{"paper_id":"12e578ce-a23b-495c-87d6-c70a09fa276e","body_text":"Sanger sequencing-the gatekeeper to exclude false positives in nucleic acid-based diagnostics for infectious diseases | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Sanger sequencing-the gatekeeper to exclude false positives in nucleic acid-based diagnostics for infectious diseases Sin Hang Lee This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8271122/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background False-positive results are a known challenge in polymerase chain reaction (PCR)-based diagnostics for infectious diseases. The widespread public testing during the COVID-19 pandemic brought the issue to unprecedented global attention with immense clinical and societal consequences. Most authors of scientific publications claim contamination due to poor laboratory management as the major cause of false-positive PCR test results. However, the possibility of false positives being generated by the PCR technology itself has not been investigated. Methods The residues of 30 patient nasopharyngeal swab samples, which were certified to be positive for SARS-CoV-2 N gene by reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays, were retested by a heminested reverse transcription polymerase chain reaction (RT-PCR), followed by Sanger sequencing to verify the authenticity of the amplified product as the physical evidence for true-positives and to explore the molecular mechanism of generating false positives. In addition, the platelet-rich plasma specimens of 145 people residing in Lyme disease-endemic areas during a Lyme disease season in the United States were used for split-sample nested PCR amplification followed by Sanger sequencing for the detection of Borrelia burgdorferi flaB and 16S rRNA genes and to explore the molecular mechanism of false positives. Results Heminested RT-PCR generated 19 PCR products from 30 SARS-CoV-2 RT-qPCR positive samples 16 of which contained a segment of SARS-CoV-2 N gene verified by Sanger sequencing. Three of the 19 PCR products showed mixtures of nontarget DNA sequences, possibly derived from the chromosomes of human cells, bacteria and fungi in the nasopharynx. Split-sample PCR testing for B. burgdorferi showed that in the absence of the target DNA, the primers designed for Borrelial 16S rRNA gene PCR may amplify segments of the human mitochondrial DNA, causing a false-positive PCR result. Sanger sequencing can eliminate all PCR-induced false positives. This study also showed that when the nested PCR protocol is optimized, the crude DNA extract can be used for initiating a primary PCR without nucleic acid isolation, purification, and quantitation. The nested PCR product can be used directly as the template for Sanger sequencing to facilitate implementation of sequence analysis in diagnostic laboratories. Biological sciences/Biological techniques Health sciences/Diseases Biological sciences/Microbiology Biological sciences/Molecular biology Sanger sequencing PCR false-positive gatekeeper infectious diseases nested PCR nucleic acid-based diagnostics Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Traditional standard practice in medical diagnostics for infectious diseases is based on culturing pathogens or nucleic acid amplification tests (NAATs), which include techniques like polymerase chain reaction (PCR) and subsequent DNA sequencing to verify the authenticity of the PCR products. After the 2002-2003 outbreak of severe acute respiratory syndrome (SARS), the U.S. Centers for Disease Control and Prevention (CDC) recommended using three specific primers to perform a heminested reverse transcription polymerase chain reaction (RT-PCR) on patient specimens and to sequence a 348-bp PCR amplicon “to verify the authenticity of the amplified product” [1] for molecular diagnosis of SARS-CoV infection. With accurate diagnosis, prompt isolation of patients and early treatment, the SARS pandemic was stopped in July, 2003 before a vaccine was readied for marketing and a virus variant of concern had time to emerge. To manage the outbreak of COVID-19 in 2020, the world has used the reverse transcription quantitative polymerase chain reaction (RT-qPCR) technology, instead of the traditional RT-PCR followed by Sanger sequencing of the PCR products, as the primary tool for molecular diagnosis of SARS-CoV-2 infections. Technically, the RT-qPCR assay for SARS-CoV-2 is a probe-based nucleic acid hybridization test as stated in a CDC-owned U.S. patent [2], which claims “The kit of claim 4, further comprising a SARS-CoV probe that hybridizes to the SARS-CoV nucleic acid amplified by the pair of primers, wherein the SARS-CoV probe is labeled with a 5'-reporter dye and a 3'-quencher dye.” In molecular terms, a TaqMan® qPCR or RT-qPCR assay simply uses the PCR process, namely the 5’-3’ exonuclease activity of the DNA polymerase, as a tool to determine if a probe, a known short DNA fragment, has hybridized to a single-stranded DNA (ssDNA) molecule. However, DNA/DNA hybridization does not require fully matched sequences to occur. The RT-qPCR assay assumes that a cycle threshold (Ct) number, representing the rate of probe degradation, generated by an instrument can be the proxy for the presence of a pathogen target nucleotide sequence in a patient’s specimen for molecular diagnosis of infectious diseases. This assumption has been challenged by researchers who found that many upper respiratory specimens labeled as positive for SARS-CoV-2 by the RT-qPCR assays did not contain SARS-CoV-2 genomic nucleic acid sequences [3, 4], and the SARS-CoV-2 virus was only successfully isolated from samples with Ct 32 [5]. It has been suggested that positive results derived from one commercial test kit should be confirmed using another nucleic acid test or nucleotide sequencing [4]. Detection of SARS-CoV-2 genomic nucleic acid sequence in RT-qPCR positive specimens is highly dependent on the Ct values of the RT-qPCR test results. A group of investigators retested 2045 SARS-CoV-2 N gene RT-qPCR positive clinical laboratory specimens, which did not have accompanying Ct values, by genome sequencing for viral lineage designation, and found that a SARS-CoV-2 genomic sequence could not be obtained in 1866 of these specimens, indicative of a false-positive rate of 91% (1866/2045). In comparison, for specimens with a Ct ≤ 27, the sequencing failure rate was only 5.3%, and for those with a Ct > 27, the sequencing failure rate was 75.5% [6]. Laboratory directors usually do not report Ct values in their RT-qPCR tests because they often face problems in determining the Ct cut-off for stating that a specimen is positive with a low viral load versus being called indeterminate or equivocal [7]. Many laboratories may call all equivocal test results with high Ct values as positive with a low viral load. An analysis of the laboratory data collected in Germany between mid-March 2020 and summer 2021 suggested that only 14%—and possibly even fewer, down to 10%—of individuals identified as SARS-CoV-2-positive via PCR testing were actually infected by the SARS-CoV-2 virus [8]. The authors of this analysis quoted a study, which showed certain SARS-CoV-2 RT-qPCR assays [9] can even generate positive results on water controls at Ct values between 36 and 38 as a possible cause of false positives. PCR was invented to amplify a specific DNA sequence in a test tube, which can facilitate implementation of Sanger sequencing in any properly equipped laboratories [10], while qPCR was designed to quantify small amounts of a known DNA sequence in solution [11]. Neither PCR result nor qPCR result can be relied upon for valid detection of a pathogen’s genomic nucleic acid sequence in a complex patient specimen for diagnostic purpose because DNA polymerase may extend a primer even if it is annealed to a partially matched DNA when its preferred target DNA template is not available. The purpose of this paper is to reiterate with actual patient specimens for illustration that Sanger sequencing is the tool to verify what has been amplified in a PCR testing to exclude false positives. False positives in infectious disease testing can lead to unnecessary quarantines and the misuse of public health resources. Materials and Methods This work is part of a research project designed to develop routine Sanger sequencing-based testing for the diagnosis of SARS-CoV-2 infection and spirochetemia at the early localized stage of Lyme disease in a CLIA-certified laboratory in the United States. SARS-CoV-2 RT-qPCR positive samples The material used for SARS-CoV-2 testing was the residues of 30 nasopharyngeal swab samples, each in 1–2 mL of viral transport medium (VTM), certified to be RT-qPCR positive for SARS-CoV-2 N gene RNA with Ct values ranged from 14.55 to 36.71 by a Food and Drug Administration (FDA)-endorsed commercial reference laboratory (Boca Biolistics Reference Laboratory, Pompano Beach, FL). These samples were collected in the month of October, 2020 from patients with respiratory infection in southern Florida, U.S.A. The sample residues were stored in a -80°C freezer or kept in dry ice during transit until testing. This material was used for a previous study on SARS-CoV-2 variant determination [12]. Specimens for Lyme disease spirochetemia The material used for the Lyme disease pathogen Sanger sequencing-based testing was 145 platelet-rich plasma (PRP) specimens ( 1 mL each) collected and prepared by DiaSorin, Inc., Stillwater, MN, USA from 145 people residing in Lyme disease-endemic areas in the United States during the Lyme disease season in 2023 according to a research protocol in compliance with 21 CFR 812 . Part of the Sanger sequencing results of these 145 PRP specimens were previously published [13]. SARS-CoV-2 N gene heminested RT-PCR and sequencing For preparation of the SARS-CoV-2 nucleic acid heminested RT-PCR products to be used as templates for Sanger sequencing, about 1 mL of the residues of the nasopharyngeal swab rinse in VTM was transferred to a graduated 1.5 mL microcentrifuge tube and centrifuged at ~16,000× g for 5 min to pellet all cells and cellular debris. The supernatant was discarded except for the last 0.2 mL, which was left in the test tube with the pellet. To each test tube containing the pellet with 0.2 mL supernatant, 200 µL of digestion buffer containing 1% sodium dodecyl sulfate, 20mM Tris-HCl (pH 7.6), 0.2M NaCl and 700 μg/mL proteinase K, was added. The mixture was digested for 1 hr in a heated shaker set at 47°C. After digestion, an equal volume (400 µL) of acidified 125:24:1 phenol:chloroform:isoamyl alcohol mixture (Thermo Fisher Scientific Inc.) was added to each tube. After vortexing twice for extraction and centrifugation at ~16,000× g for 5 min to separate the phases, the liquid in the phenol/chloroform phase was pipetted out and discarded. To the remaining aqueous phase solution 300 µL of acidified 125:24:1 phenol:chloroform:isoamyl alcohol mixture was added for a second extraction. After a second centrifugation at ~16,000× g for 5 min to separate the phases, 200 µL of the aqueous supernatant without any material at the interface was transferred to a new 1.5 mL microcentrifuge tube. To the 200 µL of phenol/chloroform-extracted aqueous solution, 20 µL of 3M sodium acetate (pH 5.2) and 570 µL of ice-cold 95% ethanol were added. The mixture was placed into a cold metal block in a -15 to -20°C freezer for 20 min. The precipitated nucleic acids were centrifuged at ~16,000× g for 5 min and washed with 700 µL of ice-cold 70% ethanol. After a final centrifugation at ~16,000× g for 5 min, the 70% ethanol was completely removed with a fine-tip pipette, and the microcentrifuge tubes with opened caps were put into a vacuum chamber for 10 minutes to evaporate the residual ethanol. The nucleic acids in each tube were dissolved in 50 µL of UltraPure™ DEPC-Treated Water (ThermoFisher Scientific). All samples were tested immediately. To initiate the primary RT-PCR, a total volume of 25 µL mixture was made in a PCR tube containing 20 µL of ready-to-use LoTemp® PCR mix with denaturing chemicals (HiFi DNA Tech, LLC, Trumbull, CT, USA), 1 µL (200 units) of Invitrogen SuperScript III Reverse Transcriptase, 1 µL (40 units) of Ambion™ RNase Inhibitor, 0.1 µL of Invitrogen 1 M DTT (dithiothreitol), 1 µL