{"paper_id":"133ddfb6-ab4e-4160-a08a-0c2feb03b3c0","body_text":"Rapid detection of N-lactoyl-phenylalanine for exercise evaluation using dual DNA biosensors based on solution-gated graphene field-effect transistor | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Rapid detection of N-lactoyl-phenylalanine for exercise evaluation using dual DNA biosensors based on solution-gated graphene field-effect transistor Jiacheng Li, Ming Zhang, Cailing Zhang, Yin Zhang, Wenbin Chen, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4865146/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract As obesity rates continue to rise, there is an increasing focus on reducing obesity through exercise. People are becoming more aware of the importance of weight loss through physical activity. However, the effectiveness of exercise can vary significantly among individuals, making it challenging to evaluate its impact. Therefore, establishing a reliable method for assessing exercise effectiveness is crucial for enhancing exercise quality and reducing obesity risk. In this study, we developed a N-lactoyl-phenylalanine (N-Lac-Phe) biosensor by detecting L-lactic acid (L-Lac) and L-phenylalanine (L-Phe) based on Solution-Gated Graphene Field-Effect Transistors (SGGT). Our findings showed that the L-Lac and L-Phe biosensors exhibited excellent linearity within concentration ranges of 300 pM to 300 nM for L-Lac and 3 nM to 1000 nM for L-Phe, with R² values of 0.99 and 0.98. The detection accuracies for these two types of SGGT biosensors were 91.63 ± 6.97% and 99.39 ± 8.53%, respectively. Using the established N-Lac-Phe, L-Lac, and L-Phe relationship model (NLL model), we calculated the concentration of N-Lac-Phe in the RAW264.7 culture medium based on the concentrations of L-Lac and L-Phe. The biosensors demonstrated excellent accuracy, and selectivity, indicating their potential for rapidly evaluating the effectiveness of exercise. Biological sciences/Biological techniques/Sensors and probes Biological sciences/Biological techniques/Sensors and probes/Dna probes Biological sciences/Biological techniques/Nanobiotechnology/Biosensors Biological sciences/Biotechnology/Nanobiotechnology/Biosensors Dual DNA Biosensor Solution-Gated Graphene Field-Effect Transistor N-lactoyl-phenylalanine Exercise evaluation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Over the past few decades, the rising obesity rates have correspondingly increased the incidence of obesity-related diseases 1 . Uncontrolled obesity frequently results in metabolic disorders and elevates the risk of conditions such as inflammation 2 , diabetes 3 , and tumors 4 . As the risk of these obesity-related diseases grows, there is an increasing focus on reducing obesity through exercise 5 . While many factors can influence the quality of exercise, maintaining a high standard of exercise quality is essential for effective obesity reduction 6 . Consequently, evaluating exercise quality is of utmost importance. As research progresses, the connection between exercise and energy metabolism is becoming increasingly evident 7 . Exercise can elevate the levels of various signaling molecules that play direct or indirect roles in regulating physiological functions 8 . For example, blood lactate concentration rises following exercise 9 . L-Lactate (L-Lac) can interact with certain amino acids to form dipeptide-like compounds that have regulatory effects 10 . The relationship between N-lactoyl-phenylalanine (N-Lac-Phe) and energy metabolism has garnered significant attention 11 . After intense exercise, N-Lac-Phe is produced through the combination of L-Lac and L-phenylalanine (L-Phe) in the presence of CNDP2 + cells, such as macrophages, monocytes, and stromal cells found in the chest 12 . N-Lac-Phe, when distributed in the plasma, can help regulate energy intake and promote weight reduction 13 . Therefore, the rapid detection of N-Lac-Phe may enhance the evaluation of exercise quality, ultimately ensuring the effectiveness of exercise interventions. Established detection methods for lactate phenylalanine, such as High-Performance Liquid Chromatography (HPLC) and Liquid Chromatography Mass Spectrometry, are widely utilized in scientific research due to their high accuracy 12 , 14 . However, these techniques often involve complex procedures, require sophisticated equipment, and necessitate intricate sample pretreatment, making them unsuitable for rapid testing. In contrast, electrochemical detection offers several advantages, including high sensitivity 15 , ease of operation 16 , and portability 17 . This method effectively overcomes the limitations of conventional detection techniques, providing a rapid and accurate assessment of exercise outcomes. The Solution-Gated Graphene Field-Effect Transistor (SGGT) is an evolution of traditional Field-Effect Transistors (FETs), featuring three electrodes: source, gate, and drain 18 . Unlike FETs, SGGTs utilize an electrolyte solution instead of an insulating layer, resulting in the formation of two double electric layers at the interfaces of the gate/electrolyte and electrolyte/channel 19 . This design allows for a smaller variation in gate voltage to achieve changes in channel current, thereby enhancing the sensitivity of the biosensor 20 , 21 . Furthermore, the high carrier mobility, excellent conductivity, and large specific surface area of graphene materials have contributed to the widespread application of SGGTs in electrochemical biosensor devices 22 , 23 . The detection of one or more substances can be achieved by modifying the gate with various probes and integrating circuit design. Currently, SGGT biosensors with modified gate electrodes can detect RNA 24 , small molecule substances 25 , proteins 20 , and heavy metal ions 26 with excellent sensitivity and selectivity. Furthermore, aptamers offer advantages over antibodies, including superior applicability, enhanced thermal stability, and lower costs 27 . As a result, aptamers are more suitable for modifying SGGT biosensors than antibodies. In this research, we developed a detection platform based on the principles of electrolyte-gated field-effect transistors for the simultaneous detection of L-Lac and L-Phe. Using the established N-Lac-Phe, L-Lac, and L-Phe relationship model (NLL model), this platform enables the rapid detection of N-Lac-Phe in cell culture media, facilitated by an established in vitro relationship model. The biosensor holds significant potential for quickly evaluating the effectiveness of exercise. 2.Materials and methods 2.1 Materials The DNA sequences (HPLC grade) were acquired from Shanghai Shenggong Biotechnology Co., Ltd. The DNA aptamer sequence for L-Lac was obtained from Po-Jung Jimmy Huang’s research 28 , while the sequence for L-Phe was derived from Kevin M. Cheung’s study 29 . Graphene was purchased from Hefei Weikang Material Technology Co., Ltd., and was prepared using the chemical vapor deposition method as suspended self-transfer monolayer graphene, classified as Grade A with over 97% single-layer coverage. PBS buffer was also obtained from Shanghai Shenggong Biotechnology Co., Ltd. N-Lac-Phe was sourced from MedChemExpress. Isopropanol, acetone, and TCEP were acquired from Sinopharm Chemical Reagent Co., Ltd. The lactic acid reagent kit was purchased from Nanjing Jiancheng Biotechnology Institute. Trypsin (Try), tyrosine (Tyr), glutamic acid (Glu), glycine (Gly), urea, L-Lac, and L-Phe were obtained from Aladdin. Methanol was supplied by TEDIA, and ethyl acetate was sourced from Macklin. Ultrapure water used throughout the study was generated using a Millipore system. Table 1 The sequence of DNA aptamers Name Sequence (5’-3’) Lac201 GACGACGAGTAGCGCGTATGAATGCTTTTCTATGGAGTCGTC Phe3 CGACGAGGCTGGATGCATCCGGATGTTCGATGTCG 2.2 Prepare L-Lac and L-Phe biosensor based on SGGT The SGGT primarily consists of three electrodes: source, drain, and gate, with their fabrication following methods described in previous studies 30 . Glass was used as the electrode substrate, with slides cut to dimensions of 1 cm × 1.2 cm. The prepared glass substrates were sequentially cleaned with acetone, isopropanol, ethanol, and deionized water, then blown dry with high-purity nitrogen. They were secured onto a mask, and patterned layers of chromium (10 nm) and gold (100 nm) were deposited using magnetron sputtering. Graphene was then wet-transferred between the source and drain electrodes, followed by a 15-minute annealing at 120°C to secure the graphene in place. The electrodes were immersed in acetone at 60°C for one hour to remove poly (methyl methacrylate) (PMMA) residue from the graphene surface. After rinsing with deionized water, the electrodes were coated with silver paste to enhance conductivity. Finally, waterproof glue was applied to protect the electrodes. Before beginning the functionalization process, the electrode surface was immersed in a piranha solution for 10 seconds and then rinsed with ultrapure water until completely clean. A mixture was prepared by combining 1 µL of L-Lac aptamer solution (100 µM) with 1 µL of 10 mM TCEP solution. After the reaction proceeded at room temperature for 1 hour, the mixture was diluted to a total volume of 200 µL with 1x PBS. The clean gate electrode was then submerged in this mixed solution and allowed to modify at room temperature for 1 hour. To block unreacted sites, the electrode surface was treated overnight at 4°C with 200 µL of 10 mM 6-mercapto-1-hexanol (MCH). Finally, any residual materials were washed away with ultrapure water. The electrode was then stored in 1x PBS buffer at 4°C. 2.3 Characterization of aptamer modified electrodes The electrochemical characterization of the modified gate electrode was performed using a CHI660D electrochemical workstation. In this setup, the gate electrode served as the working electrode, a platinum wire (Pt) was used as the auxiliary electrode, and a saturated calomel electrode (SCE) acted as the reference electrode, forming a standard three-electrode configuration. The experiments were conducted in a 10 mL electrolyte solution composed of 0.1 M KCl and 5 mM [Fe(CN) 6 ]³⁻/⁴⁻. Electrochemical impedance spectroscopy (EIS) measurements of the gate electrode were recorded in this solution with an applied potential of 0.2 V and a scanning frequency ranging from 10⁵ Hz at the high end to 0.1 Hz at the low end. The water contact angles (CAs) of the electrode surface were measured using a contact angle meter (Kunshan Shengding Industrial Intelligent Technology CO., LTD SDC 350KS). To assess the effect of modification on the electrode surface, atomic force microscopy (AFM) was employed. The electrode was fixed in place and imaged using a Bruker Dimension Icon AFM instrument, which had a scanning range of 5 µm × 5 µm. The Ra value was calculated to evaluate the modification of the electrode surface. 