{"paper_id":"1158d4b1-07d7-4ec4-b79d-b3b0613f7080","body_text":"CCK Administration Alleviates Memory Encoding Impairment in NR2A Knockout Transgenic Mice by Improving Synaptic Plasticity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article CCK Administration Alleviates Memory Encoding Impairment in NR2A Knockout Transgenic Mice by Improving Synaptic Plasticity Jufang He, Xuejiao ZHENG, Yilin Zheng, Yuanying LAI, Peng TANG, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7982110/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 12 You are reading this latest preprint version Abstract Studies have demonstrated that NMDA receptors (NMDARs) mediate multiple forms of synaptic plasticity, including the induction of long-term potentiation (LTP) and long-term depression (LTD) [ 1 ] . The NR2A subunit is closely associated with LTP generation, which in turn induces learning and memory-related behaviors. This is evidenced by the significant memory deficit behaviors observed in NR2A knockout (NR2A -/-) mice [ 2 ] . Consequently, NR2A-KO animals serve as a valuable model for exploring memory encoding-related pathways and mechanisms, as well as for providing insights into drug-based treatments for memory disorders. Previous research has shown that cholecystokinin (CCK)-expressing neurons are abundantly present in the cerebral cortex and hippocampus, and they are involved in memory engram functions across multiple brain regions [ 3 – 6 ] . However, it remains unclear whether CCK administration can ameliorate the memory deficits exhibited by NR2A knockout animals in certain learning and memory behaviors. In this study, the novel object recognition task and auditory paired conditioned fear learning paradigm were employed to evaluate the role of CCK in rescuing memory deficits in NR2A knockout (NR2A-KO) mice. Our results revealed that NR2A-KO mice displayed significant impairments in both the novel object recognition paradigm and the conditioned fear behavioral paradigm. Notably, CCK administration improved the performance of these mice in these behavioral tasks. Concurrently, in vitro multichannel electrophysiological recordings were used to investigate the effects of CCK administration on LTP induction in the cortex and hippocampus. The findings indicated that CCK restored the loss of LTP in the cortex and hippocampus of NR2A-KO mice. Furthermore, fiber photometry was utilized to monitor calcium (Ca²⁺) activity in the auditory cortex (AC) in response to the auditory cue of paired conditioned fear. The results showed that CCK administration significantly enhanced calcium signal changes in the auditory cortex in response to the sound, suggesting that CCK treatment restored the memory of auditory paired conditioned fear in NR2A-KO mice to the level of wild-type mice. To verify the hypothesis that NR2A deficiency may affect CCK release from CCK neurons, building on our previous studies which showed that the projection of CCK neurons from the lateral entorhinal cortex (LEC) to the auditory cortex is involved in sound - cued associative memory [ 7 , 8 ] , we employed a specific CCKBR sensor system combined with optogenetic viruses. We examined CCK release from CCK axon terminals projecting from the LEC to the AC following high - frequency stimulation in the presence of an NR2A antagonist. The results demonstrated that the NR2A antagonist blocked CCK release. Anatomically, a large number of NMDARs composed of NR2A subunits were found to be clustered at the CCK axon terminals projecting from the LEC to the AC, which structurally verified the possibility that NR2A might affect CCK release. Collectively, these results indicate that CCK administration not only compensates for the loss of LTP in NR2A-KO mice but also ameliorates certain memory deficit - like behaviors exhibited by these animals. Overall, our study suggests that CCK is a potential target for the treatment of memory deficits and clarifies its therapeutic role in the memory deficit behaviors displayed by NR2A-KO animals. Biological sciences/Neuroscience/Learning and memory Health sciences/Diseases Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction The ability to encode and retrieve memories is crucial for mammals to survive in a constantly changing environment. Extensive research has highlighted the key role of NMDA receptor activation in the neural plasticity underlying memory encoding and retrieval [ 7 ] . The distinct functions of these receptors in different brain networks are influenced by their biophysical properties and subunit composition [ 8 ] . Notably, the loss of the NR2A subunit leads to a significant reduction in LTP induction in the hippocampus and cortex, which is closely associated with cognitive decline, as reflected by impaired cognitive function in animals [ 9 ] . The GluN1 subfamily is essential for NMDAR function, while different subtypes of GluN2 play critical roles in regulating memory at different developmental stages. This includes the NR2A - D subfamily, which primarily determines the functional diversity and synaptic localization of NMDARs [ 10 ] . NR2A knockout (NR2A-KO) mice exhibit spatial learning and memory impairments in behavioral paradigms such as the water maze and Y - maze [ 2 – 4 ] . This underscores the role of NR2A in learning and memory processing and also indicates the applicability of this model in memory research. In our study, the novel object recognition (NOR) system and auditory paired conditioned fear task were used to assess working memory and fear memory deficits in NR2A-KO mice. The experimental results showed that NR2A-KO mice performed poorly in both the novel object recognition task and the conditioned fear task, making it difficult for them to establish working memory and fear memory. The decline in cognitive and memory functions, which is particularly prominent in certain neurological disorders such as Alzheimer's disease, often involves difficulties in recognizing familiar objects and associating cues with danger [ 11 ] . Using high - throughput techniques like microarray analysis, scientists have identified potential intervention targets and found a significant decrease in cholecystokinin (CCK) expression in patients with Alzheimer's disease [ 12 ] . CCK plays a vital role in memory encoding, and its endogenous release is closely linked to performance in associative memory tasks. Previous studies have supported the important role of CCK in neural plasticity within the central nervous system, as it significantly influences memory consolidation and promotes various types of memory, including auditory associative memory and fear memory [ 13 – 16 ] . The present study investigated the potential of cholecystokinin (CCK) administration in reversing memory deficits in NR2A knockout (NR2A-KO) mice, including the differences in performance of NR2A-KO mice in the novel object recognition task and the conditioned fear memory task before and after drug administration. Combined with calcium imaging technology, we observed that during the fear conditioning test, CCK - treated mice showed a significant enhancement in calcium signals in response to auditory stimuli. Studies have shown that brain regions such as the prefrontal cortex, auditory cortex, and hippocampus in the cortex play important roles in the processing of learning and memory. The responses of the auditory cortex, prefrontal cortex, and hippocampus to electrical stimulation further confirmed that CCK administration could restore the loss of long-term potentiation (LTP) in memory - related brain regions of NR2A-KO mice. In addition, our previous research results indicated that the projection of CCK neurons from the lateral entorhinal cortex to the auditory cortex is involved in sound - cued associative memory [ 7 , 8 ] . Therefore, we hypothesized that NR2A deficiency might affect the release of cholecystokinin (CCK) at the entorhinal - auditory projection terminals. This hypothesis was verified using a specific cholecystokinin B receptor (CCKBR) sensor and local administration of an NR2A antagonist. We found that in the presence of the NR2A antagonist, high - frequency stimulation of CCK axon terminals projecting from the lateral entorhinal cortex (LEC) to the AC blocked CCK release. Immunohistochemical staining and high - resolution imaging revealed the colocalization of CCK terminals with NR2A in cortical regions. This structurally indicates that the presence of NR2A plays a crucial role in regulating the release of the important neurotransmitter CCK, which may explain the significant memory deficit behaviors observed in NR2A knockout (KO) animals and the underlying neural regulatory mechanisms. Meanwhile, CCK holds promise as an effective drug for the treatment of memory deficits. Results NR2A Expression Was Significantly Reduced in the Auditory Cortex, Prefrontal Cortex, and Hippocampus of 3xTg AD Mice, and Cholecystokinin (CCK) Administration Ameliorated the Deficit in Fear Memory of Auditory Paired Conditioned Fear in NR2A-KO Mice Alzheimer's disease (AD) is a globally prevalent neurodegenerative disorder for which there is no effective cure, causing significant distress to humanity. It is characterized by cognitive decline, memory loss, and neuronal degeneration. A large body of research has shown that AD model mice exhibit significant deficits in memory - related behavioral tasks [ 13 , 14 , 15 ] . As a subunit of the NMDA receptor (N - methyl - D - aspartate receptor) that is closely associated with memory formation, we hypothesized that the expression level of NR2A in specific memory - related brain regions (such as the hippocampus and cerebral cortex) of AD animals might differ. To investigate whether the expression of NR2A protein in different brain regions of AD mice differs from that in normal mice, Western blot analysis was performed to detect the NR2A protein levels in 1 - year - old wild - type (WT) mice and AD (3xTg) mice. The results showed a significant reduction in NR2A in the cortex and prefrontal cortex of AD mice (Fig. 1A), suggesting that NR2A deficiency was highly likely associated with the memory impairment exhibited by AD animals. In our previous study, CCK agonist could rescue the memory impairment of AD mice exhibiting in water maze task [ 17 ] , therefore, We hypothesize whether CCK can rescue the responses of NR2A-KO in memory-related behaviors. To explore the role of cholecystokinin (CCK) in the memory behavior of NR2A knockout (KO) mice, the auditory - cued fear conditioning paradigm was used. Mice need to establish an association between a specific noise and the fear memory related to foot shocks. We observed that after training with the pairing of foot shocks and sound, NR2A-KO mice showed an extremely weak fear response to the noise (Fig. 1D) after fear conditioned training, while wild - type (WT) littermates exhibited a normal fear response to the conditioned sound. Compared with KO mice, heterozygous mice showed an intermediate level of fear response (Fig. 1D, WT vs. Homozygous: 84.5 ± 5.1% vs. 19.9 ± 4.7%, P < 0.0001). In our previous study CCK4 could transfer the blood brain barrier [ 18 ] , After intraperitoneal (i.p.) injection of 20ul CCK4 (CCKBR agonist) with 40uM per 20g weight before the training session, the fear memory response of NR2A-KO mice to the sound was significantly enhanced (Fig. 1E, Homozygous mice with CCK injection vs. Homozygous mice with vehicle injection: 80.9 ± 5.5% vs. 28.6 ± 8.5%, P < 0.01). These results indicate that CCK4 administration could improve the recovery of conditioned fear memory in mice, enabling them to respond to the conditioned sound cue in a manner similar to that of wild - type mice. To determine whether the auditory cortex is involved in auditory - cued fear conditioning, muscimol was injected to inhibit the bilateral auditory cortex in WT mice, followed by auditory - cued fear conditioning training. After muscimol injection into the auditory cortex, wild - type mice showed no response to the conditioned sound after fear training, indicating that the auditory cortex is indeed involved in auditory - associated fear memory (Fig. 1G). Changes in the Response of Cortical Neurons to Sound in NR2A-KO Mice Before and After Intraperitoneal Injection of Cholecystokinin To investigate the changes in calcium signals corresponding to the response of cortical neurons to sound before and after intraperitoneal injection of cholecystokinin (CCK) in NR2A-KO mice, AAV - Syn - Gcamp6 - WPRE - SV40 was injected into the primary auditory cortex (AC) of NR2A-KO mice and their littermate controls WT mice (Fig. 2A). We compared the changes in calcium signals in the auditory cortex neurons of NR2A-KO mice and WT littermates in response to conditioned sound before and after auditory - cued fear conditioning training. The results showed that in the NR2A-KO mice injected with saline, there was no significant change in the response of primary auditory cortex neurons to sound before and after training (Fig. 2F-H, before training vs. After training: 4.9% ± 0.6% to 4.5% ± 0.8% (△F/F0)). In contrast, littermate wild - type (WT) mice showed a stronger response to sound after training (Figure S1A-C, Before training vs. After training: 3.5% ± 0.5% to 8.7% ± 1.7% (△F/F0)). After intraperitoneal injection of CCK4 into NR2A-KO mice, the mice showed a response similar to that of WT mice, with a significant enhancement in the calcium signal corresponding to the response to sound after training (Fig. 2C-E, NR2A-KO mice Before training vs. After training: 6.5% ± 2.1% to 14.5% ± 0.8% (△F/F0)). This was significantly different from the saline injected control group, indicating that intraperitoneal injection of CCK4 rescued fear memory and restored calcium signal levels. These results suggested that CCK injection can enhance the response of NR2A-KO mice to auditory stimuli in conditioned fear training, thereby strengthening the formation of fear memory in NR2A-KO mice. NR2A-KO Mice Exhibited Impairments in the Novel Object Recognition Task, and CCK Administration Ameliorated Their Performance The ability to recognize novel objects is a fundamental survival skill for animals in nature, and the loss of this ability can be observed in certain neurological disorders, such as Alzheimer's disease. The novel object recognition (NOR) animal experimental paradigm is used to assess the integrity of working memory. We were interested in the performance of NR2A-KO mice in this experimental paradigm, so we used NR2A-KO animals and their cage - mate littermates as controls to investigate the performance of NR2A knockout mice in the novel object recognition paradigm. In this task, exploration time was quantified using the discrimination index. During the habituation phase, NR2A-KO animals did not show significant differences in locomotor activity compared with cage - mate control mice. However, in the novel object recognition test, NR2A knockout mice had a lower discrimination index than littermate control mice (Fig. 3B). The discrimination index was calculated as follows: Discrimination index = (Time spent exploring the novel object - Time spent exploring the familiar object) / (Time spent exploring the novel object + Time spent exploring the familiar object). Here, we hypothesized that CCK injection might also ameliorate the working memory deficit in knockout mice (Fig. 3C, WT vs. Homozygous: Discrimination index 0.30 ± 0.02 vs. 0.10 ± 0.04). The results showed that compared with the vehicle control group, NR2A knockout mice restored behavioral responses similar to those of normal mice (Fig. 3C, Homozygous mice with CCK injection vs. Homozygous mice with vehicle injection: 0.22 ± 0.03 vs. 0.01 ± 0.04). The movement trajectories of animals in each group's example, as shown in the Fig. 3D. After CCK injection, NR2A-KO mice spent more time on the novel object. This confirms that cholecystokinin plays a crucial role in the working memory of NR2A knockout mice. Throughout the experiment, no motor deficits were observed in NR2A knockout mice. Theta Burst Stimulation (TBS) Induced LTP in the AC, HIP, and mPFC of WT Mice but Not in NR2A-KO Mice, CCK Administration Rescued TBS - Induced LTP in NR2A-KO Mice To determine the effect of reduced NR2A subunit expression on cortical and hippocampal neural plasticity, a multichannel electrophysiological recording system (MED) was used to measure the changes in the amplitude and slope of field excitatory postsynaptic potentials (fEPSPs) in the cortex (auditory cortex, medial prefrontal cortex) and hippocampus before and after theta burst stimulation (TBS). Our results showed that in NR2A knockout (KO) mice, TBS - induced long-term potentiation (LTP) was lost in multiple brain regions, including the medial prefrontal cortex (mPFC), auditory cortex (AC), and hippocampus (Fig. 4B,C, blue line, Left panel: Auditory cortex: Before TBS vs. After TBS: 100.00 ± 0.00 vs. 95.44 ± 1.05; Middle panel: Medial prefrontal cortex: 99.81 ± 2.20 vs. 96.56 ± 2.60; Right panel: Hippocampus: 101.87 ± 0.73 vs. 106.16 ± 1.54). This indicates that NR2A deficiency leads to impaired neural plasticity. In our previous study, CCK administration could rescue the neuroplasticity of aged 3xTg AD mice [ 17 ] . However, we did not know the effect of CCK in NR2A-KO mice. Our results showed that administration of CCK at a specific concentration restored the TBS - induced LTP generation in the cerebral cortex and hippocampus (Fig. 4B,C, red line; Left panel: Auditory cortex (ACx): Before TBS vs. After TBS: 100.00 ± 0.00 vs. 143.40 ± 6.77; Middle panel: Medial prefrontal cortex (mPFC): 102.03 ± 0.38 vs. 159.71 ± 14.08; Right panel: Hippocampus (hip): 101.55 ± 0.64 vs. 130.72 ± 4.62). In contrast, the NR2A - specific antagonist NVP - AAM077 completely blocked TBS - induced LTP in wild - type mouse strains (Fig. 4D, E, red line; Left panel: Auditory cortex (ACx): Before TBS vs. After TBS: 100.56 ± 0.47 vs. 99.09 ± 1.33; Middle panel: Medial prefrontal cortex (mPFC): 99.74 ± 0.49 vs. 93.69 ± 2.47; Right panel: Hippocampus (hip): 99.25 ± 0.96 vs. 100.26 ± 1.48). This blocking effect confirmed that synaptic NMDA receptors, especially those containing the NR2A subunit, play a critical role in neural plasticity. Meanwhile, CCK administration could rescue the TBS induced LTP in NR2A-KO mice. Colocalization of NR2A Subunits with Entorhinal CCK Terminals in the Auditory Cortex and Detection of CCK Release In our previous studies, we found that CCK - expressing neurons in the entorhinal cortex extensively project to the auditory cortex and promote the formation of auditory - related memory through CCK release. CCK plays an important role in cortical and hippocampal neural plasticity [ 4 , 5 ] . The deficiency of NR2A in NR2A-KO animals leads to the loss of LTP and impairments in conditioned fear and novel object recognition memory. This led us to hypothesize that this might be related to the effect of NR2A deficiency on CCK release, and that the loss of cortical NR2A might interfere with CCK release, thereby impairing memory encoding. To verify this hypothesis, we first used immunohistochemical methods and confirmed that a large number of NR2A subunits are clustered at the axon terminals projecting from the entorhinal cortex to the auditory cortex (Fig. 5A upper panel: in auditory deep layer, lower panel: in auditory superficial layer). In the layer 5and6, the colocalizaiton of NR2A with CCK terminals is 31.67 ± 3.79%, In the layer1 and 2, the colocalizaiton of NR2A with CCK terminals is 39.35 ± 5.06%. To further clarify the possible localization of NR2A, we used a high - resolution microscope to observe the relationship between NR2A and synapses and found that many NR2A subunits are clustered at the presynaptic membrane in the deep layer of auditory cortex (Fig. 5B). In the auditory cortex, punctate structures were observed in the projections of neurons infected with adeno - associated virus (AAV-Syn-dio-mCherry-WPRE-PA), and NMDA receptors were labeled with an NR2A antibody. Further studies using two - color super - resolution localization microscopy showed a significant overlap between the mCherry punctate structures and the NR2A punctate structures. Around 30.69 ± 5.68% mCherry punctate were colocalized with NR2A (Fig. 5C) Therefore, the results indicated that NMDA receptors containing the NR2A subunit might specifically enrich at the presynaptic sites of the CCK projections from the entorhinal cortex to the auditory cortex. Next, to verify whether NR2A deficiency interferes with CCK release, we used a CCKBR sensor [ 19 ] to detect CCK release at the projection terminals and compared the results with those of a control group treated with a specific NR2A antagonist. We found that after high - frequency laser stimulation of the ChrimsonR protein expressed in the auditory cortex, a change in the fluorescence signal was observed due to the transient release of CCK. In contrast, the fluorescence signal in the antagonist group showed no significant increase compared with the baseline (Fig. 5E - H, △F/F0: HFLS group vs. HFLS + NVP - AAM077 group: 1.09 ± 0.03 vs. 0.00 ± 0.02). This indicated that NR2A antagonism affects the release of CCK from the projections of the lateral entorhinal cortex to the auditory cortex. In summary, all results indicated that CCK administration could improve the performance of NR2A-KO animals in auditory paired conditioned fear and novel object recognition behaviors. Meanwhile, the calcium activity to conditioned sound could be resued by CCK administration in NR2A-KO mice. Electrophysiologically, NR2A deficiency might lead to the loss of neural plasticity in the cortex and hippocampus, and CCK could rescue the induced long-term potentiation (LTP) in the auditory cortex, medial prefrontal cortex and hippocampus. Further mechanistic analysis suggested that NR2A deficiency might be associated with the impaired release of CCK in key pathways. Anatomically, a large number of NR2A subunits were clustered near or overlap with the presynaptically distributed cortical CCK terminals. The administration of an NR2A antagonist could block the fluorescent response detected by the sensor after CCK release. It further confirmed that the presence of NR2A might play a regulatory role in CCK release. Therefore, CCK administration provided a potential therapeutic approach for memory deficit - related neurological diseases. Methods Experimental Animals and Materials All experimental procedures were strictly in accordance with the current animal ethics regulations in Hong Kong and were approved by the Animal Ethics Committee of City University of Hong Kong. C57 (C57/BL/6) were obtained from Laboratory Animal Research Unit (LARU, City University of Hong Kong). B6;129S-NR2A-KO [Grin2a < tm1Nak>] were obtained from the Riken lab stock #RBRC02256. 3xTg AD [B6;129-Tg(APPSwe, tauP301L)1Lfa Psen1tm1Mpm / Mmjax, stock #034830-JAX] and control wildtype 129 (129S1/SvImJ, stock #002448) mice were obtained from the Jackson Laboratory. Mice were housed in 12 h light / 12 h dark cycle (light on from 8:00 to 20:00) and given food and water ad libitum. However, a week before the behavioral tests, animals were moved to a room with reversed 12 h dark / 12 h light cycle (light off from 8:00 to 20:00)Male transgenic NR2A knockout (Grin2a) mice aged 6–8 weeks, along with their negative control and heterozygous littermate mice, were used in this study. Drug Preparation and Administration for Behavioral Tests CCK-4 was purchased from Abcam (catalog no. ab141328). The drugs were dissolved in normal saline solution (0.9% NaCl) with less than 0.2% DMSO (catalog no. D8418, Sigma-Aldrich, German) to help dissolution. Vehicle (VEH) control was normal saline solution with the same concentration of DMSO as drug treatment group. Concentration and volume for i.p. injection were computed according to total blood volume (TBV). Mouse has about 56 µl of blood per grams of bodyweight [ 20 ] . For example, a mouse body weighted at 20 g, its TBV is 1.12 ml, and i.p. volume of 40 µM CCK-4 solution for the mouse is 20 µl. Insulin syringes (BD 6 mm x 31G; 3/10 mL; catalog no. 324909) were used for i.p. injection. For behavioral tests involving drug administration, The injection was performed 5 minutes before the training session. Auditory - Cued Conditioned Fear Training and Testing The conditioned fear training and testing were used to evaluate the differences in fear memory between NR2A knockout (KO) mice and their littermate control mice. In the baseline phase, the mice were placed in the experimental chamber for 2–3 minutes to allow them to familiarize themselves with the environment. Subsequently, 3 second pure tone was played through a speaker, and the mice's responses were observed. Each animal underwent 3 tests, with an interval of at least 1 minute between each test. Twenty - four hours later, the auditory - cued conditioned fear training phase began. The mice were placed in a different experimental chamber, and they were first exposed to the pure tone, followed by a foot shock (intensity: 0.5 mA), with an interval of 0.5 seconds between the tone and the shock. This phase consisted of 6 training sessions, with an interval of at least 1 minute between each session. On the next day, the mice were returned to the original experimental chamber and only exposed to the pure tone without the foot shock to assess their memory of the fear condition. Behavioral responses were recorded and analyzed by experimenters who were blind to the experimental conditions. Novel Object Recognition Test The experimental protocol for the novel object recognition test was adapted from previously published methods [ 21 , 22 ] . One week before the experiment, each mouse was handled for 2 minutes daily to acclimate it to human contact, thereby reducing its anxiety level. On Day 1, the mice were placed in a 25 cm × 25 cm experimental chamber for 10 minutes without any objects inside. On Day 2, after intraperitoneal (IP) injection of the drug or vehicle, the mice were placed in the experimental chamber containing two identical objects and allowed to acclimate for 15 minutes. One hour later, the mice were returned to the same experimental chamber, which now contained one familiar object and one novel object, and the test lasted for 5 minutes. The exploration time was quantified using the discrimination index, which was calculated as follows: Discrimination index = (Time spent exploring the novel object - Time spent exploring the familiar object) / (Time spent exploring the novel object + Time spent exploring the familiar object). Exclusion criteria included mice that did not interact sufficiently with the objects during training or testing, or mice that showed excessive fear. These mice were excluded from the data analysis. Multiple researchers performed the data analysis in a blind manner to avoid bias. Quantitative Real - Time Polymerase Chain Reaction (qRT - PCR) To detect the NR2A levels in each group of mice and evaluate the expression of the Grin2a gene, quantitative real - time polymerase chain reaction (qPCR) analysis was performed. Homozygous Grin2a mice and their age - and sex - matched littermate control mice were deeply anesthetized with isoflurane and then euthanized. Subsequently, the brains were removed, and tissue samples from the target brain regions were collected. Total RNA was first extracted using Trizol reagent (Cat. No. 15596018, Invitrogen, Waltham, USA), and then reverse - transcribed into cDNA using the Prime Script Reverse Transcription Kit (Cat. No. RR037B, TaKaRA Bio Inc., Kusatsu, Shiga, Japan). Quantitative real - time PCR analysis was performed using POWERTRACK SYBR reagent (Cat. No. A46109, Applied Biosystems, USA). Each sample was analyzed in duplicate. Details of the primers used are primer NR2A-forward, 5’— CTGCTCCAGTTTGTTGGTGACG—3’; NR2A-reverse, 5’—CCAGCATGTAGAAAACTCCTGCC—3’;. The relative gene expression levels were quantified using the comparative threshold cycle (Ct) method (2^-ΔΔCt method), with glyceraldehyde − 3 - phosphate dehydrogenase (GAPDH) serving as internal reference genes to normalize the initial Ct values. Electrophysiological Recordings For multichannel electrophysiological recordings of the medial prefrontal cortex (mPFC), auditory cortex (AC), and hippocampus, mice were anesthetized with gaseous isoflurane and then decapitated. The brains were quickly removed and immersed in ice - cold artificial cerebrospinal fluid (ACSF) saturated with oxygen (95% O₂ − 5% CO₂). The composition of the ACSF (in mM) was as follows: 124 sodium chloride (NaCl), 3 potassium chloride (KCl), 1.25 potassium dihydrogen phosphate (KH₂PO₄), 1.25 magnesium sulfate (MgSO₄), 2 calcium chloride (CaCl₂), 26 sodium bicarbonate (NaHCO₃), and 10 glucose, with a pH of 7.35–7.45. After cooling the brains in the ACSF for 1–2 minutes, the remaining brain tissue was placed on the ice - cold stage of a vibrating microtome (Leika VT1000S). Coronal brain slices (300 µm thick) containing the auditory cortex, medial prefrontal cortex, or hippocampus were prepared and transferred to an incubation chamber continuously perfused with oxygenated ACSF at 37°C. The brain slices were incubated for at least 2 hours before electrophysiological recordings were performed. A commercially available 4 - layer 16/64 - channel system (MED, Panasonic Alpha - Med Sciences) equipped with 64 - channel (8 × 8 mode) or 16 - channel (4 × 4 mode) planar microelectrode arrays (electrode size: 50 × 50 µm, electrode spacing: 150 µm) was used for the recordings. Before use, the electrode arrays were treated with 0.1% polyethyleneimine in 25 mM borate buffer (pH 8.4) at room temperature overnight. After incubation, each brain slice was placed on a MED probe, covered with recording electrodes, and then a fine mesh holder was carefully placed to ensure the stability of the brain slice during the recording process. Three sets of commercial 4-slice 16-channel electrodes array systems (MED, Panasonic Alpha-Med Sciences) were used for high-throughput extracellular field poten tial recordings. One channel of microelectrodes was chosen as the stimulating electrode. The stimulation intensity during baseline (stable recording for at least 15 min) was adjusted to elicit 30%—50% of the maximal response. Theta-burst stimulation (TBS) was adopted to induce LTP at an intensity that can evoke 75%—90% of the maximal response. Afterwards, the stimulation intensity was adjusted back to baseline level to record for another hour. For drug treatment experiments, drug was dissolved in ACSF to 100 nM and administrated directly to the incubation solution. All multichannel electrophysiological data will be analyzed offline by the MED Mobius software. Fiber Photometry For fiber photometry recordings in the auditory cortex (ACx), AAV9 - Syn - GCaMP6s - WPRE - SV40 virus (titer: 2.50 × 10¹³ vg/mL, 4 - fold dilution, volume: 300 nL, Addgene, Watertown, USA) was injected into the auditory cortex (ACx). Three weeks after virus expression, a fiber optic cannula was implanted. Calcium dynamics recordings began 2 weeks after the fiber implantation. Synapse software (Synapse suite, TDT) was used to control the excitation light and record calcium signals, with a sampling rate of 1 kHz and a low - pass filter frequency of 5 Hz. Custom scripts in Matlab software (Mathworks, USA) were used to analyze the calcium signals. The change in fluorescence signal (ΔF/F) was calculated using the formula: (ΔF - F₀)/F₀. Immunohistochemistry AAV - Syn - dio - GFP-WPRE-PA virus was injected into the entorhinal cortex of CCK - Cre mice. Four weeks later, the mice were deeply anesthetized with sodium pentobarbital (50 mg/kg, intraperitoneal injection), followed by sequential perfusion with 30 mL of 1 × phosphate - buffered saline (PBS) and 30 mL of 4% (w/v) paraformaldehyde (PFA). The brains were removed and fixed in 4% PFA at 4°C overnight. After cryoprotection of the brains with 30% (w/v) sucrose solution, 40 µm thick coronal brain slices were prepared using a cryostat (Leica CM1860, Germany). The brain slices were then washed 3 times with PBS and blocked with blocking solution (PBS containing 10% goat serum and 0.2% Triton X − 100) at 37°C for 1.5 hours. The brain slices were incubated with anti - NR2A monoclonal antibody (rabbit - derived, 1:1000, Abcam, Cat. No. ab169876) and anti - synaptotagmin 1 (Synaptotagmin1) antibody (mouse - derived, 1:1000, Abcam, Cat. No. ab302627) at 4°C for 48 hours. After washing the brain slices 4 times with PBS (10 minutes each time), they were incubated with secondary antibodies (Alexa Fluor® 594 - labeled goat anti - rabbit IgG, 1:500; Alexa Fluor® 405 - labeled goat anti - mouse IgG, 1:500, Jackson ImmunoResearch Inc.) at 37°C for 1.5 hours. Subsequently, the brain slices were washed 3 times with PBS and mounted on glass slides with PBS containing 70% glycerol. Fluorescence images were captured using a Nikon Eclipse Ni - E upright fluorescence microscope (4× objective lens, Nikon, Japan) and a confocal microscope (20×, 40× objective lenses, Nikon, Japan). Quantitative imaging analysis of the number of neurons was performed using Fiji software. Western Blotting Total proteins were extracted from the tissues using radioimmunoprecipitation assay (RIPA) buffer (containing 1% NP − 40 or Triton X − 100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 