of 10 µmolar Co1 primary forward primer (5’-ACATTGGCACCCGCAATCCTG-3’) in TE buffer, 1 µL of 10 µmolar Co3 primary reverse primer (5’-TTTGTTCTGGACCACGTCTGC-3’) in TE buffer and 1 µL of sample nucleic acid extract or 1 µL of ATCC VR-3276T synthetic RNA as positive control, and 1 µL of M.B. grade water as negative control. The ramp rate of the thermal cycler was set to 0.9 °C/s. The program for the temperature steps was set as: 47°C for 30 min to generate the cDNA, 85°C 1 cycle for 10 min, followed by 30 cycles of 85°C 30 sec for denaturing, 50°C 30 sec for annealing, 65°C 1 min for primer extension, and final extension 65°C for 10 minutes. To perform the heminested PCR, a trace (about 0.2 μL) of the primary PCR products was transferred by a calibrated micro-glass rod into a 25 μL volume of complete heminested PCR mixture containing 20 μL of ready-to-use LoTemp® mix, 1 μL of 10 μmolar Co4 heminested forward primer (5’-CAATCCTGCTAACAATGCTGC-3’), 1 μL of 10 μmolar Co3 heminested reverse primer (5’-TTTGTTCTGGACCACGTCTGC-3’) and 3 μL of M.B. grade water. The thermocycling steps were programmed to 85°C 1 cycle for 10 min, followed by 30 cycles of 85°C 30 sec for denaturing, 50°C 30 sec for annealing, 65°C 1 min for primer extension, and final extension 65°C for 10 minutes. Aliquots of all primary and nested PCR products were analyzed by agarose gel electrophoresis. The heminested PCR products yielding a band of about 398 bp in size on the gel plate were subject to Sanger sequencing without further purification. About 0.2 µL of the 398-bp SARS-CoV-2 heminested PCR product, if detected at gel electrophoresis, was transferred by a micro-glass rod from the heminested PCR tube into a Sanger reaction tube containing 1 μL of 10 μmolar sequencing primer (Co3 or Co4), 1 μL of BigDye® Terminator (v 1.1/Sequencing Standard Kit), 3.5 μL 5× buffer, and 14.5 μL M.B. grade water in a total volume of 20 μL for 20 enzymatic primer extension/termination reaction cycles according to the protocol supplied by the manufacturer (Applied Biosystems, Foster City, CA, USA). After a dye-terminator cleanup with a Centri Sep column (Princeton Separations, Adelphia, NJ, USA), the reaction mixture was loaded in an Applied Biosystems SeqStudio Genetic Analyzer for sequence analysis. Sequence alignments were performed against the reference sequences stored in the GenBank database by on-line BLAST alignment analysis, as previously published by Lee [14]. Lyme disease pathogen DNA PCRs and sequencing The platelet pellets derived from the PRP and whole blood samples were used for molecular diagnosis of Lyme disease spirochetemia; the technical details were previously published by Lee and co-workers [13, 15]. Briefly, the platelet pellet was resuspended in 0.5 M ammonium hydroxide in a 1.5 mL microcentrifuge tube. The microcentrifuge tube containing the mixture was heated at 97 °C for 5 min with closed cap, followed by 10 min with open cap. The released DNA was precipitated by cold ethanol. The suspension of the precipitated DNA was divided into two equal parts for spit-sample testing. One part was for B. burgdorferi flaB gene nested PCR amplification and the other was for borrelial 16S rRNA gene amplification. The M1 forward primer (5′-ACGATGCACACTTGGTGTTAA-3′), and the M2 reverse primer (5’- TCCGACTTATCACCGGCAGTC-3′) were used for both the primary and the same-nested PCR amplification of a 357/358-bp segment of the borrelial 16S rRNA gene [16]. The flaB outer forward (FOF) primer (5′-GCATCACTTTCAGGGTCTCA 3′), the flaB outer reverse (FOR) primer (5′-TGGGGAACTTGATTAGCCTG-3′) were the primers of the primary PCR to amplify a 503-bp segment of the B. burgdorferi flaB gene. The primers for nested PCR were the flaB inner forward (FIF) primer (5′-CTTTAAGAGTTCATGTTGGAG-3′) and the flaB inner reverse (FIR) primer (5′-TCATTGCCATTGCAGATTGT-3′) to amplify a 447-bp segment of the B. burgdorferi flab gene [13]. The nested PCR primers were used as the sequencing primers for bidirectional Sanger sequencing to verify the PCR products. Results Performing heminested RT-PCR on the 30 nasopharyngeal swab samples, which were RT-qPCR positive for the SARS-CoV-2 N gene, generated only 19 PCR products of about 398 bp in size visible on gel electrophoresis. Bidirectional Sanger sequencing yielded a 398-base sequence, which has a 100% nucleotide match with a SARS-CoV-2 N gene reference sequence in the GenBank, in 16 of the 19 (16/19) heminested RT-PCR products. A pair of electropherograms showing the sequence of one of the 16 true positives is illustrated in Figures 1 and 2. Fig.1. Computer-generated electropherogram showing a segment of SARS-CoV-2 N gene sequence in one of the 16 RT-PCR positive samples. The forward Co4 PCR primer was the sequencing primer. The reverse Co3 PCR primer site is underlined in the end of the sequence. This segment of the N gene has two base mutations, a G→T and a C→G indicated by arrows, against the SARS-CoV- 2 Wuhan-Hu-1 NCBI Reference Sequence NC_045512.2. Fig. 2. Electropherogram showing the result of reverse sequencing of the same PCR product used to generate the sequence illustrated in Fig. 1. The sequencing primer was the reverse Co3 PCR primer. The forward Co4 PCR primer site is underlined in the end of the sequence. The two mutated bases in reverse complement are indicated by arrows. Concatenation of the sequences of Figs.1 and 2 generated a 398-base 5’-3’ reading sequence, which has a 100% match with the N gene sequence of several SARS-CoV-2 genomes submitted to the GenBank in 2020 in the United Staes (GenBank Seq.ID MW566928, MW523480, and MW460593). Three (3) of the 19 heminested RT-PCR positive products contained amplicons of nontarget DNAs. An electropherogram showing the sequences of these nontarget DNAs is illustrated in Figure 3. Fig. 3. Sequencing electropherogram of a false-positive heminested RT-PCR product using the forward Co4 PCR primer as the sequencing primer. This heminested RT- PCR product was generated in the same batch and sequenced in the same series as that used for Fig. 1. In the absence of a fully matched target DNA template, the primers attached to numerous partially matched nontarget single-stranded DNAs in the PCR process for enzymatic primer extension, and generated numerous short PCR amplicons that dominate the sequence as illustrated in this electropherogram. The computer attempted to perform base calling on such a mixture of complex sequences and produced a useless or unreliable sequence. To investigate the possible origins of the nontarget DNAs that were amplified as false-positive PCR products and shown in Figure 3, the highly mixed dominating short sequences in Figure 3 were trimmed off for a second base call to generate a readable sequence shown in Figure 4. Fig. 4. After the short PCR amplicon sequences in Fig. 3 were trimmed off, a readable sequence of 61 dominant bases was generated by the computer as follows: AGCCTCTGCCCCTGGCTTCAGCTTCAAAGGGTCATGGTCAGCAGACGTGGTCCAGAACAAA. The Co3 reverse PCR primer site is marked with a black underline. A 9-base sequence immediately downstream of the primer Co3 is marked with a blue underline. The 9-base sequence in contiguity with a 6-base sequence in the 3’-end of the Co3 primer as shown in Fig. 4 is also present in some human, fungal and bacterial chromosomes. In the absence of the target SARS-CoV-2 nucleic acids, the Co3 primer can anneal to a human, a fungal or a bacterial chromosomal DNA strand to initiate enzymatic DNA synthesis or a PCR as illustrated in Figure 5. Fig. 5. Sequence information retrieved from the GenBank database showing that the nontarget sequences in Figs. 3 and 4 might have been generated from amplicons of the chromosomal DNA of human cells, bacteria and fungi in the nasopharyngeal swab samples. The sequences typed in red are those in the 3’-end of the Co3 primer, which are shared with the nontarget DNAs. It takes only a 6-bp complementary sequence at the 3’-end of a primer to initiate an enzymatic primer extension [17]. Blood specimens of healthy people are usually free of bacteria and fungi, and generate less false-positive PCR results. When human whole blood specimens are used for detection of B. burgdorferi spirochetemia, false-positive PCR products often consist of amplicons of human genomic sequences that can be confirmed by Sanger sequencing as shown in Figure 6. Fig. 6. This is an electropherogram showing that the M1/M2 PCR primer pair amplified a segment of human genomic DNA in the absence of a target Borrelial 16S rRNA gene DNA template , causing a false-positive PCR. The M2 primer was used as the sequencing primer. The M1 PCR primer site is underlined. Submission of a segment of the sequence illustrated in Figure 6 to the GenBank for BLAST analysis induced a report shown in Figure 7. Fig. 7. This BLAST report from the GenBank confirms that a segment of human chromosome 8 sequence was amplified during PCR by the M1/M2 primer pair in the absence of a Borrelial DNA template. The 9-base sequence, TTAACACCA, in the end of this human chromosomal DNA sequnce is identical to the 3’-end sequence of the M1 primer. When the platelet pellet derived from 1 mL of PRP was used as the material for detecting 1-3 B.burgdorferi cells by PCR, the human chromosomal DNA is largely excluded. However, the platelet pellet still contains a large amount of mitochondrial DNA. In the split sample testing, a single Borrelial chromosome in the entire specimen might be aliquoted for the flaB gene amplification and none was in the sample aliquoted for the 16S rRNA gene PCR. As a result, the nested PCR of the flaB gene generated an amplicon for Sanger sequencing (Figure 8) while the nested PCR for 16S rRNA gene generated a human mitochondtrial DNA amplicon (Figures 9 and 10) from the same specimen (M23-175). Fig. 8. Electropherogram showing a typical segment of B. burgdorferi flaB gene sequence (GenBank Sequence ID: CP019767) detected in one of the spit samples when the single copy of chromosomal DNA was aliquoted for flaB nested PCR amplification. Fig. 9. In the split sample aliquoted for Borrelial 16S rRNA gene PCR amplification from the same specimen (No. M23-175) used to generate the sequence shown in Fig. 8 , the M1/M2 PCR primer pair amplified multiple nontarget DNA sequences due to the absence of a preferred target template. The M2 primer was the sequencing primer. The M1 primer site is underlined. Fig. 10. Submission of a segment of clear DNA sequence excised from Fig. 9 to the GenBank for BLAST analysis induced a report confirming that the dominant segment of DNA being amplified as shown in Fig. 9 is a human mitochondrial DNA because this segment of mitochondrial DNA shares an 8-base sequence, TTAACACC, with the M1 primer in its 3’-end (typed in red). Discussion Quantitative PCR (qPCR), PCR (conventional PCR), and Sanger sequencing are common molecular tools for diagnosing infectious diseases, all designed to test for a pathogen's genomic nucleic acid derived from patient specimens. However, only Sanger sequencing can provide physical evidence of detecting a specific nucleic acid and is considered the \"gold standard\" for validating other nucleic acid amplification diagnostic tests. In the current study, retesting the residues of 30 nasopharyngeal swab samples, which were certified as RT-qPCR positive for SARS-CoV-2 and marketed as reference materials for medical diagnostic device development, shows that only 16 of these 30 reference samples contained SARS-CoV-2 nucleic acid confirmed by Sanger sequencing, indicating that the RT-qPCR assay has a false-positive rate of 46.7% (14/30). This finding is not surprising because other researchers also found SARS-CoV-2 RT-qPCR positive results with a Ct > 27 have a sequencing failure rate of 75.5% [6] and the Ct values of these 30 reference samples had a range from 14.55 to 36.71. False positive SARS-CoV-2 RT-qPCR results have been reported in peer-reviewed medical journals [3, 4, 7], and are often considered to be caused by contamination from nucleic acid amplification test (NAAT) amplicon, from other specimens or from synthetic template [18, 19]. False positives due to contamination can be mitigated by improved workflow management and employee training. In the current study, Sanger sequencing of the false-positive PCR products (Figures 3-5) shows that false-positive