{"paper_id":"12202510-28c3-4bfd-8e01-2dbfe464e595","body_text":"Lificiguat inhibits the collagen production of hepatic stellate cells independently on sGC activity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Lificiguat inhibits the collagen production of hepatic stellate cells independently on sGC activity Tongguo Yang, Yuyang Gu, Kun Li, Zhi Zheng, Jiheng Shan, Pengfei Chen, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7224016/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Liver fibrosis is driven by activated hepatic stellate cells (HSCs) that overproduce extracellular matrix, particularly collagen. Lificiguat, a soluble guanylate cyclase (sGC) stimulator, exhibits anti-fibrotic potential, but its mechanism in HSC activation remains unclear. This study aims to investigate the anti-fibrotic effect and mechanisms of lificiguat . Methods human HSCs are treated with different concentrations of lificiguat. Cell proliferation was assessed by CCK-8 assay and EdU incorporation assay. Fibrogenic markers of hepatic stellate cell including COL1A1, ACTA2 and TIMP1 are measured with RT-qPCR and Western blot. sGCβ1 (GUCY1B1) or ATG5 knockdown of HSCs are achieved with lentivirus transduction. Bulk RNA sequencing of HSC cells is performed to investigate the differentially expressed genes associated with lificiguat treatment. Serum ALT and AST, hepatic gene expression, and liver histology including Masson and Sirius red staining are analyzed with samples from CCl₄-induced fibrotic mice with or without lificiguat treatment. Results Lificiguat significantly inhibits cell proliferation and COL1A1 expression of HSCs without obvious cytotoxicity. GUCY1B1 knockdown in HSCs doesn’t reverse lificiguat’s effects, which indicates the anti-fibrotic effect of lificiguat doesn’t rely on sGC activity. Lificiguat enhances autophagic flux, but ATG5 knockdown fails to recover COL1A1 expression of HSCs treated with lificiguat. RNA-seq data indicates lificiguat modulates JAK-STAT and IL-17 pathways of HSCs. Lificiguat reduced liver injury markers including serum ALT and AST in CCL₄-challenged mice. In addition, lificiguat reduces mRNA expression of fibrogenic marker gene including Col1a1 and Acta2 and attenuate liver fibrosis in CCl₄ mice models. Conclusion Lificiguat attenuates liver fibrosis by inhibiting HSC proliferation and collagen synthesis through sGC- and ATG5-independent mechanisms, potentially via regulating JAK-STAT and IL-17 pathways. Lificiguat Liver fibrosis Hepatic stellate cells sGC Collagen Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Liver fibrosis is characterized by fibrotic scar tissue formation upon liver injury. The major components of scar tissue are the extracellular matrices produced by activated hepatic stellate cells(HSCs) [ 1 ]. HSCs are the most abundant non-parenchymal cells of liver [ 2 ]. In normal liver, HSCs reside in the space of Disse of liver sinusoid, remaining a quiescent phenotype and about 80% of whole-body retinyl esters are stored in quiescent HSCs (qHSCs). In response to liver injury, qHSCs are stimulated by a variety of molecules and transdifferentiated to an activated phenotype which acquired contractility, active proliferation, collagen production and inflammation modulation [ 3 ]. Despite the etiology of liver injury, the activation of HSCs is the common mechanism directly associated with the initiation and progression of liver fibrosis. Therefore, therapeutics of liver fibrosis are focused on the function of activated HSCs (aHSCs). The activation of HSCs can be triggered by a variety of signaling pathways and metabolic regulators. Fibrogenic and pro-proliferative cytokines such as TGF-beta (TGF-β) and Platelet-Derived Growth Factor (PDGF) are the most potent cytokines to promote collagen production, and cell proliferation and migration of aHSCs [ 1 , 2 ]. A few signaling pathways have been identified to be involved in the hepatic stellate cell activation. Nitric oxide (NO) is an important gas transmitter to activate the soluble guanylate cyclase (sGC). The sGC catalyzes the conversion of guanosine-5′-triphosphate (GTP) to cyclic guanosine-3′,5′-monophophate (cGMP). NO-sGC-cGMP signaling pathway is essential for tone regulation in hepatic sinusoids and peripheral blood vessels [ 4 ]. Decreased sGC activity has been found in experimental liver fibrosis models [ 4 – 6 ]. sGC stimulators require the NO-binding heme iron of sGC to be in a reduced, ferrous state for full activity [ 7 ]. Praliciguat, a stimulator of sGC, suppresses hepatic stellate cell activation and inhibits fibrosis and inflammation in NASH models [ 6 ]. The current evidence indicates that NO-sGC signaling pathway is a promising target for the treatment of liver fibrosis. Lificiguat (YC-1) is an indazole derivative which has been identified to directly stimulate sGC via heme-dependent and heme-independent mechanisms [ 8 ]. Lificiguat with its derivates has been proven to inhibit the cell proliferation and aSMA expression of LX-2 cells [ 9 ]. In addition, a recent study reveals that lificiguat improves the function of liver sinusoidal endothelial cells in ageing livers and attenuates the aging-related fibrosis progression [ 10 ]. However, the mechanism of lificiguat inhibiting hepatic stellate cell activation is not comprehensively elucidated. Dysregulated autophagy drives the activation of HSCs by generating free fatty acids via degrading retinyl esters [ 2 , 11 , 12 ]. NO has been demonstrated to modulate autophagy[ 13 – 15 ], which suggests the interplay between sGC and autophagy during HSC activation. However, it is unclear if lificiguat inhibit hepatic stellate cell activation via sGC-autophagy pathway. In this study, we testify the anti-fibrogenic effect and mechanisms of lificiguat, especially focused on the sGC-autophagy pathway. Interestingly, the in vitro results reveal that lificiguat inhibits the cell proliferation and collagen production of human HSCs independent of sGC activity or autophagy. The in vivo results demonstrate that lificiguat attenuates liver fibrosis in mice models. Materials and methods Cell culture and reagents LX-2 cells were kindly provided by Cell Bank, Chinese Academy of Sciences. 293T cells were purchased from Wuhan Pricella Biotechnology Co., Ltd.. The cells were cultured in Dulbecco’s Modified Dulbecco’s Medium (DMEM) supplemented with 10% heat inactivated fetal calf serum (Thermo Fisher Scientific), and antibiotics: 100 U/mL penicillin and 10 µg/mL streptomycin in an incubator containing 5% CO2 at 37°C. The lificiguat and bafilomycin A1 were purchased from Selleck (USA). The mycoplasma detection was performed regularly during the cell culture with a PCR kit (Beyotime, China). The culture cells used in the experiments were free of mycoplasma contamination Vector Construction and Lentivirus Transfection The fused protein sequence of mcherry-GFP-LC3 was amplified with PCR using pCMV-mCherry-GFP-LC3B plasmid (D2816, Beyotime, China) as the template and cloned into pLVX-CMV-MCS-SV40-Hyg plasmid with a seamless cloning kit (D7010M, Beyotime, China) following the manufacturer’s protocol. The shRNA oligos were synthesized by Sangon Biothech (China) and cloned into pLKO.1-TRC-copGFP-T2A-Puro plasmid. The oligos are shown in Table 1 . The purified shRNA-expression and other expression plasmid with pCMV-VSV-G and pCAG-dR8.9 were co-transfected via BeyoPEI™ transfection reagent (Beyotime, China) into 293T cells for virus packing. The virus-containing supernatant of 293T cells were collected at post-transfection 48h, 72h and 96h. The virus supernatant was centrifuged and filtered with 0.45um syringe filters and then used for transfection. The culture cells were refreshed with virus solution mixed with polybrene (Beyotime, China). After 24h, transfected cells were refreshed with new medium and cultured for another 48h. Then cells were incubated with 2µM puromycin (Beyotime) for selection of stable transfected cells. Table 1 shRNA target sequences Target sequences(5'-3') 1 Scramble shRNA CCTAAGGTTAAGTCGCCCTCG 2 GUCY1B1-shRNA1 GAACCAATGCAAGTTTGGTTT 3 GUCY1B1-shRNA2 GAAGGTTATTCAGCAAAGAAA 4 GUCY1B1-shRNA3 CCTCCAAATGTTTGGGAAGAT 5 ATG5-shRNA1 CCTTTCATTCAGAAGCTGTTT 6 ATG5-shRNA2 GATTCATGGAATTGAGCCAAT 7 ATG5-shRNA3 AGATTGAAGGATCAACTATTT Cell counting kit 8 (CCK-8) assay LX-2 cells were seeded with a density of 10,000 per well and cultured in the transparent 96-well plates overnight. The wells were refreshed with new medium and different concentration of lificiguat was added into wells and the cells were incubated for another 72h. At the end of incubation, 10µl CCK-8 reagent was added into each well and the plate was incubated at the incubator for 1hr. The plate was measured the optical density at 450 nm using SpectraMax i3x. EdU incorporation assay The EdU incorporation assay is performed with BeyoClick™ EdU Cell Proliferation Kit with Alexa Fluor 594 (Beyotime, China) following the manufacturer’s protocol. LX-2 cells were seeded with a density of 10,000 per well and cultured in the black 96-well plates overnight. The wells were refreshed with new medium and different concentration of lificiguat was added into wells and the cells were incubated for another 68h. At the end of the treatment, EdU solution was added into wells and cells were incubated for another 4h. Afterwards, the cells were labeled with Azide Alexa Fluor 594 via click reaction and stained with Hoechst 33342. The plate was measured fluorescence at the excitation/emission wavelength of 346/460 nm and excitation/emission wavelength of 590/615 nm to detect the fluorescence of Hoechst 33342 and Azide Alexa Fluor 594 using SpectraMax i3x. For microscopic imaging, LX-2 cells were seeded onto glass coverslips placed in 6-well plates and processed identically to the 96-well plate assay. Following treatment, coverslips were mounted using DAPI-containing antifade mounting medium (Beyotime, China) and imaged via confocal microscopy (Zeiss LSM 980). Alexa Fluor 594 was detected using the same excitation/emission settings as described previously, while DAPI was visualized using an excitation wavelength of 405 nm and an emission filter of 420–480 nm. Calcein AM/Propidium Iodide (PI) double staining assay LX-2 cells were seeded with a density of 10,000 per well and cultured in the black bottom 96-well plates overnight for fluorescence assay. LX-2 cells were seeded 10,000 per well and cultured in the 6-well plates overnight for fluorescence staining. The wells were refreshed with new medium and different concentration of lificiguat was added into wells and the cells were incubated for another 72hr. At the end of incubation, each well and blank wells was refreshed with new DMEM medium containing 2µM Calcein AM (UElandy, China) and 4.5µM PI (UElandy, China) and the plates were incubated at the incubator for 1hr. For fluorescence assay, the plates were measured the fluorescence intensity of calcein am with the excitation/emission wavelength at 490/515 nm and the fluorescence intensity of PI with the excitation/emission wavelength at 535/615 nm using SpectraMax i3x. For the microscope observation, the 6-well plates were treated for 24hr and then stained with 2µM Calcein AM (UElandy, China) and 4.5µM PI (UElandy, China) and observed under fluorescence microscope (OLYMPUS IX73) with the green channel and red channel, respectively. Animal study The animal experiments were conducted in accordance with the ARRIVE guidelines (Animal Research: Reporting of In Vivo Experiments) for the care and use of laboratory animals and protocols were approved by the Zhengzhou University Animal Care and Use Committee (approval ZZU-LAC2022071902). Male C57BL/6 mice were housed under standard SPF environment and fed chow and water ad libitum. The mouse liver fibrosis model was induced with 25% v/v carbon tetrachloride (CCl₄) intraperitoneal injection (1µL/g) twice a week for 6 weeks. The lificiguat administration was started at the fifth week with a dose of 30µg/g injected intraperitoneally every day till the end of 6 week. The mice were euthanized humanely at 48h after the last dose of CCl₄. The serum was collected and analyzed with animal automatic biochemical analyzer. Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR) Gene expression levels were quantified by real-time reverse transcription polymerase chain reaction. Total mRNA was isolated from cells using Tri-reagent (Sigma Aldrich) according to the manufacturer’s protocol. Concentration of RNA was determined by Nano-Drop 2000c (Thermo Fisher Scientific). cDNA was synthesized from 0.5–2.5 µg RNA by HiScript 1st Strand cDNA Synthesis Kit (Vazyme, China). Gene expression was determined by primers with SybrGreen (Vazyme, China) by real-time polymerase chain reaction on the QuantStudio 3 system (Thermo Fisher Scientific). Relative gene expression was calculated via the 2-𝚫𝚫Ct method. The primers and probes are shown in Table 2 . All samples were measured in duplicate using RPS18 (human) and Rps18 (mouse) as housekeeping genes. Table 2 Primers for RT-qPCR Species Gene Forward primer Reverse primer Human RPS18 TGCGAGTACTCAACACCAACA CTTCGGCCCACACCCTTAAT COL1A1 CCCCGAGGCTCTGAAGGT GCAATACCAGGAGCACCATTG ACTA2 ACTGCCTTGGTGTGTGACAA CACCATCACCCCCTGATGTC NOS2 TGACCTTGTGCTTGAGGTGG GGGCGTACCACTTTAGCTCC ARG1 TTCTCAAAGGGACAGCCACG TAGGGATGTCAGCAAAGGGC TIMP1 GCCTTCTGCAATTCCGACCT TTGGAACCCTTTATACATCTTGGTC GUCY1B1 CAGAGGCCCAGTGTCCATGA CTAGTCTGTACTCCTCTTCACCC ATG5 ACAAGCAACTCTGGATGGGA GGTCTTTCAGTCGTTGTCTGAT Mouse Rps18 TGGGAAGTACAGCCAGGTTC AGTGGTCTTGGTGTGCTGAC Acta2 AGAGCTACGAACTGCCTGAC CGCTGACTCCATCCCAATGA Col1a1 GCAAGAGGCGAGAGAGGTTT GGCACCAGTATCACCCTTGG Serpina1a ACTGCTGTCTTCCTTCTGCC ATCTGGGCTAACCTTCTGCG Il6 AGCCAGAGTCCTTCAGAGAGATA TTGGTCCTTAGCCACTCCTTC Western Blotting Protein samples were prepared in lysis buffer (HEPES 25 mmol/L, KAc 150 mmol/L, EDTA pH 8.0 2mmol/L, NP-40 0.1%, NaF 10 mmol/L, PMSF 50 mmol/L, aprotinin 1 µg/µL, pepstatin 1 µg/µL, leupeptin 1 µg/µL, DTT 1 mmol/L). Protein concentration was quantified by BCA protein assay (Beyotime, China) according to the manufacturer’s protocol using bovine serum albumin (BSA) to prepare a standard curve. Gel electrophoresis was performed with 10–20 µg protein using 4–15% gels (Beyotime, China), followed by transblotting to 0.2 µm PVDF membrane (Millipore, USA). Protein band intensities were determined and detected with BeyoECL Star kit (Beyotime, China) using the Amersham Imager 680 system (GE). Primary antibodies and secondary antibodies used in the experiments were shown in Table 3 . Blots were stripped with the stripping buffer (Beyotime, China) and then probed with anti-GAPDH if the molecular weight difference between the target protein and loading control was less than 5 KDa. Table 3 The catalog of antibodies Antibody Supplier Cat. Dilution Anti-COL1A1 ThermoFisher PA5-29569 1:1000 Anti-ACTA2 CST 19245S 1:1000 Anti-GAPDH CST 83506S 1:1000 Anti-LC3B CST 97166S 1:1000 Anti-SQSTM1 Beyotime AF0279 1:1000 HRP-labeled Goat Anti-Mouse IgG(H + L) Beyotime A0216 1:1000 HRP-labeled Goat Anti-Rabbit IgG(H + L) Beyotime A0208 1:1000 Masson trichrome staining The Masson trichrome staining was performed following the manufacturer’s protocol (Solarbio, China). The de-paraffined liver sections were incubated with Masson A buffer overnight and then heated at 65℃ for 30 min. After wash, the sections were incubated with the blended pre-warmed Masson B buffer and Masson C buffer for 1 min. The sections were washed and incubated with 1% v/v hydrochloric acid alcohol for 1min. After wash, the sections were incubated with Masson D buffer for about 6 min and then Masson E buffer for 1 min and Masson F buffer for 30 s. Afterwards, sections were incubated with 1% v/v acetic acid shortly 3 times and then dehydrated, hyalinized and sealed for observation. Sirius red staining The Sirius red staining was performed following the manufacturer’s protocol (Solarbio, China). The de-paraffined liver sections were incubated with staining buffer for 1h and then washed and incubated with 1% v/v acetic acid shortly. Afterwards the sections were dehydrated, hyalinized and sealed for observation. Bulk RNA sequencing and data analysis Both the control group and the experimental group included 4 biological replicates. Library construction, quality assessment, and sequencing were performed by Sangon Biotech (Shanghai, China).RNA sequencing using the Illumina Novaseq 6000 platform with PE150 mode. Gene expression levels were quantified using the featureCounts software. Heatmap visualization was employed to generate heatmaps depicting differential gene expression changes. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses of differentially expressed genes were performed using the Phyper function based on the hypergeometric distribution test. Statistical analysis The Data were presented as mean ± standard deviation (mean ± SD) or mean ± standard error of mean (mean ± SEM). Statistical significance was analyzed by unpaired t-test or Mann–Whitney test (Wilcoxon test) between the two groups and each group contains at least 3 independent samples. p < 0.05 was considered statistically significant (*: p < 0.05, **: p < 0.01, ***: p < 0.001, ****: p < 0.001, ns: p > 0.05). Analysis was performed using GraphPad Prism 9 (GraphPad Software). Results To investigate the toxic effect of lificiguat on HSCs, LX-2 cells were treated with 2–100 µM lificiguat for 24 h were stained with Calcein-AM and PI (Fig. 1 A). Quantitative analysis of Calcein-AM and PI fluorescence further revealed lificiguat didn’t significantly affect the cell viability of LX-2 cells (Fig. 1 B,C). The results demonstrated no significant cytotoxicity of lificiguat within this concentration range. Lificiguat treatment decreases the cell viability of LX-2 cells, which suggests the lificiguat inhibits the cell proliferation (Fig. 1 D, E). EdU incorporation assay was performed, and the results revealed the lificiguat treatment significantly inhibits the cell proliferation of LX-2 cells with concentrations higher than 50µM (Fig. 1 F). In addition, confocal microscopy revealed EdU-positive LX-2 cells were reduced by lificiguat treatment (Fig. 1 G). Collectively, these results demonstrated that lificiguat inhibited LX-2 cell proliferation without inducing cytotoxicity. The mRNA expression of ACTA2, COL1A1, and TIMP1 in LX-2 cells treated with lificiguat was analyzed by RT-qPCR. Results demonstrated about 50% reduction in COL1A1 mRNA expression in lificiguat-treated LX-2 cells (Fig. 2 B). However, mRNA expression of ACTA2 and TIMP1 remained unaltered with lificiguat treatment (Fig. 2 A, C). The RT-qPCR results indicated lificiguat inhibited collagen expression of LX-2 cells. To further validate these findings, COL1A1 and ACTA2 protein expression was quantified by Western blotting. The results revealed Lificiguat significantly suppressed COL1A1 protein expression in LX-2 cells, whereas ACTA2 protein expression was not inhibited by lificiguat (Fig. 2 D, E). The results demonstrate that lificiguat suppressed collagen synthesis in LX-2 cells. Lificiguat was proposed to be used as a prototypical sGC stimulator, which activates sGC independently of NO[ 16 , 17 ]. To determine whether lificiguat's inhibitory effects on LX-2 cell proliferation and collagen synthesis require sGC activity, we designed three shRNAs specifically targeting the sGC β1 subunit (GUCY1B1) and generated corresponding shRNA-expressing lentiviral vector. LX-2 cells transduced with GUCY1B1 shRNA2 exhibited 78% reduction in GUCY1B1 mRNA expression (22% residual vs. control)(Fig. 3 A). The results of CCK-8 assay and EdU incorporation assay revealed knock down of GUCY1B1 in LX-2 cells didn’t completely revert the inhibitory effect of lificiguat on cell proliferation (Fig. 3 B, C). RT-qPCR analysis revealed no significant alterations in ACTA2 or TIMP1 expression in either control or knockdown LX-2 cells following lificiguat treatment (Fig. 3 D, F-H). GUCY1B1 knock down slightly recovered the mRNA expression of COL1A1 in LX-2 cells treated with lificiguat, but the protein expression of COL1A1 remained unchanged either in control or knock down cells (Fig. 3 E, G, I). Altogether, the results indicated the effect of lificiguat on LX-2 cells was independent of sGC activity. Since lificiguat inhibited cell proliferation and collagen production of the LX-2 cells via a sGC-independent manner, we were wondering whether the effect of lificiguat was associated with autophagy. Macroautophagy (hereafter autophagy) regulates HSC activation[ 18 ]. We assessed LC3B lipidation and SQSTM1 degradation by western blotting. Lificiguat treatment seemed to increase expression of the LC3B-II and LC3B-I (Fig. 4 A). As autophagy involves dynamic autophagosome formation and autolysosomal fusion, we employed bafilomycin A1, a reversible V-ATPase inhibitor, to block autophagosome-lysosome fusion and lysosomal acidification. BafA1 treatment increased LC3B-II/LC3B-I ratios regardless of lificiguat exposure, confirming fusion inhibition. Notably, lificiguat and BafA1 co-treatment further elevated LC3B-II accumulation, suggesting enhanced autophagic flux(Fig. 4 B). To validate this, we monitored autophagic progression in LX-2 cells stably expressing mCherry-EGFP-LC3B with confocal microscope. The images revealed the Lificiguat significantly increased both yellow and red puncta versus vehicle control (Fig. 4 C-D), mirroring rapamycin's effects. These results demonstrate that lificiguat enhanced autophagic flux in LX-2 cells. Provided the effect of lificigaut depended on the enhanced autophagy flux, blocking autophagy could revert the lificiguat’s effect. Since ATG5 is an essential protein to form the autophagy body, we designed three ATG5-targeting shRNAs and validated lentiviral transduction. ATG5 shRNA1 reduced ATG5 mRNA to 12% of control levels (Fig. 5 A). ATG5 knockdown inhibited cell proliferation of LX-2 cells, shown as CCK-8 assay (Fig. 5 B). However, ATG5 knock down apparently reverted the inhibitory effect of lificiguat on EdU incorporation, which suggested ATG5 knock down inhibited cell proliferation but not affected S-phase DNA biosynthesis (Fig. 5 C). RT-qPCR analysis revealed ATG5 knock down didn’t reverted the reduced mRNA expression of LX-2 cells treated with lificiguat (Fig. 5 D-F). Interestingly, ATG5 knock down significantly reduced protein expression of ACTA2 in LX-2 cells without lificiguat treatment, but slightly affected protein expression of COL1A1 in LX-2 cells treated with lificiguat (Fig. 5 G-I). These data demonstrated that lificiguat inhibited collagen synthesis independent of canonical ATG5-mediated autophagy. To further explore the mechanisms of lificiguat on LX-2 cells, bulk RNA-seq was performed to detect the differentially expressed genes (DEGs). A total of 113 upregulated genes and 824 downregulated genes in lificiguat-treated cells versus controls were selected (Fig. 6 A). Heatmap visualization of normalized DEG expression demonstrated significant inter-group divergence alongside intra-group homogeneity (Fig. 6 B). GO analysis revealed significant DEG enrichment across functional categories, with biological processes dominated by system development and multicellular organismal development, cellular components prominently featuring collagen-containing extracellular matrix and general extracellular matrix structures, and molecular functions enriched for calcium ion transmembrane transporter activity and metallopeptidase activity (Fig. 6 C). KEGG enrichment showed significant pathway involvement in IL-17 signaling, calcium signaling, and extracellular matrix (ECM)-receptor interaction (Fig. 6 D). GSEA confirmed JAK-STAT pathway activation, with co-enrichment of IL-17 signaling and ECM-receptor interaction (Fig. 6 E-H). To functionally annotate DEGs in lificiguat-treated LX-2 cells, we analyzed cytokine- and ECM-related DEGs (Fig. 6 F). Treatment significantly downregulated ECM-associated genes, including collagen family members COL1A1, COL3A1, COL5A1, COL6A3, and COL12A1, alongside fibrillin (FBN1, FBN2) and fibronectin (FN1) genes. Concurrently, pro-inflammatory cytokines IL6, IL1A, IL1B, IL11, and CCL3 were upregulated. Collectively, lificiguat exerted anti-fibrotic effects through coordinated regulation of ECM production and inflammation-associated cytokine production. To evaluate the effectiveness of lificiguat in vivo, we measured the serum ALT and AST, the widely used liver injury marker in control mice and CCl₄-challenged mice treated with or without lificiguat. The results showed that lificiguat decreased the serum concentration of ALT and AST of CCl₄-challenged mice, which demonstrated the lificiguat alleviated liver injury (Fig. 7 A, B). In addition, mRNA expression of profibrotic genes including Acta2 and Col1a1 and inflammatory genes including Il6 and Cd68 of mice liver were measured with RT-qPCR (Fig. 7 C-F). The results showed lificiguat decreased about 50% expression of Acta2 and Col1a1 in the livers of mice challenged by CCl₄, which indicated the lificiguat inhibited the fibrosis progression of CCl₄ mice models. However, the inflammatory genes including Il6 and Cd68 were not altered by lificiguat, which indicated that lificiguat had little effect on general inflammatory reaction involved in the liver fibrosis. Furthermore, the liver sections of control mice, CCl₄-challenged mice treated with or without lificiguat were stained with Masson trichrome and Sirius red. The histological results revealed the lificiguat significantly decreased the formation of the fibrous septa (Fig. 7 G). Altogether, the in vivo data demonstrated the lificiguat alleviate the liver injury and fibrosis progression of CCl₄-challenged mice. Discussion Hepatic fibrosis is a pathological process characterized by accumulation of excessive ECM and scar tissue formation resulting from chronic liver injury of diverse etiologies. Activation of HSCs into myofibroblasts, which exhibit enhanced proliferative capacity and overproduction collagens and other ECM components, ultimately induce hepatic architectural disruption and function impairment[ 3 ]. Additionally, activated HSCs autocrinally secrete multiple pro-fibrotic cytokines (including TGF-β and PDGF), chemokines (e.g., CCL2), and immunoregulatory molecules that modulate immune cell functions within the injured hepatic microenvironment[ 19 ]. Lificiguat, an indazole derivative, exhibits multifaceted bioactivity including suppression of chronic inflammation via nuclear factor κB (NF-κB) inhibition and reduction of hypoxia-induced profibrotic factor expression through hypoxia-inducible factor-1α (HIF-1α) blockade[ 16 , 17 ]. Our study demonstrates lificiguat’s anti-fibrotic efficacy both in vitro and in vivo. Lificiguat significantly inhibits proliferation of the human HSC LX-2 cells and downregulates mRNA and protein expression of COL1A1 without obvious cell toxicity. More importantly, our results reveal the anti-fibrotic effect of lificiguat is independent of sGC-autophagy pathway. Concomitantly, lificiguat reduces liver injury markers, downregulates fibrotic genes (Acta2, Col1a1) in liver tissue, and attenuates fibrous septa formation in CCl₄-induced mice models, validating its in vivo anti-fibrotic activity. sGC, the key effector of NO signaling, comprises α1 (GUCY1A1) and β1 (GUCY1B1) subunits. The β1 subunit harbors a heme-containing H-NOX domain that serves as lificiguat's binding site and mediates NO sensing, with its conformational changes being essential for sGC activation[ 5 , 6 ] Upon activation, sGC catalyzes GTP conversion to the second messenger cGMP. Subsequently, cGMP suppresses HIF-1α and vascular endothelial growth factor (VEGF) expression attenuating excessive hepatic fibrosis and angiogenesis. Furthermore, sGC modulates NF-κB signaling via the cGMP/PKG pathway, reducing pro-inflammatory cytokine release and mitigating inflammation-mediated HSC activation, which collectively impedes fibrotic progression[ 16 , 20 ]. sGC agonists (e.g., riociguat, IW-1973) and has been proved to exert anti-fibrotic effects by elevating hepatic cGMP levels and inhibiting HSC activation, collagen deposition, and inflammation[ 6 , 21 , 22 ].However, our results demonstrate that lificiguat's suppression of hepatic stellate cell proliferation and COL1A1 expression independent of GUCY1B1 activity. This indicates lificiguat’s sGC-independent anti-fibrotic mechanisms. Studies indicate that BAY 41-2272, an sGC activator analogous to lificiguat, functions independently of NO stimulation. Notably, it concurrently suppresses TGFβ1-induced connective tissue growth factor (CTGF) expression in HSCs via sGC/cGMP-independent pathways, thereby exerting anti-fibrotic effects[ 23 ]. Autophagy, a conserved process involving degradation of cellular components via the autophagosome-lysosome system, regulates HSC activation. Hepatic stellate cell activation is accompanied by autophagy induction. Enhanced autophagy attenuates hepatic fibrosis by degrading profibrotic factors (e.g., type I collagen), reducing ECM deposition, suppressing exosome-induced HSC activation, and diminishing fibroblast-derived extracellular vesicle release[ 18 , 24 ].Notably, the sGC stimulator IW-1973 enhances autophagy in white adipose tissue of HFD-fed obese mice and 3T3-L1 adipocytes, manifested by upregulated autophagy-related proteins, increased LC3-II/LC3-I ratio, and reduced SQSTM1/p62[ 22 ], suggesting sGC activation may regulate lipid metabolism through autophagy induction. However, the downstream mechanisms mediating autophagy-related protein expression and functional activation require further investigation. ATG5 is a core protein of the canonical autophagy pathway, which forms an E3-like complex with ATG12 and ATG16L1 to mediate LC3 lipidation, autophagosome elongation, and maturation[ 18 ]. ATG5 maintains pH homeostasis of acidic organelles by regulating V1-ATPase recruitment, while Atg5 deficiency induces aberrant biogenesis of late endosomes and lysosomes [ 25 ]. ATG5-dependent autophagy inhibits renal fibrosis by preventing G2/M arrest in proximal tubules[ 26 ], and it is essential for rilpivirine's anti-fibrotic actions in hepatic fibrosis[ 27 ]. Although lificiguat enhanced autophagic flux of HSCs, our data demonstrate that lificiguat's anti-fibrotic effects, particularly collagen synthesis suppression doesn’t rely on ATG5-dependent autophagy. HSCs release various cytokines to orchestrate the hepatic microenvironment during hepatic fibrosis: they secrete chemokines (CXCL1, CXCL2) recruiting neutrophils and monocytes to initiate inflammation, produce pro-inflammatory cytokines (IL-1β, IL-6) amplifying immune responses, and release TGF-β, COL1A1, COL3A1, and FN1 to drive uncontrolled ECM deposition[ 28 , 29 ]. Additionally, aHSCs overexpress IL-11 to accelerate hepatic fibrogenesis through autocrine promotion of HSC activation, proliferation and upregulation of collagen genes, and JNK/ERK pathway-mediated hepatocyte apoptosis [ 30 ]. This suggests functional heterogeneity within hepatic stellate cell populations where distinct subsets specialize in inflammatory factor secretion versus collagen synthesis, exhibiting divergent effect on fibrogenesis. JAK-STAT signaling is involved in fibrogenesis through STAT3-mediated immunomodulation, HSC activation, cytokine release, proliferation and apoptosis regulation[ 31 ]. Pharmacological inhibition of JAK2 suppresses morphological transdifferentiation of HSCs while reducing mRNA expression of multiple profibrotic genes, indicating the pathway's critical regulatory role in initial HSC activation[ 32 ]. Quantitative proteomics of activated HSC reversion identifies STAT1 as a pivotal regulator during fibrogenesis, whose downregulation facilitates phenotypic transition from profibrotic activation to quiescence, thereby limiting fibrosis progression[ 33 ]. STAT1 activation induces HSC apoptosis, attenuating hepatic fibrosis by reducing profibrotic HSC populations[ 34 ]. Similarly, ginkgetin triggers STAT1-mediated HSC apoptosis and reduces collagen production[ 34 ]. The RNA-seq data of hepatic stellate cells demonstrates JAK-STAT pathway activation by lificiguat, though precise molecular mechanisms require further validation. In summary, our study demonstrates that lificiguat exerts anti-fibrotic effects both in vitro and in vivo by inhibiting HSC proliferation and collagen synthesis through mechanisms independent of sGC activity and ATG5-mediated autophagy, but may modulate ECM-inflammation-related pathways such as JAK-STAT and IL-17 signaling. Declarations Acknowledgement We acknowledge the assistance with the access of analytic instruments from the Translational Medicine Center at the First Affiliated Hospital of Zhengzhou University. Fundings This work was supported by the Henan Province Science and Technology Research Project (Grant No. 252102310060) and the Henan Province Outstanding Young Talent Program for Young and Middle-aged Health Science Innovation (Grant No. JQRC2023002). Data availability Data availability The raw sequencing data of LX-2 cells generated in this study have been deposited in the Genome Sequence Archive (GSAHuman: HRA012363) of the National Genomics Data Center, Beijing Institute of Genomics, Chinese Academy of Sciences / National Center for Bioinformation. These data can be publicly accessed through the website: https://ngdc.cncb.ac.cn/gsahuman. All other relevant data supporting the findings of this study are included in the article. CRediT authorship contribution statement Tongguo Yang : Writing – original draft, Validation, Methodology, Formal analysis, Data curation, Conceptualization. Yuyang Gu : Writing – original draft, Visualization, Investigation, Data curation. Kun Li : Writing – original draft, Software, Formal analysis, Investigation. Zhi Zheng : Writing – original draft, Methodology, Investigation. Jiheng Shan : Methodology, Investigation, Data curation. Pengfei Chen : Software, Validation, Formal analysis. Tianyu Huang : Data curation, Investigation. Jianzhuang Ren : Writing – review & editing, Supervision, Project administration, Conceptualization. Mengfan Zhang : Writing – review & editing, Supervision, Resources, Project administration, Funding acquisition. Wenguang Zhang : Writing – review & editing, Supervision, Resources, Funding acquisition, Conceptualization. References Kisseleva T, Brenner D. Molecular and cellular mechanisms of liver fibrosis and its regression, Nature reviews. Gastroenterol Hepatol. 2021;18(3):151–66. Tsuchida T, Friedman SL. Mechanisms of hepatic stellate cell activation, Nature reviews. Gastroenterology & hepatology; 2017. Zhang M, Serna-Salas S, Damba T, Borghesan M, Demaria M, Moshage H. Hepatic stellate cell senescence in liver fibrosis: Characteristics, mechanisms and perspectives. Mech Ageing Dev. 2021;199:111572. Kreisel W, Lazaro A, Trebicka J, Grosse Perdekamp M, Schmitt-Graeff A, Deibert P. Cyclic GMP in Liver Cirrhosis—Role in Pathophysiology of Portal Hypertension and Therapeutic Implications. Int J Mol Sci 22(19) (2021). Yang W, He H, Wang T, Su N, Zhang F, Jiang K, Zhu J, Zhang C, Niu K, Wang L, Yuan X, Liu N, Li L, Wei W, Hu J. Single-Cell Transcriptomic Analysis Reveals a Hepatic Stellate Cell-Activation Roadmap and Myofibroblast Origin During Liver Fibrosis in Mice, Hepatology (Baltimore. Md). 2021;74(5):2774–90. Hall KC, Bernier SG, Jacobson S, Liu G, Zhang PY, Sarno R, Catanzano V, Currie MG, Masferrer JL. sGC stimulator praliciguat suppresses stellate cell fibrotic transformation and inhibits fibrosis and inflammation in models of NASH. Proc Natl Acad Sci USA. 2019;116(22):11057–62. Buys ES, Zimmer DP, Chickering J, Graul R, Chien YT, Profy A, Hadcock JR, Masferrer JL, Milne GT. Discovery and development of next generation sGC stimulators with diverse multidimensional pharmacology and broad therapeutic potential. Nitric Oxide. 2018;78:72–80. Martin E, Lee YC, Murad F. YC-1 activation of human soluble guanylyl cyclase has both heme-dependent and heme-independent components. Proc Natl Acad Sci U S A. 2001;98(23):12938–42. Xiao J, Jin C, Liu Z, Guo S, Zhang X, Zhou X, Wu X. The design, synthesis, and biological evaluation of novel YC-1 derivatives as potent anti-hepatic fibrosis agents. Org Biomol Chem. 2015;13(26):7257–64. Dai Q, Qing X, Jiang W, Wang S, Liu S, Liu X, Huang F, Zhao H. Aging aggravates liver fibrosis through downregulated hepatocyte SIRT1-induced liver sinusoidal endothelial cell dysfunction. Hepatol Commun 8(1) (2024). Gao J, Wei B, de Assuncao TM, Liu Z, Hu X, Ibrahim S, Cooper SA, Cao S, Shah VH, Kostallari E. Hepatic stellate cell autophagy inhibits extracellular vesicle release to attenuate liver fibrosis. J Hepatol. 2020;73(5):1144–54. Horn P, Tacke F. Metabolic reprogramming in liver fibrosis. Cell Metab. 2024;36(7):1439–55. Jin L, Gao H, Wang J, Yang S, Wang J, Liu J, Yang Y, Yan T, Chen T, Zhao Y, He Y. Role and regulation of autophagy and apoptosis by nitric oxide in hepatic stellate cells during acute liver failure. Liver international: official J Int Association Study Liver. 2017;37(11):1651–9. Shirazi MK, Azarnezhad A, Abazari MF, Poorebrahim M, Ghoraeian P, Sanadgol N, Bokharaie H, Heydari S, Abbasi A, Kabiri S, Aleagha MN, Enderami SE, Dashtaki AS, Askari H. The role of nitric oxide signaling in renoprotective effects of hydrogen sulfide against chronic kidney disease in rats: Involvement of oxidative stress, autophagy and apoptosis. J Cell Physiol. 2019;234(7):11411–23. Sydor S, Bechmann LP. Hepatic stellate cell autophagy in acute liver injury: A novel role for nitric oxide? Liver international: official J Int Association Study Liver. 2017;37(11):1602–4. Sandner P, Vakalopoulos A, Hahn MG, Stasch JP, Follmann M. Soluble guanylate cyclase stimulators and their potential use: a patent review. Expert Opin Ther Pat. 2021;31(3):203–22. Liu R, Kang Y, Chen L. Activation mechanism of human soluble guanylate cyclase by stimulators and activators. Nat Commun. 2021;12(1):5492. Lucantoni F, Martínez-Cerezuela A, Gruevska A, Moragrega B, Víctor ÁVM, Esplugues JV, Blas-García A, Apostolova N. Understanding the implication of autophagy in the activation of hepatic stellate cells in liver fibrosis: are we there yet? J Pathol. 2021;254(3):216–28. Xi S, Zheng X, Li X, Jiang Y, Wu Y, Gong J, Jie Y, Li Z, Cao J, Sha L, Zhang M, Chong Y. Activated Hepatic Stellate Cells Induce Infiltration and Formation of CD163(+) Macrophages via CCL2/CCR2 Pathway. Front Med. 2021;8:627927. Yu KH, Hung HY. Synthetic strategy and structure-activity relationship (SAR) studies of 3-(5'-hydroxymethyl-2'-furyl)-1-benzyl indazole (YC-1, Lificiguat): a review. RSC Adv. 2021;12(1):251–64. Brusilovskaya K, Königshofer P, Lampach D, Szodl A, Supper P, Bauer D, Beer A, Stift J, Timelthaler G, Oberhuber G, Podesser BK, Seif M, Zinober K, Rohr-Udilova N, Trauner M, Reiberger T, Schwabl P. Soluble guanylyl cyclase stimulation and phosphodiesterase-5 inhibition improve portal hypertension and reduce liver fibrosis in bile duct-ligated rats. United Eur Gastroenterol J. 2020;8(10):1174–85. Flores-Costa R, Alcaraz-Quiles J, Titos E, López-Vicario C, Casulleras M, Duran-Güell M, Rius B, Diaz A, Hall K, Shea C, Sarno R, Currie M, Masferrer JL, Clària J. The soluble guanylate cyclase stimulator IW-1973 prevents inflammation and fibrosis in experimental non-alcoholic steatohepatitis. Br J Pharmacol. 2018;175(6):953–67. Chen PJ, Kuo LM, Wu YH, Chang YC, Lai KH, Hwang TL. BAY 41-2272 Attenuates CTGF Expression via sGC/cGMP-Independent Pathway in TGFβ1-Activated Hepatic Stellate Cells. Biomedicines 8(9) (2020). Gao J, Wei B, de Assuncao TM, Liu Z, Hu X, Ibrahim S, Cooper SA, Cao S, Shah VH, Kostallari E. Hepatic stellate cell autophagy inhibits extracellular vesicle release to attenuate liver fibrosis. J Hepatol. 2020;73(5):1144–54. Peng J, Zhang R, Cui Y, Liu H, Zhao X, Huang L, Hu M, Yuan X, Ma B, Ma X, Takashi U, Masaaki K, Liang X, Yu L. Atg5 regulates late endosome and lysosome biogenesis. Sci China Life Sci. 2014;57(1):59–68. Lucantoni F, Benedicto AM, Gruevska A, Moragrega B, Fuster-Martínez ÁI, Esplugues JV, Blas-García A, Apostolova N. Implication of autophagy in the antifibrogenic effect of Rilpivirine: when more is less. Cell Death Dis. 2022;13(4):385. Li H, Peng X, Wang Y, Cao S, Xiong L, Fan J, Wang Y, Zhuang S, Yu X, Mao H. Atg5-mediated autophagy deficiency in proximal tubules promotes cell cycle G2/M arrest and renal fibrosis. Autophagy. 2016;12(9):1472–86. Gupta G, Khadem F, Uzonna JE. Role of hepatic stellate cell (HSC)-derived cytokines in hepatic inflammation and immunity. Cytokine. 2019;124:154542. Najar M, Fayyad-Kazan H, Faour WH, El Taghdouini A, Raicevic G, Najimi M, Toungouz M, van Grunsven LA, Sokal E, Lagneaux L. Human hepatic stellate cells and inflammation: A regulated cytokine network balance. Cytokine. 2017;90:130–4. Jiang LF, Yang M, Meng HW, Jia PC, Du CL, Liu JY, Lv XW, Cheng H, Li J. The effect of hepatic stellate cell derived-IL-11 on hepatocyte injury in hepatic fibrosis. Life Sci. 2023;330:121974. Zhao J, Qi YF, Yu YR. STAT3: A key regulator in liver fibrosis. Ann Hepatol. 2021;21:100224. Lakner AM, Moore CC, Gulledge AA, Schrum LW. Daily genetic profiling indicates JAK/STAT signaling promotes early hepatic stellate cell transdifferentiation. World J Gastroenterol. 2010;16(40):5047–56. Zhang H, Chen F, Fan X, Lin C, Hao Y, Wei H, Lin W, Jiang Y, He F. Quantitative Proteomic analysis on Activated Hepatic Stellate Cells reversion Reveal STAT1 as a key regulator between Liver Fibrosis and recovery. Sci Rep. 2017;7:44910. Martí-Rodrigo A, Alegre F, Moragrega B, García-García ÁF, Martí-Rodrigo P, Fernández-Iglesias A, Gracia-Sancho J, Apostolova N, Esplugues JV. Blas-García, Rilpivirine attenuates liver fibrosis through selective STAT1-mediated apoptosis in hepatic stellate cells. Gut. 2020;69(5):920–32. Supplementary Files Supplementarymaterial.