150 mM sodium chloride, 50 mM Tris - hydrochloric acid (TrisHCl), pH 7.8, and 1 mM ethylenediaminetetraacetic acid (EDTA)). The protein concentration was determined using a BCA protein quantification kit (Thermo Scientific, Rockford, USA), and the proteins were separated by sodium dodecyl sulfate - polyacrylamide gel electrophoresis (SDS - PAGE). The proteins were then transferred onto polyvinylidene fluoride (PVDF) membranes at a constant current of 200 mA. After blocking the membranes with 5% non - fat dry milk for 2 hours, the membranes were incubated with primary antibodies (mouse anti - GAPDH antibody, 1:500; rabbit anti - NR2A antibody, Abcam, Cambridge, Massachusetts, USA) for 2 hours, followed by incubation with horseradish peroxidase (HRP) - labeled secondary antibodies (1:2000, Abcam, Cambridge, Massachusetts, USA) for another 2 hours. The membranes were washed with TBST buffer (TBST solution containing 2.5% bovine serum albumin (BSA), 1:1000 dilution, Abcam, USA), and all protein bands were visualized using a chemiluminescence method (ECL, Bio - Rad, Hercules, USA). Super - Resolution Microscopy Imaging A custom - designed two - color super - resolution localization microscope was used to obtain super - resolution images. The secondary antibodies used were Alexa Fluor 647 - labeled goat anti - rabbit IgG (Invitrogen, Cat. No. A21245, dilution ratio of 1:500 in immunohistochemistry experiments) and Alexa Fluor 750 - labeled goat anti - mouse IgG (Invitrogen, Cat. No. A21037, dilution ratio of 1:500 in immunohistochemistry experiments). The double - stained brain slices on the coverslips were immersed in an imaging buffer consisting of 200 mM Tris - hydrochloric acid (Tris - HCl, pH 9.0), 5% (w/v) glucose, 25 mM tris(2 - carboxyethyl)phosphine hydrochloride solution (TCEP, Sigma, Cat. No. 646547), 1 mM L - ascorbic acid (Sigma, Cat. No. A0537), 1 mM methyl viologen dichloride hydrate (Sigma, Cat. No. 856177), 40 µg/mL catalase (Sigma, Cat. No. C1345), and 0.5 mg/mL glucose oxidase (Sigma, Cat. No. G2133) added just before use. Quantitative and Statistical Analysis All statistical analyses (including paired t - test, two - sample t - test, one - way analysis of variance (one - way ANOVA), and two - way mixed analysis of variance (two - way mixed ANOVA)) were performed using SPSS software (IBM, USA). Statistical significance was set at p < 0.05. Discussion The NR2A subunit, as a critical component of the NMDA receptor, participates in the formation of long-term potentiation (LTP) [ 23 – 26 ] and plays a pivotal role in neural circuits underlying learning and memory [ 27 – 29 ] . In our study, we detected the levels of NR2A protein in WT and AD mice through Western blot analysis. The results showed a significant reduction in NR2A in the cortical and hippocampus region of AD mice, suggesting that NR2A is highly likely associated with the memory impairments exhibited by AD animals. In behavioral tasks, We observed that NR2A-KO mice had minimal fear responses in the contextual fear conditioning paradigm, while wild-type (WT) littermates exhibited normal fear responses. Intraperitoneal (i.p.) administration of CCK4 significantly rescued the fear-memory response in these mice. The similar phenomenon was observed during the NOR paradigm in the NR2A-KO mice we studied. NR2A-KO animals exhibit a lower discrimination ratio compared to their littermates control. However, after CCK administration, NR2A-KO mice exhibited similar behavioral responses to normal mice compared with the Vehicle control group. Its key role of CCK in conditioned fear memory in NR2A-KO mice was confirmed. At the same time, our research found that neurons in the primary auditory cortex did not show significant changes in response to sound after training in NR2A-KO mice under sound -paired fear conditions with saline administration. However, in the CCK administration group, NR2A-KO mice exhibited a similar fear response to WT mice, which was significantly different from the control saline injection group, suggesting that CCK treatment rescued fear memories which also restored calcium signaling levels in auditory cortex neurons to the conditioned sound after training. This indicates that the injection of CCK could enhance the response of NR2A-KO mice to auditory stimuli in conditioned fear, thereby strengthened the fear memory of NR2A-KO mice. The induction of long-term potentiation (LTP) in the hippocampus and cortex plays a critically important role in memory formation and retrieval. Numerous studies have demonstrated that memory deficits are closely associated with the blockade of LTP in these regions [ 30 – 32 ] . In our study, we recorded TBS-induced LTP response of the auditory cortex, prefrontal cortex and hippocampus in KO mice and found that KO mice exhibited a loss of LTP in these regions. Interestingly, perfusion of CCK could restore this loss of TBS induced LTP. Therefore, we hypothesize that the effectiveness of CCK in the treatment of memory deficits could be explained by the ability to restore the neuroplasticity. In addition, we also explored the potential mechanism of memory impairment in KO mice and the effect of CCK treatment. In our previous study, we found that cholecystokinin (CCK) neurons in the entorhinal cortex are widely projected to the auditory cortex, promoting the formation of auditory-related memories through CCK release. This lead us to hypothesize that the absence of cortical NR2A may disrupt the release of CCK, thereby impairing the formation of fear memories. To evaluated this hypothesis, we first used immunohistochemistry to confirm that there is a large amount of NR2A aggregation at the axon terminal projection from Lent to the auditory cortex, and to further confirm the possible location of NR2A, we used a high-resolution microscope to observe the relationship between NR2A and synapse and found that many NR2A was accumulating in the presynaptic membrane. Therefore, the results indicated that NMDARs with NR2A subunits was specifically enriched at presynaptic sites of CCK projections in Auditory cortex from the entorhinal cortex. Next, we used the CCKBR sensor to detect the CCK release in the protection terminals, and the results were compared to a control group treated with a specific NR2A antagonist. We found that after the high-frequency laser stimulated the expressed ChrimsonR protein in auditory cortex. We could see a change in the fluorescence signal by the transient CCK release, However, there was no significant increase in the fluorescence signal in the antagonist group compared to the baseline which illustrated that the absence of NR2A may blocks the release of CCK projected from Lent to AC. Taken together, all the results suggest that CCK administration could rescue the behavioral representations associated with memory loss in NR2A-KO animals, and it was likely that NR2A loss leads to the loss of neuroplasticity in the cortex and hippocampus. And CCK could rescue the induced LTP in cortex and hippocampus same time restored calcium signaling levels. Further mechanism analysis might be caused by the impact on the release of CCK in key pathways. Our study would provide the therapeutic potential of CCK in various neuroplasticity disorders diseases. For example, Neuronal damage caused by abnormalities of N-methyl-D-aspartate receptors (NMDARs) containing the NR2A subunit, such as that seen in schizophrenia, bipolar disorder, and other related conditions [ 33 – 36 ] . Declarations Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. References Philpot BD, Cho KK, Bear MF. Obligatory role of NR2A for metaplasticity in visual cortex. Neuron. 2007;53(4):495–502. doi: 10.1016/j.neuron.2007.01.027 Brigman JL, Feyder M, Saksida LM, Bussey TJ, Mishina M, Holmes A. Impaired discrimination learning in mice lacking the NMDA receptor NR2A subunit. Learn Mem. 2008;15(2):50–54. Published 2008 Jan 28. doi: 10.1101/lm.777308 Su J, Huang F, Tian Y, et al. Entorhinohippocampal cholecystokinin modulates spatial learning by facilitating neuroplasticity of hippocampal CA3-CA1 synapses. Cell Rep. 2023;42(12):113467. doi: 10.1016/j.celrep.2023.113467 Asim M, Wang H, Waris A, He J. Basolateral amygdala parvalbumin and cholecystokinin-expressing GABAergic neurons modulate depressive and anxiety-like behaviors. Transl Psychiatry. 2024;14(1):418. Published 2024 Oct 5. doi: 10.1038/s41398-024-03135-z Sun W, Wu H, Peng Y, et al. Heterosynaptic plasticity of the visuo-auditory projection requires cholecystokinin released from entorhinal cortex afferents. Elife. 2024;13:e83356. Published 2024 Mar 4. doi: 10.7554/eLife.83356 Li X, Yu K, Zhang Z, et al. Cholecystokinin from the entorhinal cortex enables neural plasticity in the auditory cortex. Cell Res. 2014;24(3):307–330. doi: 10.1038/cr.2013.164 Nakazawa, K., McHugh, T., Wilson, M. et al. NMDA receptors, place cells and hippocampal spatial memory. Nat Rev Neurosci 5, 361–372 (2004). https://doi.org/10.1038/nrn1385 Paoletti P, Bellone C, Zhou Q. NMDA receptor subunit diversity: impact on receptor properties, synaptic plasticity and disease. Nat Rev Neurosci. 2013;14(6):383–400. doi: 10.1038/nrn3504 Zhao JP, Constantine-Paton M. NR2A-/- mice lack long-term potentiation but retain NMDA receptor and L-type Ca2 + channel-dependent long-term depression in the juvenile superior colliculus. J Neurosci. 2007;27(50):13649–13654. doi: 10.1523/JNEUROSCI.3153-07.2007 Furuie H, Yamada M. Neonatal blockade of NR2A-containing but not NR2B-containing NMDA receptor induces spatial working memory deficits in adult rats. Neurosci Res. 2022;176:57–65. doi: 10.1016/j.neures.2021.10.005 Kirova AM, Bays RB, Lagalwar S. Working memory and executive function decline across normal aging, mild cognitive impairment, and Alzheimer's disease. Biomed Res Int. 2015;2015:748212. doi: 10.1155/2015/748212 Badesso S, Cartas-Cejudo P, Espelosin M, Santamaria E, Cuadrado-Tejedor M, Garcia-Osta A. Docosahexaenoic Acid Ameliorates Contextual Fear Memory Deficits in the Tg2576 Alzheimer's Disease Mouse Model: Cellular and Molecular Correlates. Pharmaceutics. 2022;15(1):82. doi: 10.3390/pharmaceutics15010082 . PMID: 36678710; PMCID: PMC9866126. Bromley-Brits, Kelley et al. “Morris water maze test for learning and memory deficits in Alzheimer's disease model mice.” Journal of visualized experiments: JoVE ,53 2920. 20 Jul. 2011, doi: 10.3791/2920 . Jahn H. Memory loss in Alzheimer's disease. Dialogues Clin Neurosci. 2013;15(4):445–454. doi: 10.31887/DCNS.2013.15.4/hjahn . Stover, Kurt R et al. “Early detection of cognitive deficits in the 3xTg-AD mouse model of Alzheimer's disease.” Behavioural brain research vol. 289 (2015): 29–38. doi: 10.1016/j.bbr.2015.04.012 . Doniger, Glen M et al. “Impaired visual object recognition and dorsal/ventral stream interaction in schizophrenia.” Archives of general psychiatry vol. 59,11 (2002): 1011–20. doi: 10.1001/archpsyc.59.11.1011 . Zhang, N., Sui, Y., Jendrichovsky, P., Feng, H., Shi, H., Zhang, X., Xu, S., Sun, W., Zhang, H., Chen, X., Tortorella, M. D., & He, J. (2024). Cholecystokinin B receptor agonists alleviates anterograde amnesia in cholecystokinin-deficient and aged Alzheimer's disease mice. Alzheimer's research & therapy, 16(1), 109. Feng H, Su J, Fang W, Chen X, He J. The entorhinal cortex modulates trace fear memory formation and neuroplasticity in the mouse lateral amygdala via cholecystokinin. Elife. 2021;10: e69333. Wang H, Qian T, Zhao Y, et al. A tool kit of highly selective and sensitive genetically encoded neuropeptide sensors. Science. 2023;382(6672):eabq8173. doi: 10.1126/science.abq8173 . Shankar, Ganesh M et al. “Amyloid-beta protein dimers isolated directly from Alzheimer's brains impair synaptic plasticity and memory.” Nature medicine vol. 14,8 (2008): 837–42. doi: 10.1038/nm1782 . Lueptow, Lindsay M. “Novel Object Recognition Test for the Investigation of Learning and Memory in Mice.” Journal of visualized experiments: JoVE ,126 55718. 30 Aug. 2017, doi: 10.3791/55718 . Cohen, Sarah J, and Robert W Stackman Jr. “Assessing rodent hippocampal involvement in the novel object recognition task. A review.” Behavioural brain research vol. 285 (2015): 105–17. doi: 10.1016/j.bbr.2014.08.002 . Fleischmann, Alexander et al. “Impaired long-term memory and NR2A-type NMDA receptor-dependent synaptic plasticity in mice lacking c-Fos in the CNS.” The Journal of neuroscience: the official journal of the Society for Neuroscience vol. 23,27 (2003): 9116–22. doi: 10.1523/JNEUROSCI.23-27-09116.2003 . Cui, Zhenzhong et al. “Increased NR2A:NR2B ratio compresses long-term depression range and constrains long-term memory.” Scientific reports vol. 3 (2013): 1036. doi: 10.1038/srep01036 . Asim, Muhammad et al. “Shedding light on cholecystokinin's role in hippocampal neuroplasticity and memory formation.” Neuroscience and biobehavioral reviews vol. 159 (2024): 105615. doi: 10.1016/j.neubiorev.2024.105615 . Nomoto, S et al. “Impaired learning and memory in OLETF rats without cholecystokinin (CCK)-A receptor.” Physiology & behavior vol. 66,5 (1999): 869–72. doi: 10.1016/s0031-9384(99)00033-5 . Zhang, Xu et al. “Cholecystokinin B receptor antagonists for the treatment of depression via blocking long-term potentiation in the basolateral amygdala.” Molecular psychiatry vol. 28,8 (2023): 3459–3474. doi: 10.1038/s41380-023-02127-7 . Adamec, R. “Transmitter systems involved in neural plasticity underlying increased anxiety and defense–implications for understanding anxiety following traumatic stress.” Neuroscience and biobehavioral reviews vol. 21,6 (1997): 755–65. doi: 10.1016/s0149-7634(96)00055-3 . Li, Qing-Qing et al. “Enhancing GluN2A-type NMDA receptors impairs long-term synaptic plasticity and learning and memory.” Molecular psychiatry vol. 27,8 (2022): 3468–3478. doi: 10.1038/s41380-022-01579-7 . Cui, Zhenzhong et al. “Increased NR2A:NR2B ratio compresses long-term depression range and constrains long-term memory.” Scientific reports vol. 3 (2013): 1036. doi: 10.1038/srep01036 . Shipton, Olivia A, and Ole Paulsen. “GluN2A and GluN2B subunit-containing NMDA receptors in hippocampal plasticity.” Philosophical transactions of the Royal Society of London. Series B, Biological sciences vol. 369,1633 20130163. 2 Dec. 2013, doi: 10.1098/rstb.2013.0163 . Baltaci, Saltuk Bugra et al. “Molecular Mechanisms of Early and Late LTP.” Neurochemical research vol. 44,2 (2019): 281–296. doi: 10.1007/s11064-018-2695-4 . Harrison, P. J., & Bannerman, D. M. (2023). GRIN2A (NR2A): a gene contributing to glutamatergic involvement in schizophrenia. Molecular psychiatry, 28(9), 3568–3572. https://doi.org/10.1038/s41380-023-02265-y . McCullumsmith, R. E., Kristiansen, L. V., Beneyto, M., Scarr, E., Dean, B., & Meador-Woodruff, J. H. (2007). Decreased NR1, NR2A, and SAP102 transcript expression in the hippocampus in bipolar disorder. Brain research, 1127(1), 108–118. Pearlman, Daniel M., and Najjar, Souhel.. \"Meta-analysis of the association between N-methyl-d-aspartate receptor antibodies and schizophrenia, schizoaffective disorder, bipolar disorder, and major depressive disorder.\" Schizophrenia research 157.1-3(2014). Woo, Tsung-Ung W et al. “N-methyl-D-aspartate receptor and calbindin-containing neurons in the anterior cingulate cortex in schizophrenia and bipolar disorder.” Biological psychiatry vol. 64,9 (2008): 803–9. doi: 10.1016/j.biopsych.2008.04.034 . Additional Declarations The authors have declared there is NO conflict of interest to disclose Supplementary Files s1.jpg Figure S1. Calcium Imaging in the Auditory Cortex of WT Mice Before and After Conditioning (A) Representative examples of average photometric calcium signals collected by fiber photometry from wild - type mice (N = 7) before and after auditory - paired conditioned fear training. (B) A post - hoc two - tailed paired t - test with Bonferroni correction was used to analyze the calcium signal amplitude. *P < 0.05 after correction. Data are presented as mean ± standard error. (C) Heatmap of the population activity of the wild - type group in response to sound stimulation before and after fear conditioning training. Each row represents an individual mouse. The color represents the change in fluorescence intensity (△F/F). (D) qRT - PCR verification showed that compared with wild - type and heterozygous littermate mice, the expression of NR2A mRNA in NR2A knockout homozygous mice was significantly reduced, with the heterozygous group showing an intermediate level, One-way ANOVA followed by Tukey’s comparision test, C57 vs. NR2A-KO, **P < 0.01; C57 vs hetero,*P < 0.05. All data were shown as mean±SEM. Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: revise 10 Dec, 2025 Review # 2 received at journal 23 Nov, 2025 Review # 1 received at journal 21 Nov, 2025 Review # 3 received at journal 09 Nov, 2025 Reviewer # 3 agreed at journal 09 Nov, 2025 Reviewer # 2 agreed at journal 05 Nov, 2025 Reviewer # 1 agreed at journal 05 Nov, 2025 Reviewers invited by journal 04 Nov, 2025 Editor assigned by journal 04 Nov, 2025 Submission checks completed at journal 04 Nov, 2025 First submitted to journal 01 Nov, 2025 Unknown event 30 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-7982110\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":540117907,\"identity\":\"5601e4ed-9dc4-4417-a096-567d47c09c56\",\"order_by\":0,\"name\":\"Jufang He\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9klEQVRIiWNgGAWjYBACxgbGB0DqAAM/kAkROsDABmPi0MJsAFYm2cDY2ECUFgYGqBaDAzBrCGlhnpHM+Lng1x054+OH2x/ztjHI8d1IYHs4A5/DZiQzS8/se2ZsdiaxsRmoxVjyRgK74Qa8WvIPSPP2HE7cdoMRrCVxA9AWyQcEbPkN1FK/eQZESz0xWtikeX4cTjCQgGhJMABpweuwnsds1rwNhw1nAP0yc845CcOZZx62SeLzvmF7MvNtnj+H5fnbjz/48KbMRp7vePIxyR58WhpAVrVBOEw8DBIgbgMeDQwM8mDyD9SVP/CqHQWjYBSMgpEKAKL2VjkPTcKfAAAAAElFTkSuQmCC\",\"orcid\":\"https://orcid.org/0000-0002-4288-5957\",\"institution\":\"City University of Hong Kong\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Jufang\",\"middleName\":\"\",\"lastName\":\"He\",\"suffix\":\"\"},{\"id\":540117908,\"identity\":\"eef2657f-76da-419e-89e6-4120800dc527\",\"order_by\":1,\"name\":\"Xuejiao ZHENG\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xuejiao\",\"middleName\":\"\",\"lastName\":\"ZHENG\",\"suffix\":\"\"},{\"id\":540117909,\"identity\":\"8371322f-a502-49e1-9ef5-89fc0f9de711\",\"order_by\":2,\"name\":\"Yilin Zheng\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0002-5583-5350\",\"institution\":\"City University of Hong Kong\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yilin\",\"middleName\":\"\",\"lastName\":\"Zheng\",\"suffix\":\"\"},{\"id\":540117910,\"identity\":\"6e22be0c-7b2e-4c2d-aee9-76e18a10907e\",\"order_by\":3,\"name\":\"Yuanying LAI\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yuanying\",\"middleName\":\"\",\"lastName\":\"LAI\",\"suffix\":\"\"},{\"id\":540117911,\"identity\":\"c4637ca7-e8c1-40af-9200-2d2ade414c38\",\"order_by\":4,\"name\":\"Peng TANG\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Peng\",\"middleName\":\"\",\"lastName\":\"TANG\",\"suffix\":\"\"},{\"id\":540117912,\"identity\":\"6f8253a2-79d0-4cfb-9f15-4d6a5e17c491\",\"order_by\":5,\"name\":\"Jie MENG\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jie\",\"middleName\":\"\",\"lastName\":\"MENG\",\"suffix\":\"\"},{\"id\":540117913,\"identity\":\"8e0138d0-8724-40a3-93eb-4d48dc281a12\",\"order_by\":6,\"name\":\"Waris ABDUL\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Waris\",\"middleName\":\"\",\"lastName\":\"ABDUL\",\"suffix\":\"\"},{\"id\":540117914,\"identity\":\"49156a08-3bb8-4c1a-8b48-4b21a51ba6c7\",\"order_by\":7,\"name\":\"Jing LI\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0001-8075-0650\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jing\",\"middleName\":\"\",\"lastName\":\"LI\",\"suffix\":\"\"},{\"id\":540117915,\"identity\":\"9fa83729-4b90-48b2-928b-cf65466cddaf\",\"order_by\":8,\"name\":\"Qianqian GAO\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Qianqian\",\"middleName\":\"\",\"lastName\":\"GAO\",\"suffix\":\"\"},{\"id\":540117916,\"identity\":\"3d83029c-bab6-44f3-99a7-6ebe9c6cc264\",\"order_by\":9,\"name\":\"Mengying CHEN\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mengying\",\"middleName\":\"\",\"lastName\":\"CHEN\",\"suffix\":\"\"},{\"id\":540117917,\"identity\":\"0958653a-73b7-41ce-b628-8cfeb4b5736e\",\"order_by\":10,\"name\":\"Tao CHEN\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tao\",\"middleName\":\"\",\"lastName\":\"CHEN\",\"suffix\":\"\"},{\"id\":540117918,\"identity\":\"2854adb8-14d9-4cb2-9263-025db1cd3cb9\",\"order_by\":11,\"name\":\"Siuhin LAU\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Siuhin\",\"middleName\":\"\",\"lastName\":\"LAU\",\"suffix\":\"\"},{\"id\":540117919,\"identity\":\"9a373e3e-3060-4ca0-be25-c28da66454b8\",\"order_by\":12,\"name\":\"Xi Chen\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0002-2144-6584\",\"institution\":\"City University of Hong Kong\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xi\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-10-29 16:47:42\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-7982110/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-7982110/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":96242633,\"identity\":\"736cbd6c-9675-4204-8838-1468bc46f3c2\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:13:53\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":45430,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscriptrevised20251101.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7982110/v1/4efb16f0e88d7e5a5a8da11d.docx\"},{\"id\":95911512,\"identity\":\"2eaa6e23-5fa9-4083-ad04-cda47003f71d\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 10:37:32\",\"extension\":\"json\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":14555,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"2025TP002653.json\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7982110/v1/3fe43445b680e7886d84cd8b.json\"},{\"id\":96243503,\"identity\":\"8756d6a4-3ba4-4cb9-84cf-030437b90bcb\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:16:31\",\"extension\":\"xml\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":118089,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"2025TP0026530enriched.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7982110/v1/9da4c91c0311e7e4c80bfe3c.xml\"},{\"id\":95911518,\"identity\":\"b8403315-2de8-4f10-a94c-187397a35299\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 10:37:32\",\"extension\":\"pdf\",\"order_by\":4,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":4829331,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"summaryofresultsrevised1027.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7982110/v1/fb3e596a21964a9ee2aa671b.pdf\"},{\"id\":95911517,\"identity\":\"79b495d9-8690-4b91-8ed9-8fc5b4701825\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 10:37:32\",\"extension\":\"xml\",\"order_by\":5,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":115362,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"2025TP0026530structuring.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7982110/v1/2b729b591e8721dc89565d75.xml\"},{\"id\":95911516,\"identity\":\"aa229ee3-14bd-44c8-b8d7-48dbe6be6c43\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 10:37:32\",\"extension\":\"html\",\"order_by\":6,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":126240,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"earlyproof.html\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7982110/v1/9949d3a69cd41ac0850d847e.html\"},{\"id\":96243980,\"identity\":\"7ae807b0-a6b4-4a7c-8bed-0837b8bfae43\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:17:27\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":517497,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eNR2A Protein Expression Levels Were Decreased in the Cortex and Hippocampus of 3xTg AD Mice; NR2A Knockout Mice Exhibited a Deficit in Fear Memory in the Auditory - Cued Conditioned Fear Task; Intraperitoneal Injection of Cholecystokinin (CCK4) Ameliorated Their Performance to the Normal Level\\u003c/p\\u003e\\n\\u003cp\\u003eWestern blot analysis was used to detect the NR2A protein levels in wild - type (WT) mice and Alzheimer's disease (3xTg, one - year - old AD) mice. (A) The ratio of NR2A bands to GAPDH signals in each group. (B) Representative immunoblot images of NR2A protein and glyceraldehyde - 3 - phosphate dehydrogenase (GAPDH) stained membranes. *P \\u0026lt; 0.05, unpaired Student's t - test. (C) Schematic diagram of the auditory - cued conditioned fear experiment and drug administration protocol. (D) The freezing response of mice in each group to the sound before foot shock training and 24 hours after auditory - paired foot shock training. The animal groups included wild - type (N = 7), heterozygous (N = 9), and homozygous (N = 10) mice. The results showed that compared with the homozygous group, the wild - type group showed a significant freezing response after training, and the heterozygous group showed an intermediate response. ****P \\u0026lt; 0.0001, One-way ANOVA followed by Tukey’s comparision test, WT vs. NR2A-KO, ***P \\u0026lt; 0.001; WT vs hetero. Homozygous mice showed no significant fear response after training. (E) The NR2A-KO group showed a significant difference from the Saline group after CCK4 administration, with a significant response to the sound after training, approaching the WT level. ****P \\u0026lt; 0.0001, One-way ANOVA followed by Tukey’s comparision test, Vehicle vs. CCK (F) Schematic diagram of the auditory - paired conditioned fear protocol and the site of muscimol administration. (G) Muscimol or artificial cerebrospinal fluid (ACSF) was injected into wild - type mice during auditory - cued foot shock training, and the freezing response was measured before and after training. The freezing level of the ACSF group was significantly higher than that of the muscimol group. ****P \\u0026lt; 0.0001, one - way ANOVA followed by Tukey’s comparision test. All data were shown as mean±SEM.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7982110/v1/a394d8e59a9e6ad7bd356fe7.jpg\"},{\"id\":95911508,\"identity\":\"ac89b4d3-a259-4dac-ad1c-2345c9ef41d7\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 10:37:32\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":530772,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCalcium Imaging Results in the Auditory Cortex of NR2A Knockout Mice and Wild - Type Mice Before and After Conditioned Fear Training\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Experimental setup: AAV9-Syn-GCaMP6s-WPRE-SV40 was injected into the auditory cortex of NR2A-KO/WT mice, and a photometry fiber was implanted above the virus injection site. The results of virus injection and fiber implantation are shown in the brain slice image, where GCaMP6s expression is green and DAPI is blue. Scale bar, 1 mm. (B) Schematic diagram of the auditory - paired conditioned fear behavioral paradigm, drug administration protocol, and recording time. (C) Average calcium signals collected by fiber photometry before and after auditory - paired fear training. For homozygous mice before and after cholecystokinin administration, the blue line represents the calcium signal in response to sound before training, and the red line represents the calcium signal in response to sound after training (N = 6). (D) The average peak values of calcium signals in homozygous mice before and after cholecystokinin administration. A post - hoc two - tailed paired t - test with Bonferroni correction was used to analyze the calcium signal amplitude. *P \\u0026lt; 0.05 after correction. (E) Upper panel: Heatmap of calcium signal activity in homozygous mice in response to sound stimulation after conditioned fear training (N = 6); Lower panel: Heatmap of calcium signal activity in homozygous mice in response to sound after training following cholecystokinin administration. (F) Average calcium signals collected by fiber photometry before and after auditory - paired fear training. For homozygous mice before and after saline administration, the blue line represents the calcium signal in response to sound before training, and the red line represents the calcium signal in response to sound after training (N = 7). (G) The average peak values of calcium signals in homozygous mice before and after saline administration. A post - hoc two - tailed paired t - test with Bonferroni correction was used to analyze the calcium signal amplitude. (H) Heatmap of calcium signal activity in the saline - injected group of NR2A knockout homozygous mice in response to sound stimulation. Upper panel: Heatmap of calcium signal activity in homozygous mice in response to sound stimulation after conditioned fear training (N = 6); Lower panel: Heatmap of calcium signal activity in homozygous mice in response to sound after training following saline administration. Data are presented as mean ± standard error.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7982110/v1/174e8ae90acdf60f8da2230b.jpg\"},{\"id\":95911509,\"identity\":\"e1a3b936-397c-41d2-bc79-161a067e48d7\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 10:37:32\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":872659,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eNR2A Knockout Mice Exhibited Impairments in Novel Object Recognition; Injection of CCK Ameliorated Their Performance\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Schematic diagram of the novel object recognition experimental paradigm. The first two stages are the environment habituation stage and the location habituation stage, respectively. The test stage was conducted 24 hours after the location habituation stage. (B) Bar graph of the discrimination index of three experimental groups (wild - type (WT), heterozygous (Hetero), and homozygous (Homo)) in the novel object recognition task (calculated as the total time spent with the novel object / the total time spent exploring the objects). There was a highly significant difference between the wild - type group and the homozygous group, ****P \\u0026lt; 0.0001, WT vs Homo; one - way ANOVA followed by Tukey’s comparision test. (C) Measurement results of the discrimination index of three groups of mice injected with CCK or vehicle during the test. Homozygous mice and heterozygous mice injected with CCK had higher scores than those in the vehicle group, and there was no significant difference in the wild - type group, ***P \\u0026lt; 0.001, unpaired Student's t - test. Data are presented as mean ± standard error. (D) Representative trajectories of three groups of mice in the test stage with CCK or Vehicle injection. Upper left: Location of the familiar object; Lower right: Location of the novel object.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7982110/v1/e853202c627553635a52daf0.jpg\"},{\"id\":95911510,\"identity\":\"0ea29e22-9a0a-4b70-a347-3eccbfdd56d0\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 10:37:32\",\"extension\":\"jpg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":742361,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eTheta Burst Stimulation (TBS) Induced LTP in the AC, HIP, and mPFC of Wild - Type (WT) Mice but Not in NR2A-KO Mice; CCK Administration Restored TBS - Induced LTP in NR2A-KO Mice\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Timeline of stimulation and recording, TBS stimulation protocol, and images of cortical and hippocampal slices in contact with the MEA chip. (B) Field excitatory postsynaptic potentials recorded from the auditory cortex, medial prefrontal cortex, and hippocampus of NR2A knockout homozygous mice brain slices. Baseline recording was conducted for the first 15 minutes, and TBS could not induce LTP in the auditory cortex, medial prefrontal cortex, and hippocampus of NR2A-KO mouse brain slices. However, after treatment with cholecystokinin for 10 minutes, cholecystokinin significantly rescued the loss of LTP in NR2A knockout mice. (C) Statistical analysis of the amplitude of field excitatory postsynaptic potentials recorded in Figure B, including the baseline, after TBS, and after drug administration + TBS. Number of slices and mice: 4 - 6 months old; Auditory cortex: 16 slices / 8 mice; Medial prefrontal cortex: 14 slices / 6 mice; Hippocampus: 16 slices / 6 mice. Data are presented as mean ± standard error, ***P \\u0026lt; 0.001, ****P \\u0026lt; 0.0001, A post - hoc two - tailed paired t - test with Bonferroni correction. (D) Field excitatory postsynaptic potentials (fEPSPs) recorded from the auditory cortex, medial prefrontal cortex, and hippocampus of wild - type mice. Baseline recording was conducted for the first 15 minutes, and TBS could induce LTP. After the addition of NVP - AAM077 (NR2A antagonist) treatment, TBS could not induce LTP, indicating that the NR2A antagonist can block LTP. (E) Statistical analysis of the amplitude of field excitatory postsynaptic potentials recorded in Figure D. *P \\u0026lt; 0.05, ***P \\u0026lt; 0.001, ****P \\u0026lt; 0.0001,A post - hoc two - tailed paired t - test with Bonferroni correction. Number of slices and mice: 4 - 6 months old; Auditory cortex: 15 slices / 8 mice; Medial prefrontal cortex: 13 slices / 6 mice; Hippocampus: 16 slices / 6 mice.