PCR results may be due to amplification of nontarget DNAs extracted from human cells, bacteria and fungi in the nasopharynx. This type of false positives is inevitable due to the nature of the PCR technology. The function of DNA polymerase is to extend a primer that is annealed to a single-stranded DNA template by adding new nucleotides to the 3’-end of the primer to build a new complementary strand. However, the annealing of a primer to a DNA template does not strictly require fully matched sequences. A 12-base complementary stretch can be sufficient to create a stable duplex [20]. In the absence of a fully matched template a 6-bp complementary sequence at the 3’-end of a primer is sufficient to initiate an enzymatic primer extension [17], as demonstrated in Figures 4 and 5 in this report. Using the platelet pellets properly prepared by differential centrifugation for detection of 1-3 B. burgdorferi spirochetes in the blood specimen of Lyme disease patients [13] has excluded all human chromosomal DNA from the PCR. But the primers designed for Borrelial 16S rRNA gene DNA PCR still can amplify human mitochondrial DNAs in samples without the Borrelial DNA template (Figures 9 and 10). In molecular diagnostics for infectious diseases, unintended PCR amplification of nontarget DNAs derived from true-negative human specimens is always a possibility. Sanger sequencing of the PCR products is the most convenient gatekeeper to eliminate these PCR-induced false positives. The value of using Sanger sequencing to monitor the accuracy of molecular diagnosis of infectious diseases is recognized by the veterinary laboratory diagnosticians, and a set of national guidelines for putting sequence analysis into practice has been compiled by the Laboratory Technology Committee of the American Association of Veterinary Laboratory Diagnosticians [21]. If similar guidelines were adopted for monitoring the accuracy of molecular diagnosis of human infectious diseases, numerous false-positive diagnoses of COVID-19 [3, 4, 7, 22], HPV infections [23] and Lyme disease [24] due to unmonitored NAATs would have been avoided. To implement Sanger sequencing-based molecular diagnostics for infectious diseases, instead of overemphasizing the need for pre-PCR isolation, purification, and quantification of the DNA extracted from the clinical specimens [21], which is of little relevance to getting the target DNA into PCR for amplification, the better approach is to design an optimized high-fidelity nested PCR protocol to prepare a mass of clean homogeneous nested PCR amplicons for Sanger sequencing. A properly prepared nested, heminested or same-nested PCR product can be used directly as the template for Sanger sequencing to generate high-quality sequence electropherograms for diagnostic interpretation, as shown in Figures 1, 2 and 8 of this report and in a few articles previously published [12-15]. In general, conventional PCR is not sensitive enough for molecular detection of infectious agents in clinical specimens. According to the Guidelines for PCR Optimization published by New England BioLab Inc., when a program of 25–30 cycles is used for PCR amplification, it takes about 10 4 copies of target DNA as the template to generate a PCR product that can be visualized as a band in agarose gel electrophoresis [25] because when testing for a pathogen’s genomic DNA in human specimens PCR amplification never reaches its theoretical 100% efficiency due to the presence of PCR inhibitors among many other interfering factors as shown by Roux and colleagues [26] and by Svec and colleagues [27]. It is technically difficult to put 10 4 copies of target pathogen DNA into a primary PCR mixture without simultaneously introducing a large amount of PCR inhibitors because very few routine methods are available for selectively removing host DNA from the crude DNA extracts. Pre-PCR purification of DNA in complex human samples may risk losing the target DNA altogether when the latter is low in quantity. This is especially important in testing for B. burgdorferi cells in Lyme disease patients with spirochetemia. In these patients, there may be just one B. burgdorferi spirochete in the blood specimen [13], as demonstrated in Figures 8 and 9. The amount of DNA extract used to initiate a primary PCR must be customarily optimized for each clinical specimen and pathogen. To detect a single copy of Borrelial chromosomal DNA, the entire DNA extract from the platelet pellet must be used to initiate a primary PCR. In contrast, since there are about 10 5 viral particles within a single SARS-CoV-2 infected cell at any point in time [28], 1 µL of the nucleic acid extract is enough for the primary RT-PCR when cellular components of the patient’s nasopharyngeal swab are included in the test material. In the nested PCR protocol described above, the initial concentration of PCR inhibitors in the crude DNA extracts is approximately diluted 3125 (25x25/0.2) fold in the nested PCR mixture. Such a dilution factor has largely eliminated the effects of the inhibitors carried over from the crude DNA extract into the nested PCR so that only a small number of target DNA primary PCR amplicons are needed for replication to form a mass of homogeneous nested PCR amplicons to be used as the template for Sanger sequencing. Since only 0.2 µL of the nested PCR product is used for a Sanger reaction in a total volume of ~20 mL, the unwanted nested PCR primer residue is diluted more than 100-fold. At this dilution, the small numbers of interfering sequences generated by the unwanted nested PCR primer usually disappear into the baseline in the electropherograms (Figures 1, 2, 8). Conclusion All PCR-based molecular diagnostics for infectious diseases may generate false-positive results because PCR primers can anneal to nontarget DNA strands extracted from the complex patient specimens in the absence of their preferred target DNA template and initiate enzymatic primer extension and even an unwanted PCR. False-positive test results for infectious diseases can lead to personal anxiety, unnecessary medical treatments, and significant costs, while on a societal level, they can strain public health resources and cause public panic. Using Sanger sequencing to verify the authenticity of all PCR-amplified products in a diagnostic laboratory can eliminate false-positives except for contamination due to technical errors that can be mitigated by improved management and employee training. This study also shows that using a properly designed nested PCR protocol can eliminate the need for pre-PCR isolation, purification, and quantification of the extracted sample DNA. Crude DNA extracts can be used to initiate a primary PCR. A properly generated nested PCR product can be used directly for Sanger sequencing without further purification to facilitate implementation of sequence analysis in diagnostic laboratories. Declarations This study was supported by a statement of Independent Investigational Review Board, Inc. (Columbia, MD, USA) SOP 10-00414 Rev E and IRB approved protocols at multiple blood collection sites after informed consent was obtained in accordance with applicable regulations and compliant to 21 CFR 812. Acknowledgement The author thanks Ashli Rode and her colleagues in DiaSorin, Inc. for supplying the platelet-rich plasma specimens used in part of this study. Author contributions SH Lee developed the methodology, supervised the testing, analyzed the PCR and Sanger sequencing results, wrote the manuscript and revised the manuscript after peer reviews. The author has participated sufficiently in the work and agreed to be accountable for all aspects of the work. Funding This research received no external funding. Data availability The datasets generated and/or analyzed during the current study are available in the GenBank with accession Seq.ID MW566928, MW523480, MW460593 and CP019767. Ethics approval and consent to participate DiaSorin, Inc., Stillwater, MN, USA enrolled the 145 patients and healthy donor controls in the Lyme disease-endemic areas and performed the initial specimen preparation for a research project after informed consent was obtained in accordance with applicable regulations in compliance with 21 CFR 812. Written document is available upon request. The study was carried out in accordance with the guidelines of the Declaration of Helsinki. Consent for publication All authors of this study agreed to publish. Institutional review board statement The commercial supplier of the 30 SARS-CoV-2 RT-qPCR positive nasopharyngeal swabs (Boca Biolistics, LLC, Pompano Beach, FL, USA) has provided a statement of Independent Investigational Review Board, Inc. (Columbia, MD, USA) SOP 10-00414 Rev E (De-Linking Specimens). Competing interests SH Lee is Director of the Milford Molecular Diagnostics Laboratory specialized in developing DNA sequencing-based diagnostic tests implementable in community hospital laboratories. References CDC. SARS-CoV Specific RT-PCR Primers. https://www.who.int/publications/m/item/sars-cov-specific-rt-pcr-primers U.S. Patent No.: US 7,776,521 B1 CORONAVIRUS ISOLATED FROM HUMANS. Assignee: CDC. Date of Patent: Aug. 17, 2010. https://www.lens.org/lens/patent/134-714-336-789-388/frontpage Basile K, Maddocks S, Kok J, Dwyer DE. Accuracy amidst ambiguity: false positive SARS-CoV-2 nucleic acid tests when COVID-19 prevalence is low. Pathology. 2020;52(7):809-811. Rahman H, Carter I, Basile K, Donovan L, Kumar S, Tran T, Ko D, Alderson S, Sivaruban T, Eden JS, Rockett R, O'Sullivan MV, Sintchenko V, Chen SC, Maddocks S, Dwyer DE, Kok J. Interpret with caution: An evaluation of the commercial AusDiagnostics versus in-house developed assays for the detection of SARS-CoV-2 virus. J Clin Virol. 2020;127:104374. Basile K, McPhie K, Carter I, Alderson S, Rahman H, Donovan L, Kumar S, Tran T, Ko D, Sivaruban T, Ngo C, Toi C, O'Sullivan MV, Sintchenko V, Chen SC, Maddocks S, Dwyer DE, Kok J. Cell-based Culture Informs Infectivity and Safe De-Isolation Assessments in Patients with Coronavirus Disease 2019. Clin Infect Dis. 2021;73(9):e2952-e2959. Tartof SY, Slezak JM, Fischer H, Hong V, Ackerson BK, Ranasinghe ON, Frankland TB, Ogun OA, Zamparo JM, Gray S, Valluri SR, Pan K, Angulo FJ, Jodar L, McLaughlin JM. Effectiveness of mRNA BNT162b2 COVID-19 vaccine up to 6 months in a large integrated health system in the USA: a retrospective cohort study. Appendix Table 4. Lancet. 2021;398(10309):1407-1416. Braunstein GD, Schwartz L, Hymel P, etal. False Positive Results With SARS-CoV-2 RT-PCR Tests and How to Evaluate a RT-PCR-Positive Test for the Possibility of a False Positive Result. J Occup Environ Med. 2021;63:e159-e162. Günther M, Rockenfeller R, Walach H. A calibration of nucleic acid (PCR) by antibody (IgG) tests in Germany: the course of SARS-CoV-2 infections estimated. Front Epidemiol. 2025;5:1592629. Etievant S, Bal A, Escuret V, Brengel-Pesce K, Bouscambert M, Cheynet V, Generenaz L, Oriol G, Destras G, Billaud G, Josset L, Frobert E, Morfin F, Gaymard A. Performance Assessment of SARS-CoV-2 PCR Assays Developed by WHO Referral Laboratories. J Clin Med. 2020;9(6):1871. Appenzeller T. Democratizing the DNA sequence. Science. 1990;247(4946):1030-2. Higuchi R, Fockler C, Dollinger G, Watson R. Kinetic PCR analysis: real-time monitoring of DNA amplification reactions. Biotechnology (N Y). 1993;11:1026-1030. Lee SH. A Routine Sanger Sequencing Target Specific Mutation Assay for SARS-CoV-2 Variants of Concern and Interest. Viruses. 2021;13(12):2386. Lee SH. Sanger Sequencing of Borrelia burgdorferi flaB Paralogs Detected Spirochetemia at the Early Localized Stage of Lyme Disease. Front Biosci (Schol Ed). 2025;17(2):31280. Lee, S.H. Testing for SARS-CoV-2 in cellular components by routine nested RT-PCR followed by DNA sequencing. Int. J. Geriatr. Rehabil. 2020, 2, 69–96. https://www.int-soc-clin-geriat.com/info/wp-content/uploads/2020/03/Dr.-Lees-paper-on-testing-for-SARS-CoV-2.pdf Lee SH, Vigliotti JS, Vigliotti VS, Jones W, Moorcroft TA, Lantsman K. DNA sequencing diagnosis of off-season spirochetemia with low bacterial density in Borrelia burgdorferi and Borrelia miyamotoi infections. Int J Mol Sci. 2014;15(7):11364-86. Lee SH, Healy JE, Lambert JS. Single Core Genome Sequencing for Detection of both Borrelia burgdorferi Sensu Lato and Relapsing Fever Borrelia Species. Int J Environ Res Public Health. 