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-7224016\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":495668700,\"identity\":\"1c3395fc-6577-4ee0-8180-318a5cfe69e2\",\"order_by\":0,\"name\":\"Tongguo Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Zhengzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tongguo\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":495668701,\"identity\":\"2cf306f6-6dce-4eb6-a2fb-47a78cc91ad4\",\"order_by\":1,\"name\":\"Yuyang Gu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Zhengzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yuyang\",\"middleName\":\"\",\"lastName\":\"Gu\",\"suffix\":\"\"},{\"id\":495668702,\"identity\":\"892f6e1b-4262-45b7-b489-6a7971b58c9c\",\"order_by\":2,\"name\":\"Kun Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Zhengzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Kun\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":495668703,\"identity\":\"3df3264a-b129-41e5-be97-fa3feaef3926\",\"order_by\":3,\"name\":\"Zhi Zheng\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Zhengzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zhi\",\"middleName\":\"\",\"lastName\":\"Zheng\",\"suffix\":\"\"},{\"id\":495668704,\"identity\":\"d9c74f37-33fe-4227-81a2-9a668aa4d9ad\",\"order_by\":4,\"name\":\"Jiheng Shan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Zhengzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jiheng\",\"middleName\":\"\",\"lastName\":\"Shan\",\"suffix\":\"\"},{\"id\":495668705,\"identity\":\"d426f83b-eb83-4d98-bdd6-f68f35dc37a0\",\"order_by\":5,\"name\":\"Pengfei Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Zhengzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Pengfei\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":495668706,\"identity\":\"a4ada8ce-bbd5-4ec3-b3db-63991850d890\",\"order_by\":6,\"name\":\"Tianyu Huang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Zhengzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tianyu\",\"middleName\":\"\",\"lastName\":\"Huang\",\"suffix\":\"\"},{\"id\":495668707,\"identity\":\"4d6dcb9b-73f8-464c-807c-8599887bb4e9\",\"order_by\":7,\"name\":\"Jianzhuang Ren\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Zhengzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jianzhuang\",\"middleName\":\"\",\"lastName\":\"Ren\",\"suffix\":\"\"},{\"id\":495668708,\"identity\":\"423092a6-f771-49c0-83ea-d5f0bcbb385d\",\"order_by\":8,\"name\":\"Mengfan Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Zhengzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mengfan\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":495668709,\"identity\":\"36ad251a-ac67-4443-8ffd-9ad0626dfb25\",\"order_by\":9,\"name\":\"Wenguang Zhang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIiWNgGAWjYBAC9uYDDMxAWg7CZSNCC8+xBLAWY9K1JDYQr4WN+fHnwrba9Pn9ZwwYPpQdZuCf3UBIC5uB8cy247mNDWcMGGecO8wgcecAfi328j0MybzbjuU2M/YYMPO2HWYwkEggZAsPw2GglnQ2Zh4D5r9EamFs5t1WkwBkGDAzEqeFzZiZ998Bwxk8bAUHe86l80jcIKgFGGI8Z+rk5fsPb3zwo8xajn8GAS1QcBhMHgCZQZR6IKgjVuEoGAWjYBSMRAAAdEg6dj+DouwAAAAASUVORK5CYII=\",\"orcid\":\"https://orcid.org/0000-0002-9638-8446\",\"institution\":\"The First Affiliated Hospital of Zhengzhou University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Wenguang\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-07-27 04:16:45\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-7224016/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-7224016/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":88464618,\"identity\":\"d87f42dc-9840-4c52-8fcb-97e8b4336f1d\",\"added_by\":\"auto\",\"created_at\":\"2025-08-06 17:12:19\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":983884,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eLificiguat inhibits LX-2 cell proliferation. A. LX-2 cells were treated with varying concentrations of lificiguat for 24 h and stained with Calcein-AM and PI. B, C. LX-2 cells were treated with 2–100 µM lificiguat for 24 h, and fluorescence intensity of Calcein-AM and PI was measured (n = 8). D, E. LX-2 cells were treated with 2–100 µM lificiguat for 24 h or 72 h, respectively, and cell viability was assessed using the CCK-8 assay (n = 6). F. LX-2 cells were treated with 2–100 µM lificiguat for 72 h, and cell proliferation was evaluated using the EdU incorporation assay (n = 6). G. LX-2 cells were treated with indicated concentrations of lificiguat for 72 h and then incorporated with EdU and stained; representative confocal microscopy images (Zeiss LSM 980) of EdU (red) and DAPI (blue) staining are shown.\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7224016/v1/76489c1f91fae513081e55a5.png\"},{\"id\":88465001,\"identity\":\"7a173b05-56c9-4203-8f56-fc9332f56a13\",\"added_by\":\"auto\",\"created_at\":\"2025-08-06 17:20:19\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":233330,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eLificiguat suppresses COL1A1 expression in LX-2 cells.A–C. mRNA expression levels of ACTA2, COL1A1, and TIMP1 in LX-2 cells treated with or without 50 μM lificiguat for 72 h (n = 3). D, E. Protein expression of COL1A1 and ACTA2 in LX-2 cells treated with or without 50 μM lificiguat for 72 h, analyzed by Western blotting. GAPDH served as loading control (n = 4).\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe mRNA expression of ACTA2, COL1A1, and TIMP1 in LX-2 cells treated with lificiguat was analyzed by RT-qPCR. Results demonstrated about 50% reduction in COL1A1 mRNA expression in lificiguat-treated LX-2 cells (Fig. 2B). However, mRNA expression of ACTA2 and TIMP1 remained unaltered with lificiguat treatment (Fig. 2A, C). The RT-qPCR results indicated lificiguat inhibited collagen expression of LX-2 cells. To further validate these findings, COL1A1 and ACTA2 protein expression was quantified by Western blotting. The results revealed Lificiguat significantly suppressed COL1A1 protein expression in LX-2 cells, whereas ACTA2 protein expression was not inhibited by lificiguat (Fig. 2D, E). The results demonstrate that lificiguat suppressed collagen synthesis in LX-2 cells.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7224016/v1/c9336b72750588ad81814999.png\"},{\"id\":88464617,\"identity\":\"44f5ec4b-31c4-4bf6-84fa-19be79cac489\",\"added_by\":\"auto\",\"created_at\":\"2025-08-06 17:12:19\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":399871,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eGUCY1B1 knockdown fails to revert lificiguat’s inhibitory effects on LX-2 cell proliferation and collagen synthesis. A. GUCY1B1 mRNA expression in LX-2 cells transduced with lentiviral vector expressing scramble or shRNA targeting GUCY1B1 (n = 3). B, C. Proliferation of LX-2 cells transfected with GUCY1B1 shRNA or scramble shRNA and treated ±50 μM lificiguat for 72 h, assessed by CCK-8 assay and EdU incorporation assay (n = 6). D–F. mRNA expression of ACTA2, COL1A1, and TIMP1 in control and GUCY1B1 knock down LX-2 cells treated ±50 μM lificiguat for 72 h (n = 3). G–I. Protein expression of ACTA2 and COL1A1 in control and GUCY1B1 knock down LX-2 cells treated ±50 μM lificiguat for 72 h, analyzed by Western blotting. GAPDH served as loading control (n = 4).\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7224016/v1/8777e5a1260faa2251834661.png\"},{\"id\":88464619,\"identity\":\"a69b52f1-1268-46b3-a9aa-48f05fed3be7\",\"added_by\":\"auto\",\"created_at\":\"2025-08-06 17:12:19\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":474899,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eLificiguat enhances autophagic flux in LX-2 cells. A. Western blot of LC3B-II and SQSTM1/p62 in LX-2 cells following 24-h treatment with vehicle or 50 μM lificiguat (GAPDH loading control). B. Protein expression of LC3B-II and SQSTM1/p62 in cells treated for 24 h with: vehicle, lificiguat (50 μM), Bafilomycin A₁ (100 nM; BafA1), or lificiguat + BafA1 (BafA1 added during final 2 h). C. Confocal micrographs (Zeiss LSM 980) of LX-2 cells stably expressing mCherry-EGFP-LC3B treated for 24 h with vehicle, lificiguat (50 μM), or rapamycin (200 nM). Representative images of autophagosomes (yellow dots generated from the overlap of mCherry and EGFP puncta) and autolysosomes (red dots generated from mCherry puncta). Nuclei counterstained with Hoechst 33342. D. Quantification of autophagic vesicle fluorescence signals. Images were analyzed using ImageJ to enumerate red puncta (autolysosomes; red box plots), green puncta, and dual-positive puncta (autophagosomes; yellow box plots) (n = 3).\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7224016/v1/a6e0020533de8a47fe87a621.png\"},{\"id\":88464630,\"identity\":\"0ee8ce7d-04df-44cb-8859-4912a46d8c89\",\"added_by\":\"auto\",\"created_at\":\"2025-08-06 17:12:20\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":409208,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eATG5-dependent autophagy blockade does not abrogate lificiguat's antifibrotic effects in LX-2 cells. A. ATG5 mRNA expression in LX-2 cells transfected with ATG5 shRNA1 (n = 3). B, C. Proliferation of LX-2 cells transfected with ATG5 shRNA1 or control shRNA and treated ±50 μM lificiguat for 72 h, assessed by CCK-8 assay and EdU incorporation (n= 6). D–F. mRNA expression of ACTA2, COL1A1, and TIMP1 in transfected LX-2 cells treated ±50 μM lificiguat for 72 h (n = 3). G–I. Protein expression of ACTA2 and COL1A1 in transfected cells treated ±50 μM lificiguat for 72 h, GAPDH served as loading control (n =4).\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7224016/v1/9a3462b42d276eb619ef5337.png\"},{\"id\":88465003,\"identity\":\"31883e05-5ffc-4e12-ac3f-f34ba81ffb4d\",\"added_by\":\"auto\",\"created_at\":\"2025-08-06 17:20:20\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":676354,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eTranscriptomic Profiling of LX-2 Cells Treated with 50 μM Lificiguat for 72 Hours. A. Volcano plot of DEGs between control (Ctrl) and lificiguat-treated groups (|log₂FC| \\u0026gt; 1, p \\u0026lt; 0.05). Blue: downregulated; gray: nonsignificant; red: upregulated. B. Heatmap of normalized expression for DEGs across replicates. C. GO classification of DEGs. D. KEGG pathway enrichment of DEGs. E. Gene Set Enrichment Analysis (GSEA) of DEGs. F. Heatmap of normalized expression for cytokine- and extracellular matrix-related DEGs. G-I. Based on the GSEA results comparing the treatment group versus the control group, three signaling pathways were significantly enriched: the JAK-STAT signaling pathway exhibited a normalized enrichment score (NES) of 1.24 (p = 0.017), the ECM-receptor interaction pathway showed an NES of -1.57 (p = 0.001), and the IL-17 signaling pathway demonstrated an NES of 1.45 (p = 0.001). Each subfigure displays the enrichment score profile across the ranked dataset and the corresponding ranked list metrics.\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7224016/v1/d2484483cff9ce1f0efedb4a.png\"},{\"id\":88464626,\"identity\":\"571cfe22-b9f1-4e2a-87d4-7a56e937955a\",\"added_by\":\"auto\",\"created_at\":\"2025-08-06 17:12:20\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":786095,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eLificiguat decreased liver injury and liver fibrosis in CCl₄ challenged mice. A, B Serum concentration of ALT and AST in control mice, CCl₄-challenged mice treated with or without lificiguat. C-F mRNA expression of Acta2, Col1a1, Il6 and Cd68 in control mice and CCl₄-challenged mice treated with or without lificiguat. G Masson trichrome staining and sirius red staining of liver sections collected from control mice, CCl₄-challenged mice treated with or without lificiguat.\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7224016/v1/f50eb468ad7ad1f09dd85a04.png\"},{\"id\":90132418,\"identity\":\"13c6048c-a07d-488f-9180-6b78b7a6e92e\",\"added_by\":\"auto\",\"created_at\":\"2025-08-28 22:59:25\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":6473885,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7224016/v1/5289107a-136e-4e5a-b375-d1308e998576.pdf\"},{\"id\":88465019,\"identity\":\"1a9abbb8-4d88-4827-b71d-08f51c754c90\",\"added_by\":\"auto\",\"created_at\":\"2025-08-06 17:20:20\",\"extension\":\"docx\",\"order_by\":11,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":10774065,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supplementarymaterial.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7224016/v1/86712dbf51481b187dbc49f3.docx\"}],\"financialInterests\":\"\",\"formattedTitle\":\"Lificiguat inhibits the collagen production of hepatic stellate cells independently on sGC activity\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eLiver fibrosis is characterized by fibrotic scar tissue formation upon liver injury. The major components of scar tissue are the extracellular matrices produced by activated hepatic stellate cells(HSCs) [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. HSCs are the most abundant non-parenchymal cells of liver [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. In normal liver, HSCs reside in the space of Disse of liver sinusoid, remaining a quiescent phenotype and about 80% of whole-body retinyl esters are stored in quiescent HSCs (qHSCs). In response to liver injury, qHSCs are stimulated by a variety of molecules and transdifferentiated to an activated phenotype which acquired contractility, active proliferation, collagen production and inflammation modulation [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. Despite the etiology of liver injury, the activation of HSCs is the common mechanism directly associated with the initiation and progression of liver fibrosis. Therefore, therapeutics of liver fibrosis are focused on the function of activated HSCs (aHSCs).