2.4 Electrochemical detection The DNA aptamer-modified SGGTs were used to detect L-Lac and L-Phe in the samples. All devices were washed with deionized water and immersed in 10 mL of 1x PBS solution for testing. The gate, source, and drain electrodes were connected to two Keithley 2400 digital source meters, which were controlled by LabVIEW software. A mixture of varying concentrations of L-Lac and L-Phe in culture media was added to the PBS system, and the transfer curve was measured every 300 seconds. The experimental parameters were set as follows: gate voltage (V G ) ranged from 0 to 0.8 V, source-drain voltage (V DS ) was set at 0.05 V, and the scanning rate was 0.01 V/s. Changes in the gate voltage corresponding to the Dirac point were recorded. This experimental procedure was repeated three times to verify the stability of the detection results. Additionally, the concentrations of L-Lac and L-Phe in the culture medium were also measured using the DNA aptamer-modified SGGTs. 2.5 Establishment the relationship model of the concentration of L-Lac, L-Phe and N-Lac-Phe The concentrations of L-Lac, L-Phe, and N-Lac-Phe in cellular samples were measured using a lactic acid kit and liquid chromatography-mass spectrometry (LC-MS), respectively. All cellular samples were derived from the culture medium of RAW264.7 cells after 24 hours of cultivation. A total of 200 µL of culture medium was extracted with 1 mL of ethyl acetate and vortexed for 15 minutes. The mixture was then centrifuged at 12,000 rpm for 15 min, and the supernatant was collected. The supernatant was passed through a 0.22 µm filter, dried, and reconstituted in 100 µL of methanol, followed by centrifugation at 12,000 rpm for an additional 15 min. Eighty microliters of the supernatant were injected into the LC-MS system. Liquid chromatography-tandem mass spectrometry analysis was performed using an Agilent Vanquish Q Exactive Plus system, utilizing both positive and negative ion scan modes. The mass spectrometry conditions included a spray voltage of 3.5 kV, a capillary temperature of 350°C, sheath gas pressure at 35 psi, and auxiliary gas set to 10 arb. For the liquid phase, the mobile phases consisted of 0.1% formic acid in water (A) and methanol (B). The gradient program was set as follows: from 0 to 18 min, 95%A:5%B; then shifting to 5%A:95%B until 20 min, maintaining this composition until 25 min, and returning to the initial conditions. The flow rate was maintained at 0.2 mL/min with a column temperature of 30°C. The detection of lactic acid was performed using a lactic acid reagent kit. In this method, nicotinamide adenine dinucleotide (NAD) acts as a hydrogen acceptor, and lactate dehydrogenase (LDH) catalyzes the conversion of lactate to pyruvate, resulting in the reduction of NAD to reduced nicotinamide adenine dinucleotide (NADH). NADH then reduces nitro tetrazolium blue chloride (NBT) to a purple product through the hydrogenation of phenazine methane sulfonate (PMS). The absorbance of this product at 530 nm is linearly correlated with lactate concentration. The lactate content is determined according to the operational steps of the reagent kit using the following formula: $$\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:C=\\frac{{OD}_{STD}-{OD}_{Blank}}{{OD-OD}_{Blank}}\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\left(1\\right)$$ In this formula, C represents the lactate concentration (mM), OD Blank is the absorbance of the blank medium measured at 530 nm, OD STD is the absorbance value of the lactate reference standard at 530 nm, and OD denotes the absorbance of the cell culture medium at 530 nm. All absorbance measurements at 530 nm were obtained using a microplate reader. 3. Results and discussion 3.1 Characterizations of the DNA aptamer-modified electrodes To determine whether the aptamer is effectively modified on the electrode surface, we assessed the functionality of the gate by measuring the impedance of various gate electrodes. By analyzing the diameter of the semi-circular pattern in the high-frequency region of the Electrochemical Impedance Spectroscopy (EIS) results, we can determine the surface charge transfer resistance (Rct) generated during the charge transfer process. As shown in Fig. 1 a, the bare Au electrode exhibited a lower impedance of 733.09 Ω, indicating good conductivity. Upon modification with the L-Lac aptamer, the diameter of the semicircle increased, resulting in an Rct value of 1451.34 Ω. Similarly, the results for L-Phe aptamer modification, presented in Fig. 1 b, show that the impedance of the bare Au electrode increased from 579.34 Ω to 1331.78 Ω after L-Phe aptamer modification. Additionally, the contact angles (CAs) of the bare gold electrode were measured at 91.42°. After aptamer modification, the CAs for the modified electrodes were 64.59° for the L-Lac biosensor and 66.37° for the L-Phe biosensor (Fig. 1 ). The results from Atomic Force Microscopy (AFM) analysis, shown in Fig. S1 , indicate an increase in the surface roughness of the aptamer-modified electrode, with the Ra value increasing from 1.24 nm for the bare gold electrode to 3.12 nm for the L-Lac biosensor and 3.73 nm for the L-Phe biosensor. 3.2 Design of the simultaneous detection of L-Lac and L-Phe Figure 2 illustrates the detection circuit of the L-Lac and L-Phe biosensors, which includes two gates modified with different aptamers. The detection of various targets can be achieved by switching between the gates. As shown in Fig. 3 a and b, when the concentration of L-Lac increased from 300 pM to 300 nM, the transfer curve of the biosensor shifted towards the negative voltage. The values of Dirac point voltage displacement (|ΔV Dirac |) were recorded as 0.0282, 0.0432, 0.058, 0.074, 0.0861, 0.094, and 0.106, respectively. Based on previous research studys 25 , a quantitative relationship was observed between the the concentration and |ΔV Dirac |. Through data fitting, we obtained a curve represented by the equation \\(\\:\\text{Y}\\text{=}\\frac{\\text{121}\\text{.}\\text{69}}{\\text{1}\\text{+}{\\text{(}\\frac{\\text{3}\\text{.}\\text{17}}{\\text{X}}\\text{)}}^{\\text{0}\\text{.}\\text{537}}}\\) , where Y denotes |ΔV Dirac | and X represents the logarithm of the L-Lac concentration. Similarly, the L-Phe biosensor exhibited comparable detection results (Fig. 3 c and d). The |ΔV Dirac | values extracted from the transfer curve were 0.013, 0.021, 0.0287, 0.0407, 0.0517, and 0.0587, respectively. We also derived a fitting curve represented by \\(\\:\\text{Y}\\text{=}\\frac{\\text{88.95}}{\\text{1}\\text{+}{\\text{(}\\frac{\\text{152.34}}{\\text{X}}\\text{)}}^{\\text{0.374}}}\\:\\) , where Y corresponds to |ΔV Dirac | and X corresponds to the logarithm of the L-Phe concentration. 3.3 Selectivity performance of L-Lac biosensor and L-Phe biosensor To evaluate the selectivity of the L-Lac and L-Phe biosensors, we examined the interference from substances such as urea, tryptophan (Try), NaCl, KCl, glucose (Glu), glycine (Gly), Na 2 SO 4 , and tyrosine (Tyr). As shown in Fig. 4 a, the L-Lac biosensor exhibited a strong response exclusively to the L-Lac target, while the |ΔV Dirac | values for the interfering substances were − 0.53 ± 0.15 mV for urea, -0.30 ± 0.10 mV for Try, -1.27 ± 0.11 mV for NaCl, -0.23 ± 0.12 mV for KCl, 2.63 ± 0.38 mV for Glu, 1.53 ± 0.15 mV for Gly, -0.27 ± 0.15 mV for Na 2 SO 4 , and − 0.27 ± 0.15 mV for Tyr. Notably, only the addition of L-Lac resulted in a significant change in |ΔV Dirac |, which measured 13.67 ± 0.21 mV. In Fig. 4 b, the |ΔV Dirac | values for the L-Phe biosensor in response to the same interfering substances were 4.36 ± 0.31 mV for urea, 1.15 ± 0.03 mV for Try, 6.80 ± 0.43 mV for NaCl, 0.46 ± 0.25 mV for KCl, 7.16 ± 0.26 mV for Glu, -6.21 ± 0.39 mV for Gly, 6.46 ± 0.21 mV for Na 2 SO 4 , and 8.01 ± 0.29 mV for Tyr. In contrast, the |ΔV Dirac | value for L-Phe was significantly higher at 22.50 ± 0.26 mV. Additionally, we developed new electrodes to assess the response of N-Lac-Phe in L-Lac and L-Phe biosensors at a concentration of 100 nM. The experimental results presented in Fig. S2 indicate that the presence of N-Lac-Phe has minimal impact on the detection outcomes compared to the |ΔV Dirac | values of the target biosensors. Therefore, we conclude that despite the structural similarities between N-Lac-Phe and L-Lac/L-Phe, neither of these biosensors is capable of detecting N-Lac-Phe. 3.4 Detection of the L-Lac and L-Phe in the cell culture medium To validate the detection accuracy of the L-Lac and L-Phe biosensors, we introduced 10 nM standards of L-Lac and L-Phe into the cell culture medium and employed the respective biosensors for detection. The detection results for L-Lac and L-Phe in the cell culture medium are presented in Fig. 5 a, b, and c. The L-Lac biosensor demonstrated a detection accuracy of 111.75 ± 4.10% for 10 nM L-Lac in the culture medium, while the L-Phe biosensor exhibited a detection accuracy of 112.28 ± 18.67% for 10 nM L-Phe. Furthermore, we evaluated the detection accuracy of the L-Lac and L-Phe biosensors in practical applications by using them to measure the levels of L-Lac and L-Phe in cell culture media. In Fig. 5 d, e, and f, the concentrations of L-Lac and L-Phe in actual cell samples were determined using reagent kits and HPLC, respectively. The biosensor detected concentrations of L-Lac and L-Phe as 42.98 ± 1.60 mM and 78.89 ± 6.77 nM, respectively. The recovery rates for the L-Lac biosensor were 91.63 ± 6.97%, while the recovery rate for the L-Phe biosensor was 99.39 ± 8.53%. 3.5 Establishing the concentration relationship model of N-Lac-Phe, L-Lac, and L-Phe (NLL model) in cell culture media According to previous studies, the concentration of N-Lac-Phe is closed related with the concentrations of L-Lac and L-Phe 31 . The linear fitting results, presented in the figure, reveal the concentration relationship among these three substances as follows: [Lac-Phe] = 1.73E − 4 [Lac][Phe] + 4.17, where [Lac-Phe] represents the concentration of N-Lac-Phe, [Lac] and [Phe] denote the concentrations of L-Lac and L-Phe, respectively (R² = 0.72), with a K value of 1.73E − 4 . By combining the two biosensors, we can further facilitate the detection of N-Lac-Phe in the culture medium. 