2019;16(10):1779. Ryu KH, Choi SH, Lee JS. Restriction primers as short as 6-mers for PCR amplification of bacterial and plant genomic DNA and plant viral RNA. Mol Biotechnol. 2000;14(1):1-3. Huggett JF, O'Sullivan DM, Cowen S, Cleveland MH, Davies K, Harris K, Moran-Gilad J, Winter A, Braybrook J, Messenger M. Ensuring accuracy in the development and application of nucleic acid amplification tests (NAATs) for infectious disease. Mol Aspects Med. 2024;97:101275. Mick E, Kamm J, Pisco AO, Ratnasiri K, Babik JM, Castañeda G, DeRisi JL, Detweiler AM, Hao SL, Kangelaris KN, Kumar GR, Li LM, Mann SA, Neff N, Prasad PA, Serpa PH, Shah SJ, Spottiswoode N, Tan M, Calfee CS, Christenson SA, Kistler A, Langelier C. Upper airway gene expression reveals suppressed immune responses to SARS-CoV-2 compared with other respiratory viruses. Nat Commun. 2020;11(1):5854. Garhyan J, Gharaibeh RZ, McGee S, Gibas CJ. The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization. BMC Res Notes. 2013 ;6:72. Crossley BM, Bai J, Glaser A, Maes R, Porter E, Killian ML, Clement T, Toohey-Kurth K. Guidelines for Sanger sequencing and molecular assay monitoring. J Vet Diagn Invest. 2020;32(6):767-775. Healy B, Khan A, Metezai H, Blyth I, Asad H. The impact of false positive COVID-19 results in an area of low prevalence. Clin Med (Lond). 2021;21(1):e54-e56. Schiffman M, de Sanjose S. False positive cervical HPV screening test results. Papillomavirus Res. 2019 Jun;7:184-187. Molloy PJ, Persing DH, Berardi VP. False-positive results of PCR testing for Lyme disease. Clin Infect Dis. 2001;33(3):412-3. New England BioLab Inc. Guidelines for PCR Optimization with Taq DNA Polymerase. Available at: https://www.neb.com/en-us/tools-and-resources/usage-guidelines/guidelines-for-pcr-optimization-with-taq-dna-polymerase Roux G, Ravel C, Varlet-Marie E, Jendrowiak R, Bastien P, Sterkers Y. Inhibition of polymerase chain reaction: Pathogen specific controls are better than human gene amplification. PloS One. 2019; 14: e0219276. Svec D, Tichopad A, Novosadova V, Pfaffl MW, Kubista M. How good is a PCR efficiency estimate: Recommendations for precise and robust qPCR efficiency assessments. Biomolecular Detection and Quantification. 2015; 3: 9–16. Sender R, Bar-On YM, Gleizer S, Bernshtein B, Flamholz A, Phillips R, Milo R. The total number and mass of SARS-CoV-2 virions. Proc Natl Acad Sci U S A. 2021;118(25):e2024815118. Additional Declarations Competing interest reported. SH Lee is Director of the Milford Molecular Diagnostics Laboratory specialized in developing DNA sequencing-based diagnostic tests implementable in community hospital laboratories. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-8271122\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":558831209,\"identity\":\"53737656-8052-410e-9beb-aec7adc5d5a7\",\"order_by\":0,\"name\":\"Sin Hang Lee\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAw0lEQVRIiWNgGAWjYDACCeYGBgYDCTlStDACtVRYGAOZIBaDBJFazlQkNhCtRX52Y+ODj20S6fNnNx9/wLjDpo6gFoM7B5sNZ7ZJ5G64cyyxgfFMGmFbDCQS26R5QVokcgwbGNsOE+GwGYntv/8CHSY/I/8jUMt/Irx/I7GNmeGMRALDjRxGoJYDRDjsRmKzZE+FhOGGG2mGMxLbkiUbCDss+eCHHwZ18kDGgw8f2+z4CTsMBSSQqH4UjIJRMApGAQ4AAG6SPqg3X6J6AAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Milford Molecular Diagnostics Laboratory\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Sin\",\"middleName\":\"Hang\",\"lastName\":\"Lee\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-12-03 14:08:20\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-8271122/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-8271122/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":98076110,\"identity\":\"aacb48b1-ed56-4400-9098-97019b40b8cc\",\"added_by\":\"auto\",\"created_at\":\"2025-12-12 13:40:08\",\"extension\":\"docx\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":1494300,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SangersequencingSciRepMSRevision3.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/b0dfb881120ae6bca74fabf6.docx\"},{\"id\":98429180,\"identity\":\"d45bd923-530a-448b-b2b3-28a74df5d91e\",\"added_by\":\"auto\",\"created_at\":\"2025-12-17 16:42:55\",\"extension\":\"json\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":4924,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"4802a26a808146fc86f227af20258d2e.json\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/cdffe765bf51880b90447134.json\"},{\"id\":98427456,\"identity\":\"bd85be94-8aef-4b60-9355-7578eb908d0b\",\"added_by\":\"auto\",\"created_at\":\"2025-12-17 16:40:29\",\"extension\":\"xml\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":80867,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"4802a26a808146fc86f227af20258d2e1enriched.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/899d5be594611ebbf5e01183.xml\"},{\"id\":98429314,\"identity\":\"1b86bb16-491e-4b78-8036-400031af6cf4\",\"added_by\":\"auto\",\"created_at\":\"2025-12-17 16:43:12\",\"extension\":\"png\",\"order_by\":10,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":26273,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage10.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/180e74aada2177a46b770020.png\"},{\"id\":98429817,\"identity\":\"95252e62-7806-47e1-b02a-6650ff5e4a81\",\"added_by\":\"auto\",\"created_at\":\"2025-12-17 16:44:11\",\"extension\":\"png\",\"order_by\":13,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":92467,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/1968da5004b9faa4cd1ffad0.png\"},{\"id\":98427556,\"identity\":\"2fb0c73f-e25f-46f0-913d-76591f999f85\",\"added_by\":\"auto\",\"created_at\":\"2025-12-17 16:40:40\",\"extension\":\"png\",\"order_by\":14,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":8130,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage10.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/696a2e8fd295ba51f790b03b.png\"},{\"id\":98429443,\"identity\":\"4c752ed6-3dc0-4b30-bd9d-e50ec4b75b46\",\"added_by\":\"auto\",\"created_at\":\"2025-12-17 16:43:28\",\"extension\":\"png\",\"order_by\":15,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":102957,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/d5444c5e93c9b525c4f0a6f4.png\"},{\"id\":98429523,\"identity\":\"442dcc16-8b2d-4d89-a7ae-1ac6216f515d\",\"added_by\":\"auto\",\"created_at\":\"2025-12-17 16:43:37\",\"extension\":\"png\",\"order_by\":16,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":40873,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/097e0adc95affa60758683ea.png\"},{\"id\":98429286,\"identity\":\"a7e6d423-4b01-4478-9ae3-4728c8daf674\",\"added_by\":\"auto\",\"created_at\":\"2025-12-17 16:43:07\",\"extension\":\"png\",\"order_by\":17,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":28509,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/bf1e03cfbf116bed57c7d2b4.png\"},{\"id\":98076122,\"identity\":\"33609ef6-01dc-4aec-b408-a0f44e9428ce\",\"added_by\":\"auto\",\"created_at\":\"2025-12-12 13:40:08\",\"extension\":\"png\",\"order_by\":18,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":32403,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/8f0f09e513e9f072d48f5122.png\"},{\"id\":98429305,\"identity\":\"f9d087bf-8f98-4297-b87c-07e9ab51cb62\",\"added_by\":\"auto\",\"created_at\":\"2025-12-17 16:43:11\",\"extension\":\"png\",\"order_by\":19,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":42108,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/68810769bf2d0be40d232f99.png\"},{\"id\":98076126,\"identity\":\"4299bbaf-dcbd-4f0e-8f03-d9c93ba1d3d7\",\"added_by\":\"auto\",\"created_at\":\"2025-12-12 13:40:09\",\"extension\":\"png\",\"order_by\":20,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":31132,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/d1467d478913194653ce36a1.png\"},{\"id\":98076130,\"identity\":\"6fad6deb-a731-4dc5-b3a2-f52229acc41d\",\"added_by\":\"auto\",\"created_at\":\"2025-12-12 13:40:09\",\"extension\":\"png\",\"order_by\":21,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":104307,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/f842f4299e4677bb7d9388e7.png\"},{\"id\":98427457,\"identity\":\"2f5f3561-457a-4675-bd1f-82841e73cb5c\",\"added_by\":\"auto\",\"created_at\":\"2025-12-17 16:40:29\",\"extension\":\"png\",\"order_by\":22,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":53384,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage9.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/5a1ff7bfd0909b289bc556d4.png\"},{\"id\":98429839,\"identity\":\"1b885b6d-c1a9-4c3e-bba9-db84bbf3a68d\",\"added_by\":\"auto\",\"created_at\":\"2025-12-17 16:44:12\",\"extension\":\"xml\",\"order_by\":23,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":79711,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"4802a26a808146fc86f227af20258d2e1structuring.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/c6392500c3464eaf17a8f760.xml\"},{\"id\":98429346,\"identity\":\"070e016a-76e7-4f16-9e4b-85c004b18582\",\"added_by\":\"auto\",\"created_at\":\"2025-12-17 16:43:15\",\"extension\":\"html\",\"order_by\":24,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":88839,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"earlyproof.html\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/c587d3d3d30e5ea52052a9ed.html\"},{\"id\":98076108,\"identity\":\"4517e459-63dd-40bd-8b8f-34592d8f0b99\",\"added_by\":\"auto\",\"created_at\":\"2025-12-12 13:40:08\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":226278,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eComputer-generated electropherogram showing a segment of SARS-CoV-2 N gene sequence in one of the 16 RT-PCR positive samples. The forward Co4 PCR primer was the sequencing primer. The reverse Co3 PCR primer site is underlined in the end of the sequence. This segment of the N gene has two base mutations, a G→T and a C→G indicated by arrows, against the SARS-CoV- 2 Wuhan-Hu-1 NCBI Reference Sequence NC_045512.2.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/517950ef71577a2b7d7c9c89.png\"},{\"id\":98076113,\"identity\":\"7c9a21b2-fd4f-42fd-a18a-8c3e13a6c50f\",\"added_by\":\"auto\",\"created_at\":\"2025-12-12 13:40:08\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":253160,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eElectropherogram showing the result of reverse sequencing of the same PCR product used to generate the sequence illustrated in Fig. 1. The sequencing primer was the reverse Co3 PCR primer. The forward Co4 PCR primer site is underlined in the end of the sequence. The two mutated bases in reverse complement are indicated by arrows. Concatenation of the sequences of Figs.1 and 2 generated a 398-base 5’-3’ reading sequence, which has a 100% match with the N gene sequence of several SARS-CoV-2 genomes submitted to the GenBank in 2020 in the United Staes (GenBank Seq.ID MW566928, MW523480, and MW460593).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/7e5c398baccce9638cab85ce.png\"},{\"id\":98429197,\"identity\":\"87527ea7-ab7b-4cd8-b7ca-f22d6ea84a87\",\"added_by\":\"auto\",\"created_at\":\"2025-12-17 16:42:57\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":118435,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSequencing electropherogram of a false-positive heminested RT-PCR product using the forward Co4 PCR primer as the sequencing primer. This heminested RT- PCR product was generated in the same batch and sequenced in the same series as that used for Fig. 1. In the absence of a fully matched target DNA template, the primers attached to numerous partially matched nontarget single-stranded DNAs in the PCR process for enzymatic primer extension, and generated numerous short PCR amplicons that dominate the sequence as illustrated in this electropherogram. The computer attempted to perform base calling on such a mixture of complex sequences and produced a useless or unreliable sequence.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/4edfb61c68185513f4f201ad.png\"},{\"id\":98076115,\"identity\":\"bf24da5f-7d4e-417a-b9d1-7291609869b2\",\"added_by\":\"auto\",\"created_at\":\"2025-12-12 13:40:08\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":78946,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eAfter the short PCR amplicon sequences in Fig. 3 were trimmed off, a readable sequence of 61 dominant bases was generated by the computer as follows: \\u0026nbsp;AGCCTCTGCCCCTGGCTTCAGCTTCAAAGGGTCATGGTCA\\u003cu\\u003eGCAGACGTGGTCCAGAACAAA\\u003c/u\\u003e.