\\u003c/p\\u003e\\u003cp\\u003eThe activation of HSCs can be triggered by a variety of signaling pathways and metabolic regulators. Fibrogenic and pro-proliferative cytokines such as TGF-beta (TGF-β) and Platelet-Derived Growth Factor (PDGF) are the most potent cytokines to promote collagen production, and cell proliferation and migration of aHSCs [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. A few signaling pathways have been identified to be involved in the hepatic stellate cell activation. Nitric oxide (NO) is an important gas transmitter to activate the soluble guanylate cyclase (sGC). The sGC catalyzes the conversion of guanosine-5\\u0026prime;-triphosphate (GTP) to cyclic guanosine-3\\u0026prime;,5\\u0026prime;-monophophate (cGMP). NO-sGC-cGMP signaling pathway is essential for tone regulation in hepatic sinusoids and peripheral blood vessels [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Decreased sGC activity has been found in experimental liver fibrosis models [\\u003cspan additionalcitationids=\\\"CR5\\\" citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e].\\u003c/p\\u003e\\u003cp\\u003esGC stimulators require the NO-binding heme iron of sGC to be in a reduced, ferrous state for full activity [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. Praliciguat, a stimulator of sGC, suppresses hepatic stellate cell activation and inhibits fibrosis and inflammation in NASH models [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. The current evidence indicates that NO-sGC signaling pathway is a promising target for the treatment of liver fibrosis. Lificiguat (YC-1) is an indazole derivative which has been identified to directly stimulate sGC via heme-dependent and heme-independent mechanisms [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. Lificiguat with its derivates has been proven to inhibit the cell proliferation and aSMA expression of LX-2 cells [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. In addition, a recent study reveals that lificiguat improves the function of liver sinusoidal endothelial cells in ageing livers and attenuates the aging-related fibrosis progression [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. However, the mechanism of lificiguat inhibiting hepatic stellate cell activation is not comprehensively elucidated.\\u003c/p\\u003e\\u003cp\\u003eDysregulated autophagy drives the activation of HSCs by generating free fatty acids via degrading retinyl esters [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. NO has been demonstrated to modulate autophagy[\\u003cspan additionalcitationids=\\\"CR14\\\" citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e], which suggests the interplay between sGC and autophagy during HSC activation. However, it is unclear if lificiguat inhibit hepatic stellate cell activation via sGC-autophagy pathway. In this study, we testify the anti-fibrogenic effect and mechanisms of lificiguat, especially focused on the sGC-autophagy pathway. Interestingly, the in vitro results reveal that lificiguat inhibits the cell proliferation and collagen production of human HSCs independent of sGC activity or autophagy. The in vivo results demonstrate that lificiguat attenuates liver fibrosis in mice models.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cp\\u003e\\u003cb\\u003eCell culture and reagents\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eLX-2 cells were kindly provided by Cell Bank, Chinese Academy of Sciences. 293T cells were purchased from Wuhan Pricella Biotechnology Co., Ltd.. The cells were cultured in Dulbecco\\u0026rsquo;s Modified Dulbecco\\u0026rsquo;s Medium (DMEM) supplemented with 10% heat inactivated fetal calf serum (Thermo Fisher Scientific), and antibiotics: 100 U/mL penicillin and 10 \\u0026micro;g/mL streptomycin in an incubator containing 5% CO2 at 37\\u0026deg;C. The lificiguat and bafilomycin A1 were purchased from Selleck (USA). The mycoplasma detection was performed regularly during the cell culture with a PCR kit (Beyotime, China). The culture cells used in the experiments were free of mycoplasma contamination\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eVector Construction and Lentivirus Transfection\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe fused protein sequence of mcherry-GFP-LC3 was amplified with PCR using pCMV-mCherry-GFP-LC3B plasmid (D2816, Beyotime, China) as the template and cloned into pLVX-CMV-MCS-SV40-Hyg plasmid with a seamless cloning kit (D7010M, Beyotime, China) following the manufacturer\\u0026rsquo;s protocol. The shRNA oligos were synthesized by Sangon Biothech (China) and cloned into pLKO.1-TRC-copGFP-T2A-Puro plasmid. The oligos are shown in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. The purified shRNA-expression and other expression plasmid with pCMV-VSV-G and pCAG-dR8.9 were co-transfected via BeyoPEI\\u0026trade; transfection reagent (Beyotime, China) into 293T cells for virus packing. The virus-containing supernatant of 293T cells were collected at post-transfection 48h, 72h and 96h. The virus supernatant was centrifuged and filtered with 0.45um syringe filters and then used for transfection. The culture cells were refreshed with virus solution mixed with polybrene (Beyotime, China). After 24h, transfected cells were refreshed with new medium and cultured for another 48h. Then cells were incubated with 2\\u0026micro;M puromycin (Beyotime) for selection of stable transfected cells.\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eshRNA target sequences\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"3\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eTarget sequences(5'-3')\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e1\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eScramble shRNA\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eCCTAAGGTTAAGTCGCCCTCG\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e2\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eGUCY1B1-shRNA1\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGAACCAATGCAAGTTTGGTTT\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e3\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eGUCY1B1-shRNA2\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGAAGGTTATTCAGCAAAGAAA\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e4\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eGUCY1B1-shRNA3\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eCCTCCAAATGTTTGGGAAGAT\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e5\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eATG5-shRNA1\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eCCTTTCATTCAGAAGCTGTTT\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e6\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eATG5-shRNA2\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGATTCATGGAATTGAGCCAAT\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e7\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eATG5-shRNA3\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eAGATTGAAGGATCAACTATTT\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eCell counting kit 8 (CCK-8) assay\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eLX-2 cells were seeded with a density of 10,000 per well and cultured in the transparent 96-well plates overnight. The wells were refreshed with new medium and different concentration of lificiguat was added into wells and the cells were incubated for another 72h. At the end of incubation, 10\\u0026micro;l CCK-8 reagent was added into each well and the plate was incubated at the incubator for 1hr. The plate was measured the optical density at 450 nm using SpectraMax i3x.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eEdU incorporation assay\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe EdU incorporation assay is performed with BeyoClick\\u0026trade; EdU Cell Proliferation Kit with Alexa Fluor 594 (Beyotime, China) following the manufacturer\\u0026rsquo;s protocol. LX-2 cells were seeded with a density of 10,000 per well and cultured in the black 96-well plates overnight. The wells were refreshed with new medium and different concentration of lificiguat was added into wells and the cells were incubated for another 68h. At the end of the treatment, EdU solution was added into wells and cells were incubated for another 4h. Afterwards, the cells were labeled with Azide Alexa Fluor 594 via click reaction and stained with Hoechst 33342. The plate was measured fluorescence at the excitation/emission wavelength of 346/460 nm and excitation/emission wavelength of 590/615 nm to detect the fluorescence of Hoechst 33342 and Azide Alexa Fluor 594 using SpectraMax i3x. For microscopic imaging, LX-2 cells were seeded onto glass coverslips placed in 6-well plates and processed identically to the 96-well plate assay. Following treatment, coverslips were mounted using DAPI-containing antifade mounting medium (Beyotime, China) and imaged via confocal microscopy (Zeiss LSM 980). Alexa Fluor 594 was detected using the same excitation/emission settings as described previously, while DAPI was visualized using an excitation wavelength of 405 nm and an emission filter of 420\\u0026ndash;480 nm.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eCalcein AM/Propidium Iodide (PI) double staining assay\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eLX-2 cells were seeded with a density of 10,000 per well and cultured in the black bottom 96-well plates overnight for fluorescence assay. LX-2 cells were seeded 10,000 per well and cultured in the 6-well plates overnight for fluorescence staining. The wells were refreshed with new medium and different concentration of lificiguat was added into wells and the cells were incubated for another 72hr. At the end of incubation, each well and blank wells was refreshed with new DMEM medium containing 2\\u0026micro;M Calcein AM (UElandy, China) and 4.5\\u0026micro;M PI (UElandy, China) and the plates were incubated at the incubator for 1hr. For fluorescence assay, the plates were measured the fluorescence intensity of calcein am with the excitation/emission wavelength at 490/515 nm and the fluorescence intensity of PI with the excitation/emission wavelength at 535/615 nm using SpectraMax i3x. For the microscope observation, the 6-well plates were treated for 24hr and then stained with 2\\u0026micro;M Calcein AM (UElandy, China) and 4.5\\u0026micro;M PI (UElandy, China) and observed under fluorescence microscope (OLYMPUS IX73) with the green channel and red channel, respectively.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eAnimal study\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003e The animal experiments were conducted in accordance with the ARRIVE guidelines (Animal Research: Reporting of In Vivo Experiments) for the care and use of laboratory animals and protocols were approved by the Zhengzhou University Animal Care and Use Committee (approval ZZU-LAC2022071902). Male C57BL/6 mice were housed under standard SPF environment and fed chow and water ad libitum. The mouse liver fibrosis model was induced with 25% v/v carbon tetrachloride (CCl₄) intraperitoneal injection (1\\u0026micro;L/g) twice a week for 6 weeks. The lificiguat administration was started at the fifth week with a dose of 30\\u0026micro;g/g injected intraperitoneally every day till the end of 6 week. The mice were euthanized humanely at 48h after the last dose of CCl₄. The serum was collected and analyzed with animal automatic biochemical analyzer.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eQuantitative Real-Time Polymerase Chain Reaction (RT-qPCR)\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eGene expression levels were quantified by real-time reverse transcription polymerase chain reaction. Total mRNA was isolated from cells using Tri-reagent (Sigma Aldrich) according to the manufacturer\\u0026rsquo;s protocol. Concentration of RNA was determined by Nano-Drop 2000c (Thermo Fisher Scientific). cDNA was synthesized from 0.5\\u0026ndash;2.5 \\u0026micro;g RNA by HiScript 1st Strand cDNA Synthesis Kit (Vazyme, China). Gene expression was determined by primers with SybrGreen (Vazyme, China) by real-time polymerase chain reaction on the QuantStudio 3 system (Thermo Fisher Scientific). Relative gene expression was calculated via the 2-\\u0026#120491;\\u0026#120491;Ct method. The primers and probes are shown in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e. All samples were measured in duplicate using RPS18 (human) and Rps18 (mouse) as housekeeping genes.