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7982110/v1/1aa5309cc1ac43ee88eedf8d.jpg\"},{\"id\":95911513,\"identity\":\"ef5a5831-275a-4511-aca7-9289520b73a1\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 10:37:32\",\"extension\":\"jpg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":612387,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eNR2A Subunits Showed Extensive Colocalization with Entorhinal CCK Neuron Projection Terminals in the Auditory Cortex; the CCKBR Sensor Could Detect CCK Release After High - Frequency Laser Stimulation, but This Release Could Be Blocked by an NR2A Antagonist.\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Fluorescence image of nerve fibers projecting to the auditory cortex after injection of AAV -Syn- dio - eYFP-WPRE-PA into the lateral entorhinal cortex (LEnt) of CCK - Cre mice. Images of 50 μm thick slices showed that axons labeled with eYFP virus from the entorhinal cortex projected to the superficial and deep layers of the auditory cortex. NR2A showed extensive colocalization with the projected synaptic terminals in deep layer and superficial layer of auditory cortex. Arrows indicate the colocalization regions of eYFP antibody (green), NR2A (red), and the presynaptic active zone marker SYT1 (blue), with white representing the colocalization signal. Scale bar: 0.1 mm (left panel), 10 μm (right panel). (B) Super - resolution STORM imaging showed that synaptic nanoclusters of GFP in the auditory cortex (Acx) from the lateral entorhinal cortex were combined with NR2A subunit antibodies (red), indicating that most CCK terminal nanoclusters are located in the presynaptic active zone near NR2A. (C) Statistical graph showing the percentage of NR2A - binding puncta on CCK synaptic terminals relative to the total number of CCK terminals. (D) Statistic graph showing the percentage of colocalization of CCK terminals and NR2A ratio to CCK terminals. (eYFP+SYT1+eYFP/CCK+SYT1)(E) Schematic diagram of the experimental design for in vivo fiber photometry in auditory cortex neurons to detect CCK release by the CCKBR sensor after high - frequency laser stimulation of ChrimsonR. (F) Schematic diagram of the expression of AAV - Syn - Sensor2.3 and AAV - Syn - dio - ChrimsonR neurons in the auditory cortex. Scale bar: 500 μm. (G) Group average of △F/F0. The sensor signal in response to CCK after high - frequency laser stimulation (red) and the signal after administration of NVP - AAM077 (blue). The results indicated that the administration of an NR2A antagonist could block CCK release. (H) There was a highly significant difference in the amplitude of the CCK sensor response between high - frequency laser stimulation and high - frequency stimulation + NVP - AAM077, unpaired t - test, ****P \\u0026lt; 0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7982110/v1/89ec84e6bb27d1ac4dd4fdbd.jpg\"},{\"id\":96255260,\"identity\":\"abbca6db-0db3-4b5f-b2e3-492bee8689ac\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:48:15\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":3992024,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7982110/v1/65b8d982-66fd-49ec-b0e8-6112284ae614.pdf\"},{\"id\":95911506,\"identity\":\"fe64c30b-c542-4205-a341-54dc4ca9f1ed\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 10:37:32\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":334279,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eFigure S1.\\u003c/strong\\u003e Calcium Imaging in the Auditory Cortex of \\u0026nbsp;WT Mice Before and After Conditioning\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Representative examples of average photometric calcium signals collected by fiber photometry from wild - type mice (N = 7) before and after auditory - paired conditioned fear training. (B) A post - hoc two - tailed paired t - test with Bonferroni correction was used to analyze the calcium signal amplitude. *P \\u0026lt; 0.05 after correction. Data are presented as mean ± standard error. (C) Heatmap of the population activity of the wild - type group in response to sound stimulation before and after fear conditioning training. Each row represents an individual mouse. The color represents the change in fluorescence intensity (△F/F). (D) qRT - PCR verification showed that compared with wild - type and heterozygous littermate mice, the expression of NR2A mRNA in NR2A knockout homozygous mice was significantly reduced, with the heterozygous group showing an intermediate level, One-way ANOVA followed by Tukey’s comparision test, C57 vs. NR2A-KO, **P \\u0026lt; 0.01; C57 vs hetero,*P \\u0026lt; 0.05. All data were shown as mean±SEM.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"s1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7982110/v1/21469b35108aaa5cc757dd52.jpg\"}],\"financialInterests\":\"The authors have declared there is \\u003cb\\u003eNO\\u003c/b\\u003e conflict of interest to disclose\",\"formattedTitle\":\"CCK Administration Alleviates Memory Encoding Impairment in NR2A Knockout Transgenic Mice by Improving Synaptic Plasticity\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eThe ability to encode and retrieve memories is crucial for mammals to survive in a constantly changing environment. Extensive research has highlighted the key role of NMDA receptor activation in the neural plasticity underlying memory encoding and retrieval \\u003csup\\u003e[\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]\\u003c/sup\\u003e. The distinct functions of these receptors in different brain networks are influenced by their biophysical properties and subunit composition \\u003csup\\u003e[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]\\u003c/sup\\u003e. Notably, the loss of the NR2A subunit leads to a significant reduction in LTP induction in the hippocampus and cortex, which is closely associated with cognitive decline, as reflected by impaired cognitive function in animals \\u003csup\\u003e[\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]\\u003c/sup\\u003e. The GluN1 subfamily is essential for NMDAR function, while different subtypes of GluN2 play critical roles in regulating memory at different developmental stages. This includes the NR2A - D subfamily, which primarily determines the functional diversity and synaptic localization of NMDARs \\u003csup\\u003e[\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]\\u003c/sup\\u003e.\\u003c/p\\u003e\\u003cp\\u003eNR2A knockout (NR2A-KO) mice exhibit spatial learning and memory impairments in behavioral paradigms such as the water maze and Y - maze \\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR3\\\" citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]\\u003c/sup\\u003e. This underscores the role of NR2A in learning and memory processing and also indicates the applicability of this model in memory research. In our study, the novel object recognition (NOR) system and auditory paired conditioned fear task were used to assess working memory and fear memory deficits in NR2A-KO mice. The experimental results showed that NR2A-KO mice performed poorly in both the novel object recognition task and the conditioned fear task, making it difficult for them to establish working memory and fear memory. The decline in cognitive and memory functions, which is particularly prominent in certain neurological disorders such as Alzheimer's disease, often involves difficulties in recognizing familiar objects and associating cues with danger \\u003csup\\u003e[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]\\u003c/sup\\u003e. Using high - throughput techniques like microarray analysis, scientists have identified potential intervention targets and found a significant decrease in cholecystokinin (CCK) expression in patients with Alzheimer's disease \\u003csup\\u003e[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]\\u003c/sup\\u003e. CCK plays a vital role in memory encoding, and its endogenous release is closely linked to performance in associative memory tasks. Previous studies have supported the important role of CCK in neural plasticity within the central nervous system, as it significantly influences memory consolidation and promotes various types of memory, including auditory associative memory and fear memory \\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR14 CR15\\\" citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]\\u003c/sup\\u003e.\\u003c/p\\u003e\\u003cp\\u003eThe present study investigated the potential of cholecystokinin (CCK) administration in reversing memory deficits in NR2A knockout (NR2A-KO) mice, including the differences in performance of NR2A-KO mice in the novel object recognition task and the conditioned fear memory task before and after drug administration. Combined with calcium imaging technology, we observed that during the fear conditioning test, CCK - treated mice showed a significant enhancement in calcium signals in response to auditory stimuli. Studies have shown that brain regions such as the prefrontal cortex, auditory cortex, and hippocampus in the cortex play important roles in the processing of learning and memory. The responses of the auditory cortex, prefrontal cortex, and hippocampus to electrical stimulation further confirmed that CCK administration could restore the loss of long-term potentiation (LTP) in memory - related brain regions of NR2A-KO mice.\\u003c/p\\u003e\\u003cp\\u003eIn addition, our previous research results indicated that the projection of CCK neurons from the lateral entorhinal cortex to the auditory cortex is involved in sound - cued associative memory \\u003csup\\u003e[\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]\\u003c/sup\\u003e. Therefore, we hypothesized that NR2A deficiency might affect the release of cholecystokinin (CCK) at the entorhinal - auditory projection terminals. This hypothesis was verified using a specific cholecystokinin B receptor (CCKBR) sensor and local administration of an NR2A antagonist. We found that in the presence of the NR2A antagonist, high - frequency stimulation of CCK axon terminals projecting from the lateral entorhinal cortex (LEC) to the AC blocked CCK release. Immunohistochemical staining and high - resolution imaging revealed the colocalization of CCK terminals with NR2A in cortical regions. This structurally indicates that the presence of NR2A plays a crucial role in regulating the release of the important neurotransmitter CCK, which may explain the significant memory deficit behaviors observed in NR2A knockout (KO) animals and the underlying neural regulatory mechanisms. Meanwhile, CCK holds promise as an effective drug for the treatment of memory deficits.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cb\\u003eNR2A Expression Was Significantly Reduced in the Auditory Cortex, Prefrontal Cortex, and Hippocampus of 3xTg AD Mice, and Cholecystokinin (CCK) Administration Ameliorated the Deficit in Fear Memory of Auditory Paired Conditioned Fear in NR2A-KO Mice\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eAlzheimer's disease (AD) is a globally prevalent neurodegenerative disorder for which there is no effective cure, causing significant distress to humanity. It is characterized by cognitive decline, memory loss, and neuronal degeneration. A large body of research has shown that AD model mice exhibit significant deficits in memory - related behavioral tasks \\u003csup\\u003e[\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]\\u003c/sup\\u003e. As a subunit of the NMDA receptor (N - methyl - D - aspartate receptor) that is closely associated with memory formation, we hypothesized that the expression level of NR2A in specific memory - related brain regions (such as the hippocampus and cerebral cortex) of AD animals might differ. To investigate whether the expression of NR2A protein in different brain regions of AD mice differs from that in normal mice, Western blot analysis was performed to detect the NR2A protein levels in 1 - year - old wild - type (WT) mice and AD (3xTg) mice. The results showed a significant reduction in NR2A in the cortex and prefrontal cortex of AD mice (Fig.\\u0026nbsp;1A), suggesting that NR2A deficiency was highly likely associated with the memory impairment exhibited by AD animals. In our previous study, CCK agonist could rescue the memory impairment of AD mice exhibiting in water maze task\\u003csup\\u003e[\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]\\u003c/sup\\u003e, therefore, We hypothesize whether CCK can rescue the responses of NR2A-KO in memory-related behaviors. To explore the role of cholecystokinin (CCK) in the memory behavior of NR2A knockout (KO) mice, the auditory - cued fear conditioning paradigm was used. Mice need to establish an association between a specific noise and the fear memory related to foot shocks. We observed that after training with the pairing of foot shocks and sound, NR2A-KO mice showed an extremely weak fear response to the noise (Fig.\\u0026nbsp;1D) after fear conditioned training, while wild - type (WT) littermates exhibited a normal fear response to the conditioned sound. Compared with KO mice, heterozygous mice showed an intermediate level of fear response (Fig.\\u0026nbsp;1D, WT vs. Homozygous: 84.5 ± 5.1% vs. 19.9 ± 4.7%, P \\u0026lt; 0.0001). In our previous study CCK4 could transfer the blood brain barrier\\u003csup\\u003e[\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]\\u003c/sup\\u003e, After intraperitoneal (i.p.) injection of 20ul CCK4 (CCKBR agonist) with 40uM per 20g weight before the training session, the fear memory response of NR2A-KO mice to the sound was significantly enhanced (Fig.\\u0026nbsp;1E, Homozygous mice with CCK injection vs. Homozygous mice with vehicle injection: 80.9 ± 5.5% vs. 28.6 ± 8.5%, P \\u0026lt; 0.01). These results indicate that CCK4 administration could improve the recovery of conditioned fear memory in mice, enabling them to respond to the conditioned sound cue in a manner similar to that of wild - type mice. To determine whether the auditory cortex is involved in auditory - cued fear conditioning, muscimol was injected to inhibit the bilateral auditory cortex in WT mice, followed by auditory - cued fear conditioning training. After muscimol injection into the auditory cortex, wild - type mice showed no response to the conditioned sound after fear training, indicating that the auditory cortex is indeed involved in auditory - associated fear memory (Fig.\\u0026nbsp;1G).\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eChanges in the Response of Cortical Neurons to Sound in NR2A-KO Mice Before and After Intraperitoneal Injection of Cholecystokinin\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eTo investigate the changes in calcium signals corresponding to the response of cortical neurons to sound before and after intraperitoneal injection of cholecystokinin (CCK) in NR2A-KO mice, AAV - Syn - Gcamp6 - WPRE - SV40 was injected into the primary auditory cortex (AC) of NR2A-KO mice and their littermate controls WT mice (Fig.\\u0026nbsp;2A). We compared the changes in calcium signals in the auditory cortex neurons of NR2A-KO mice and WT littermates in response to conditioned sound before and after auditory - cued fear conditioning training. The results showed that in the NR2A-KO mice injected with saline, there was no significant change in the response of primary auditory cortex neurons to sound before and after training (Fig.\\u0026nbsp;2F-H, before training vs. After training: 4.9% ± 0.6% to 4.5% ± 0.8% (△F/F0)). In contrast, littermate wild - type (WT) mice showed a stronger response to sound after training (Figure S1A-C, Before training vs. After training: 3.5% ± 0.5% to 8.7% ± 1.7% (△F/F0)). After intraperitoneal injection of CCK4 into NR2A-KO mice, the mice showed a response similar to that of WT mice, with a significant enhancement in the calcium signal corresponding to the response to sound after training (Fig.\\u0026nbsp;2C-E, NR2A-KO mice Before training vs. After training: 6.5% ± 2.1% to 14.5% ± 0.8% (△F/F0)). This was significantly different from the saline injected control group, indicating that intraperitoneal injection of CCK4 rescued fear memory and restored calcium signal levels. These results suggested that CCK injection can enhance the response of NR2A-KO mice to auditory stimuli in conditioned fear training, thereby strengthening the formation of fear memory in NR2A-KO mice.