RJ, Williams IM, Gibson AL, Davidson CD, Incao AA, Hubbard BT et al. Systemic AAV9 gene therapy improves the lifespan of mice with Niemann-Pick disease, type C1. Hum Mol Genet [Internet]. 2017;26:52\\u0026ndash;64. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.ncbi.nlm.nih.gov/pubmed/27798114\\u003c/span\\u003e\\u003cspan address=\\\"http://www.ncbi.nlm.nih.gov/pubmed/27798114\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDavidson CD, Gibson AL, Gu T, Baxter LL, Deverman BE, Beadle K et al. Improved systemic AAV gene therapy with a neurotrophic capsid in Niemann\\u0026ndash;Pick disease type C1 mice. Life Sci Alliance [Internet]. 2021;4:e202101040. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.life-science-alliance.org/content/4/10/e202101040\\u003c/span\\u003e\\u003cspan address=\\\"https://www.life-science-alliance.org/content/4/10/e202101040\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHughes MP, Smith DA, Morris L, Fletcher C, Colaco A, Huebecker M, et al. AAV9 intracerebroventricular gene therapy improves lifespan, locomotor function and pathology in a mouse model of Niemann\\u0026ndash;Pick type C1 disease. Hum Mol Genet. 2018;27:3079\\u0026ndash;98.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKurokawa Y, Osaka H, Kouga T, Jimbo E, Muramatsu K, Nakamura S, et al. Gene Therapy in a Mouse Model of Niemann\\u0026ndash;Pick Disease Type C1. Hum Gene Ther [Internet]. 2021;32:589\\u0026ndash;98. Available from: /pmc/articles/PMC8236559/.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePineda M, Jur\\u0026iacute;čkov\\u0026aacute; K, Karimzadeh P, Kolnikova M, Malinova V, Insua JL et al. Disease characteristics, prognosis and miglustat treatment effects on disease progression in patients with Niemann-Pick disease Type C: an international, multicenter, retrospective chart review. Orphanet J Rare Dis [Internet]. 2019;14:32. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e/pmc/articles/PMC6367842/\\u003c/span\\u003e\\u003cspan address=\\\"http:///pmc/articles/PMC6367842/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOhshima-Hosoyama S, Simmons HA, Goecks N, Joers V, Swanson CR, Bondarenko V et al. A Monoclonal Antibody-GDNF Fusion Protein Is Not Neuroprotective and Is Associated with Proliferative Pancreatic Lesions in Parkinsonian Monkeys. Mosley RL, editor. PLoS One [Internet]. Public Library of Science; 2012 [cited 2018 Feb 19];7:e39036. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://dx.plos.org/10.1371/journal.pone.0039036\\u003c/span\\u003e\\u003cspan address=\\\"http://dx.plos.10.1371/journal.pone.0039036\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"},{\"header\":\"Tables\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eTable I. Overview of the primers used in the study.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"661\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eGene\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eForward\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eReverse\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eCAG\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAACGCCAATAGGGACTTTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGTAGGAAAGTCCCATAAGGTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eNpc2 mutant\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCCAGGCAGCACGGATGTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGCCAGGGTTTTCCCAGTCA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eNpc2 wild-type\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTGTGGCTCAGTGGCTTAGG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCCAGGAAGGGATTTCACACA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"fluids-and-barriers-of-the-cns\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"fbcn\",\"sideBox\":\"Learn more about [Fluids and Barriers of the CNS](http://fluidsbarrierscns.biomedcentral.com/)\",\"snPcode\":\"12987\",\"submissionUrl\":\"https://submission.nature.com/new-submission/12987/3\",\"title\":\"Fluids and Barriers of the CNS\",\"twitterHandle\":\"@BioMedCentral\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"AAV-BR1, blood-brain barrier, viral gene therapy, Niemann-Pick type C2 disease, NPC2, cross-correction, gangliosides, cholesterol.\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-5245293/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-5245293/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cstrong\\u003eBackground:\\u003c/strong\\u003e Patients with the genetic disorder Niemann-Pick type C2 disease (NP-C2) suffer from lysosomal accumulation of cholesterol causing both systemic and severe neurological symptoms. In a murine NP-C2 model, otherwise successful intravenous Niemann-Pick C2 protein (NPC2) replacement therapy fails to alleviate progressive neurodegeneration as infused NPC2 cannot cross the blood-brain barrier (BBB). Genetic modification of brain endothelial cells (BECs) is thought to enable secretion of recombinant proteins thereby overcoming the restrictions of the BBB. We hypothesized that an adeno-associated virus (AAV-BR1) encoding the \\u003cem\\u003eNpc2\\u003c/em\\u003egene could cure neurological symptoms in\\u003cem\\u003e Npc2\\u003c/em\\u003e-/- mice through transduction of BECs, and possibly neurons via viral passage across the BBB.