\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003ePrimers for RT-qPCR\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"4\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eSpecies\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eGene\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eForward primer\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eReverse primer\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"7\\\" rowspan=\\\"8\\\"\\u003e\\u003cp\\u003eHuman\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eRPS18\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eTGCGAGTACTCAACACCAACA\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eCTTCGGCCCACACCCTTAAT\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCOL1A1\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eCCCCGAGGCTCTGAAGGT\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eGCAATACCAGGAGCACCATTG\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eACTA2\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eACTGCCTTGGTGTGTGACAA\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eCACCATCACCCCCTGATGTC\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eNOS2\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eTGACCTTGTGCTTGAGGTGG\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eGGGCGTACCACTTTAGCTCC\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eARG1\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eTTCTCAAAGGGACAGCCACG\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eTAGGGATGTCAGCAAAGGGC\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eTIMP1\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGCCTTCTGCAATTCCGACCT\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eTTGGAACCCTTTATACATCTTGGTC\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eGUCY1B1\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eCAGAGGCCCAGTGTCCATGA\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eCTAGTCTGTACTCCTCTTCACCC\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eATG5\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eACAAGCAACTCTGGATGGGA\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eGGTCTTTCAGTCGTTGTCTGAT\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"4\\\" rowspan=\\\"5\\\"\\u003e\\u003cp\\u003eMouse\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eRps18\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eTGGGAAGTACAGCCAGGTTC\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eAGTGGTCTTGGTGTGCTGAC\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eActa2\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eAGAGCTACGAACTGCCTGAC\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eCGCTGACTCCATCCCAATGA\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCol1a1\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGCAAGAGGCGAGAGAGGTTT\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eGGCACCAGTATCACCCTTGG\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eSerpina1a\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eACTGCTGTCTTCCTTCTGCC\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eATCTGGGCTAACCTTCTGCG\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eIl6\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eAGCCAGAGTCCTTCAGAGAGATA\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eTTGGTCCTTAGCCACTCCTTC\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eWestern Blotting\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eProtein samples were prepared in lysis buffer (HEPES 25 mmol/L, KAc 150 mmol/L, EDTA pH 8.0 2mmol/L, NP-40 0.1%, NaF 10 mmol/L, PMSF 50 mmol/L, aprotinin 1 \\u0026micro;g/\\u0026micro;L, pepstatin 1 \\u0026micro;g/\\u0026micro;L, leupeptin 1 \\u0026micro;g/\\u0026micro;L, DTT 1 mmol/L). Protein concentration was quantified by BCA protein assay (Beyotime, China) according to the manufacturer\\u0026rsquo;s protocol using bovine serum albumin (BSA) to prepare a standard curve. Gel electrophoresis was performed with 10\\u0026ndash;20 \\u0026micro;g protein using 4\\u0026ndash;15% gels (Beyotime, China), followed by transblotting to 0.2 \\u0026micro;m PVDF membrane (Millipore, USA). Protein band intensities were determined and detected with BeyoECL Star kit (Beyotime, China) using the Amersham Imager 680 system (GE). Primary antibodies and secondary antibodies used in the experiments were shown in Table\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e. Blots were stripped with the stripping buffer (Beyotime, China) and then probed with anti-GAPDH if the molecular weight difference between the target protein and loading control was less than 5 KDa.\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab3\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 3\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eThe catalog of antibodies\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"4\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eAntibody\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eSupplier\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eCat.\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eDilution\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eAnti-COL1A1\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eThermoFisher\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003ePA5-29569\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e1:1000\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eAnti-ACTA2\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCST\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e19245S\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e1:1000\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eAnti-GAPDH\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCST\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e83506S\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e1:1000\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eAnti-LC3B\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCST\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e97166S\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e1:1000\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eAnti-SQSTM1\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eBeyotime\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eAF0279\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e1:1000\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eHRP-labeled Goat Anti-Mouse IgG(H\\u0026thinsp;+\\u0026thinsp;L)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eBeyotime\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eA0216\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e1:1000\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eHRP-labeled Goat Anti-Rabbit IgG(H\\u0026thinsp;+\\u0026thinsp;L)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eBeyotime\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eA0208\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e1:1000\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eMasson trichrome staining\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe Masson trichrome staining was performed following the manufacturer\\u0026rsquo;s protocol (Solarbio, China). The de-paraffined liver sections were incubated with Masson A buffer overnight and then heated at 65℃ for 30 min. After wash, the sections were incubated with the blended pre-warmed Masson B buffer and Masson C buffer for 1 min. The sections were washed and incubated with 1% v/v hydrochloric acid alcohol for 1min. After wash, the sections were incubated with Masson D buffer for about 6 min and then Masson E buffer for 1 min and Masson F buffer for 30 s. Afterwards, sections were incubated with 1% v/v acetic acid shortly 3 times and then dehydrated, hyalinized and sealed for observation.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eSirius red staining\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe Sirius red staining was performed following the manufacturer\\u0026rsquo;s protocol (Solarbio, China). The de-paraffined liver sections were incubated with staining buffer for 1h and then washed and incubated with 1% v/v acetic acid shortly. Afterwards the sections were dehydrated, hyalinized and sealed for observation.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eBulk RNA sequencing and data analysis\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eBoth the control group and the experimental group included 4 biological replicates. Library construction, quality assessment, and sequencing were performed by Sangon Biotech (Shanghai, China).RNA sequencing using the Illumina Novaseq 6000 platform with PE150 mode. Gene expression levels were quantified using the featureCounts software. Heatmap visualization was employed to generate heatmaps depicting differential gene expression changes. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses of differentially expressed genes were performed using the Phyper function based on the hypergeometric distribution test.\\u003c/p\\u003e\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e\\u003cp\\u003eThe Data were presented as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation (mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD) or mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard error of mean (mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM). Statistical significance was analyzed by unpaired t-test or Mann\\u0026ndash;Whitney test (Wilcoxon test) between the two groups and each group contains at least 3 independent samples. p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was considered statistically significant (*: p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, **: p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, ***: p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, ****: p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, ns: p\\u0026thinsp;\\u0026gt;\\u0026thinsp;0.05). Analysis was performed using GraphPad Prism 9 (GraphPad Software).\\u003c/p\\u003e\\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eTo investigate the toxic effect of lificiguat on HSCs, LX-2 cells were treated with 2\\u0026ndash;100 \\u0026micro;M lificiguat for 24 h were stained with Calcein-AM and PI (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). Quantitative analysis of Calcein-AM and PI fluorescence further revealed lificiguat didn\\u0026rsquo;t significantly affect the cell viability of LX-2 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB,C). The results demonstrated no significant cytotoxicity of lificiguat within this concentration range. Lificiguat treatment decreases the cell viability of LX-2 cells, which suggests the lificiguat inhibits the cell proliferation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD, E). EdU incorporation assay was performed, and the results revealed the lificiguat treatment significantly inhibits the cell proliferation of LX-2 cells with concentrations higher than 50\\u0026micro;M (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eF). In addition, confocal microscopy revealed EdU-positive LX-2 cells were reduced by lificiguat treatment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eG). Collectively, these results demonstrated that lificiguat inhibited LX-2 cell proliferation without inducing cytotoxicity.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe mRNA expression of ACTA2, COL1A1, and TIMP1 in LX-2 cells treated with lificiguat was analyzed by RT-qPCR. Results demonstrated about 50% reduction in COL1A1 mRNA expression in lificiguat-treated LX-2 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). However, mRNA expression of ACTA2 and TIMP1 remained unaltered with lificiguat treatment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA, C). The RT-qPCR results indicated lificiguat inhibited collagen expression of LX-2 cells. To further validate these findings, COL1A1 and ACTA2 protein expression was quantified by Western blotting. The results revealed Lificiguat significantly suppressed COL1A1 protein expression in LX-2 cells, whereas ACTA2 protein expression was not inhibited by lificiguat (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD, E). The results demonstrate that lificiguat suppressed collagen synthesis in LX-2 cells.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eLificiguat was proposed to be used as a prototypical sGC stimulator, which activates sGC independently of NO[\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. To determine whether lificiguat's inhibitory effects on LX-2 cell proliferation and collagen synthesis require sGC activity, we designed three shRNAs specifically targeting the sGC β1 subunit (GUCY1B1) and generated corresponding shRNA-expressing lentiviral vector. LX-2 cells transduced with GUCY1B1 shRNA2 exhibited 78% reduction in GUCY1B1 mRNA expression (22% residual vs. control)(Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). The results of CCK-8 assay and EdU incorporation assay revealed knock down of GUCY1B1 in LX-2 cells didn\\u0026rsquo;t completely revert the inhibitory effect of lificiguat on cell proliferation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB, C). RT-qPCR analysis revealed no significant alterations in ACTA2 or TIMP1 expression in either control or knockdown LX-2 cells following lificiguat treatment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD, F-H). GUCY1B1 knock down slightly recovered the mRNA expression of COL1A1 in LX-2 cells treated with lificiguat, but the protein expression of COL1A1 remained unchanged either in control or knock down cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eE, G, I). Altogether, the results indicated the effect of lificiguat on LX-2 cells was independent of sGC activity.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eSince lificiguat inhibited cell proliferation and collagen production of the LX-2 cells via a sGC-independent manner, we were wondering whether the effect of lificiguat was associated with autophagy. Macroautophagy (hereafter autophagy) regulates HSC activation[\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. We assessed LC3B lipidation and SQSTM1 degradation by western blotting. Lificiguat treatment seemed to increase expression of the LC3B-II and LC3B-I (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA). As autophagy involves dynamic autophagosome formation and autolysosomal fusion, we employed bafilomycin A1, a reversible V-ATPase inhibitor, to block autophagosome-lysosome fusion and lysosomal acidification. BafA1 treatment increased LC3B-II/LC3B-I ratios regardless of lificiguat exposure, confirming fusion inhibition. Notably, lificiguat and BafA1 co-treatment further elevated LC3B-II accumulation, suggesting enhanced autophagic flux(Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB). To validate this, we monitored autophagic progression in LX-2 cells stably expressing mCherry-EGFP-LC3B with confocal microscope. The images revealed the Lificiguat significantly increased both yellow and red puncta versus vehicle control (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC-D), mirroring rapamycin's effects. These results demonstrate that lificiguat enhanced autophagic flux in LX-2 cells.