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/8c7a8dcaca982092268d3a1a.png\"},{\"id\":98429656,\"identity\":\"20fef107-1cae-424f-935b-2e46b6a961b4\",\"added_by\":\"auto\",\"created_at\":\"2025-12-17 16:43:57\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":136504,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSequence information retrieved from the GenBank database showing that the nontarget sequences in Figs. 3 and 4 might have been generated from amplicons of the chromosomal DNA of human cells, bacteria and fungi in the nasopharyngeal swab samples. The sequences typed in red are those in the 3’-end of the Co3 primer, which are shared with the nontarget DNAs. It takes only a 6-bp complementary sequence at the 3’-end of a primer to initiate an enzymatic primer extension [17].\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/1a2d1a5232739e761fa0271e.png\"},{\"id\":98427736,\"identity\":\"f1e46a9a-4cdc-41e2-b491-b96e0bd2e0d0\",\"added_by\":\"auto\",\"created_at\":\"2025-12-17 16:41:03\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":97352,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThis is an electropherogram showing that the M1/M2 PCR primer pair amplified a segment of human genomic DNA in the absence of a target Borrelial 16S rRNA gene DNA template , causing a false-positive PCR. The M2 primer was used as the sequencing primer. The M1 PCR primer site is underlined.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/2e39628c501032b53e225d36.png\"},{\"id\":98076119,\"identity\":\"ad8faf48-d9ab-475d-bb00-34b036447db9\",\"added_by\":\"auto\",\"created_at\":\"2025-12-12 13:40:08\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":127261,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThis BLAST report from the GenBank confirms that a segment of human chromosome 8 sequence was amplified during PCR by the M1/M2 primer pair in the absence of a Borrelial DNA template. The 9-base sequence, TTAACACCA, in the end of this human chromosomal DNA sequnce is identical to the 3’-end sequence of the M1 primer.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/1499a44f85ab0b58af9fb93a.png\"},{\"id\":98076133,\"identity\":\"9283828a-dcad-4ae2-b750-01fee6d16ac0\",\"added_by\":\"auto\",\"created_at\":\"2025-12-12 13:40:09\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":260724,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eElectropherogram showing a typical segment of \\u003cem\\u003eB. burgdorferi flaB\\u003c/em\\u003egene sequence (GenBank Sequence ID: CP019767) detected in one of the spit samples when the single copy of chromosomal DNA was aliquoted for \\u003cem\\u003eflaB\\u003c/em\\u003e nested PCR amplification.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/f2a23e91427050af6efbdb67.png\"},{\"id\":98427455,\"identity\":\"c707461a-48b2-4e99-ac9f-f7a7b9179313\",\"added_by\":\"auto\",\"created_at\":\"2025-12-17 16:40:29\",\"extension\":\"png\",\"order_by\":9,\"title\":\"Figure 9\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":146587,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eIn the split sample aliquoted for Borrelial 16S rRNA gene PCR amplification from the same specimen (No. M23-175) used to generate the sequence shown in Fig. 8 , the M1/M2 PCR primer pair amplified multiple nontarget DNA sequences due to the absence of a preferred target template. The M2 primer was the sequencing primer. The M1 primer site is underlined.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage9.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/a6ebc45b9b1e69b45515e3db.png\"},{\"id\":103448382,\"identity\":\"9abbbdaf-140c-41e4-884b-f2be01a703b0\",\"added_by\":\"auto\",\"created_at\":\"2026-02-25 19:59:45\",\"extension\":\"png\",\"order_by\":10,\"title\":\"Figure 10\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":26273,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage10.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/e082f8a428ee040c3eb62778.png\"},{\"id\":104781034,\"identity\":\"cf997a72-240f-48f2-b245-bddb25298582\",\"added_by\":\"auto\",\"created_at\":\"2026-03-17 07:54:32\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1756869,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8271122/v1/c4eea473-923a-4c42-8b79-0afae876cd04.pdf\"}],\"financialInterests\":\"Competing interest reported. SH Lee is Director of the Milford Molecular Diagnostics Laboratory specialized in developing DNA sequencing-based diagnostic tests implementable in community hospital laboratories.\",\"formattedTitle\":\"Sanger sequencing-the gatekeeper to exclude false positives in nucleic acid-based diagnostics for infectious diseases\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eTraditional standard practice in medical diagnostics for infectious diseases is based on culturing pathogens or nucleic acid amplification tests (NAATs), which include techniques like polymerase chain reaction (PCR) and subsequent DNA sequencing to verify the authenticity of the PCR products. After the 2002-2003 outbreak of severe acute respiratory syndrome (SARS), the U.S. Centers for Disease Control and Prevention (CDC) recommended using three specific primers to perform a heminested reverse transcription polymerase chain reaction (RT-PCR) on patient specimens and to sequence a 348-bp PCR amplicon “to verify the authenticity of the amplified product” [1] for molecular diagnosis of SARS-CoV infection. With accurate diagnosis, prompt isolation of patients and early treatment, the SARS pandemic was stopped in July, 2003 before a vaccine was readied for marketing and a virus variant of concern had time to emerge.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;To manage the outbreak of COVID-19 in 2020, the world has used the reverse transcription quantitative polymerase chain reaction (RT-qPCR) technology, instead of the traditional RT-PCR followed by Sanger sequencing of the PCR products, as the primary tool for molecular diagnosis of SARS-CoV-2 infections. Technically, the RT-qPCR assay for SARS-CoV-2 is a probe-based nucleic acid hybridization test as stated in a CDC-owned U.S. patent [2], which claims “The kit of claim 4, further comprising a SARS-CoV probe that hybridizes to the SARS-CoV nucleic acid amplified by the pair of primers, wherein the SARS-CoV probe is labeled with a 5'-reporter dye and a 3'-quencher dye.” \\u0026nbsp;In molecular terms, a TaqMan®\\u0026nbsp;qPCR or RT-qPCR assay simply uses the PCR process, namely the 5’-3’ exonuclease activity of the DNA polymerase, as a tool to determine if a probe, a known short DNA fragment, has hybridized to a single-stranded DNA (ssDNA) molecule. However, DNA/DNA hybridization does not require fully matched sequences to occur. The RT-qPCR assay assumes that a cycle threshold (Ct) number, representing the rate of probe degradation, generated by an instrument can be the proxy for the presence of a pathogen target nucleotide sequence in a patient’s specimen for molecular diagnosis of infectious diseases. This assumption has been challenged by researchers who found that many upper respiratory specimens labeled as positive for SARS-CoV-2 by the RT-qPCR assays did not contain SARS-CoV-2 genomic nucleic acid sequences [3, 4], and the SARS-CoV-2 virus was only successfully isolated from samples with Ct\\u0026nbsp;\\u003cimg width=\\\"12\\\" height=\\\"37\\\" src=\\\"blob:https://wordtohtml.net/833ba425-c590-4858-ac69-f3daa7652339\\\" alt=\\\"image\\\"\\u003e32 [5]. It has been suggested that positive results derived from one commercial test kit should be confirmed using another nucleic acid test or nucleotide sequencing [4].\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;Detection of SARS-CoV-2 genomic nucleic acid sequence in RT-qPCR positive specimens is highly dependent on the Ct values of the RT-qPCR test results. A group of investigators retested 2045 SARS-CoV-2 N gene RT-qPCR positive clinical laboratory specimens, which did not have accompanying Ct values, by genome sequencing for viral lineage designation, and found that a SARS-CoV-2 genomic sequence could not be obtained in 1866 of these specimens, indicative of a false-positive rate of 91% (1866/2045).\\u0026nbsp;In comparison, for specimens with a Ct ≤ 27, the sequencing failure rate was only 5.3%, and for those with a Ct \\u0026gt; 27, the sequencing failure rate was 75.5% [6]. Laboratory directors usually do not report Ct values in their RT-qPCR tests because they often face problems in determining the Ct cut-off for stating that a specimen is positive with a low viral load versus being called indeterminate or equivocal [7]. Many laboratories may call all equivocal test results with high Ct values as positive with a low viral load.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;An analysis of the laboratory data collected in Germany between mid-March 2020 and summer 2021 suggested that only 14%—and possibly even fewer, down to 10%—of individuals identified as SARS-CoV-2-positive via PCR testing were actually infected by the SARS-CoV-2 virus [8]. \\u0026nbsp;The authors of this analysis quoted a study, which showed certain SARS-CoV-2 RT-qPCR assays [9] can even generate positive results on water controls at Ct values between 36 and 38 as a possible cause of false positives.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;PCR was invented to amplify a specific DNA sequence in a test tube, which can facilitate implementation of Sanger sequencing in any properly equipped laboratories [10], while qPCR was designed to quantify small amounts of a known DNA sequence in solution [11]. Neither PCR result nor qPCR result can be relied upon for valid detection of a pathogen’s genomic nucleic acid sequence in a complex patient specimen for diagnostic purpose because DNA polymerase may extend a primer even if it is annealed to a partially matched DNA when its preferred target DNA template is not available. The purpose of this paper is to reiterate with actual patient specimens for illustration that Sanger sequencing is the tool to verify what has been amplified in a PCR testing to exclude false positives. False positives in infectious disease testing can lead to unnecessary quarantines and the misuse of public health resources.\\u003c/p\\u003e\"},{\"header\":\"Materials and Methods\",\"content\":\"\\u003cp\\u003eThis work is part of a research project designed to develop routine Sanger sequencing-based testing for the diagnosis of SARS-CoV-2 infection and spirochetemia at the early localized stage of Lyme disease in a CLIA-certified laboratory in the United States. \\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eSARS-CoV-2 RT-qPCR positive samples\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe material used for SARS-CoV-2 testing was the residues of 30 nasopharyngeal swab samples, each in 1–2 mL of viral transport medium (VTM), certified to be RT-qPCR positive for SARS-CoV-2 N gene RNA with Ct values ranged from 14.55 to 36.71 by a Food and Drug Administration (FDA)-endorsed commercial reference laboratory (Boca Biolistics Reference Laboratory, Pompano Beach, FL). These samples were collected in the month of October, 2020 from patients with respiratory infection in southern Florida, U.S.A. The sample residues were stored in a -80°C freezer or kept in dry ice during transit until testing. This material was used for a previous study on SARS-CoV-2 variant determination [12].\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eSpecimens for Lyme disease spirochetemia\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe material used for the Lyme disease pathogen Sanger sequencing-based testing was 145 platelet-rich plasma (PRP) specimens ( 1 mL each) collected and prepared by DiaSorin, Inc., Stillwater, MN, USA from 145 people residing in Lyme disease-endemic areas in the United States during the Lyme disease season in 2023 according to a research protocol in compliance with 21 CFR 812 . Part of the Sanger sequencing results of these 145 PRP specimens were previously published [13].