3.6 Mechanism of aptamer modified SGGT for detecting L-Lac and L-Phe The process of detecting L-Lac and L-Phe using SGGT biosensors is illustrated in the figure. We employed a similar approach for the detection of both L-Lac and L-Phe. First, we modified the aptamer on the surface of the gate through self-assembly. During the detection process, the aptamer specifically recognized and bound to either L-Lac or L-Phe, resulting in a conformational change. This structural folding led to a redistribution of potential across the gate surface. The decrease in the electric double layer (EDL) on the gate surface resulted in an increase in capacitance. Under a fixed drain voltage, the channel current can be calculated using the following formula: $$\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:{I}_{DS}\\approx\\:\\frac{W}{L}\\mu\\:{C}_{i}\\left|{V}_{GS}-{V}_{Dirac}\\right|{V}_{DS}\\:，\\:\\:\\:\\left(\\text{when\\:}{V}_{DS}\\ll\\:\\left|{V}_{GS}-{V}_{Dirac}\\right|\\right)\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\:\\left(2\\right)$$ In the formula, W and L denote the width and length of the channel, respectively; µ represents the carrier (electron or hole) mobility of graphene; C i is the total capacitance; and V Dirac is the charge neutral point voltage. As indicated by the formula, when L-Lac and L-Phe targets are captured, the transfer curve of the biosensor shifts toward the negative voltage axis due to an increase in C i , as illustrated in the figure. Consequently, the primary sensing mechanism of the biosensor is the structural change of the aptamer probe. 4. Conclusion In summary, to achieve the rapid detection of N-Lac-Phe, we developed a highly specific biosensor for L-Lac and L-Phe based on SGGT, with the gate modified using L-Lac DNA and L-Phe DNA aptamers. The biosensor exhibited excellent detection accuracy and stability within the concentration ranges of 300 pM to 300 nM for L-Lac and 10 nM to 1000 nM for L-Phe. Additionally, we established the NLL model for the concentration relationship of L-Lac, L-Phe, and N-Lac-Phe under culture medium conditions. Thereby, we could use these two biosensors in conjunction with the NLL model to determine the concentration of N-Lac-Phe in the RAW264.7 culture medium. In conclusion, this study presented an effective method for detecting N-Lac-Phe to assess the effectiveness of exercise. Declarations Conflicts of interest The authors state that they have no known competing economic interests or personal relationships. Acknowledgement This work was supported by the National Natural Science Foundation of China (32172294), and the Fundamental Research Funds for the Central Universities (JZ2024HGTG0283). Author Contribution Jiacheng Li and Cailing Zhang completed the design and implementation of the experiment. Jiacheng Li and Ming Zhang wrote the original manuscript and handled the data visualization. Yin Zhang and Wenbin Cheng conducted validation and optimized the quality of the figures. Project management was carried out by Jian Liu, Lu Wang, and Hao Qu, with Jian Liu and Lu Wang supervising the experimental process. Hao Qu provided funding support. Additionally, Jiacheng Li, Jian Liu, Lu Wang, and Hao Qu reviewed the manuscript. References Collaborators, T. G. O. Health Effects of Overweight and Obesity in 195 Countries over 25 Years. New England Journal of Medicine 377, 13–27, doi: 10.1056/NEJMoa1614362 (2017). Monteiro, R. & Azevedo, I. Chronic Inflammation in Obesity and the Metabolic Syndrome. Mediators of Inflammation 2010, 289645, doi: https://doi.org/10.1155/2010/289645 (2010). Klein, S., Gastaldelli, A., Yki-Järvinen, H. & Scherer, P. E. Why does obesity cause diabetes? Cell Metabolism 34, 11–20, doi: https://doi.org/10.1016/j.cmet.2021.12.012 (2022). Iyengar, N. M., Gucalp, A., Dannenberg, A. J. & Hudis, C. A. Obesity and Cancer Mechanisms: Tumor Microenvironment and Inflammation. Journal of Clinical Oncology 34, 4270–4276, doi: 10.1200/JCO.2016.67.4283 (2016). Butragueño, J. & Ruiz, J. R. Metabolic alliance: pharmacotherapy and exercise management of obesity. Nature Reviews Endocrinology, doi: 10.1038/s41574-024-01006-7 (2024). Molina-Garcia, P. et al. Fatness and fitness in relation to functional movement quality in overweight and obese children. Journal of Sports Sciences 37, 878–885, doi: 10.1080/02640414.2018.1532152 (2019). Hargreaves, M. & Spriet, L. L. Skeletal muscle energy metabolism during exercise. Nature Metabolism 2, 817–828, doi: 10.1038/s42255-020-0251-4 (2020). Lundsgaard, A.-M., Fritzen, A. M. & Kiens, B. Molecular Regulation of Fatty Acid Oxidation in Skeletal Muscle during Aerobic Exercise. Trends in Endocrinology & Metabolism 29, 18–30, doi: 10.1016/j.tem.2017.10.011 (2018). Cai, H. et al. Moderate l-lactate administration suppresses adipose tissue macrophage M1 polarization to alleviate obesity-associated insulin resistance. Journal of Biological Chemistry 298, 101768, doi: https://doi.org/10.1016/j.jbc.2022.101768 (2022). Monelli, E. et al. Angiocrine polyamine production regulates adiposity. Nature Metabolism 4, 327–343, doi: 10.1038/s42255-022-00544-6 (2022). Li, S. et al. The effect of blood flow restriction exercise on N-lactoylphenylalanine and appetite regulation in obese adults: a cross-design study. Frontiers in Endocrinology 14 (2023). Li, V. L. et al. An exercise-inducible metabolite that suppresses feeding and obesity. Nature 606, 785–790, doi: 10.1038/s41586-022-04828-5 (2022). Xiao, S. et al. Lac-Phe mediates the effects of metformin on food intake and body weight. Nature Metabolism 6, 659–669, doi: 10.1038/s42255-024-00999-9 (2024). Wu, J. et al. Preparation and Taste Characteristics of Kokumi N-Lactoyl Phenylalanine in the Presence of Phenylalanine and Lactate. Journal of Agricultural and Food Chemistry 70, 5396–5407, doi: 10.1021/acs.jafc.2c00530 (2022). Tang, W. et al. Solution processed low power organic field-effect transistor bio-chemical sensor of high transconductance efficiency. npj Flexible Electronics 6, 18, doi: 10.1038/s41528-022-00149-9 (2022). Deng, M. et al. Flexible adaptive sensing tonometry for medical-grade multi-parametric hemodynamic monitoring. npj Flexible Electronics 8, 45, doi: 10.1038/s41528-024-00329-9 (2024). Wang, C. et al. High-precision flexible sweat self-collection sensor for mental stress evaluation. npj Flexible Electronics 8, 47, doi: 10.1038/s41528-024-00333-z (2024). Yan, F., Zhang, M. & Li, J. Solution-Gated Graphene Transistors for Chemical and Biological Sensors. Advanced Healthcare Materials 3, 313–331, doi: https://doi.org/10.1002/adhm.201300221 (2014). Wang, Y., Qu, H., Wang, R., Dong, B. & Zheng, L. Label-free biosensing of mercury(II) in milk using an aptamer-gated graphene field-effect transistor. Journal of Electroanalytical Chemistry 904, 115931, doi: https://doi.org/10.1016/j.jelechem.2021.115931 (2022). Zheng, J. et al. Amplification-free and label-free rapid detection of Staphylococcus aureus using solution-gated graphene transistor-based DNA biosensor with hybridization enhancement by interface engineering. Chemical Engineering Journal 495, 153329, doi: https://doi.org/10.1016/j.cej.2024.153329 (2024). Deng, M. et al. Portable and Rapid Dual-Biomarker Detection Using Solution-Gated Graphene Field Transistors in the Accurate Diagnosis of Prostate Cancer. Advanced Healthcare Materials 13, 2302117, doi: https://doi.org/10.1002/adhm.202302117 (2024). Zhao, S. et al. Selective detection of Pb2 + ions based on a graphene field-effect transistor gated by DNAzymes in binding mode. Biosensors and Bioelectronics 237, 115549, doi: https://doi.org/10.1016/j.bios.2023.115549 (2023). Yu, H. et al. Aptamer-Based Solution-Gated Graphene Transistors for Highly Sensitive and Real-Time Detection of Thrombin Molecules. Analytical Chemistry 93, 13673–13679, doi: 10.1021/acs.analchem.1c03129 (2021). Deng, M. et al. Unamplified and Real-Time Label-Free miRNA-21 Detection Using Solution-Gated Graphene Transistors in Prostate Cancer Diagnosis. Advanced Science 10, 2205886, doi: https://doi.org/10.1002/advs.202205886 (2023). Dou, X. et al. A miniaturized biosensor for rapid detection of tetracycline based on a graphene field-effect transistor with an aptamer modified gate. Talanta 271, 125702, doi: https://doi.org/10.1016/j.talanta.2024.125702 (2024). Xiao, B. et al. The Gate-Modified Solution-Gated Graphene Transistors for the Highly Sensitive Detection of Lead Ions. ACS Applied Materials & Interfaces 14, 1626–1633, doi: 10.1021/acsami.1c21706 (2022). Song, Y., Li, W. & Xu, H. Recent advances and trends in aptasensors for sensitive detection of foodborne pathogens in various foods. TrAC Trends in Analytical Chemistry 167, 117268, doi: https://doi.org/10.1016/j.trac.2023.117268 (2023). Huang, P.-J. J. & Liu, J. Simultaneous Detection of L-Lactate and D-Glucose Using DNA Aptamers in Human Blood Serum. Angewandte Chemie International Edition 62, e202212879, doi: https://doi.org/10.1002/anie.202212879 (2023). Cheung, K. M. et al. Phenylalanine Monitoring via Aptamer-Field-Effect Transistor Sensors. ACS Sensors 4, 3308–3317, doi: 10.1021/acssensors.9b01963 (2019). Bi, Y. et al. Porous carbon supported nanoceria derived from one step in situ pyrolysis of Jerusalem artichoke stalk for functionalization of solution-gated graphene transistors for real-time detection of lactic acid from cancer cell metabolism. Biosensors and Bioelectronics 140, 111271, doi: https://doi.org/10.1016/j.bios.2019.04.039 (2019). Jansen, R. S. et al. N-lactoyl-amino acids are ubiquitous metabolites that originate from CNDP2-mediated reverse proteolysis of lactate and amino acids. Proceedings of the National Academy of Sciences 112, 6601–6606, doi: 10.1073/pnas.1424638112 (2015). Additional Declarations No competing interests reported. Supplementary Files SupplementaryData.