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eProvided the effect of lificigaut depended on the enhanced autophagy flux, blocking autophagy could revert the lificiguat\\u0026rsquo;s effect. Since ATG5 is an essential protein to form the autophagy body, we designed three ATG5-targeting shRNAs and validated lentiviral transduction. ATG5 shRNA1 reduced ATG5 mRNA to 12% of control levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA). ATG5 knockdown inhibited cell proliferation of LX-2 cells, shown as CCK-8 assay (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB). However, ATG5 knock down apparently reverted the inhibitory effect of lificiguat on EdU incorporation, which suggested ATG5 knock down inhibited cell proliferation but not affected S-phase DNA biosynthesis (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC). RT-qPCR analysis revealed ATG5 knock down didn\\u0026rsquo;t reverted the reduced mRNA expression of LX-2 cells treated with lificiguat (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eD-F). Interestingly, ATG5 knock down significantly reduced protein expression of ACTA2 in LX-2 cells without lificiguat treatment, but slightly affected protein expression of COL1A1 in LX-2 cells treated with lificiguat (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eG-I). These data demonstrated that lificiguat inhibited collagen synthesis independent of canonical ATG5-mediated autophagy.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eTo further explore the mechanisms of lificiguat on LX-2 cells, bulk RNA-seq was performed to detect the differentially expressed genes (DEGs). A total of 113 upregulated genes and 824 downregulated genes in lificiguat-treated cells versus controls were selected (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA). Heatmap visualization of normalized DEG expression demonstrated significant inter-group divergence alongside intra-group homogeneity (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eB). GO analysis revealed significant DEG enrichment across functional categories, with biological processes dominated by system development and multicellular organismal development, cellular components prominently featuring collagen-containing extracellular matrix and general extracellular matrix structures, and molecular functions enriched for calcium ion transmembrane transporter activity and metallopeptidase activity (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eC). KEGG enrichment showed significant pathway involvement in IL-17 signaling, calcium signaling, and extracellular matrix (ECM)-receptor interaction (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eD). GSEA confirmed JAK-STAT pathway activation, with co-enrichment of IL-17 signaling and ECM-receptor interaction (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eE-H). To functionally annotate DEGs in lificiguat-treated LX-2 cells, we analyzed cytokine- and ECM-related DEGs (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eF). Treatment significantly downregulated ECM-associated genes, including collagen family members COL1A1, COL3A1, COL5A1, COL6A3, and COL12A1, alongside fibrillin (FBN1, FBN2) and fibronectin (FN1) genes. Concurrently, pro-inflammatory cytokines IL6, IL1A, IL1B, IL11, and CCL3 were upregulated. Collectively, lificiguat exerted anti-fibrotic effects through coordinated regulation of ECM production and inflammation-associated cytokine production.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eTo evaluate the effectiveness of lificiguat in vivo, we measured the serum ALT and AST, the widely used liver injury marker in control mice and CCl₄-challenged mice treated with or without lificiguat. The results showed that lificiguat decreased the serum concentration of ALT and AST of CCl₄-challenged mice, which demonstrated the lificiguat alleviated liver injury (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eA, B). In addition, mRNA expression of profibrotic genes including Acta2 and Col1a1 and inflammatory genes including Il6 and Cd68 of mice liver were measured with RT-qPCR (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eC-F). The results showed lificiguat decreased about 50% expression of Acta2 and Col1a1 in the livers of mice challenged by CCl₄, which indicated the lificiguat inhibited the fibrosis progression of CCl₄ mice models. However, the inflammatory genes including Il6 and Cd68 were not altered by lificiguat, which indicated that lificiguat had little effect on general inflammatory reaction involved in the liver fibrosis. Furthermore, the liver sections of control mice, CCl₄-challenged mice treated with or without lificiguat were stained with Masson trichrome and Sirius red. The histological results revealed the lificiguat significantly decreased the formation of the fibrous septa (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eG). Altogether, the in vivo data demonstrated the lificiguat alleviate the liver injury and fibrosis progression of CCl₄-challenged mice.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eHepatic fibrosis is a pathological process characterized by accumulation of excessive ECM and scar tissue formation resulting from chronic liver injury of diverse etiologies. Activation of HSCs into myofibroblasts, which exhibit enhanced proliferative capacity and overproduction collagens and other ECM components, ultimately induce hepatic architectural disruption and function impairment[\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. Additionally, activated HSCs autocrinally secrete multiple pro-fibrotic cytokines (including TGF-β and PDGF), chemokines (e.g., CCL2), and immunoregulatory molecules that modulate immune cell functions within the injured hepatic microenvironment[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. Lificiguat, an indazole derivative, exhibits multifaceted bioactivity including suppression of chronic inflammation via nuclear factor κB (NF-κB) inhibition and reduction of hypoxia-induced profibrotic factor expression through hypoxia-inducible factor-1α (HIF-1α) blockade[\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. Our study demonstrates lificiguat\\u0026rsquo;s anti-fibrotic efficacy both in vitro and in vivo. Lificiguat significantly inhibits proliferation of the human HSC LX-2 cells and downregulates mRNA and protein expression of COL1A1 without obvious cell toxicity. More importantly, our results reveal the anti-fibrotic effect of lificiguat is independent of sGC-autophagy pathway. Concomitantly, lificiguat reduces liver injury markers, downregulates fibrotic genes (Acta2, Col1a1) in liver tissue, and attenuates fibrous septa formation in CCl₄-induced mice models, validating its in vivo anti-fibrotic activity.\\u003c/p\\u003e\\u003cp\\u003esGC, the key effector of NO signaling, comprises α1 (GUCY1A1) and β1 (GUCY1B1) subunits. The β1 subunit harbors a heme-containing H-NOX domain that serves as lificiguat's binding site and mediates NO sensing, with its conformational changes being essential for sGC activation[\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e] Upon activation, sGC catalyzes GTP conversion to the second messenger cGMP. Subsequently, cGMP suppresses HIF-1α and vascular endothelial growth factor (VEGF) expression attenuating excessive hepatic fibrosis and angiogenesis. Furthermore, sGC modulates NF-κB signaling via the cGMP/PKG pathway, reducing pro-inflammatory cytokine release and mitigating inflammation-mediated HSC activation, which collectively impedes fibrotic progression[\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. sGC agonists (e.g., riociguat, IW-1973) and has been proved to exert anti-fibrotic effects by elevating hepatic cGMP levels and inhibiting HSC activation, collagen deposition, and inflammation[\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e].However, our results demonstrate that lificiguat's suppression of hepatic stellate cell proliferation and COL1A1 expression independent of GUCY1B1 activity. This indicates lificiguat\\u0026rsquo;s sGC-independent anti-fibrotic mechanisms. Studies indicate that BAY 41-2272, an sGC activator analogous to lificiguat, functions independently of NO stimulation. Notably, it concurrently suppresses TGFβ1-induced connective tissue growth factor (CTGF) expression in HSCs via sGC/cGMP-independent pathways, thereby exerting anti-fibrotic effects[\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e].\\u003c/p\\u003e\\u003cp\\u003eAutophagy, a conserved process involving degradation of cellular components via the autophagosome-lysosome system, regulates HSC activation. Hepatic stellate cell activation is accompanied by autophagy induction. Enhanced autophagy attenuates hepatic fibrosis by degrading profibrotic factors (e.g., type I collagen), reducing ECM deposition, suppressing exosome-induced HSC activation, and diminishing fibroblast-derived extracellular vesicle release[\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e].Notably, the sGC stimulator IW-1973 enhances autophagy in white adipose tissue of HFD-fed obese mice and 3T3-L1 adipocytes, manifested by upregulated autophagy-related proteins, increased LC3-II/LC3-I ratio, and reduced SQSTM1/p62[\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e], suggesting sGC activation may regulate lipid metabolism through autophagy induction. However, the downstream mechanisms mediating autophagy-related protein expression and functional activation require further investigation. ATG5 is a core protein of the canonical autophagy pathway, which forms an E3-like complex with ATG12 and ATG16L1 to mediate LC3 lipidation, autophagosome elongation, and maturation[\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. ATG5 maintains pH homeostasis of acidic organelles by regulating V1-ATPase recruitment, while Atg5 deficiency induces aberrant biogenesis of late endosomes and lysosomes [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. ATG5-dependent autophagy inhibits renal fibrosis by preventing G2/M arrest in proximal tubules[\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e], and it is essential for rilpivirine's anti-fibrotic actions in hepatic fibrosis[\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. Although lificiguat enhanced autophagic flux of HSCs, our data demonstrate that lificiguat's anti-fibrotic effects, particularly collagen synthesis suppression doesn\\u0026rsquo;t rely on ATG5-dependent autophagy.\\u003c/p\\u003e\\u003cp\\u003eHSCs release various cytokines to orchestrate the hepatic microenvironment during hepatic fibrosis: they secrete chemokines (CXCL1, CXCL2) recruiting neutrophils and monocytes to initiate inflammation, produce pro-inflammatory cytokines (IL-1β, IL-6) amplifying immune responses, and release TGF-β, COL1A1, COL3A1, and FN1 to drive uncontrolled ECM deposition[\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. Additionally, aHSCs overexpress IL-11 to accelerate hepatic fibrogenesis through autocrine promotion of HSC activation, proliferation and upregulation of collagen genes, and JNK/ERK pathway-mediated hepatocyte apoptosis [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. This suggests functional heterogeneity within hepatic stellate cell populations where distinct subsets specialize in inflammatory factor secretion versus collagen synthesis, exhibiting divergent effect on fibrogenesis. JAK-STAT signaling is involved in fibrogenesis through STAT3-mediated immunomodulation, HSC activation, cytokine release, proliferation and apoptosis regulation[\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. Pharmacological inhibition of JAK2 suppresses morphological transdifferentiation of HSCs while reducing mRNA expression of multiple profibrotic genes, indicating the pathway's critical regulatory role in initial HSC activation[\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]. Quantitative proteomics of activated HSC reversion identifies STAT1 as a pivotal regulator during fibrogenesis, whose downregulation facilitates phenotypic transition from profibrotic activation to quiescence, thereby limiting fibrosis progression[\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]. STAT1 activation induces HSC apoptosis, attenuating hepatic fibrosis by reducing profibrotic HSC populations[\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. Similarly, ginkgetin triggers STAT1-mediated HSC apoptosis and reduces collagen production[\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. The RNA-seq data of hepatic stellate cells demonstrates JAK-STAT pathway activation by lificiguat, though precise molecular mechanisms require further validation.\\u003c/p\\u003e\\u003cp\\u003eIn summary, our study demonstrates that lificiguat exerts anti-fibrotic effects both in vitro and in vivo by inhibiting HSC proliferation and collagen synthesis through mechanisms independent of sGC activity and ATG5-mediated autophagy, but may modulate ECM-inflammation-related pathways such as JAK-STAT and IL-17 signaling.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe acknowledge the assistance with the access of analytic instruments from the Translational Medicine Center at the First Affiliated Hospital of Zhengzhou University.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFundings\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by the Henan Province Science and Technology Research Project (Grant No. 252102310060) and the Henan Province Outstanding Young Talent Program for Young and Middle-aged Health Science Innovation (Grant No. JQRC2023002).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eData availability The raw sequencing data of LX-2 cells generated in this study have been deposited in the Genome Sequence Archive (GSAHuman: HRA012363) of the National Genomics Data Center, Beijing Institute of Genomics, Chinese Academy of Sciences / National Center for Bioinformation. These data can be publicly accessed through the website: https://ngdc.cncb.ac.cn/gsahuman. All other relevant data supporting the findings of this study are included in the article.