\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eSARS-CoV-2 N gene heminested RT-PCR and sequencing\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFor preparation of the SARS-CoV-2 nucleic acid heminested RT-PCR products to be used as templates for Sanger sequencing, about 1 mL of the residues of the nasopharyngeal swab rinse in VTM was transferred to a graduated 1.5 mL microcentrifuge tube and centrifuged at ~16,000× g for 5 min to pellet all cells and cellular debris. The supernatant was discarded except for the last 0.2 mL, which was left in the test tube with the pellet. To each test tube containing the pellet with 0.2 mL supernatant, 200 µL of digestion buffer containing 1% sodium dodecyl sulfate, 20mM Tris-HCl (pH 7.6), 0.2M NaCl and 700 μg/mL proteinase K, was added. The mixture was digested for 1 hr in a heated shaker set at 47°C. After digestion, an equal volume (400 µL) of acidified 125:24:1 phenol:chloroform:isoamyl alcohol mixture (Thermo Fisher Scientific Inc.) was added to each tube. After vortexing twice for extraction and centrifugation at ~16,000× g for 5 min to separate the phases, the liquid in the phenol/chloroform phase was pipetted out and discarded. To the remaining aqueous phase solution 300 µL of acidified 125:24:1 phenol:chloroform:isoamyl alcohol mixture was added for a second extraction. After a second centrifugation at ~16,000× g for 5 min to separate the phases, 200 µL of the aqueous supernatant without any material at the interface was transferred to a new 1.5 mL microcentrifuge tube.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTo the 200 µL of phenol/chloroform-extracted aqueous solution, 20 µL of 3M sodium acetate (pH 5.2) and 570 µL of ice-cold 95% ethanol were added. The mixture was placed into a cold metal block in a -15 to -20°C freezer for 20 min. The precipitated nucleic acids were centrifuged at ~16,000× g for 5 min and washed with 700 µL of ice-cold 70% ethanol.\\u003c/p\\u003e\\n\\u003cp\\u003eAfter a final centrifugation at ~16,000× g for 5 min, the 70% ethanol was completely removed with a fine-tip pipette, and the microcentrifuge tubes with opened caps were put into a vacuum chamber for 10 minutes to evaporate the residual ethanol. The nucleic acids in each tube were dissolved in 50 µL of UltraPure™ DEPC-Treated Water (ThermoFisher Scientific). All samples were tested immediately.\\u003c/p\\u003e\\n\\u003cp\\u003eTo initiate the primary RT-PCR, a total volume of 25 µL mixture was made in a PCR tube containing 20 µL of ready-to-use LoTemp® PCR mix with denaturing chemicals (HiFi DNA Tech, LLC, Trumbull, CT, USA), 1 µL (200 units) of Invitrogen SuperScript III Reverse Transcriptase, 1 µL (40 units) of Ambion™ RNase Inhibitor, 0.1 µL of Invitrogen 1 M DTT (dithiothreitol), 1 µL of 10 µmolar Co1 primary forward primer (5’-ACATTGGCACCCGCAATCCTG-3’) in TE buffer, 1 µL of 10 µmolar Co3 primary reverse primer (5’-TTTGTTCTGGACCACGTCTGC-3’) in TE buffer and 1 µL of sample nucleic acid extract or 1 µL of ATCC VR-3276T synthetic RNA as positive control, and 1 µL of M.B. grade water as negative control. The ramp rate of the thermal cycler was set to 0.9 °C/s. The program for the temperature steps was set as: 47°C for 30 min to generate the cDNA, 85°C 1 cycle for 10 min, followed by 30 cycles of 85°C 30 sec for denaturing, 50°C 30 sec for annealing, 65°C 1 min for primer extension, and final extension 65°C for 10 minutes.\\u003c/p\\u003e\\n\\u003cp\\u003eTo perform the heminested PCR, a trace (about 0.2 μL) of the primary PCR products was transferred by a calibrated micro-glass rod into a 25 μL volume of complete heminested PCR mixture containing 20 μL of ready-to-use LoTemp® mix, 1 μL of 10 μmolar Co4 heminested forward primer (5’-CAATCCTGCTAACAATGCTGC-3’), 1 μL of 10 μmolar Co3 heminested reverse primer (5’-TTTGTTCTGGACCACGTCTGC-3’) and 3 μL of M.B. grade water. The thermocycling steps were programmed to 85°C 1 cycle for 10 min, followed by 30 cycles of 85°C 30 sec for denaturing, 50°C 30 sec for annealing, 65°C 1 min for primer extension, and final extension 65°C for 10 minutes.\\u003c/p\\u003e\\n\\u003cp\\u003eAliquots of all primary and nested PCR products were analyzed by agarose gel electrophoresis. The heminested PCR products yielding a band of about 398 bp in size on the gel plate were subject to Sanger sequencing without further purification.\\u003c/p\\u003e\\n\\u003cp\\u003eAbout 0.2 µL of the 398-bp SARS-CoV-2 heminested PCR product, if detected at gel electrophoresis, was transferred by a micro-glass rod from the heminested PCR tube into a Sanger reaction tube containing 1 μL of 10 μmolar sequencing primer (Co3 or Co4), 1 μL of BigDye® Terminator (v 1.1/Sequencing Standard Kit), 3.5 μL 5× buffer, and 14.5 μL M.B. grade water in a total volume of 20 μL for 20 enzymatic primer extension/termination reaction cycles according to the protocol supplied by the manufacturer (Applied Biosystems, Foster City, CA, USA). After a dye-terminator cleanup with a Centri Sep column (Princeton Separations, Adelphia, NJ, USA), the reaction mixture was loaded in an Applied Biosystems SeqStudio Genetic Analyzer for sequence analysis. Sequence alignments were performed against the reference sequences stored in the GenBank database by on-line BLAST alignment analysis, as\\u0026nbsp;previously published by Lee [14]. \\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eLyme disease pathogen DNA PCRs and sequencing\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe platelet pellets derived from the PRP and whole blood samples were used for molecular diagnosis of Lyme disease spirochetemia; the technical details were previously published by Lee and co-workers [13, 15]. Briefly, the platelet pellet was resuspended in 0.5 M ammonium hydroxide in a 1.5 mL microcentrifuge tube. The microcentrifuge tube containing the mixture was heated at 97 °C for 5 min with closed cap, followed by 10 min with open cap. The released DNA was precipitated by cold ethanol. The suspension of the precipitated DNA was divided into two equal parts for spit-sample testing. One part was for \\u003cem\\u003eB. burgdorferi flaB\\u0026nbsp;\\u003c/em\\u003egene nested PCR amplification and the other was for borrelial 16S rRNA gene amplification. The M1 forward primer (5′-ACGATGCACACTTGGTGTTAA-3′), and the M2 reverse primer (5’- TCCGACTTATCACCGGCAGTC-3′) were used for both the primary and the same-nested PCR amplification of a 357/358-bp segment of the borrelial 16S rRNA gene [16]. The \\u003cem\\u003eflaB\\u003c/em\\u003e outer forward (FOF) primer (5′-GCATCACTTTCAGGGTCTCA 3′), the \\u003cem\\u003eflaB\\u003c/em\\u003e outer reverse (FOR) primer (5′-TGGGGAACTTGATTAGCCTG-3′) were the primers of the primary PCR to amplify a 503-bp segment of the \\u003cem\\u003eB. burgdorferi flaB\\u003c/em\\u003e gene. The primers for nested PCR\\u0026nbsp;were the \\u003cem\\u003eflaB\\u003c/em\\u003e inner forward (FIF) primer (5′-CTTTAAGAGTTCATGTTGGAG-3′) and the \\u003cem\\u003eflaB\\u0026nbsp;\\u003c/em\\u003einner reverse (FIR) primer (5′-TCATTGCCATTGCAGATTGT-3′) to amplify a 447-bp segment of the \\u003cem\\u003eB. burgdorferi flab\\u003c/em\\u003e gene [13]. The nested PCR primers were used as the sequencing primers for bidirectional Sanger sequencing to verify the PCR products. \\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"Performing heminested RT-PCR on the 30 nasopharyngeal swab samples, which were RT-qPCR positive for the SARS-CoV-2 N gene, generated only 19 PCR products of about 398 bp in size visible on gel electrophoresis. Bidirectional Sanger sequencing yielded a 398-base sequence, which has a 100% nucleotide match with a SARS-CoV-2 N gene reference sequence in the GenBank, in 16 of the 19 (16/19) heminested RT-PCR products. A pair of electropherograms showing the sequence of one of the 16 true positives is illustrated in Figures 1 and 2.\\n\\nFig.1. Computer-generated electropherogram showing a segment of SARS-CoV-2 N gene sequence in one of the 16 RT-PCR positive samples. The forward Co4 PCR primer was the sequencing primer. The reverse Co3 PCR primer site is underlined in the end of the sequence. This segment of the N gene has two base mutations, a G→T and a C→G indicated by arrows, against the SARS-CoV- 2 Wuhan-Hu-1 NCBI Reference Sequence NC_045512.2.\\n\\nFig. 2. Electropherogram showing the result of reverse sequencing of the same PCR product used to generate the sequence illustrated in Fig. 1. The sequencing primer was the reverse Co3 PCR primer. The forward Co4 PCR primer site is underlined in the end of the sequence. The two mutated bases in reverse complement are indicated by arrows. Concatenation of the sequences of Figs.1 and 2 generated a 398-base 5’-3’ reading sequence, which has a 100% match with the N gene sequence of several SARS-CoV-2 genomes submitted to the GenBank in 2020 in the United Staes (GenBank Seq.ID MW566928, MW523480, and MW460593).\\n\\nThree (3) of the 19 heminested RT-PCR positive products contained amplicons of nontarget DNAs. An electropherogram showing the sequences of these nontarget DNAs is illustrated in Figure 3.\\n\\nFig. 3. Sequencing electropherogram of a false-positive heminested RT-PCR product using the forward Co4 PCR primer as the sequencing primer. This heminested RT- PCR product was generated in the same batch and sequenced in the same series as that used for Fig. 1. In the absence of a fully matched target DNA template, the primers attached to numerous partially matched nontarget single-stranded DNAs in the PCR process for enzymatic primer extension, and generated numerous short PCR amplicons that dominate the sequence as illustrated in this electropherogram. The computer attempted to perform base calling on such a mixture of complex sequences and produced a useless or unreliable sequence.\\n\\nTo investigate the possible origins of the nontarget DNAs that were amplified as false-positive PCR products and shown in Figure 3, the highly mixed dominating short sequences in Figure 3 were trimmed off for a second base call to generate a readable sequence shown in Figure 4.\\n\\nFig. 4. After the short PCR amplicon sequences in Fig. 3 were trimmed off, a readable sequence of 61 dominant bases was generated by the computer as follows: AGCCTCTGCCCCTGGCTTCAGCTTCAAAGGGTCATGGTCAGCAGACGTGGTCCAGAACAAA. \\n\\nThe Co3 reverse PCR primer site is marked with a black underline. A 9-base sequence immediately downstream of the primer Co3 is marked with a blue underline.\\n\\nThe 9-base sequence in contiguity with a 6-base sequence in the 3’-end of the Co3 primer as shown in Fig. 4 is also present in some human, fungal and bacterial chromosomes. In the absence of the target SARS-CoV-2 nucleic acids, the Co3 primer can anneal to a human, a fungal or a bacterial chromosomal DNA strand to initiate enzymatic DNA synthesis or a PCR as illustrated in Figure 5.\\n\\nFig. 5. Sequence information retrieved from the GenBank database showing that the nontarget sequences in Figs. 3 and 4 might have been generated from amplicons of the chromosomal DNA of human cells, bacteria and fungi in the nasopharyngeal swab samples. The sequences typed in red are those in the 3’-end of the Co3 primer, which are shared with the nontarget DNAs. It takes only a 6-bp complementary sequence at the 3’-end of a primer to initiate an enzymatic primer extension [17].\\n\\nBlood specimens of healthy people are usually free of bacteria and fungi, and generate less false-positive PCR results. When human whole blood specimens are used for detection of B. burgdorferi spirochetemia, false-positive PCR products often consist of amplicons of human genomic sequences that can be confirmed by Sanger sequencing as shown in Figure 6.\\n\\nFig. 6. This is an electropherogram showing that the M1/M2 PCR primer pair amplified a segment of human genomic DNA in the absence of a target Borrelial 16S rRNA gene DNA template , causing a false-positive PCR. The M2 primer was used as the sequencing primer. The M1 PCR primer site is underlined.\\n\\nSubmission of a segment of the sequence illustrated in Figure 6 to the GenBank for BLAST analysis induced a report shown in Figure 7.\\n\\nFig. 7. This BLAST report from the GenBank confirms that a segment of human chromosome 8 sequence was amplified during PCR by the M1/M2 primer pair in the absence of a Borrelial DNA template. The 9-base sequence, TTAACACCA, in the end of this human chromosomal DNA sequnce is identical to the 3’-end sequence of the M1 primer.