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4865146\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":349190956,\"identity\":\"ccaaf4c9-509c-47a1-93f5-25a4fbd2563c\",\"order_by\":0,\"name\":\"Jiacheng Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hefei University of Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jiacheng\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":349190957,\"identity\":\"38b90734-f534-405e-93e5-1a48520df84f\",\"order_by\":1,\"name\":\"Ming Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hefei University of Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ming\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":349190958,\"identity\":\"29467f7d-d51d-4155-8ac4-a83a153c0181\",\"order_by\":2,\"name\":\"Cailing Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hefei University of Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Cailing\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":349190959,\"identity\":\"1922581a-30a0-46ce-89ad-c13365bb2c18\",\"order_by\":3,\"name\":\"Yin Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hefei University of Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yin\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":349190960,\"identity\":\"610b755e-7853-44a8-ae84-a0b0267e9275\",\"order_by\":4,\"name\":\"Wenbin Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hefei University of Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Wenbin\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":349190961,\"identity\":\"f3b7e709-6cb0-4b65-a28b-fc07299b6f04\",\"order_by\":5,\"name\":\"Jian Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hefei University of Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jian\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":349190962,\"identity\":\"429bfa07-6c2e-4c17-9c1d-a4e9aeac0a25\",\"order_by\":6,\"name\":\"Hao Qu\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwElEQVRIiWNgGAWjYFACHiCuOMAPZxOp5cwByQY2krQwtpGihe9G7sEPH+fdkTC438D44G0bg7w5IS2SN/KSJWdueyZhcIyB2XBuG4PhzgYCWgxu5BhI8247XAfUwibN28aQYHCAsBbj37xzDoNsYf9NrBYzad4GsBY2ZqK0SJ55Y2Y549hhCcljic2Sc85JGG4gpIXveI7xjQ81hyX4Dh8++OFNmY08QVsYEAoYG4CEBCH1KFpGwSgYBaNgFOAAAH3pQiO0tR0SAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Hefei University of Technology\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Hao\",\"middleName\":\"\",\"lastName\":\"Qu\",\"suffix\":\"\"},{\"id\":349190963,\"identity\":\"1126b2c4-6223-4c5f-990d-8990b672686e\",\"order_by\":7,\"name\":\"Lu Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hefei University of Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Lu\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-08-06 03:18:29\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4865146/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4865146/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":64048291,\"identity\":\"0cc9f58e-6c9f-4aad-a917-f3cbc5a1ddcf\",\"added_by\":\"auto\",\"created_at\":\"2024-09-05 15:06:48\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":110455,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCharacterizations of the DNA aptamer-modified electrodes; (a) Electrochemical impedance spectroscopy (EIS) curves of the L-Lac aptamer SGGT biosensor before and after modification of the gate electrode; (b) Electrochemical impedance spectroscopy (EIS) curves of the L-Phe aptamer SGGT biosensor before and after modification of the gate electrode; (c)The water contact angles (CAs) of the Au sensing gate before and after modification of the Lac aptamer and Phe aptamer separately.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4865146/v1/1eea9ebcd23e3c32166f0079.png\"},{\"id\":64048308,\"identity\":\"d21b682a-aaaa-4f5d-b3d1-c5cce95ca6b5\",\"added_by\":\"auto\",\"created_at\":\"2024-09-05 15:06:52\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":165880,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSchematic diagram of N-Lac-Phe detection biosensor based on SGGT biosensor.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4865146/v1/dccf3c5ce96074bf7c667578.png\"},{\"id\":64048299,\"identity\":\"2d551be1-9f61-48f2-be4c-4069a61ada1f\",\"added_by\":\"auto\",\"created_at\":\"2024-09-05 15:06:49\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":124432,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe transfer curve of the biosensors. (a) The transfer curve of aptamers modified L-Lac biosensor; (b) The |ΔV\\u003csub\\u003eDirac\\u003c/sub\\u003e| values of L-Lac biosensors under different concentrations of L-Lac; (d) The transfer curve of aptamers modified L-Phe biosensor; (e) The |ΔV\\u003csub\\u003eDirac\\u003c/sub\\u003e| values of L-Phe biosensors under different concentrations of L-Phe.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4865146/v1/5b63b2744d09c39c524fa4ff.png\"},{\"id\":64048302,\"identity\":\"e299c4d1-5b6d-4a2f-9ba2-9b92fb58c1a3\",\"added_by\":\"auto\",\"created_at\":\"2024-09-05 15:06:49\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":24590,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe selectivity performance of the biosensors. (a)The |ΔV\\u003csub\\u003eDirac\\u003c/sub\\u003e| value changes of L-Lac biosensor of Urea, Glu, Try, NaCl, Gly, Na\\u003csub\\u003e2\\u003c/sub\\u003eSO\\u003csub\\u003e4\\u003c/sub\\u003e, Tyr, and L-Lac; (b)The |ΔV\\u003csub\\u003eDirac\\u003c/sub\\u003e| value changes of L-Phe biosensor of Urea, Glu, Try, NaCl, Gly, Na\\u003csub\\u003e2\\u003c/sub\\u003eSO\\u003csub\\u003e4\\u003c/sub\\u003e, Tyr, and L-Phe.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4865146/v1/5a1a883e0835cc87a0800135.png\"},{\"id\":64048305,\"identity\":\"5d0fdfc1-60c6-4a88-bf6c-c44bb6cd1800\",\"added_by\":\"auto\",\"created_at\":\"2024-09-05 15:06:51\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":95011,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eDetection of the L-Lac and L-Phe in the cell culture medium samples; (a) Detection of L-Lac in the spiked samples; (b) Detection of L-Phe in the spiked samples; (c) The detection accuracy of L-Lac and L-Phe biosensors in the actual cell samples; (d) Detection of L-Lac in the actual cell samples; (e) Detection of L-Phe in the actual cell samples; (f) The detection accuracy of L-Lac and L-Phe biosensors in actual cell samples.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4865146/v1/c803902811871fa896bef059.png\"},{\"id\":64048294,\"identity\":\"73c5d4d7-76d0-4553-a89b-24a126cb9b74\",\"added_by\":\"auto\",\"created_at\":\"2024-09-05 15:06:48\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":57337,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eL-Lac, L-Phe, and N-Lac-Phe concentration relationship model in RAW 264.7 cell culture.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4865146/v1/a7f730b5ce922056dcd657c8.png\"},{\"id\":64048301,\"identity\":\"3b46611a-75b9-4a61-8147-a7ac40b3c262\",\"added_by\":\"auto\",\"created_at\":\"2024-09-05 15:06:49\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":77836,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe principle in the detection of L-Lac and L-Phe with aptamers modified SGGT.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4865146/v1/086152095f8a3738be348009.png\"},{\"id\":66646147,\"identity\":\"0a5d6ee1-4f59-46f4-8663-934d84ba048e\",\"added_by\":\"auto\",\"created_at\":\"2024-10-15 06:54:07\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1139706,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4865146/v1/a68d490f-416f-4f68-b4bf-98b4bfd9fed3.pdf\"},{\"id\":64048262,\"identity\":\"e4c83c96-8395-4fa7-b883-f7830ea9b0df\",\"added_by\":\"auto\",\"created_at\":\"2024-09-05 15:06:45\",\"extension\":\"docx\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":525617,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryData.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4865146/v1/2e5b69cdfc2aeb358aa16aad.docx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Rapid detection of N-lactoyl-phenylalanine for exercise evaluation using dual DNA biosensors based on solution-gated graphene field-effect transistor\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003eOver the past few decades, the rising obesity rates have correspondingly increased the incidence of obesity-related diseases\\u003csup\\u003e\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e\\u003c/sup\\u003e. Uncontrolled obesity frequently results in metabolic disorders and elevates the risk of conditions such as inflammation\\u003csup\\u003e\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u003c/sup\\u003e, diabetes\\u003csup\\u003e\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e\\u003c/sup\\u003e, and tumors\\u003csup\\u003e\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e\\u003c/sup\\u003e. As the risk of these obesity-related diseases grows, there is an increasing focus on reducing obesity through exercise\\u003csup\\u003e\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e\\u003c/sup\\u003e. While many factors can influence the quality of exercise, maintaining a high standard of exercise quality is essential for effective obesity reduction\\u003csup\\u003e\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u003c/sup\\u003e. Consequently, evaluating exercise quality is of utmost importance.\\u003c/p\\u003e \\u003cp\\u003eAs research progresses, the connection between exercise and energy metabolism is becoming increasingly evident\\u003csup\\u003e\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e\\u003c/sup\\u003e. Exercise can elevate the levels of various signaling molecules that play direct or indirect roles in regulating physiological functions\\u003csup\\u003e\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e\\u003c/sup\\u003e. For example, blood lactate concentration rises following exercise\\u003csup\\u003e\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e\\u003c/sup\\u003e. L-Lactate (L-Lac) can interact with certain amino acids to form dipeptide-like compounds that have regulatory effects\\u003csup\\u003e\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e\\u003c/sup\\u003e. The relationship between N-lactoyl-phenylalanine (N-Lac-Phe) and energy metabolism has garnered significant attention\\u003csup\\u003e\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e\\u003c/sup\\u003e. After intense exercise, N-Lac-Phe is produced through the combination of L-Lac and L-phenylalanine (L-Phe) in the presence of CNDP2\\u003csup\\u003e+\\u003c/sup\\u003e cells, such as macrophages, monocytes, and stromal cells found in the chest\\u003csup\\u003e\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e\\u003c/sup\\u003e. N-Lac-Phe, when distributed in the plasma, can help regulate energy intake and promote weight reduction\\u003csup\\u003e\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u003c/sup\\u003e. Therefore, the rapid detection of N-Lac-Phe may enhance the evaluation of exercise quality, ultimately ensuring the effectiveness of exercise interventions.