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCRediT authorship contribution statement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTongguo Yang\\u003c/strong\\u003e: Writing \\u0026ndash; original draft, Validation, Methodology, Formal analysis, Data curation, Conceptualization. \\u003cstrong\\u003eYuyang Gu\\u003c/strong\\u003e: Writing \\u0026ndash; original draft, Visualization, Investigation, Data curation. \\u003cstrong\\u003eKun Li\\u003c/strong\\u003e: Writing \\u0026ndash; original draft, Software, Formal analysis, Investigation. \\u003cstrong\\u003eZhi Zheng\\u003c/strong\\u003e: Writing \\u0026ndash; original draft, Methodology, Investigation. \\u003cstrong\\u003eJiheng Shan\\u003c/strong\\u003e: Methodology, Investigation, Data curation. \\u003cstrong\\u003ePengfei Chen\\u003c/strong\\u003e: Software, Validation, Formal analysis. \\u003cstrong\\u003eTianyu Huang\\u003c/strong\\u003e: Data curation, Investigation. \\u003cstrong\\u003eJianzhuang Ren\\u003c/strong\\u003e: Writing \\u0026ndash; review \\u0026amp; editing, Supervision, Project administration, Conceptualization. \\u003cstrong\\u003eMengfan Zhang\\u003c/strong\\u003e: Writing \\u0026ndash; review \\u0026amp; editing, Supervision, Resources, Project administration, Funding acquisition. \\u003cstrong\\u003eWenguang Zhang\\u003c/strong\\u003e: Writing \\u0026ndash; review \\u0026amp; editing, Supervision, Resources, Funding acquisition, Conceptualization.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eKisseleva T, Brenner D. Molecular and cellular mechanisms of liver fibrosis and its regression, Nature reviews. Gastroenterol Hepatol. 2021;18(3):151\\u0026ndash;66.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eTsuchida T, Friedman SL. Mechanisms of hepatic stellate cell activation, Nature reviews. Gastroenterology \\u0026amp; hepatology; 2017.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZhang M, Serna-Salas S, Damba T, Borghesan M, Demaria M, Moshage H. Hepatic stellate cell senescence in liver fibrosis: Characteristics, mechanisms and perspectives. Mech Ageing Dev. 2021;199:111572.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKreisel W, Lazaro A, Trebicka J, Grosse Perdekamp M, Schmitt-Graeff A, Deibert P. Cyclic GMP in Liver Cirrhosis\\u0026mdash;Role in Pathophysiology of Portal Hypertension and Therapeutic Implications. Int J Mol Sci 22(19) (2021).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eYang W, He H, Wang T, Su N, Zhang F, Jiang K, Zhu J, Zhang C, Niu K, Wang L, Yuan X, Liu N, Li L, Wei W, Hu J. Single-Cell Transcriptomic Analysis Reveals a Hepatic Stellate Cell-Activation Roadmap and Myofibroblast Origin During Liver Fibrosis in Mice, Hepatology (Baltimore. Md). 2021;74(5):2774\\u0026ndash;90.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eHall KC, Bernier SG, Jacobson S, Liu G, Zhang PY, Sarno R, Catanzano V, Currie MG, Masferrer JL. sGC stimulator praliciguat suppresses stellate cell fibrotic transformation and inhibits fibrosis and inflammation in models of NASH. Proc Natl Acad Sci USA. 2019;116(22):11057\\u0026ndash;62.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBuys ES, Zimmer DP, Chickering J, Graul R, Chien YT, Profy A, Hadcock JR, Masferrer JL, Milne GT. Discovery and development of next generation sGC stimulators with diverse multidimensional pharmacology and broad therapeutic potential. Nitric Oxide. 2018;78:72\\u0026ndash;80.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMartin E, Lee YC, Murad F. YC-1 activation of human soluble guanylyl cyclase has both heme-dependent and heme-independent components. Proc Natl Acad Sci U S A. 2001;98(23):12938\\u0026ndash;42.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eXiao J, Jin C, Liu Z, Guo S, Zhang X, Zhou X, Wu X. The design, synthesis, and biological evaluation of novel YC-1 derivatives as potent anti-hepatic fibrosis agents. Org Biomol Chem. 2015;13(26):7257\\u0026ndash;64.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eDai Q, Qing X, Jiang W, Wang S, Liu S, Liu X, Huang F, Zhao H. Aging aggravates liver fibrosis through downregulated hepatocyte SIRT1-induced liver sinusoidal endothelial cell dysfunction. Hepatol Commun 8(1) (2024).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eGao J, Wei B, de Assuncao TM, Liu Z, Hu X, Ibrahim S, Cooper SA, Cao S, Shah VH, Kostallari E. Hepatic stellate cell autophagy inhibits extracellular vesicle release to attenuate liver fibrosis. J Hepatol. 2020;73(5):1144\\u0026ndash;54.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eHorn P, Tacke F. Metabolic reprogramming in liver fibrosis. Cell Metab. 2024;36(7):1439\\u0026ndash;55.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eJin L, Gao H, Wang J, Yang S, Wang J, Liu J, Yang Y, Yan T, Chen T, Zhao Y, He Y. Role and regulation of autophagy and apoptosis by nitric oxide in hepatic stellate cells during acute liver failure. Liver international: official J Int Association Study Liver. 2017;37(11):1651\\u0026ndash;9.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eShirazi MK, Azarnezhad A, Abazari MF, Poorebrahim M, Ghoraeian P, Sanadgol N, Bokharaie H, Heydari S, Abbasi A, Kabiri S, Aleagha MN, Enderami SE, Dashtaki AS, Askari H. The role of nitric oxide signaling in renoprotective effects of hydrogen sulfide against chronic kidney disease in rats: Involvement of oxidative stress, autophagy and apoptosis. J Cell Physiol. 2019;234(7):11411\\u0026ndash;23.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSydor S, Bechmann LP. Hepatic stellate cell autophagy in acute liver injury: A novel role for nitric oxide? Liver international: official J Int Association Study Liver. 2017;37(11):1602\\u0026ndash;4.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSandner P, Vakalopoulos A, Hahn MG, Stasch JP, Follmann M. Soluble guanylate cyclase stimulators and their potential use: a patent review. Expert Opin Ther Pat. 2021;31(3):203\\u0026ndash;22.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLiu R, Kang Y, Chen L. Activation mechanism of human soluble guanylate cyclase by stimulators and activators. Nat Commun. 2021;12(1):5492.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLucantoni F, Mart\\u0026iacute;nez-Cerezuela A, Gruevska A, Moragrega B, V\\u0026iacute;ctor \\u0026Aacute;VM, Esplugues JV, Blas-Garc\\u0026iacute;a A, Apostolova N. Understanding the implication of autophagy in the activation of hepatic stellate cells in liver fibrosis: are we there yet? J Pathol. 2021;254(3):216\\u0026ndash;28.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eXi S, Zheng X, Li X, Jiang Y, Wu Y, Gong J, Jie Y, Li Z, Cao J, Sha L, Zhang M, Chong Y. Activated Hepatic Stellate Cells Induce Infiltration and Formation of CD163(+) Macrophages via CCL2/CCR2 Pathway. Front Med. 2021;8:627927.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eYu KH, Hung HY. Synthetic strategy and structure-activity relationship (SAR) studies of 3-(5'-hydroxymethyl-2'-furyl)-1-benzyl indazole (YC-1, Lificiguat): a review. RSC Adv. 2021;12(1):251\\u0026ndash;64.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBrusilovskaya K, K\\u0026ouml;nigshofer P, Lampach D, Szodl A, Supper P, Bauer D, Beer A, Stift J, Timelthaler G, Oberhuber G, Podesser BK, Seif M, Zinober K, Rohr-Udilova N, Trauner M, Reiberger T, Schwabl P. Soluble guanylyl cyclase stimulation and phosphodiesterase-5 inhibition improve portal hypertension and reduce liver fibrosis in bile duct-ligated rats. United Eur Gastroenterol J. 2020;8(10):1174\\u0026ndash;85.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eFlores-Costa R, Alcaraz-Quiles J, Titos E, L\\u0026oacute;pez-Vicario C, Casulleras M, Duran-G\\u0026uuml;ell M, Rius B, Diaz A, Hall K, Shea C, Sarno R, Currie M, Masferrer JL, Cl\\u0026agrave;ria J. The soluble guanylate cyclase stimulator IW-1973 prevents inflammation and fibrosis in experimental non-alcoholic steatohepatitis. Br J Pharmacol. 2018;175(6):953\\u0026ndash;67.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eChen PJ, Kuo LM, Wu YH, Chang YC, Lai KH, Hwang TL. BAY 41-2272 Attenuates CTGF Expression via sGC/cGMP-Independent Pathway in TGFβ1-Activated Hepatic Stellate Cells. Biomedicines 8(9) (2020).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eGao J, Wei B, de Assuncao TM, Liu Z, Hu X, Ibrahim S, Cooper SA, Cao S, Shah VH, Kostallari E. Hepatic stellate cell autophagy inhibits extracellular vesicle release to attenuate liver fibrosis. J Hepatol. 2020;73(5):1144\\u0026ndash;54.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003ePeng J, Zhang R, Cui Y, Liu H, Zhao X, Huang L, Hu M, Yuan X, Ma B, Ma X, Takashi U, Masaaki K, Liang X, Yu L. Atg5 regulates late endosome and lysosome biogenesis. Sci China Life Sci. 2014;57(1):59\\u0026ndash;68.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLucantoni F, Benedicto AM, Gruevska A, Moragrega B, Fuster-Mart\\u0026iacute;nez \\u0026Aacute;I, Esplugues JV, Blas-Garc\\u0026iacute;a A, Apostolova N. Implication of autophagy in the antifibrogenic effect of Rilpivirine: when more is less. Cell Death Dis. 2022;13(4):385.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLi H, Peng X, Wang Y, Cao S, Xiong L, Fan J, Wang Y, Zhuang S, Yu X, Mao H. Atg5-mediated autophagy deficiency in proximal tubules promotes cell cycle G2/M arrest and renal fibrosis. Autophagy. 2016;12(9):1472\\u0026ndash;86.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eGupta G, Khadem F, Uzonna JE. Role of hepatic stellate cell (HSC)-derived cytokines in hepatic inflammation and immunity. Cytokine. 2019;124:154542.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eNajar M, Fayyad-Kazan H, Faour WH, El Taghdouini A, Raicevic G, Najimi M, Toungouz M, van Grunsven LA, Sokal E, Lagneaux L. Human hepatic stellate cells and inflammation: A regulated cytokine network balance. Cytokine. 2017;90:130\\u0026ndash;4.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eJiang LF, Yang M, Meng HW, Jia PC, Du CL, Liu JY, Lv XW, Cheng H, Li J. The effect of hepatic stellate cell derived-IL-11 on hepatocyte injury in hepatic fibrosis. Life Sci. 2023;330:121974.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZhao J, Qi YF, Yu YR. STAT3: A key regulator in liver fibrosis. Ann Hepatol. 2021;21:100224.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLakner AM, Moore CC, Gulledge AA, Schrum LW. Daily genetic profiling indicates JAK/STAT signaling promotes early hepatic stellate cell transdifferentiation. World J Gastroenterol. 2010;16(40):5047\\u0026ndash;56.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZhang H, Chen F, Fan X, Lin C, Hao Y, Wei H, Lin W, Jiang Y, He F. Quantitative Proteomic analysis on Activated Hepatic Stellate Cells reversion Reveal STAT1 as a key regulator between Liver Fibrosis and recovery. Sci Rep. 2017;7:44910.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMart\\u0026iacute;-Rodrigo A, Alegre F, Moragrega B, Garc\\u0026iacute;a-Garc\\u0026iacute;a \\u0026Aacute;F, Mart\\u0026iacute;-Rodrigo P, Fern\\u0026aacute;ndez-Iglesias A, Gracia-Sancho J, Apostolova N, Esplugues JV. Blas-Garc\\u0026iacute;a, Rilpivirine attenuates liver fibrosis through selective STAT1-mediated apoptosis in hepatic stellate cells. Gut. 2020;69(5):920\\u0026ndash;32.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Lificiguat, Liver fibrosis, Hepatic stellate cells, sGC, Collagen\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-7224016/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-7224016/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e\\u003cp\\u003eLiver fibrosis is driven by activated hepatic stellate cells (HSCs) that overproduce extracellular matrix, particularly collagen. Lificiguat, a soluble guanylate cyclase (sGC) stimulator, exhibits anti-fibrotic potential, but its mechanism in HSC activation remains unclear. This study aims to investigate the anti-fibrotic effect and mechanisms of lificiguat .\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e\\u003cp\\u003ehuman HSCs are treated with different concentrations of lificiguat. Cell proliferation was assessed by CCK-8 assay and EdU incorporation assay. Fibrogenic markers of hepatic stellate cell including COL1A1, ACTA2 and TIMP1 are measured with RT-qPCR and Western blot. sGCβ1 (GUCY1B1) or ATG5 knockdown of HSCs are achieved with lentivirus transduction. Bulk RNA sequencing of HSC cells is performed to investigate the differentially expressed genes associated with lificiguat treatment. Serum ALT and AST, hepatic gene expression, and liver histology including Masson and Sirius red staining are analyzed with samples from CCl₄-induced fibrotic mice with or without lificiguat treatment.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e\\u003cp\\u003eLificiguat significantly inhibits cell proliferation and COL1A1 expression of HSCs without obvious cytotoxicity. GUCY1B1 knockdown in HSCs doesn\\u0026rsquo;t reverse lificiguat\\u0026rsquo;s effects, which indicates the anti-fibrotic effect of lificiguat doesn\\u0026rsquo;t rely on sGC activity. Lificiguat enhances autophagic flux, but ATG5 knockdown fails to recover COL1A1 expression of HSCs treated with lificiguat. RNA-seq data indicates lificiguat modulates JAK-STAT and IL-17 pathways of HSCs. Lificiguat reduced liver injury markers including serum ALT and AST in CCL₄-challenged mice. In addition, lificiguat reduces mRNA expression of fibrogenic marker gene including Col1a1 and Acta2 and attenuate liver fibrosis in CCl₄ mice models.\\u003c/p\\u003e\\u003ch2\\u003eConclusion\\u003c/h2\\u003e\\u003cp\\u003eLificiguat attenuates liver fibrosis by inhibiting HSC proliferation and collagen synthesis through sGC- and ATG5-independent mechanisms, potentially via regulating JAK-STAT and IL-17 pathways.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Lificiguat inhibits the collagen production of hepatic stellate cells independently on sGC activity\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-08-06 17:12:15\",\"doi\":\"10.21203/rs.3.rs-7224016/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"028b565e-556d-4a2e-b401-a3a69bb6f560\",\"owner\":[],\"postedDate\":\"August 6th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-08-28T22:51:14+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-08-06 17:12:15\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-7224016\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-7224016\",\"identity\":\"rs-7224016\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}