\\n\\nWhen the platelet pellet derived from 1 mL of PRP was used as the material for detecting 1-3 B.burgdorferi cells by PCR, the human chromosomal DNA is largely excluded. However, the platelet pellet still contains a large amount of mitochondrial DNA. In the split sample testing, a single Borrelial chromosome in the entire specimen might be aliquoted for the flaB gene amplification and none was in the sample aliquoted for the 16S rRNA gene PCR. As a result, the nested PCR of the flaB gene generated an amplicon for Sanger sequencing (Figure 8) while the nested PCR for 16S rRNA gene generated a human mitochondtrial DNA amplicon (Figures 9 and 10) from the same specimen (M23-175).\\n\\nFig. 8. Electropherogram showing a typical segment of B. burgdorferi flaB gene sequence (GenBank Sequence ID: CP019767) detected in one of the spit samples when the single copy of chromosomal DNA was aliquoted for flaB nested PCR amplification.\\n\\nFig. 9. In the split sample aliquoted for Borrelial 16S rRNA gene PCR amplification from the same specimen (No. M23-175) used to generate the sequence shown in Fig. 8 , the M1/M2 PCR primer pair amplified multiple nontarget DNA sequences due to the absence of a preferred target template. The M2 primer was the sequencing primer. The M1 primer site is underlined.\\n\\nFig. 10. Submission of a segment of clear DNA sequence excised from Fig. 9 to the GenBank for BLAST analysis induced a report confirming that the dominant segment of DNA being amplified as shown in Fig. 9 is a human mitochondrial DNA because this segment of mitochondrial DNA shares an 8-base sequence, TTAACACC, with the M1 primer in its 3’-end (typed in red).\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eQuantitative PCR (qPCR), PCR (conventional PCR), and Sanger sequencing are common molecular tools for diagnosing infectious diseases, all designed to test for a pathogen's genomic nucleic acid derived from patient specimens. However, only Sanger sequencing can provide physical evidence of detecting a specific nucleic acid and is considered the \\\"gold standard\\\" for validating other nucleic acid amplification diagnostic tests. In the current study, retesting the residues of 30 nasopharyngeal swab samples, which were certified as RT-qPCR positive for SARS-CoV-2 and marketed as reference materials for medical diagnostic device development, shows that only 16 of these 30 reference samples contained SARS-CoV-2 nucleic acid confirmed by Sanger sequencing, indicating that the RT-qPCR assay has a false-positive rate of 46.7% (14/30). This finding is not surprising because other researchers also found SARS-CoV-2 RT-qPCR positive results with a Ct \\u0026gt; 27 have a sequencing failure rate of 75.5% [6] and the Ct values of these 30 reference samples had a range from 14.55 to 36.71. \\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;False positive SARS-CoV-2 RT-qPCR results have been reported in peer-reviewed medical journals [3, 4, 7], and are often considered to be caused by contamination from nucleic acid amplification test (NAAT) amplicon, from other specimens or from synthetic template [18, 19]. False positives due to contamination can be mitigated by improved workflow management and employee training. In the current study, Sanger sequencing of the false-positive PCR products (Figures 3-5) shows that false-positive PCR results may be due to amplification of nontarget DNAs extracted from human cells, bacteria and fungi in the nasopharynx. This type of false positives is inevitable due to the nature of the PCR technology.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;The function of DNA polymerase is to extend a primer that is annealed to a single-stranded DNA template by adding new nucleotides to the 3’-end of the primer to build a new complementary strand. However, the annealing of a primer to a DNA template does not strictly require fully matched sequences. A 12-base complementary stretch can be sufficient to create a stable duplex [20]. In the absence of a fully matched template a 6-bp complementary sequence at the 3’-end of a primer is sufficient to initiate an enzymatic primer extension [17], as demonstrated in Figures 4 and 5 in this report.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;Using the platelet pellets properly prepared by differential centrifugation for detection of 1-3 \\u003cem\\u003eB.\\u003c/em\\u003e \\u003cem\\u003eburgdorferi\\u0026nbsp;\\u003c/em\\u003espirochetes in the blood specimen of Lyme disease patients [13] has excluded all human chromosomal DNA from the PCR. But the primers designed for Borrelial 16S rRNA gene DNA PCR still can amplify human mitochondrial DNAs in samples without the Borrelial DNA template \\u0026nbsp;(Figures 9 and 10). In molecular diagnostics for infectious diseases, unintended PCR amplification of nontarget DNAs derived from true-negative human specimens is always a possibility. Sanger sequencing of the PCR products is the most convenient gatekeeper to eliminate these PCR-induced false positives. \\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;The value of using Sanger sequencing to monitor the accuracy of molecular diagnosis of infectious diseases is recognized by the veterinary laboratory diagnosticians, and a set of national guidelines for putting sequence analysis into practice has been compiled by the Laboratory Technology Committee of the American Association of Veterinary Laboratory Diagnosticians [21]. If similar guidelines were adopted for monitoring the accuracy of molecular diagnosis of human infectious diseases, numerous false-positive diagnoses of COVID-19 [3, 4, 7, 22], HPV infections [23] and Lyme disease [24] due to unmonitored NAATs would have been avoided.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;To implement Sanger sequencing-based molecular diagnostics for infectious diseases, instead of overemphasizing the need for pre-PCR isolation, purification, and quantification of the DNA extracted from the clinical specimens [21], which is of little relevance to getting the target DNA into PCR for amplification, the better approach is to design an optimized high-fidelity nested PCR protocol to prepare a mass of clean homogeneous nested PCR amplicons for Sanger sequencing.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;A properly prepared nested, heminested or same-nested PCR product can be used directly as the template for Sanger sequencing to generate high-quality sequence electropherograms for diagnostic interpretation, as shown in Figures 1, 2 and 8 of this report and in a few articles previously published [12-15].\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;In general, conventional PCR is not sensitive enough for molecular detection of infectious agents in clinical specimens. According to the Guidelines for PCR Optimization published by New England BioLab Inc., when a program of 25–30 cycles is used for PCR amplification, it takes about 10\\u003csup\\u003e4\\u003c/sup\\u003e copies of target DNA as the template to generate a PCR product that can be visualized as a band in agarose gel electrophoresis [25] because when testing for a pathogen’s genomic DNA in human specimens PCR amplification never reaches its theoretical 100% efficiency due to the presence of PCR inhibitors among many other interfering factors as shown by Roux and colleagues [26] and by Svec and colleagues [27]. It is technically difficult to put 10\\u003csup\\u003e4\\u003c/sup\\u003e copies of target pathogen DNA into a primary PCR mixture without simultaneously introducing a large amount of PCR inhibitors because very few routine methods are available for selectively removing host DNA from the crude DNA extracts. Pre-PCR purification of DNA in complex human samples may risk losing the target DNA altogether when the latter is low in quantity. This is especially important in testing for \\u003cem\\u003eB.\\u003c/em\\u003e \\u003cem\\u003eburgdorferi\\u003c/em\\u003e cells in Lyme disease patients with spirochetemia. In these patients, there may be just one \\u003cem\\u003eB. burgdorferi\\u003c/em\\u003e spirochete in the blood specimen [13], as demonstrated in Figures 8 and 9. The amount of DNA extract used to initiate a primary PCR must be customarily optimized for each clinical specimen and pathogen. To detect a single copy of Borrelial chromosomal DNA, the entire DNA extract from the platelet pellet must be used to initiate a primary PCR. In contrast, since there are about 10\\u003csup\\u003e5\\u003c/sup\\u003e viral particles within a single SARS-CoV-2 infected cell at any point in time [28], 1\\u0026nbsp;µL of the nucleic acid extract is enough for the primary RT-PCR when cellular components of the patient’s nasopharyngeal swab are included in the test material.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;In the nested PCR protocol described above, the initial concentration of PCR inhibitors in the crude DNA extracts is approximately diluted 3125 (25x25/0.2) fold in the nested PCR mixture. Such a dilution factor has largely eliminated the effects of the inhibitors carried over from the crude DNA extract into the nested PCR so that only a small number of target DNA primary PCR amplicons are needed for replication to form a mass of homogeneous nested PCR amplicons to be used as the template for Sanger sequencing. Since only 0.2 µL of the nested PCR product is used for a Sanger reaction in a total volume of ~20 mL, the unwanted nested PCR primer residue is diluted more than 100-fold. At this dilution, the small numbers of interfering sequences generated by the unwanted nested PCR primer usually disappear into the baseline in the electropherograms (Figures 1, 2, 8).\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eAll PCR-based molecular diagnostics for infectious diseases may generate false-positive results because PCR primers can anneal to nontarget DNA strands extracted from the complex patient specimens in the absence of their preferred target DNA template and initiate enzymatic primer extension and even an unwanted PCR. False-positive test results for infectious diseases can lead to personal anxiety, unnecessary medical treatments, and significant costs, while on a societal level, they can strain public health resources and cause public panic. Using Sanger sequencing to verify the authenticity of all PCR-amplified products in a diagnostic laboratory can eliminate false-positives except for contamination due to technical errors that can be mitigated by improved management and employee training. This study also shows that using a properly designed nested PCR protocol can eliminate the need for pre-PCR isolation, purification, and quantification of the extracted sample DNA. Crude DNA extracts can be used to initiate a primary PCR. A properly generated nested PCR product can be used directly for Sanger sequencing without further purification to facilitate implementation of sequence analysis in diagnostic laboratories.\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003eThis study was supported by a statement of Independent Investigational Review Board, Inc. (Columbia, MD, USA) SOP 10-00414 Rev E and IRB approved protocols at multiple blood collection sites after informed consent was obtained in accordance with applicable regulations and compliant to 21 CFR 812.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe author thanks Ashli Rode and her colleagues in DiaSorin, Inc. for supplying the platelet-rich plasma specimens used in part of this study.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eSH Lee developed the methodology, supervised the testing, analyzed the PCR and Sanger sequencing results, wrote the manuscript and revised the manuscript after peer reviews. The author has participated sufficiently in the work and agreed to be accountable for all aspects of the work.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis research received no external funding.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe datasets generated and/or analyzed during the current study are available in the GenBank with accession Seq.ID MW566928, MW523480, MW460593 and CP019767.