\\u003c/p\\u003e \\u003cp\\u003eEstablished detection methods for lactate phenylalanine, such as High-Performance Liquid Chromatography (HPLC) and Liquid Chromatography Mass Spectrometry, are widely utilized in scientific research due to their high accuracy\\u003csup\\u003e\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u003c/sup\\u003e. However, these techniques often involve complex procedures, require sophisticated equipment, and necessitate intricate sample pretreatment, making them unsuitable for rapid testing. In contrast, electrochemical detection offers several advantages, including high sensitivity\\u003csup\\u003e\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e\\u003c/sup\\u003e, ease of operation\\u003csup\\u003e\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e\\u003c/sup\\u003e, and portability\\u003csup\\u003e\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e\\u003c/sup\\u003e. This method effectively overcomes the limitations of conventional detection techniques, providing a rapid and accurate assessment of exercise outcomes.\\u003c/p\\u003e \\u003cp\\u003eThe Solution-Gated Graphene Field-Effect Transistor (SGGT) is an evolution of traditional Field-Effect Transistors (FETs), featuring three electrodes: source, gate, and drain\\u003csup\\u003e\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e\\u003c/sup\\u003e. Unlike FETs, SGGTs utilize an electrolyte solution instead of an insulating layer, resulting in the formation of two double electric layers at the interfaces of the gate/electrolyte and electrolyte/channel\\u003csup\\u003e19\\u003c/sup\\u003e. This design allows for a smaller variation in gate voltage to achieve changes in channel current, thereby enhancing the sensitivity of the biosensor\\u003csup\\u003e\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e\\u003c/sup\\u003e. Furthermore, the high carrier mobility, excellent conductivity, and large specific surface area of graphene materials have contributed to the widespread application of SGGTs in electrochemical biosensor devices\\u003csup\\u003e\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eThe detection of one or more substances can be achieved by modifying the gate with various probes and integrating circuit design. Currently, SGGT biosensors with modified gate electrodes can detect RNA\\u003csup\\u003e\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e, small molecule substances\\u003csup\\u003e\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e\\u003c/sup\\u003e, proteins\\u003csup\\u003e\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e\\u003c/sup\\u003e, and heavy metal ions\\u003csup\\u003e\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e\\u003c/sup\\u003e with excellent sensitivity and selectivity. Furthermore, aptamers offer advantages over antibodies, including superior applicability, enhanced thermal stability, and lower costs\\u003csup\\u003e\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e\\u003c/sup\\u003e. As a result, aptamers are more suitable for modifying SGGT biosensors than antibodies.\\u003c/p\\u003e \\u003cp\\u003eIn this research, we developed a detection platform based on the principles of electrolyte-gated field-effect transistors for the simultaneous detection of L-Lac and L-Phe. Using the established N-Lac-Phe, L-Lac, and L-Phe relationship model (NLL model), this platform enables the rapid detection of N-Lac-Phe in cell culture media, facilitated by an established in vitro relationship model. The biosensor holds significant potential for quickly evaluating the effectiveness of exercise.\\u003c/p\\u003e\"},{\"header\":\"2.Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1 Materials\\u003c/h2\\u003e \\u003cp\\u003eThe DNA sequences (HPLC grade) were acquired from Shanghai Shenggong Biotechnology Co., Ltd. The DNA aptamer sequence for L-Lac was obtained from Po-Jung Jimmy Huang\\u0026rsquo;s research\\u003csup\\u003e\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e\\u003c/sup\\u003e, while the sequence for L-Phe was derived from Kevin M. Cheung\\u0026rsquo;s study\\u003csup\\u003e\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e\\u003c/sup\\u003e. Graphene was purchased from Hefei Weikang Material Technology Co., Ltd., and was prepared using the chemical vapor deposition method as suspended self-transfer monolayer graphene, classified as Grade A with over 97% single-layer coverage. PBS buffer was also obtained from Shanghai Shenggong Biotechnology Co., Ltd. N-Lac-Phe was sourced from MedChemExpress. Isopropanol, acetone, and TCEP were acquired from Sinopharm Chemical Reagent Co., Ltd. The lactic acid reagent kit was purchased from Nanjing Jiancheng Biotechnology Institute. Trypsin (Try), tyrosine (Tyr), glutamic acid (Glu), glycine (Gly), urea, L-Lac, and L-Phe were obtained from Aladdin. Methanol was supplied by TEDIA, and ethyl acetate was sourced from Macklin. Ultrapure water used throughout the study was generated using a Millipore system.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eThe sequence of DNA aptamers\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eName\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eSequence (5\\u0026rsquo;-3\\u0026rsquo;)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLac201\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGACGACGAGTAGCGCGTATGAATGCTTTTCTATGGAGTCGTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhe3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCGACGAGGCTGGATGCATCCGGATGTTCGATGTCG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2 Prepare L-Lac and L-Phe biosensor based on SGGT\\u003c/h2\\u003e \\u003cp\\u003eThe SGGT primarily consists of three electrodes: source, drain, and gate, with their fabrication following methods described in previous studies\\u003csup\\u003e\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e\\u003c/sup\\u003e. Glass was used as the electrode substrate, with slides cut to dimensions of 1 cm \\u0026times; 1.2 cm. The prepared glass substrates were sequentially cleaned with acetone, isopropanol, ethanol, and deionized water, then blown dry with high-purity nitrogen. They were secured onto a mask, and patterned layers of chromium (10 nm) and gold (100 nm) were deposited using magnetron sputtering. Graphene was then wet-transferred between the source and drain electrodes, followed by a 15-minute annealing at 120\\u0026deg;C to secure the graphene in place. The electrodes were immersed in acetone at 60\\u0026deg;C for one hour to remove poly (methyl methacrylate) (PMMA) residue from the graphene surface. After rinsing with deionized water, the electrodes were coated with silver paste to enhance conductivity. Finally, waterproof glue was applied to protect the electrodes.\\u003c/p\\u003e \\u003cp\\u003eBefore beginning the functionalization process, the electrode surface was immersed in a piranha solution for 10 seconds and then rinsed with ultrapure water until completely clean. A mixture was prepared by combining 1 \\u0026micro;L of L-Lac aptamer solution (100 \\u0026micro;M) with 1 \\u0026micro;L of 10 mM TCEP solution. After the reaction proceeded at room temperature for 1 hour, the mixture was diluted to a total volume of 200 \\u0026micro;L with 1x PBS. The clean gate electrode was then submerged in this mixed solution and allowed to modify at room temperature for 1 hour. To block unreacted sites, the electrode surface was treated overnight at 4\\u0026deg;C with 200 \\u0026micro;L of 10 mM 6-mercapto-1-hexanol (MCH). Finally, any residual materials were washed away with ultrapure water. The electrode was then stored in 1x PBS buffer at 4\\u0026deg;C.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3 Characterization of aptamer modified electrodes\\u003c/h2\\u003e \\u003cp\\u003eThe electrochemical characterization of the modified gate electrode was performed using a CHI660D electrochemical workstation. In this setup, the gate electrode served as the working electrode, a platinum wire (Pt) was used as the auxiliary electrode, and a saturated calomel electrode (SCE) acted as the reference electrode, forming a standard three-electrode configuration. The experiments were conducted in a 10 mL electrolyte solution composed of 0.1 M KCl and 5 mM [Fe(CN)\\u003csub\\u003e6\\u003c/sub\\u003e]\\u0026sup3;⁻/⁴⁻. Electrochemical impedance spectroscopy (EIS) measurements of the gate electrode were recorded in this solution with an applied potential of 0.2 V and a scanning frequency ranging from 10⁵ Hz at the high end to 0.1 Hz at the low end.\\u003c/p\\u003e \\u003cp\\u003eThe water contact angles (CAs) of the electrode surface were measured using a contact angle meter (Kunshan Shengding Industrial Intelligent Technology CO., LTD SDC 350KS). To assess the effect of modification on the electrode surface, atomic force microscopy (AFM) was employed. The electrode was fixed in place and imaged using a Bruker Dimension Icon AFM instrument, which had a scanning range of 5 \\u0026micro;m \\u0026times; 5 \\u0026micro;m. The Ra value was calculated to evaluate the modification of the electrode surface.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4 Electrochemical detection\\u003c/h2\\u003e \\u003cp\\u003eThe DNA aptamer-modified SGGTs were used to detect L-Lac and L-Phe in the samples. All devices were washed with deionized water and immersed in 10 mL of 1x PBS solution for testing. The gate, source, and drain electrodes were connected to two Keithley 2400 digital source meters, which were controlled by LabVIEW software. A mixture of varying concentrations of L-Lac and L-Phe in culture media was added to the PBS system, and the transfer curve was measured every 300 seconds. The experimental parameters were set as follows: gate voltage (V\\u003csub\\u003eG\\u003c/sub\\u003e) ranged from 0 to 0.8 V, source-drain voltage (V\\u003csub\\u003eDS\\u003c/sub\\u003e) was set at 0.05 V, and the scanning rate was 0.01 V/s. Changes in the gate voltage corresponding to the Dirac point were recorded. This experimental procedure was repeated three times to verify the stability of the detection results. Additionally, the concentrations of L-Lac and L-Phe in the culture medium were also measured using the DNA aptamer-modified SGGTs.