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMethods:\\u003c/strong\\u003e Six weeks old \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice were intravenously injected with the AAV-BR1-NPC2 vector. Composite phenotype scores and behavioral tests were assessed for the following six weeks and visually documented. Post-mortem analyses included gene expression analyses, verification of neurodegeneration in Purkinje cells, determination of NPC2 transduction in the CNS, assessment of neuroinflammation, quantification of gangliosides and co-detection of cholesterol with NPC2 in degenerating neurons.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eResults: \\u003c/strong\\u003eTreatment with the AAV-BR1-NPC2 vector improved motor functions, reduced neocortical inflammation, and preserved Purkinje cells in most of the mice, referred to as high-responders. The vector exerted tropism for BECs and neurons resulting in a widespread NPC2 distribution in the brain with a concomitant reduction of cholesterol in adjacent neurons, presumably not transduced by the vector. Mass spectrometry imaging revealed distinct lipid alterations in the brains of \\u003cem\\u003eNpc2\\u003c/em\\u003e-/- mice, with increased GM2 and GM3 ganglioside accumulation in the cerebellum and hippocampus. AAV-BR1-NPC2 treatment partially normalized these ganglioside distributions in high responders, including restoration of lipid profiles towards those of \\u003cem\\u003eNpc2\\u003c/em\\u003e+/+ controls.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConclusion: \\u003c/strong\\u003eThe data suggests cross-correcting gene therapy to the brain via delivery of NPC2 from BECs and neurons.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Endothelial and neuronal engagement by AAV-BR1 gene therapy alleviates neurological symptoms and lipid deposition in a mouse model of Niemann-Pick type C2\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-12-19 10:43:20\",\"doi\":\"10.21203/rs.3.rs-5245293/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2024-12-03T14:05:54+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2024-12-01T04:56:31+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2024-11-30T07:02:17+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"311536356203440958321861043683373400962\",\"date\":\"2024-11-19T13:27:03+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2024-11-15T20:32:14+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"244702149173125130747223727413428969881\",\"date\":\"2024-10-27T22:56:26+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"200016228453749416705342965675297701834\",\"date\":\"2024-10-22T23:49:55+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2024-10-22T14:22:04+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2024-10-21T14:05:21+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2024-10-21T13:14:45+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Fluids and Barriers of the CNS\",\"date\":\"2024-10-11T10:09:57+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"fluids-and-barriers-of-the-cns\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"fbcn\",\"sideBox\":\"Learn more about [Fluids and Barriers of the CNS](http://fluidsbarrierscns.biomedcentral.com/)\",\"snPcode\":\"12987\",\"submissionUrl\":\"https://submission.nature.com/new-submission/12987/3\",\"title\":\"Fluids and Barriers of the CNS\",\"twitterHandle\":\"@BioMedCentral\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"ad2bed95-76eb-44d5-bc2d-e183fa45cbaf\",\"owner\":[],\"postedDate\":\"December 19th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-02-03T15:59:02+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-5245293\",\"link\":\"https://doi.org/10.1186/s12987-025-00621-4\",\"journal\":{\"identity\":\"fluids-and-barriers-of-the-cns\",\"isVorOnly\":false,\"title\":\"Fluids and Barriers of the CNS\"},\"publishedOn\":\"2025-01-31 15:56:58\",\"publishedOnDateReadable\":\"January 31st, 2025\"},\"versionCreatedAt\":\"2024-12-19 10:43:20\",\"video\":\"\",\"vorDoi\":\"10.1186/s12987-025-00621-4\",\"vorDoiUrl\":\"https://doi.org/10.1186/s12987-025-00621-4\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-5245293\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-5245293\",\"identity\":\"rs-5245293\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}