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eDiaSorin, Inc., Stillwater, MN, USA enrolled the 145 patients and healthy donor controls in the Lyme disease-endemic areas and performed the initial specimen preparation for a research project after informed consent was obtained in accordance with applicable regulations in compliance with 21 CFR 812. Written document is available upon request. The study was carried out in accordance with the guidelines of the Declaration of Helsinki.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll authors of this study agreed to publish.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eInstitutional review board statement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe commercial supplier of the 30 SARS-CoV-2 RT-qPCR positive nasopharyngeal swabs (Boca Biolistics, LLC, Pompano Beach, FL, USA) has provided a statement of Independent Investigational Review Board, Inc. (Columbia, MD, USA) SOP 10-00414 Rev E (De-Linking Specimens).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eSH Lee is Director of the Milford Molecular Diagnostics Laboratory specialized in developing DNA sequencing-based diagnostic tests implementable in community hospital laboratories.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n \\u003cli\\u003eCDC. SARS-CoV Specific RT-PCR Primers. https://www.who.int/publications/m/item/sars-cov-specific-rt-pcr-primers \\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eU.S. Patent No.: US 7,776,521 B1 CORONAVIRUS ISOLATED FROM HUMANS. Assignee: CDC. Date of Patent: Aug. 17, 2010. \\u0026nbsp;https://www.lens.org/lens/patent/134-714-336-789-388/frontpage \\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eBasile K, Maddocks S, Kok J, Dwyer DE. Accuracy amidst ambiguity: false positive SARS-CoV-2 nucleic acid tests when COVID-19 prevalence is low. Pathology. 2020;52(7):809-811.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eRahman H, Carter I, Basile K, Donovan L, Kumar S, Tran T, Ko D, Alderson S, Sivaruban T, Eden JS, Rockett R, O\\u0026apos;Sullivan MV, Sintchenko V, Chen SC, Maddocks S, Dwyer DE, Kok J. Interpret with caution: An evaluation of the commercial AusDiagnostics versus in-house developed assays for the detection of SARS-CoV-2 virus. J Clin Virol. 2020;127:104374.\\u003c/li\\u003e\\n \\u003cli\\u003eBasile K, McPhie K, Carter I, Alderson S, Rahman H, Donovan L, Kumar S, Tran T, Ko D, Sivaruban T, Ngo C, Toi C, O\\u0026apos;Sullivan MV, Sintchenko V, Chen SC, Maddocks S, Dwyer DE, Kok J. Cell-based Culture Informs Infectivity and Safe De-Isolation Assessments in Patients with Coronavirus Disease 2019. Clin Infect Dis. 2021;73(9):e2952-e2959.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eTartof SY, Slezak JM, Fischer H, Hong V, Ackerson BK, Ranasinghe ON, Frankland TB, Ogun OA, Zamparo JM, Gray S, Valluri SR, Pan K, Angulo FJ, Jodar L, McLaughlin JM. Effectiveness of mRNA BNT162b2 COVID-19 vaccine up to 6 months in a large integrated health system in the USA: a retrospective cohort study. Appendix Table 4. Lancet. 2021;398(10309):1407-1416.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eBraunstein GD, Schwartz L, Hymel P, etal. False Positive Results With SARS-CoV-2 RT-PCR Tests and How to Evaluate a RT-PCR-Positive Test for the Possibility of a False Positive Result. J Occup Environ Med. 2021;63:e159-e162.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eG\\u0026uuml;nther M, Rockenfeller R, Walach H. A calibration of nucleic acid (PCR) by antibody (IgG) tests in Germany: the course of SARS-CoV-2 infections estimated. Front Epidemiol. 2025;5:1592629.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eEtievant S, Bal A, Escuret V, Brengel-Pesce K, Bouscambert M, Cheynet V, Generenaz L, Oriol G, Destras G, Billaud G, Josset L, Frobert E, Morfin F, Gaymard A. Performance Assessment of SARS-CoV-2 PCR Assays Developed by WHO Referral Laboratories. J Clin Med. 2020;9(6):1871.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eAppenzeller T. Democratizing the DNA sequence. Science. 1990;247(4946):1030-2.\\u003c/li\\u003e\\n \\u003cli\\u003eHiguchi R, Fockler C, Dollinger G, Watson R. Kinetic PCR analysis: real-time monitoring of DNA amplification reactions. Biotechnology (N Y). 1993;11:1026-1030.\\u003c/li\\u003e\\n \\u003cli\\u003eLee SH. A Routine Sanger Sequencing Target Specific Mutation Assay for SARS-CoV-2 Variants of Concern and Interest. Viruses. 2021;13(12):2386.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eLee SH. Sanger Sequencing of Borrelia burgdorferi flaB Paralogs Detected Spirochetemia at the Early Localized Stage of Lyme Disease. Front Biosci (Schol Ed). 2025;17(2):31280.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eLee, S.H. Testing for SARS-CoV-2 in cellular components by routine nested RT-PCR followed by DNA sequencing. Int. J. Geriatr. Rehabil. 2020, 2, 69\\u0026ndash;96. https://www.int-soc-clin-geriat.com/info/wp-content/uploads/2020/03/Dr.-Lees-paper-on-testing-for-SARS-CoV-2.pdf \\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eLee SH, Vigliotti JS, Vigliotti VS, Jones W, Moorcroft TA, Lantsman K. DNA sequencing diagnosis of off-season spirochetemia with low bacterial density in Borrelia burgdorferi and Borrelia miyamotoi infections. Int J Mol Sci. 2014;15(7):11364-86.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eLee SH, Healy JE, Lambert JS. Single Core Genome Sequencing for Detection of both Borrelia burgdorferi Sensu Lato and Relapsing Fever Borrelia Species. Int J Environ Res Public Health. 2019;16(10):1779.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eRyu KH, Choi SH, Lee JS. Restriction primers as short as 6-mers for PCR amplification of bacterial and plant genomic DNA and plant viral RNA. Mol Biotechnol. 2000;14(1):1-3.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eHuggett JF, O\\u0026apos;Sullivan DM, Cowen S, Cleveland MH, Davies K, Harris K, Moran-Gilad J, Winter A, Braybrook J, Messenger M. Ensuring accuracy in the development and application of nucleic acid amplification tests (NAATs) for infectious disease. Mol Aspects Med. 2024;97:101275.\\u003c/li\\u003e\\n \\u003cli\\u003eMick E, Kamm J, Pisco AO, Ratnasiri K, Babik JM, Casta\\u0026ntilde;eda G, DeRisi JL, Detweiler AM, Hao SL, Kangelaris KN, Kumar GR, Li LM, Mann SA, Neff N, Prasad PA, Serpa PH, Shah SJ, Spottiswoode N, Tan M, Calfee CS, Christenson SA, Kistler A, Langelier C. Upper airway gene expression reveals suppressed immune responses to SARS-CoV-2 compared with other respiratory viruses. Nat Commun. 2020;11(1):5854.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eGarhyan J, Gharaibeh RZ, McGee S, Gibas CJ. The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization. BMC Res Notes. 2013 ;6:72.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eCrossley BM, Bai J, Glaser A, Maes R, Porter E, Killian ML, Clement T, Toohey-Kurth K. Guidelines for Sanger sequencing and molecular assay monitoring. J Vet Diagn Invest. 2020;32(6):767-775.\\u003c/li\\u003e\\n \\u003cli\\u003eHealy B, Khan A, Metezai H, Blyth I, Asad H. The impact of false positive COVID-19 results in an area of low prevalence. Clin Med (Lond). 2021;21(1):e54-e56.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eSchiffman M, de Sanjose S. False positive cervical HPV screening test results. Papillomavirus Res. 2019 Jun;7:184-187.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eMolloy PJ, Persing DH, Berardi VP. False-positive results of PCR testing for Lyme disease. Clin Infect Dis. 2001;33(3):412-3.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eNew England BioLab Inc. Guidelines for PCR Optimization with Taq DNA Polymerase. Available at: https://www.neb.com/en-us/tools-and-resources/usage-guidelines/guidelines-for-pcr-optimization-with-taq-dna-polymerase\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eRoux G, Ravel C, Varlet-Marie E, Jendrowiak R, Bastien P, Sterkers Y. Inhibition of polymerase chain reaction: Pathogen specific controls are better than human gene amplification. PloS One. 2019; 14: e0219276.\\u003c/li\\u003e\\n \\u003cli\\u003eSvec D, Tichopad A, Novosadova V, Pfaffl MW, Kubista M. How good is a PCR efficiency estimate: Recommendations for precise and robust qPCR efficiency assessments. Biomolecular Detection and Quantification. 2015; 3: 9\\u0026ndash;16.\\u003c/li\\u003e\\n \\u003cli\\u003eSender R, Bar-On YM, Gleizer S, Bernshtein B, Flamholz A, Phillips R, Milo R. The total number and mass of SARS-CoV-2 virions. Proc Natl Acad Sci U S A. 2021;118(25):e2024815118.\\u0026nbsp;\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Sanger sequencing, PCR false-positive, gatekeeper, infectious diseases, nested PCR, nucleic acid-based diagnostics\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-8271122/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-8271122/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e \\u003cp\\u003eFalse-positive results are a known challenge in polymerase chain reaction (PCR)-based diagnostics for infectious diseases. The widespread public testing during the COVID-19 pandemic brought the issue to unprecedented global attention with immense clinical and societal consequences. Most authors of scientific publications claim contamination due to poor laboratory management as the major cause of false-positive PCR test results. However, the possibility of false positives being generated by the PCR technology itself has not been investigated.\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e \\u003cp\\u003eThe residues of 30 patient nasopharyngeal swab samples, which were certified to be positive for SARS-CoV-2 N gene by reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays, were retested by a heminested reverse transcription polymerase chain reaction (RT-PCR), followed by Sanger sequencing to verify the authenticity of the amplified product as the physical evidence for true-positives and to explore the molecular mechanism of generating false positives. In addition, the platelet-rich plasma specimens of 145 people residing in Lyme disease-endemic areas during a Lyme disease season in the United States were used for split-sample nested PCR amplification followed by Sanger sequencing for the detection of \\u003cem\\u003eBorrelia burgdorferi flaB\\u003c/em\\u003e and 16S rRNA genes and to explore the molecular mechanism of false positives.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e \\u003cp\\u003eHeminested RT-PCR generated 19 PCR products from 30 SARS-CoV-2 RT-qPCR positive samples 16 of which contained a segment of SARS-CoV-2 N gene verified by Sanger sequencing. Three of the 19 PCR products showed mixtures of nontarget DNA sequences, possibly derived from the chromosomes of human cells, bacteria and fungi in the nasopharynx. Split-sample PCR testing for \\u003cem\\u003eB. burgdorferi\\u003c/em\\u003e showed that in the absence of the target DNA, the primers designed for Borrelial 16S rRNA gene PCR may amplify segments of the human mitochondrial DNA, causing a false-positive PCR result. Sanger sequencing can eliminate all PCR-induced false positives. This study also showed that when the nested PCR protocol is optimized, the crude DNA extract can be used for initiating a primary PCR without nucleic acid isolation, purification, and quantitation. The nested PCR product can be used directly as the template for Sanger sequencing to facilitate implementation of sequence analysis in diagnostic laboratories.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Sanger sequencing-the gatekeeper to exclude false positives in nucleic acid-based diagnostics for infectious diseases\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-12-12 13:40:02\",\"doi\":\"10.21203/rs.3.rs-8271122/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"c0abcd72-e3f7-4224-ab71-7ccf9bdb59cf\",\"owner\":[],\"postedDate\":\"December 12th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":59490231,\"name\":\"Biological sciences/Biological techniques\"},{\"id\":59490232,\"name\":\"Health sciences/Diseases\"},{\"id\":59490233,\"name\":\"Biological sciences/Microbiology\"},{\"id\":59490234,\"name\":\"Biological sciences/Molecular biology\"}],\"tags\":[],\"updatedAt\":\"2026-03-13T04:55:46+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-12-12 13:40:02\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-8271122\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-8271122\",\"identity\":\"rs-8271122\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}