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5 Establishment the relationship model of the concentration of L-Lac, L-Phe and N-Lac-Phe\\u003c/h2\\u003e \\u003cp\\u003eThe concentrations of L-Lac, L-Phe, and N-Lac-Phe in cellular samples were measured using a lactic acid kit and liquid chromatography-mass spectrometry (LC-MS), respectively. All cellular samples were derived from the culture medium of RAW264.7 cells after 24 hours of cultivation. A total of 200 \\u0026micro;L of culture medium was extracted with 1 mL of ethyl acetate and vortexed for 15 minutes. The mixture was then centrifuged at 12,000 rpm for 15 min, and the supernatant was collected. The supernatant was passed through a 0.22 \\u0026micro;m filter, dried, and reconstituted in 100 \\u0026micro;L of methanol, followed by centrifugation at 12,000 rpm for an additional 15 min. Eighty microliters of the supernatant were injected into the LC-MS system. Liquid chromatography-tandem mass spectrometry analysis was performed using an Agilent Vanquish Q Exactive Plus system, utilizing both positive and negative ion scan modes. The mass spectrometry conditions included a spray voltage of 3.5 kV, a capillary temperature of 350\\u0026deg;C, sheath gas pressure at 35 psi, and auxiliary gas set to 10 arb. For the liquid phase, the mobile phases consisted of 0.1% formic acid in water (A) and methanol (B). The gradient program was set as follows: from 0 to 18 min, 95%A:5%B; then shifting to 5%A:95%B until 20 min, maintaining this composition until 25 min, and returning to the initial conditions. The flow rate was maintained at 0.2 mL/min with a column temperature of 30\\u0026deg;C. The detection of lactic acid was performed using a lactic acid reagent kit. In this method, nicotinamide adenine dinucleotide (NAD) acts as a hydrogen acceptor, and lactate dehydrogenase (LDH) catalyzes the conversion of lactate to pyruvate, resulting in the reduction of NAD to reduced nicotinamide adenine dinucleotide (NADH). NADH then reduces nitro tetrazolium blue chloride (NBT) to a purple product through the hydrogenation of phenazine methane sulfonate (PMS). The absorbance of this product at 530 nm is linearly correlated with lactate concentration. The lactate content is determined according to the operational steps of the reagent kit using the following formula:\\u003cdiv id=\\\"Equa\\\" class=\\\"Equation\\\"\\u003e\\u003cdiv format=\\\"TEX\\\" class=\\\"mathdisplay\\\" id=\\\"FileID_Equa\\\" name=\\\"EquationSource\\\"\\u003e\\n$$\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:C=\\\\frac{{OD}_{STD}-{OD}_{Blank}}{{OD-OD}_{Blank}}\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\left(1\\\\right)$$\\u003c/div\\u003e\\u003c/div\\u003e\\u003c/p\\u003e \\u003cp\\u003eIn this formula, C represents the lactate concentration (mM), OD\\u003csub\\u003eBlank\\u003c/sub\\u003e is the absorbance of the blank medium measured at 530 nm, OD\\u003csub\\u003eSTD\\u003c/sub\\u003e is the absorbance value of the lactate reference standard at 530 nm, and OD denotes the absorbance of the cell culture medium at 530 nm. All absorbance measurements at 530 nm were obtained using a microplate reader.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. Results and discussion\",\"content\":\"\\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.1 Characterizations of the DNA aptamer-modified electrodes\\u003c/h2\\u003e \\u003cp\\u003eTo determine whether the aptamer is effectively modified on the electrode surface, we assessed the functionality of the gate by measuring the impedance of various gate electrodes. By analyzing the diameter of the semi-circular pattern in the high-frequency region of the Electrochemical Impedance Spectroscopy (EIS) results, we can determine the surface charge transfer resistance (Rct) generated during the charge transfer process. As shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea, the bare Au electrode exhibited a lower impedance of 733.09 Ω, indicating good conductivity. Upon modification with the L-Lac aptamer, the diameter of the semicircle increased, resulting in an Rct value of 1451.34 Ω. Similarly, the results for L-Phe aptamer modification, presented in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eb, show that the impedance of the bare Au electrode increased from 579.34 Ω to 1331.78 Ω after L-Phe aptamer modification. Additionally, the contact angles (CAs) of the bare gold electrode were measured at 91.42\\u0026deg;. After aptamer modification, the CAs for the modified electrodes were 64.59\\u0026deg; for the L-Lac biosensor and 66.37\\u0026deg; for the L-Phe biosensor (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). The results from Atomic Force Microscopy (AFM) analysis, shown in Fig. \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e, indicate an increase in the surface roughness of the aptamer-modified electrode, with the Ra value increasing from 1.24 nm for the bare gold electrode to 3.12 nm for the L-Lac biosensor and 3.73 nm for the L-Phe biosensor.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.2 Design of the simultaneous detection of L-Lac and L-Phe\\u003c/h2\\u003e \\u003cp\\u003eFigure\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e illustrates the detection circuit of the L-Lac and L-Phe biosensors, which includes two gates modified with different aptamers. The detection of various targets can be achieved by switching between the gates. As shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea and b, when the concentration of L-Lac increased from 300 pM to 300 nM, the transfer curve of the biosensor shifted towards the negative voltage. The values of Dirac point voltage displacement (|ΔV\\u003csub\\u003eDirac\\u003c/sub\\u003e|) were recorded as 0.0282, 0.0432, 0.058, 0.074, 0.0861, 0.094, and 0.106, respectively. Based on previous research studys\\u003csup\\u003e\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e\\u003c/sup\\u003e, a quantitative relationship was observed between the the concentration and |ΔV\\u003csub\\u003eDirac\\u003c/sub\\u003e|. Through data fitting, we obtained a curve represented by the equation \\u003cspan class=\\\"InlineEquation\\\"\\u003e\\u003cspan class=\\\"mathinline\\\"\\u003e\\\\(\\\\:\\\\text{Y}\\\\text{=}\\\\frac{\\\\text{121}\\\\text{.}\\\\text{69}}{\\\\text{1}\\\\text{+}{\\\\text{(}\\\\frac{\\\\text{3}\\\\text{.}\\\\text{17}}{\\\\text{X}}\\\\text{)}}^{\\\\text{0}\\\\text{.}\\\\text{537}}}\\\\)\\u003c/span\\u003e\\u003c/span\\u003e, where Y denotes |ΔV\\u003csub\\u003eDirac\\u003c/sub\\u003e| and X represents the logarithm of the L-Lac concentration. Similarly, the L-Phe biosensor exhibited comparable detection results (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ec and d). The |ΔV\\u003csub\\u003eDirac\\u003c/sub\\u003e| values extracted from the transfer curve were 0.013, 0.021, 0.0287, 0.0407, 0.0517, and 0.0587, respectively. We also derived a fitting curve represented by \\u003cspan class=\\\"InlineEquation\\\"\\u003e\\u003cspan class=\\\"mathinline\\\"\\u003e\\\\(\\\\:\\\\text{Y}\\\\text{=}\\\\frac{\\\\text{88.95}}{\\\\text{1}\\\\text{+}{\\\\text{(}\\\\frac{\\\\text{152.34}}{\\\\text{X}}\\\\text{)}}^{\\\\text{0.374}}}\\\\:\\\\)\\u003c/span\\u003e\\u003c/span\\u003e, where Y corresponds to |ΔV\\u003csub\\u003eDirac\\u003c/sub\\u003e| and X corresponds to the logarithm of the L-Phe concentration.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.3 Selectivity performance of L-Lac biosensor and L-Phe biosensor\\u003c/h2\\u003e \\u003cp\\u003eTo evaluate the selectivity of the L-Lac and L-Phe biosensors, we examined the interference from substances such as urea, tryptophan (Try), NaCl, KCl, glucose (Glu), glycine (Gly), Na\\u003csub\\u003e2\\u003c/sub\\u003eSO\\u003csub\\u003e4\\u003c/sub\\u003e, and tyrosine (Tyr). As shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ea, the L-Lac biosensor exhibited a strong response exclusively to the L-Lac target, while the |ΔV\\u003csub\\u003eDirac\\u003c/sub\\u003e| values for the interfering substances were \\u0026minus;\\u0026thinsp;0.53\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.15 mV for urea, -0.30\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.10 mV for Try, -1.27\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.11 mV for NaCl, -0.23\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.12 mV for KCl, 2.63\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.38 mV for Glu, 1.53\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.15 mV for Gly, -0.27\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.15 mV for Na\\u003csub\\u003e2\\u003c/sub\\u003eSO\\u003csub\\u003e4\\u003c/sub\\u003e, and \\u0026minus;\\u0026thinsp;0.27\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.15 mV for Tyr. Notably, only the addition of L-Lac resulted in a significant change in |ΔV\\u003csub\\u003eDirac\\u003c/sub\\u003e|, which measured 13.67\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.21 mV. In Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eb, the |ΔV\\u003csub\\u003eDirac\\u003c/sub\\u003e| values for the L-Phe biosensor in response to the same interfering substances were 4.36\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.31 mV for urea, 1.15\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.03 mV for Try, 6.80\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.43 mV for NaCl, 0.46\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.25 mV for KCl, 7.16\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.26 mV for Glu, -6.21\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.39 mV for Gly, 6.46\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.21 mV for Na\\u003csub\\u003e2\\u003c/sub\\u003eSO\\u003csub\\u003e4\\u003c/sub\\u003e, and 8.01\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.29 mV for Tyr. In contrast, the |ΔV\\u003csub\\u003eDirac\\u003c/sub\\u003e| value for L-Phe was significantly higher at 22.50\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.26 mV.\\u003c/p\\u003e \\u003cp\\u003eAdditionally, we developed new electrodes to assess the response of N-Lac-Phe in L-Lac and L-Phe biosensors at a concentration of 100 nM. The experimental results presented in Fig. S2 indicate that the presence of N-Lac-Phe has minimal impact on the detection outcomes compared to the |ΔV\\u003csub\\u003eDirac\\u003c/sub\\u003e| values of the target biosensors. Therefore, we conclude that despite the structural similarities between N-Lac-Phe and L-Lac/L-Phe, neither of these biosensors is capable of detecting N-Lac-Phe.