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eNR2A-KO Mice Exhibited Impairments in the Novel Object Recognition Task, and CCK Administration Ameliorated Their Performance\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe ability to recognize novel objects is a fundamental survival skill for animals in nature, and the loss of this ability can be observed in certain neurological disorders, such as Alzheimer's disease. The novel object recognition (NOR) animal experimental paradigm is used to assess the integrity of working memory. We were interested in the performance of NR2A-KO mice in this experimental paradigm, so we used NR2A-KO animals and their cage - mate littermates as controls to investigate the performance of NR2A knockout mice in the novel object recognition paradigm. In this task, exploration time was quantified using the discrimination index. During the habituation phase, NR2A-KO animals did not show significant differences in locomotor activity compared with cage - mate control mice. However, in the novel object recognition test, NR2A knockout mice had a lower discrimination index than littermate control mice (Fig.\\u0026nbsp;3B). The discrimination index was calculated as follows: Discrimination index = (Time spent exploring the novel object - Time spent exploring the familiar object) / (Time spent exploring the novel object + Time spent exploring the familiar object). Here, we hypothesized that CCK injection might also ameliorate the working memory deficit in knockout mice (Fig.\\u0026nbsp;3C, WT vs. Homozygous: Discrimination index 0.30 ± 0.02 vs. 0.10 ± 0.04). The results showed that compared with the vehicle control group, NR2A knockout mice restored behavioral responses similar to those of normal mice (Fig.\\u0026nbsp;3C, Homozygous mice with CCK injection vs. Homozygous mice with vehicle injection: 0.22 ± 0.03 vs. 0.01 ± 0.04). The movement trajectories of animals in each group's example, as shown in the Fig.\\u0026nbsp;3D. After CCK injection, NR2A-KO mice spent more time on the novel object. This confirms that cholecystokinin plays a crucial role in the working memory of NR2A knockout mice. Throughout the experiment, no motor deficits were observed in NR2A knockout mice.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eTheta Burst Stimulation (TBS) Induced LTP in the AC, HIP, and mPFC of WT Mice but Not in NR2A-KO Mice, CCK Administration Rescued TBS - Induced LTP in NR2A-KO Mice\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eTo determine the effect of reduced NR2A subunit expression on cortical and hippocampal neural plasticity, a multichannel electrophysiological recording system (MED) was used to measure the changes in the amplitude and slope of field excitatory postsynaptic potentials (fEPSPs) in the cortex (auditory cortex, medial prefrontal cortex) and hippocampus before and after theta burst stimulation (TBS). Our results showed that in NR2A knockout (KO) mice, TBS - induced long-term potentiation (LTP) was lost in multiple brain regions, including the medial prefrontal cortex (mPFC), auditory cortex (AC), and hippocampus (Fig.\\u0026nbsp;4B,C, blue line, Left panel: Auditory cortex: Before TBS vs. After TBS: 100.00 ± 0.00 vs. 95.44 ± 1.05; Middle panel: Medial prefrontal cortex: 99.81 ± 2.20 vs. 96.56 ± 2.60; Right panel: Hippocampus: 101.87 ± 0.73 vs. 106.16 ± 1.54). This indicates that NR2A deficiency leads to impaired neural plasticity. In our previous study, CCK administration could rescue the neuroplasticity of aged 3xTg AD mice\\u003csup\\u003e[\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]\\u003c/sup\\u003e. However, we did not know the effect of CCK in NR2A-KO mice. Our results showed that administration of CCK at a specific concentration restored the TBS - induced LTP generation in the cerebral cortex and hippocampus (Fig.\\u0026nbsp;4B,C, red line; Left panel: Auditory cortex (ACx): Before TBS vs. After TBS: 100.00 ± 0.00 vs. 143.40 ± 6.77; Middle panel: Medial prefrontal cortex (mPFC): 102.03 ± 0.38 vs. 159.71 ± 14.08; Right panel: Hippocampus (hip): 101.55 ± 0.64 vs. 130.72 ± 4.62). In contrast, the NR2A - specific antagonist NVP - AAM077 completely blocked TBS - induced LTP in wild - type mouse strains (Fig.\\u0026nbsp;4D, E, red line; Left panel: Auditory cortex (ACx): Before TBS vs. After TBS: 100.56 ± 0.47 vs. 99.09 ± 1.33; Middle panel: Medial prefrontal cortex (mPFC): 99.74 ± 0.49 vs. 93.69 ± 2.47; Right panel: Hippocampus (hip): 99.25 ± 0.96 vs. 100.26 ± 1.48). This blocking effect confirmed that synaptic NMDA receptors, especially those containing the NR2A subunit, play a critical role in neural plasticity. Meanwhile, CCK administration could rescue the TBS induced LTP in NR2A-KO mice.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eColocalization of NR2A Subunits with Entorhinal CCK Terminals in the Auditory Cortex and Detection of CCK Release\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eIn our previous studies, we found that CCK - expressing neurons in the entorhinal cortex extensively project to the auditory cortex and promote the formation of auditory - related memory through CCK release. CCK plays an important role in cortical and hippocampal neural plasticity\\u003csup\\u003e[\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]\\u003c/sup\\u003e. The deficiency of NR2A in NR2A-KO animals leads to the loss of LTP and impairments in conditioned fear and novel object recognition memory. This led us to hypothesize that this might be related to the effect of NR2A deficiency on CCK release, and that the loss of cortical NR2A might interfere with CCK release, thereby impairing memory encoding. To verify this hypothesis, we first used immunohistochemical methods and confirmed that a large number of NR2A subunits are clustered at the axon terminals projecting from the entorhinal cortex to the auditory cortex (Fig.\\u0026nbsp;5A upper panel: in auditory deep layer, lower panel: in auditory superficial layer). In the layer 5and6, the colocalizaiton of NR2A with CCK terminals is 31.67 ± 3.79%, In the layer1 and 2, the colocalizaiton of NR2A with CCK terminals is 39.35 ± 5.06%. To further clarify the possible localization of NR2A, we used a high - resolution microscope to observe the relationship between NR2A and synapses and found that many NR2A subunits are clustered at the presynaptic membrane in the deep layer of auditory cortex (Fig.\\u0026nbsp;5B). In the auditory cortex, punctate structures were observed in the projections of neurons infected with adeno - associated virus (AAV-Syn-dio-mCherry-WPRE-PA), and NMDA receptors were labeled with an NR2A antibody. Further studies using two - color super - resolution localization microscopy showed a significant overlap between the mCherry punctate structures and the NR2A punctate structures. Around 30.69 ± 5.68% mCherry punctate were colocalized with NR2A (Fig.\\u0026nbsp;5C) Therefore, the results indicated that NMDA receptors containing the NR2A subunit might specifically enrich at the presynaptic sites of the CCK projections from the entorhinal cortex to the auditory cortex. Next, to verify whether NR2A deficiency interferes with CCK release, we used a CCKBR sensor\\u003csup\\u003e[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]\\u003c/sup\\u003e to detect CCK release at the projection terminals and compared the results with those of a control group treated with a specific NR2A antagonist. We found that after high - frequency laser stimulation of the ChrimsonR protein expressed in the auditory cortex, a change in the fluorescence signal was observed due to the transient release of CCK. In contrast, the fluorescence signal in the antagonist group showed no significant increase compared with the baseline (Fig.\\u0026nbsp;5E - H, △F/F0: HFLS group vs. HFLS + NVP - AAM077 group: 1.09 ± 0.03 vs. 0.00 ± 0.02). This indicated that NR2A antagonism affects the release of CCK from the projections of the lateral entorhinal cortex to the auditory cortex.\\u003c/p\\u003e\\u003cp\\u003eIn summary, all results indicated that CCK administration could improve the performance of NR2A-KO animals in auditory paired conditioned fear and novel object recognition behaviors. Meanwhile, the calcium activity to conditioned sound could be resued by CCK administration in NR2A-KO mice. Electrophysiologically, NR2A deficiency might lead to the loss of neural plasticity in the cortex and hippocampus, and CCK could rescue the induced long-term potentiation (LTP) in the auditory cortex, medial prefrontal cortex and hippocampus. Further mechanistic analysis suggested that NR2A deficiency might be associated with the impaired release of CCK in key pathways. Anatomically, a large number of NR2A subunits were clustered near or overlap with the presynaptically distributed cortical CCK terminals. The administration of an NR2A antagonist could block the fluorescent response detected by the sensor after CCK release. It further confirmed that the presence of NR2A might play a regulatory role in CCK release. Therefore, CCK administration provided a potential therapeutic approach for memory deficit - related neurological diseases.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cp\\u003eExperimental Animals and Materials\\u003c/p\\u003e\\u003cp\\u003e All experimental procedures were strictly in accordance with the current animal ethics regulations in Hong Kong and were approved by the Animal Ethics Committee of City University of Hong Kong. C57 (C57/BL/6) were obtained from Laboratory Animal Research Unit (LARU, City University of Hong Kong). B6;129S-NR2A-KO [Grin2a \\u0026lt; tm1Nak\\u0026gt;] were obtained from the Riken lab stock #RBRC02256. 3xTg AD [B6;129-Tg(APPSwe, tauP301L)1Lfa Psen1tm1Mpm / Mmjax, stock #034830-JAX] and control wildtype 129 (129S1/SvImJ, stock #002448) mice were obtained from the Jackson Laboratory. Mice were housed in 12 h light / 12 h dark cycle (light on from 8:00 to 20:00) and given food and water ad libitum. However, a week before the behavioral tests, animals were moved to a room with reversed 12 h dark / 12 h light cycle (light off from 8:00 to 20:00)Male transgenic NR2A knockout (Grin2a) mice aged 6–8 weeks, along with their negative control and heterozygous littermate mice, were used in this study.\\u003c/p\\u003e\\u003cp\\u003eDrug Preparation and Administration for Behavioral Tests\\u003c/p\\u003e\\u003cp\\u003eCCK-4 was purchased from Abcam (catalog no. ab141328). The drugs were dissolved in normal saline solution (0.9% NaCl) with less than 0.2% DMSO (catalog no. D8418, Sigma-Aldrich, German) to help dissolution. Vehicle (VEH) control was normal saline solution with the same concentration of DMSO as drug treatment group. Concentration and volume for i.p. injection were computed according to total blood volume (TBV). Mouse has about 56 µl of blood per grams of bodyweight \\u003csup\\u003e[\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]\\u003c/sup\\u003e. For example, a mouse body weighted at 20 g, its TBV is 1.12 ml, and i.p. volume of 40 µM CCK-4 solution for the mouse is 20 µl. Insulin syringes (BD 6 mm x 31G; 3/10 mL; catalog no. 324909) were used for i.p. injection. For behavioral tests involving drug administration, The injection was performed 5 minutes before the training session.\\u003c/p\\u003e\\u003cp\\u003eAuditory - Cued Conditioned Fear Training and Testing\\u003c/p\\u003e\\u003cp\\u003eThe conditioned fear training and testing were used to evaluate the differences in fear memory between NR2A knockout (KO) mice and their littermate control mice. In the baseline phase, the mice were placed in the experimental chamber for 2–3 minutes to allow them to familiarize themselves with the environment. Subsequently, 3 second pure tone was played through a speaker, and the mice's responses were observed. Each animal underwent 3 tests, with an interval of at least 1 minute between each test. Twenty - four hours later, the auditory - cued conditioned fear training phase began. The mice were placed in a different experimental chamber, and they were first exposed to the pure tone, followed by a foot shock (intensity: 0.5 mA), with an interval of 0.5 seconds between the tone and the shock. This phase consisted of 6 training sessions, with an interval of at least 1 minute between each session. On the next day, the mice were returned to the original experimental chamber and only exposed to the pure tone without the foot shock to assess their memory of the fear condition. Behavioral responses were recorded and analyzed by experimenters who were blind to the experimental conditions.\\u003c/p\\u003e\\u003cp\\u003eNovel Object Recognition Test\\u003c/p\\u003e\\u003cp\\u003eThe experimental protocol for the novel object recognition test was adapted from previously published methods \\u003csup\\u003e[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]\\u003c/sup\\u003e. One week before the experiment, each mouse was handled for 2 minutes daily to acclimate it to human contact, thereby reducing its anxiety level. On Day 1, the mice were placed in a 25 cm × 25 cm experimental chamber for 10 minutes without any objects inside. On Day 2, after intraperitoneal (IP) injection of the drug or vehicle, the mice were placed in the experimental chamber containing two identical objects and allowed to acclimate for 15 minutes. One hour later, the mice were returned to the same experimental chamber, which now contained one familiar object and one novel object, and the test lasted for 5 minutes. The exploration time was quantified using the discrimination index, which was calculated as follows: Discrimination index = (Time spent exploring the novel object - Time spent exploring the familiar object) / (Time spent exploring the novel object + Time spent exploring the familiar object). Exclusion criteria included mice that did not interact sufficiently with the objects during training or testing, or mice that showed excessive fear. These mice were excluded from the data analysis. Multiple researchers performed the data analysis in a blind manner to avoid bias.\\u003c/p\\u003e\\u003cp\\u003eQuantitative Real - Time Polymerase Chain Reaction (qRT - PCR)\\u003c/p\\u003e\\u003cp\\u003eTo detect the NR2A levels in each group of mice and evaluate the expression of the Grin2a gene, quantitative real - time polymerase chain reaction (qPCR) analysis was performed. Homozygous Grin2a mice and their age - and sex - matched littermate control mice were deeply anesthetized with isoflurane and then euthanized. Subsequently, the brains were removed, and tissue samples from the target brain regions were collected. Total RNA was first extracted using Trizol reagent (Cat. No. 15596018, Invitrogen, Waltham, USA), and then reverse - transcribed into cDNA using the Prime Script Reverse Transcription Kit (Cat. No. RR037B, TaKaRA Bio Inc., Kusatsu, Shiga, Japan). Quantitative real - time PCR analysis was performed using POWERTRACK SYBR reagent (Cat. No. A46109, Applied Biosystems, USA). Each sample was analyzed in duplicate. Details of the primers used are primer NR2A-forward, 5’— CTGCTCCAGTTTGTTGGTGACG—3’; NR2A-reverse, 5’—CCAGCATGTAGAAAACTCCTGCC—3’;. The relative gene expression levels were quantified using the comparative threshold cycle (Ct) method (2^-ΔΔCt method), with glyceraldehyde − 3 - phosphate dehydrogenase (GAPDH) serving as internal reference genes to normalize the initial Ct values.\\u003c/p\\u003e\\u003cp\\u003eElectrophysiological Recordings\\u003c/p\\u003e\\u003cp\\u003eFor multichannel electrophysiological recordings of the medial prefrontal cortex (mPFC), auditory cortex (AC), and hippocampus, mice were anesthetized with gaseous isoflurane and then decapitated. The brains were quickly removed and immersed in ice - cold artificial cerebrospinal fluid (ACSF) saturated with oxygen (95% O₂ − 5% CO₂). The composition of the ACSF (in mM) was as follows: 124 sodium chloride (NaCl), 3 potassium chloride (KCl), 1.25 potassium dihydrogen phosphate (KH₂PO₄), 1.25 magnesium sulfate (MgSO₄), 2 calcium chloride (CaCl₂), 26 sodium bicarbonate (NaHCO₃), and 10 glucose, with a pH of 7.35–7.45. After cooling the brains in the ACSF for 1–2 minutes, the remaining brain tissue was placed on the ice - cold stage of a vibrating microtome (Leika VT1000S). Coronal brain slices (300 µm thick) containing the auditory cortex, medial prefrontal cortex, or hippocampus were prepared and transferred to an incubation chamber continuously perfused with oxygenated ACSF at 37°C. The brain slices were incubated for at least 2 hours before electrophysiological recordings were performed. A commercially available 4 - layer 16/64 - channel system (MED, Panasonic Alpha - Med Sciences) equipped with 64 - channel (8 × 8 mode) or 16 - channel (4 × 4 mode) planar microelectrode arrays (electrode size: 50 × 50 µm, electrode spacing: 150 µm) was used for the recordings. Before use, the electrode arrays were treated with 0.1% polyethyleneimine in 25 mM borate buffer (pH 8.4) at room temperature overnight. After incubation, each brain slice was placed on a MED probe, covered with recording electrodes, and then a fine mesh holder was carefully placed to ensure the stability of the brain slice during the recording process. Three sets of commercial 4-slice 16-channel electrodes array systems (MED, Panasonic Alpha-Med Sciences) were used for high-throughput extracellular field poten tial recordings. One channel of microelectrodes was chosen as the stimulating electrode. The stimulation intensity during baseline (stable recording for at least 15 min) was adjusted to elicit 30%—50% of the maximal response. Theta-burst stimulation (TBS) was adopted to induce LTP at an intensity that can evoke 75%—90% of the maximal response. Afterwards, the stimulation intensity was adjusted back to baseline level to record for another hour. For drug treatment experiments, drug was dissolved in ACSF to 100 nM and administrated directly to the incubation solution. All multichannel electrophysiological data will be analyzed offline by the MED Mobius software.