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.4 Detection of the L-Lac and L-Phe in the cell culture medium\\u003c/h2\\u003e \\u003cp\\u003eTo validate the detection accuracy of the L-Lac and L-Phe biosensors, we introduced 10 nM standards of L-Lac and L-Phe into the cell culture medium and employed the respective biosensors for detection. The detection results for L-Lac and L-Phe in the cell culture medium are presented in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ea, b, and c. The L-Lac biosensor demonstrated a detection accuracy of 111.75\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;4.10% for 10 nM L-Lac in the culture medium, while the L-Phe biosensor exhibited a detection accuracy of 112.28\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;18.67% for 10 nM L-Phe. Furthermore, we evaluated the detection accuracy of the L-Lac and L-Phe biosensors in practical applications by using them to measure the levels of L-Lac and L-Phe in cell culture media. In Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ed, e, and f, the concentrations of L-Lac and L-Phe in actual cell samples were determined using reagent kits and HPLC, respectively. The biosensor detected concentrations of L-Lac and L-Phe as 42.98\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.60 mM and 78.89\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;6.77 nM, respectively. The recovery rates for the L-Lac biosensor were 91.63\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;6.97%, while the recovery rate for the L-Phe biosensor was 99.39\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;8.53%.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003e3.5 Establishing the concentration relationship model of N-Lac-Phe, L-Lac, and L-Phe (NLL model) in cell culture media\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eAccording to previous studies, the concentration of N-Lac-Phe is closed related with the concentrations of L-Lac and L-Phe\\u003csup\\u003e\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e\\u003c/sup\\u003e. The linear fitting results, presented in the figure, reveal the concentration relationship among these three substances as follows: [Lac-Phe]\\u0026thinsp;=\\u0026thinsp;1.73E\\u003csup\\u003e\\u0026minus;\\u0026thinsp;4\\u003c/sup\\u003e[Lac][Phe]\\u0026thinsp;+\\u0026thinsp;4.17, where [Lac-Phe] represents the concentration of N-Lac-Phe, [Lac] and [Phe] denote the concentrations of L-Lac and L-Phe, respectively (R\\u0026sup2; = 0.72), with a K value of 1.73E\\u003csup\\u003e\\u0026minus;\\u0026thinsp;4\\u003c/sup\\u003e. By combining the two biosensors, we can further facilitate the detection of N-Lac-Phe in the culture medium.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.6 Mechanism of aptamer modified SGGT for detecting L-Lac and L-Phe\\u003c/h2\\u003e \\u003cp\\u003eThe process of detecting L-Lac and L-Phe using SGGT biosensors is illustrated in the figure. We employed a similar approach for the detection of both L-Lac and L-Phe. First, we modified the aptamer on the surface of the gate through self-assembly. During the detection process, the aptamer specifically recognized and bound to either L-Lac or L-Phe, resulting in a conformational change. This structural folding led to a redistribution of potential across the gate surface. The decrease in the electric double layer (EDL) on the gate surface resulted in an increase in capacitance. Under a fixed drain voltage, the channel current can be calculated using the following formula:\\u003cdiv id=\\\"Equb\\\" class=\\\"Equation\\\"\\u003e\\u003cdiv format=\\\"TEX\\\" class=\\\"mathdisplay\\\" id=\\\"FileID_Equb\\\" name=\\\"EquationSource\\\"\\u003e\\n$$\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:{I}_{DS}\\\\approx\\\\:\\\\frac{W}{L}\\\\mu\\\\:{C}_{i}\\\\left|{V}_{GS}-{V}_{Dirac}\\\\right|{V}_{DS}\\\\:，\\\\:\\\\:\\\\:\\\\left(\\\\text{when\\\\:}{V}_{DS}\\\\ll\\\\:\\\\left|{V}_{GS}-{V}_{Dirac}\\\\right|\\\\right)\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\:\\\\left(2\\\\right)$$\\u003c/div\\u003e\\u003c/div\\u003e\\u003c/p\\u003e \\u003cp\\u003eIn the formula, W and L denote the width and length of the channel, respectively; \\u0026micro; represents the carrier (electron or hole) mobility of graphene; C\\u003csub\\u003ei\\u003c/sub\\u003e is the total capacitance; and V\\u003csub\\u003eDirac\\u003c/sub\\u003e is the charge neutral point voltage. As indicated by the formula, when L-Lac and L-Phe targets are captured, the transfer curve of the biosensor shifts toward the negative voltage axis due to an increase in C\\u003csub\\u003ei\\u003c/sub\\u003e, as illustrated in the figure. Consequently, the primary sensing mechanism of the biosensor is the structural change of the aptamer probe.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"4. Conclusion\",\"content\":\"\\u003cp\\u003eIn summary, to achieve the rapid detection of N-Lac-Phe, we developed a highly specific biosensor for L-Lac and L-Phe based on SGGT, with the gate modified using L-Lac DNA and L-Phe DNA aptamers. The biosensor exhibited excellent detection accuracy and stability within the concentration ranges of 300 pM to 300 nM for L-Lac and 10 nM to 1000 nM for L-Phe. Additionally, we established the NLL model for the concentration relationship of L-Lac, L-Phe, and N-Lac-Phe under culture medium conditions. Thereby, we could use these two biosensors in conjunction with the NLL model to determine the concentration of N-Lac-Phe in the RAW264.7 culture medium. In conclusion, this study presented an effective method for detecting N-Lac-Phe to assess the effectiveness of exercise.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003ch2\\u003eConflicts of interest\\u003c/h2\\u003e \\u003cp\\u003eThe authors state that they have no known competing economic interests or personal relationships.\\u003c/p\\u003e \\u003ch2\\u003eAcknowledgement\\u003c/h2\\u003e\\u003cp\\u003eThis work was supported by the National Natural Science Foundation of China (32172294), and the Fundamental Research Funds for the Central Universities (JZ2024HGTG0283).\\u003c/p\\u003e\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\u003cp\\u003eJiacheng Li and Cailing Zhang completed the design and implementation of the experiment. Jiacheng Li and Ming Zhang wrote the original manuscript and handled the data visualization. Yin Zhang and Wenbin Cheng conducted validation and optimized the quality of the figures. Project management was carried out by Jian Liu, Lu Wang, and Hao Qu, with Jian Liu and Lu Wang supervising the experimental process. Hao Qu provided funding support. Additionally, Jiacheng Li, Jian Liu, Lu Wang, and Hao Qu reviewed the manuscript.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eCollaborators, T. G. O. Health Effects of Overweight and Obesity in 195 Countries over 25 Years. New England Journal of Medicine 377, 13\\u0026ndash;27, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1056/NEJMoa1614362\\u003c/span\\u003e\\u003cspan address=\\\"10.1056/NEJMoa1614362\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMonteiro, R. \\u0026amp; Azevedo, I. Chronic Inflammation in Obesity and the Metabolic Syndrome. Mediators of Inflammation 2010, 289645, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1155/2010/289645\\u003c/span\\u003e\\u003cspan address=\\\"10.1155/2010/289645\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2010).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKlein, S., Gastaldelli, A., Yki-J\\u0026auml;rvinen, H. \\u0026amp; Scherer, P. E. Why does obesity cause diabetes? Cell Metabolism 34, 11\\u0026ndash;20, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.cmet.2021.12.012\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.cmet.2021.12.012\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eIyengar, N. M., Gucalp, A., Dannenberg, A. J. \\u0026amp; Hudis, C. A. Obesity and Cancer Mechanisms: Tumor Microenvironment and Inflammation. Journal of Clinical Oncology 34, 4270\\u0026ndash;4276, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1200/JCO.2016.67.4283\\u003c/span\\u003e\\u003cspan address=\\\"10.1200/JCO.2016.67.4283\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2016).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eButrague\\u0026ntilde;o, J. \\u0026amp; Ruiz, J. R. Metabolic alliance: pharmacotherapy and exercise management of obesity. Nature Reviews Endocrinology, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41574-024-01006-7\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41574-024-01006-7\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMolina-Garcia, P. et al. Fatness and fitness in relation to functional movement quality in overweight and obese children. Journal of Sports Sciences 37, 878\\u0026ndash;885, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1080/02640414.2018.1532152\\u003c/span\\u003e\\u003cspan address=\\\"10.1080/02640414.2018.1532152\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHargreaves, M. \\u0026amp; Spriet, L. L. Skeletal muscle energy metabolism during exercise. Nature Metabolism 2, 817\\u0026ndash;828, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s42255-020-0251-4\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s42255-020-0251-4\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLundsgaard, A.-M., Fritzen, A. M. \\u0026amp; Kiens, B. Molecular Regulation of Fatty Acid Oxidation in Skeletal Muscle during Aerobic Exercise. Trends in Endocrinology \\u0026amp; Metabolism 29, 18\\u0026ndash;30, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.tem.2017.10.011\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.tem.2017.10.011\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCai, H. et al. Moderate l-lactate administration suppresses adipose tissue macrophage M1 polarization to alleviate obesity-associated insulin resistance. Journal of Biological Chemistry 298, 101768, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.jbc.2022.101768\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jbc.2022.101768\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMonelli, E. et al. Angiocrine polyamine production regulates adiposity. Nature Metabolism 4, 327\\u0026ndash;343, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s42255-022-00544-6\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s42255-022-00544-6\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi, S. et al. The effect of blood flow restriction exercise on N-lactoylphenylalanine and appetite regulation in obese adults: a cross-design study. Frontiers in Endocrinology 14 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi, V. L. et al. An exercise-inducible metabolite that suppresses feeding and obesity. Nature 606, 785\\u0026ndash;790, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41586-022-04828-5\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41586-022-04828-5\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXiao, S. et al. Lac-Phe mediates the effects of metformin on food intake and body weight. Nature Metabolism 6, 659\\u0026ndash;669, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s42255-024-00999-9\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s42255-024-00999-9\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu, J. et al. Preparation and Taste Characteristics of Kokumi N-Lactoyl Phenylalanine in the Presence of Phenylalanine and Lactate. Journal of Agricultural and Food Chemistry 70, 5396\\u0026ndash;5407, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1021/acs.jafc.2c00530\\u003c/span\\u003e\\u003cspan address=\\\"10.1021/acs.jafc.2c00530\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTang, W. et al. Solution processed low power organic field-effect transistor bio-chemical sensor of high transconductance efficiency. npj Flexible Electronics 6, 18, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41528-022-00149-9\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41528-022-00149-9\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDeng, M. et al. Flexible adaptive sensing tonometry for medical-grade multi-parametric hemodynamic monitoring. npj Flexible Electronics 8, 45, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41528-024-00329-9\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41528-024-00329-9\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, C. et al. High-precision flexible sweat self-collection sensor for mental stress evaluation. npj Flexible Electronics 8, 47, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41528-024-00333-z\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41528-024-00333-z\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYan, F., Zhang, M. \\u0026amp; Li, J. Solution-Gated Graphene Transistors for Chemical and Biological Sensors. Advanced Healthcare Materials 3, 313\\u0026ndash;331, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1002/adhm.201300221\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/adhm.201300221\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, Y., Qu, H., Wang, R., Dong, B. \\u0026amp; Zheng, L. Label-free biosensing of mercury(II) in milk using an aptamer-gated graphene field-effect transistor. Journal of Electroanalytical Chemistry 904, 115931, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.jelechem.2021.115931\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jelechem.2021.115931\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZheng, J. et al. Amplification-free and label-free rapid detection of Staphylococcus aureus using solution-gated graphene transistor-based DNA biosensor with hybridization enhancement by interface engineering. Chemical Engineering Journal 495, 153329, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.cej.2024.153329\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.cej.2024.153329\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDeng, M. et al. Portable and Rapid Dual-Biomarker Detection Using Solution-Gated Graphene Field Transistors in the Accurate Diagnosis of Prostate Cancer. Advanced Healthcare Materials 13, 2302117, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1002/adhm.202302117\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/adhm.202302117\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhao, S. et al. Selective detection of Pb2\\u0026thinsp;+\\u0026thinsp;ions based on a graphene field-effect transistor gated by DNAzymes in binding mode. Biosensors and Bioelectronics 237, 115549, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.bios.2023.115549\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.bios.2023.115549\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYu, H. et al. Aptamer-Based Solution-Gated Graphene Transistors for Highly Sensitive and Real-Time Detection of Thrombin Molecules. Analytical Chemistry 93, 13673\\u0026ndash;13679, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1021/acs.analchem.1c03129\\u003c/span\\u003e\\u003cspan address=\\\"10.1021/acs.analchem.1c03129\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDeng, M. et al. Unamplified and Real-Time Label-Free miRNA-21 Detection Using Solution-Gated Graphene Transistors in Prostate Cancer Diagnosis. Advanced Science 10, 2205886, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1002/advs.202205886\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/advs.202205886\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDou, X. et al. A miniaturized biosensor for rapid detection of tetracycline based on a graphene field-effect transistor with an aptamer modified gate. Talanta 271, 125702, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.talanta.2024.125702\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.talanta.2024.125702\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXiao, B. et al. The Gate-Modified Solution-Gated Graphene Transistors for the Highly Sensitive Detection of Lead Ions. ACS Applied Materials \\u0026amp; Interfaces 14, 1626\\u0026ndash;1633, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1021/acsami.1c21706\\u003c/span\\u003e\\u003cspan address=\\\"10.1021/acsami.1c21706\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSong, Y., Li, W. \\u0026amp; Xu, H. Recent advances and trends in aptasensors for sensitive detection of foodborne pathogens in various foods. TrAC Trends in Analytical Chemistry 167, 117268, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.trac.2023.117268\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.trac.2023.117268\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHuang, P.-J. J. \\u0026amp; Liu, J. Simultaneous Detection of L-Lactate and D-Glucose Using DNA Aptamers in Human Blood Serum. Angewandte Chemie International Edition 62, e202212879, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1002/anie.202212879\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/anie.202212879\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCheung, K. M. et al. Phenylalanine Monitoring via Aptamer-Field-Effect Transistor Sensors. ACS Sensors 4, 3308\\u0026ndash;3317, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1021/acssensors.9b01963\\u003c/span\\u003e\\u003cspan address=\\\"10.1021/acssensors.9b01963\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBi, Y. et al. Porous carbon supported nanoceria derived from one step in situ pyrolysis of Jerusalem artichoke stalk for functionalization of solution-gated graphene transistors for real-time detection of lactic acid from cancer cell metabolism. Biosensors and Bioelectronics 140, 111271, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.bios.2019.04.039\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.bios.2019.04.039\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJansen, R. S. et al. N-lactoyl-amino acids are ubiquitous metabolites that originate from CNDP2-mediated reverse proteolysis of lactate and amino acids. Proceedings of the National Academy of Sciences 112, 6601\\u0026ndash;6606, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1073/pnas.1424638112\\u003c/span\\u003e\\u003cspan address=\\\"10.1073/pnas.1424638112\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2015).\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Dual DNA Biosensor, Solution-Gated Graphene Field-Effect Transistor, N-lactoyl-phenylalanine, Exercise evaluation\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4865146/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4865146/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eAs obesity rates continue to rise, there is an increasing focus on reducing obesity through exercise. People are becoming more aware of the importance of weight loss through physical activity. However, the effectiveness of exercise can vary significantly among individuals, making it challenging to evaluate its impact. Therefore, establishing a reliable method for assessing exercise effectiveness is crucial for enhancing exercise quality and reducing obesity risk. In this study, we developed a N-lactoyl-phenylalanine (N-Lac-Phe) biosensor by detecting L-lactic acid (L-Lac) and L-phenylalanine (L-Phe) based on Solution-Gated Graphene Field-Effect Transistors (SGGT). Our findings showed that the L-Lac and L-Phe biosensors exhibited excellent linearity within concentration ranges of 300 pM to 300 nM for L-Lac and 3 nM to 1000 nM for L-Phe, with R\\u0026sup2; values of 0.99 and 0.98. The detection accuracies for these two types of SGGT biosensors were 91.63\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;6.97% and 99.39\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;8.53%, respectively. Using the established N-Lac-Phe, L-Lac, and L-Phe relationship model (NLL model), we calculated the concentration of N-Lac-Phe in the RAW264.7 culture medium based on the concentrations of L-Lac and L-Phe. The biosensors demonstrated excellent accuracy, and selectivity, indicating their potential for rapidly evaluating the effectiveness of exercise.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Rapid detection of N-lactoyl-phenylalanine for exercise evaluation using dual DNA biosensors based on solution-gated graphene field-effect transistor\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-09-05 15:06:36\",\"doi\":\"10.21203/rs.3.rs-4865146/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"e2305d4e-2943-41e3-a465-0f9bfc0eef25\",\"owner\":[],\"postedDate\":\"September 5th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":37060570,\"name\":\"Biological sciences/Biological techniques/Sensors and probes\"},{\"id\":37060571,\"name\":\"Biological sciences/Biological techniques/Sensors and probes/Dna probes\"},{\"id\":37060572,\"name\":\"Biological sciences/Biological techniques/Nanobiotechnology/Biosensors\"},{\"id\":37060573,\"name\":\"Biological sciences/Biotechnology/Nanobiotechnology/Biosensors\"}],\"tags\":[],\"updatedAt\":\"2024-10-15T06:53:46+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-09-05 15:06:36\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4865146\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4865146\",\"identity\":\"rs-4865146\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}