\\u003c/p\\u003e\\u003cp\\u003eFiber Photometry\\u003c/p\\u003e\\u003cp\\u003eFor fiber photometry recordings in the auditory cortex (ACx), AAV9 - Syn - GCaMP6s - WPRE - SV40 virus (titer: 2.50 × 10¹³ vg/mL, 4 - fold dilution, volume: 300 nL, Addgene, Watertown, USA) was injected into the auditory cortex (ACx). Three weeks after virus expression, a fiber optic cannula was implanted. Calcium dynamics recordings began 2 weeks after the fiber implantation. Synapse software (Synapse suite, TDT) was used to control the excitation light and record calcium signals, with a sampling rate of 1 kHz and a low - pass filter frequency of 5 Hz. Custom scripts in Matlab software (Mathworks, USA) were used to analyze the calcium signals. The change in fluorescence signal (ΔF/F) was calculated using the formula: (ΔF - F₀)/F₀.\\u003c/p\\u003e\\u003cp\\u003eImmunohistochemistry\\u003c/p\\u003e\\u003cp\\u003eAAV - Syn - dio - GFP-WPRE-PA virus was injected into the entorhinal cortex of CCK - Cre mice. Four weeks later, the mice were deeply anesthetized with sodium pentobarbital (50 mg/kg, intraperitoneal injection), followed by sequential perfusion with 30 mL of 1 × phosphate - buffered saline (PBS) and 30 mL of 4% (w/v) paraformaldehyde (PFA). The brains were removed and fixed in 4% PFA at 4°C overnight. After cryoprotection of the brains with 30% (w/v) sucrose solution, 40 µm thick coronal brain slices were prepared using a cryostat (Leica CM1860, Germany). The brain slices were then washed 3 times with PBS and blocked with blocking solution (PBS containing 10% goat serum and 0.2% Triton X − 100) at 37°C for 1.5 hours. The brain slices were incubated with anti - NR2A monoclonal antibody (rabbit - derived, 1:1000, Abcam, Cat. No. ab169876) and anti - synaptotagmin 1 (Synaptotagmin1) antibody (mouse - derived, 1:1000, Abcam, Cat. No. ab302627) at 4°C for 48 hours. After washing the brain slices 4 times with PBS (10 minutes each time), they were incubated with secondary antibodies (Alexa Fluor® 594 - labeled goat anti - rabbit IgG, 1:500; Alexa Fluor® 405 - labeled goat anti - mouse IgG, 1:500, Jackson ImmunoResearch Inc.) at 37°C for 1.5 hours. Subsequently, the brain slices were washed 3 times with PBS and mounted on glass slides with PBS containing 70% glycerol. Fluorescence images were captured using a Nikon Eclipse Ni - E upright fluorescence microscope (4× objective lens, Nikon, Japan) and a confocal microscope (20×, 40× objective lenses, Nikon, Japan). Quantitative imaging analysis of the number of neurons was performed using Fiji software.\\u003c/p\\u003e\\u003cp\\u003eWestern Blotting\\u003c/p\\u003e\\u003cp\\u003eTotal proteins were extracted from the tissues using radioimmunoprecipitation assay (RIPA) buffer (containing 1% NP − 40 or Triton X − 100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 150 mM sodium chloride, 50 mM Tris - hydrochloric acid (TrisHCl), pH 7.8, and 1 mM ethylenediaminetetraacetic acid (EDTA)). The protein concentration was determined using a BCA protein quantification kit (Thermo Scientific, Rockford, USA), and the proteins were separated by sodium dodecyl sulfate - polyacrylamide gel electrophoresis (SDS - PAGE). The proteins were then transferred onto polyvinylidene fluoride (PVDF) membranes at a constant current of 200 mA. After blocking the membranes with 5% non - fat dry milk for 2 hours, the membranes were incubated with primary antibodies (mouse anti - GAPDH antibody, 1:500; rabbit anti - NR2A antibody, Abcam, Cambridge, Massachusetts, USA) for 2 hours, followed by incubation with horseradish peroxidase (HRP) - labeled secondary antibodies (1:2000, Abcam, Cambridge, Massachusetts, USA) for another 2 hours. The membranes were washed with TBST buffer (TBST solution containing 2.5% bovine serum albumin (BSA), 1:1000 dilution, Abcam, USA), and all protein bands were visualized using a chemiluminescence method (ECL, Bio - Rad, Hercules, USA).\\u003c/p\\u003e\\u003cp\\u003eSuper - Resolution Microscopy Imaging\\u003c/p\\u003e\\u003cp\\u003eA custom - designed two - color super - resolution localization microscope was used to obtain super - resolution images. The secondary antibodies used were Alexa Fluor 647 - labeled goat anti - rabbit IgG (Invitrogen, Cat. No. A21245, dilution ratio of 1:500 in immunohistochemistry experiments) and Alexa Fluor 750 - labeled goat anti - mouse IgG (Invitrogen, Cat. No. A21037, dilution ratio of 1:500 in immunohistochemistry experiments). The double - stained brain slices on the coverslips were immersed in an imaging buffer consisting of 200 mM Tris - hydrochloric acid (Tris - HCl, pH 9.0), 5% (w/v) glucose, 25 mM tris(2 - carboxyethyl)phosphine hydrochloride solution (TCEP, Sigma, Cat. No. 646547), 1 mM L - ascorbic acid (Sigma, Cat. No. A0537), 1 mM methyl viologen dichloride hydrate (Sigma, Cat. No. 856177), 40 µg/mL catalase (Sigma, Cat. No. C1345), and 0.5 mg/mL glucose oxidase (Sigma, Cat. No. G2133) added just before use.\\u003c/p\\u003e\\u003cp\\u003eQuantitative and Statistical Analysis\\u003c/p\\u003e\\u003cp\\u003eAll statistical analyses (including paired t - test, two - sample t - test, one - way analysis of variance (one - way ANOVA), and two - way mixed analysis of variance (two - way mixed ANOVA)) were performed using SPSS software (IBM, USA). Statistical significance was set at p \\u0026lt; 0.05.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eThe NR2A subunit, as a critical component of the NMDA receptor, participates in the formation of long-term potentiation (LTP)\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR24 CR25\\\" citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]\\u003c/sup\\u003e and plays a pivotal role in neural circuits underlying learning and memory\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR28\\\" citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]\\u003c/sup\\u003e. In our study, we detected the levels of NR2A protein in WT and AD mice through Western blot analysis. The results showed a significant reduction in NR2A in the cortical and hippocampus region of AD mice, suggesting that NR2A is highly likely associated with the memory impairments exhibited by AD animals. In behavioral tasks, We observed that NR2A-KO mice had minimal fear responses in the contextual fear conditioning paradigm, while wild-type (WT) littermates exhibited normal fear responses. Intraperitoneal (i.p.) administration of CCK4 significantly rescued the fear-memory response in these mice. The similar phenomenon was observed during the NOR paradigm in the NR2A-KO mice we studied. NR2A-KO animals exhibit a lower discrimination ratio compared to their littermates control. However, after CCK administration, NR2A-KO mice exhibited similar behavioral responses to normal mice compared with the Vehicle control group. Its key role of CCK in conditioned fear memory in NR2A-KO mice was confirmed. At the same time, our research found that neurons in the primary auditory cortex did not show significant changes in response to sound after training in NR2A-KO mice under sound -paired fear conditions with saline administration. However, in the CCK administration group, NR2A-KO mice exhibited a similar fear response to WT mice, which was significantly different from the control saline injection group, suggesting that CCK treatment rescued fear memories which also restored calcium signaling levels in auditory cortex neurons to the conditioned sound after training. This indicates that the injection of CCK could enhance the response of NR2A-KO mice to auditory stimuli in conditioned fear, thereby strengthened the fear memory of NR2A-KO mice.\\u003c/p\\u003e\\u003cp\\u003eThe induction of long-term potentiation (LTP) in the hippocampus and cortex plays a critically important role in memory formation and retrieval. Numerous studies have demonstrated that memory deficits are closely associated with the blockade of LTP in these regions\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR31\\\" citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]\\u003c/sup\\u003e. In our study, we recorded TBS-induced LTP response of the auditory cortex, prefrontal cortex and hippocampus in KO mice and found that KO mice exhibited a loss of LTP in these regions. Interestingly, perfusion of CCK could restore this loss of TBS induced LTP. Therefore, we hypothesize that the effectiveness of CCK in the treatment of memory deficits could be explained by the ability to restore the neuroplasticity. In addition, we also explored the potential mechanism of memory impairment in KO mice and the effect of CCK treatment. In our previous study, we found that cholecystokinin (CCK) neurons in the entorhinal cortex are widely projected to the auditory cortex, promoting the formation of auditory-related memories through CCK release. This lead us to hypothesize that the absence of cortical NR2A may disrupt the release of CCK, thereby impairing the formation of fear memories. To evaluated this hypothesis, we first used immunohistochemistry to confirm that there is a large amount of NR2A aggregation at the axon terminal projection from Lent to the auditory cortex, and to further confirm the possible location of NR2A, we used a high-resolution microscope to observe the relationship between NR2A and synapse and found that many NR2A was accumulating in the presynaptic membrane. Therefore, the results indicated that NMDARs with NR2A subunits was specifically enriched at presynaptic sites of CCK projections in Auditory cortex from the entorhinal cortex. Next, we used the CCKBR sensor to detect the CCK release in the protection terminals, and the results were compared to a control group treated with a specific NR2A antagonist. We found that after the high-frequency laser stimulated the expressed ChrimsonR protein in auditory cortex. We could see a change in the fluorescence signal by the transient CCK release, However, there was no significant increase in the fluorescence signal in the antagonist group compared to the baseline which illustrated that the absence of NR2A may blocks the release of CCK projected from Lent to AC. Taken together, all the results suggest that CCK administration could rescue the behavioral representations associated with memory loss in NR2A-KO animals, and it was likely that NR2A loss leads to the loss of neuroplasticity in the cortex and hippocampus. And CCK could rescue the induced LTP in cortex and hippocampus same time restored calcium signaling levels. Further mechanism analysis might be caused by the impact on the release of CCK in key pathways. Our study would provide the therapeutic potential of CCK in various neuroplasticity disorders diseases. For example, Neuronal damage caused by abnormalities of N-methyl-D-aspartate receptors (NMDARs) containing the NR2A subunit, such as that seen in schizophrenia, bipolar disorder, and other related conditions\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR34 CR35\\\" citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]\\u003c/sup\\u003e.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003ch2\\u003eConflict of interest\\u003c/h2\\u003e\\u003cp\\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\\u003c/p\\u003e\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003ePhilpot BD, Cho KK, Bear MF. Obligatory role of NR2A for metaplasticity in visual cortex. Neuron. 2007;53(4):495\\u0026ndash;502. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.neuron.2007.01.027\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.neuron.2007.01.027\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBrigman JL, Feyder M, Saksida LM, Bussey TJ, Mishina M, Holmes A. Impaired discrimination learning in mice lacking the NMDA receptor NR2A subunit. Learn Mem. 2008;15(2):50\\u0026ndash;54. Published 2008 Jan 28. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1101/lm.777308\\u003c/span\\u003e\\u003cspan address=\\\"10.1101/lm.777308\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSu J, Huang F, Tian Y, et al. Entorhinohippocampal cholecystokinin modulates spatial learning by facilitating neuroplasticity of hippocampal CA3-CA1 synapses. Cell Rep. 2023;42(12):113467. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.celrep.2023.113467\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.celrep.2023.113467\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eAsim M, Wang H, Waris A, He J. Basolateral amygdala parvalbumin and cholecystokinin-expressing GABAergic neurons modulate depressive and anxiety-like behaviors. Transl Psychiatry. 2024;14(1):418. Published 2024 Oct 5. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41398-024-03135-z\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41398-024-03135-z\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSun W, Wu H, Peng Y, et al. Heterosynaptic plasticity of the visuo-auditory projection requires cholecystokinin released from entorhinal cortex afferents. Elife. 2024;13:e83356. Published 2024 Mar 4. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.7554/eLife.83356\\u003c/span\\u003e\\u003cspan address=\\\"10.7554/eLife.83356\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLi X, Yu K, Zhang Z, et al. Cholecystokinin from the entorhinal cortex enables neural plasticity in the auditory cortex. Cell Res. 2014;24(3):307\\u0026ndash;330. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/cr.2013.164\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/cr.2013.164\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eNakazawa, K., McHugh, T., Wilson, M. et al. NMDA receptors, place cells and hippocampal spatial memory. Nat Rev Neurosci 5, 361\\u0026ndash;372 (2004). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1038/nrn1385\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/nrn1385\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003ePaoletti P, Bellone C, Zhou Q. NMDA receptor subunit diversity: impact on receptor properties, synaptic plasticity and disease. Nat Rev Neurosci. 2013;14(6):383\\u0026ndash;400. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/nrn3504\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/nrn3504\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZhao JP, Constantine-Paton M. NR2A-/- mice lack long-term potentiation but retain NMDA receptor and L-type Ca2\\u0026thinsp;+\\u0026thinsp;channel-dependent long-term depression in the juvenile superior colliculus. J Neurosci. 2007;27(50):13649\\u0026ndash;13654. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1523/JNEUROSCI.3153-07.2007\\u003c/span\\u003e\\u003cspan address=\\\"10.1523/JNEUROSCI.3153-07.2007\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eFuruie H, Yamada M. Neonatal blockade of NR2A-containing but not NR2B-containing NMDA receptor induces spatial working memory deficits in adult rats. Neurosci Res. 2022;176:57\\u0026ndash;65. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.neures.2021.10.005\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.neures.2021.10.005\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKirova AM, Bays RB, Lagalwar S. Working memory and executive function decline across normal aging, mild cognitive impairment, and Alzheimer's disease. Biomed Res Int. 2015;2015:748212. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1155/2015/748212\\u003c/span\\u003e\\u003cspan address=\\\"10.1155/2015/748212\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBadesso S, Cartas-Cejudo P, Espelosin M, Santamaria E, Cuadrado-Tejedor M, Garcia-Osta A. Docosahexaenoic Acid Ameliorates Contextual Fear Memory Deficits in the Tg2576 Alzheimer's Disease Mouse Model: Cellular and Molecular Correlates. Pharmaceutics. 2022;15(1):82. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3390/pharmaceutics15010082\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/pharmaceutics15010082\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e. PMID: 36678710; PMCID: PMC9866126.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBromley-Brits, Kelley et al. \\u0026ldquo;Morris water maze test for learning and memory deficits in Alzheimer's disease model mice.\\u0026rdquo; Journal of visualized experiments: JoVE ,53 2920. 20 Jul. 2011, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3791/2920\\u003c/span\\u003e\\u003cspan address=\\\"10.3791/2920\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eJahn H. Memory loss in Alzheimer's disease. Dialogues Clin Neurosci. 2013;15(4):445\\u0026ndash;454. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.31887/DCNS.2013.15.4/hjahn\\u003c/span\\u003e\\u003cspan address=\\\"10.31887/DCNS.2013.15.4/hjahn\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eStover, Kurt R et al. \\u0026ldquo;Early detection of cognitive deficits in the 3xTg-AD mouse model of Alzheimer's disease.\\u0026rdquo; Behavioural brain research vol. 289 (2015): 29\\u0026ndash;38. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.bbr.2015.04.012\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.bbr.2015.04.012\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eDoniger, Glen M et al. \\u0026ldquo;Impaired visual object recognition and dorsal/ventral stream interaction in schizophrenia.\\u0026rdquo; Archives of general psychiatry vol. 59,11 (2002): 1011\\u0026ndash;20. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1001/archpsyc.59.11.1011\\u003c/span\\u003e\\u003cspan address=\\\"10.1001/archpsyc.59.11.1011\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZhang, N., Sui, Y., Jendrichovsky, P., Feng, H., Shi, H., Zhang, X., Xu, S., Sun, W., Zhang, H., Chen, X., Tortorella, M. D., \\u0026amp; He, J. (2024). Cholecystokinin B receptor agonists alleviates anterograde amnesia in cholecystokinin-deficient and aged Alzheimer's disease mice. Alzheimer's research \\u0026amp; therapy, 16(1), 109.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eFeng H, Su J, Fang W, Chen X, He J. The entorhinal cortex modulates trace fear memory formation and neuroplasticity in the mouse lateral amygdala via cholecystokinin. Elife. 2021;10: e69333.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eWang H, Qian T, Zhao Y, et al. A tool kit of highly selective and sensitive genetically encoded neuropeptide sensors. Science. 2023;382(6672):eabq8173. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1126/science.abq8173\\u003c/span\\u003e\\u003cspan address=\\\"10.1126/science.abq8173\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eShankar, Ganesh M et al. \\u0026ldquo;Amyloid-beta protein dimers isolated directly from Alzheimer's brains impair synaptic plasticity and memory.\\u0026rdquo; Nature medicine vol. 14,8 (2008): 837\\u0026ndash;42. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/nm1782\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/nm1782\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLueptow, Lindsay M. \\u0026ldquo;Novel Object Recognition Test for the Investigation of Learning and Memory in Mice.\\u0026rdquo; Journal of visualized experiments: JoVE ,126 55718. 30 Aug. 2017, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3791/55718\\u003c/span\\u003e\\u003cspan address=\\\"10.3791/55718\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eCohen, Sarah J, and Robert W Stackman Jr. \\u0026ldquo;Assessing rodent hippocampal involvement in the novel object recognition task. A review.\\u0026rdquo; Behavioural brain research vol. 285 (2015): 105\\u0026ndash;17. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.bbr.2014.08.002\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.bbr.2014.08.002\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eFleischmann, Alexander et al. \\u0026ldquo;Impaired long-term memory and NR2A-type NMDA receptor-dependent synaptic plasticity in mice lacking c-Fos in the CNS.\\u0026rdquo; The Journal of neuroscience: the official journal of the Society for Neuroscience vol. 23,27 (2003): 9116\\u0026ndash;22. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1523/JNEUROSCI.23-27-09116.2003\\u003c/span\\u003e\\u003cspan address=\\\"10.1523/JNEUROSCI.23-27-09116.2003\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eCui, Zhenzhong et al. \\u0026ldquo;Increased NR2A:NR2B ratio compresses long-term depression range and constrains long-term memory.\\u0026rdquo; Scientific reports vol. 3 (2013): 1036. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/srep01036\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/srep01036\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eAsim, Muhammad et al. \\u0026ldquo;Shedding light on cholecystokinin's role in hippocampal neuroplasticity and memory formation.\\u0026rdquo; Neuroscience and biobehavioral reviews vol. 159 (2024): 105615. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.neubiorev.2024.105615\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.neubiorev.2024.105615\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eNomoto, S et al. \\u0026ldquo;Impaired learning and memory in OLETF rats without cholecystokinin (CCK)-A receptor.\\u0026rdquo; Physiology \\u0026amp; behavior vol. 66,5 (1999): 869\\u0026ndash;72. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/s0031-9384(99)00033-5\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/s0031-9384(99)00033-5\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZhang, Xu et al. \\u0026ldquo;Cholecystokinin B receptor antagonists for the treatment of depression via blocking long-term potentiation in the basolateral amygdala.\\u0026rdquo; Molecular psychiatry vol. 28,8 (2023): 3459\\u0026ndash;3474. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41380-023-02127-7\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41380-023-02127-7\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eAdamec, R. \\u0026ldquo;Transmitter systems involved in neural plasticity underlying increased anxiety and defense\\u0026ndash;implications for understanding anxiety following traumatic stress.\\u0026rdquo; Neuroscience and biobehavioral reviews vol. 21,6 (1997): 755\\u0026ndash;65. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/s0149-7634(96)00055-3\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/s0149-7634(96)00055-3\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLi, Qing-Qing et al. \\u0026ldquo;Enhancing GluN2A-type NMDA receptors impairs long-term synaptic plasticity and learning and memory.\\u0026rdquo; Molecular psychiatry vol. 27,8 (2022): 3468\\u0026ndash;3478. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41380-022-01579-7\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41380-022-01579-7\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eCui, Zhenzhong et al. \\u0026ldquo;Increased NR2A:NR2B ratio compresses long-term depression range and constrains long-term memory.\\u0026rdquo; Scientific reports vol. 3 (2013): 1036. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/srep01036\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/srep01036\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eShipton, Olivia A, and Ole Paulsen. \\u0026ldquo;GluN2A and GluN2B subunit-containing NMDA receptors in hippocampal plasticity.\\u0026rdquo; Philosophical transactions of the Royal Society of London. Series B, Biological sciences vol. 369,1633 20130163. 2 Dec. 2013, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1098/rstb.2013.0163\\u003c/span\\u003e\\u003cspan address=\\\"10.1098/rstb.2013.0163\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBaltaci, Saltuk Bugra et al. \\u0026ldquo;Molecular Mechanisms of Early and Late LTP.\\u0026rdquo; Neurochemical research vol. 44,2 (2019): 281\\u0026ndash;296. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s11064-018-2695-4\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s11064-018-2695-4\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eHarrison, P. J., \\u0026amp; Bannerman, D. M. (2023). GRIN2A (NR2A): a gene contributing to glutamatergic involvement in schizophrenia. Molecular psychiatry, 28(9), 3568\\u0026ndash;3572. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1038/s41380-023-02265-y\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41380-023-02265-y\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMcCullumsmith, R. E., Kristiansen, L. V., Beneyto, M., Scarr, E., Dean, B., \\u0026amp; Meador-Woodruff, J. H. (2007). Decreased NR1, NR2A, and SAP102 transcript expression in the hippocampus in bipolar disorder. Brain research, 1127(1), 108\\u0026ndash;118.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003ePearlman, Daniel M., and Najjar, Souhel.. \\\"Meta-analysis of the association between N-methyl-d-aspartate receptor antibodies and schizophrenia, schizoaffective disorder, bipolar disorder, and major depressive disorder.\\\" Schizophrenia research 157.1-3(2014).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eWoo, Tsung-Ung W et al. \\u0026ldquo;N-methyl-D-aspartate receptor and calbindin-containing neurons in the anterior cingulate cortex in schizophrenia and bipolar disorder.\\u0026rdquo; Biological psychiatry vol. 64,9 (2008): 803\\u0026ndash;9. doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.biopsych.2008.04.034\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.biopsych.2008.04.034\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"translational-psychiatry\",\"isNatureJournal\":false,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"tp\",\"sideBox\":\"Learn more about [Translational Psychiatry](http://www.nature.com/tp/)\",\"snPcode\":\"41398\",\"submissionUrl\":\"https://mts-tp.nature.com/cgi-bin/main.plex\",\"title\":\"Translational Psychiatry\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-7982110/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-7982110/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eStudies have demonstrated that NMDA receptors (NMDARs) mediate multiple forms of synaptic plasticity, including the induction of long-term potentiation (LTP) and long-term depression (LTD) \\u003csup\\u003e[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]\\u003c/sup\\u003e. The NR2A subunit is closely associated with LTP generation, which in turn induces learning and memory-related behaviors. This is evidenced by the significant memory deficit behaviors observed in NR2A knockout (NR2A -/-) mice \\u003csup\\u003e[\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]\\u003c/sup\\u003e. Consequently, NR2A-KO animals serve as a valuable model for exploring memory encoding-related pathways and mechanisms, as well as for providing insights into drug-based treatments for memory disorders. Previous research has shown that cholecystokinin (CCK)-expressing neurons are abundantly present in the cerebral cortex and hippocampus, and they are involved in memory engram functions across multiple brain regions \\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR4 CR5\\\" citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]\\u003c/sup\\u003e. However, it remains unclear whether CCK administration can ameliorate the memory deficits exhibited by NR2A knockout animals in certain learning and memory behaviors. In this study, the novel object recognition task and auditory paired conditioned fear learning paradigm were employed to evaluate the role of CCK in rescuing memory deficits in NR2A knockout (NR2A-KO) mice. Our results revealed that NR2A-KO mice displayed significant impairments in both the novel object recognition paradigm and the conditioned fear behavioral paradigm. Notably, CCK administration improved the performance of these mice in these behavioral tasks. Concurrently, in vitro multichannel electrophysiological recordings were used to investigate the effects of CCK administration on LTP induction in the cortex and hippocampus. The findings indicated that CCK restored the loss of LTP in the cortex and hippocampus of NR2A-KO mice. Furthermore, fiber photometry was utilized to monitor calcium (Ca\\u0026sup2;⁺) activity in the auditory cortex (AC) in response to the auditory cue of paired conditioned fear. The results showed that CCK administration significantly enhanced calcium signal changes in the auditory cortex in response to the sound, suggesting that CCK treatment restored the memory of auditory paired conditioned fear in NR2A-KO mice to the level of wild-type mice. To verify the hypothesis that NR2A deficiency may affect CCK release from CCK neurons, building on our previous studies which showed that the projection of CCK neurons from the lateral entorhinal cortex (LEC) to the auditory cortex is involved in sound - cued associative memory \\u003csup\\u003e[\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]\\u003c/sup\\u003e, we employed a specific CCKBR sensor system combined with optogenetic viruses. We examined CCK release from CCK axon terminals projecting from the LEC to the AC following high - frequency stimulation in the presence of an NR2A antagonist. The results demonstrated that the NR2A antagonist blocked CCK release. Anatomically, a large number of NMDARs composed of NR2A subunits were found to be clustered at the CCK axon terminals projecting from the LEC to the AC, which structurally verified the possibility that NR2A might affect CCK release. Collectively, these results indicate that CCK administration not only compensates for the loss of LTP in NR2A-KO mice but also ameliorates certain memory deficit - like behaviors exhibited by these animals. Overall, our study suggests that CCK is a potential target for the treatment of memory deficits and clarifies its therapeutic role in the memory deficit behaviors displayed by NR2A-KO animals.\\u003c/p\\u003e\",\"manuscriptTitle\":\"CCK Administration Alleviates Memory Encoding Impairment in NR2A Knockout Transgenic Mice by Improving Synaptic Plasticity\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-11-14 10:37:27\",\"doi\":\"10.21203/rs.3.rs-7982110/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"revise\",\"date\":\"2025-12-10T11:51:56+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"This content is not available.\",\"date\":\"2025-11-23T14:29:08+00:00\",\"index\":2,\"fulltext\":\"This content is not available.\"},{\"type\":\"editorInvitedReview\",\"content\":\"This content is not available.\",\"date\":\"2025-11-21T17:14:06+00:00\",\"index\":1,\"fulltext\":\"This content is not available.\"},{\"type\":\"editorInvitedReview\",\"content\":\"This content is not available.\",\"date\":\"2025-11-09T12:08:37+00:00\",\"index\":3,\"fulltext\":\"This content is not available.\"},{\"type\":\"reviewerAgreed\",\"content\":\"This content is not available.\",\"date\":\"2025-11-09T09:07:12+00:00\",\"index\":3,\"fulltext\":\"This content is not available.\"},{\"type\":\"reviewerAgreed\",\"content\":\"This content is not available.\",\"date\":\"2025-11-05T15:46:10+00:00\",\"index\":2,\"fulltext\":\"This content is not available.\"},{\"type\":\"reviewerAgreed\",\"content\":\"This content is not available.\",\"date\":\"2025-11-05T13:18:08+00:00\",\"index\":1,\"fulltext\":\"This content is not available.\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2025-11-05T03:02:59+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2025-11-04T12:50:41+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2025-11-04T12:41:04+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Translational Psychiatry\",\"date\":\"2025-11-01T15:06:16+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksFailed\",\"content\":\"\",\"date\":\"2025-10-30T13:44:46+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"translational-psychiatry\",\"isNatureJournal\":false,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"tp\",\"sideBox\":\"Learn more about [Translational Psychiatry](http://www.nature.com/tp/)\",\"snPcode\":\"41398\",\"submissionUrl\":\"https://mts-tp.nature.com/cgi-bin/main.plex\",\"title\":\"Translational Psychiatry\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"cfeaa8ed-045f-49b9-ad7c-9bfa96771e7e\",\"owner\":[],\"postedDate\":\"November 14th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"in-revision\",\"subjectAreas\":[{\"id\":57452390,\"name\":\"Biological sciences/Neuroscience/Learning and memory\"},{\"id\":57452391,\"name\":\"Health sciences/Diseases\"}],\"tags\":[],\"updatedAt\":\"2026-04-13T15:02:52+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-11-14 10:37:27\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-7982110\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-7982110\",\"identity\":\"rs-7982110\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}