{"paper_id":"1155aab8-9b8c-4b6e-bf7d-67b68626bc06","body_text":"1 \nTwo paralogous PHD finger proteins \nparticipate in Paramecium tetraurelia’s \nnatural genome editing \n \nLilia Häußermann1, Aditi Singh1,#, Estienne C. Swart1,# \n \n1Max Planck Institute for Biology, Max-Planck-Ring 5, 72076, Tübingen, Germany \n \n#Corresponding author: estienne.swart@tuebingen.mpg.de, \naditi.singh@tuebingen.mpg.de  \n \n \n \nKeywords: genome reorganization; PHD finger proteins; small RNAs \n \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 2 \nAbstract 1 \nThe unicellular eukaryote Paramecium tetraurelia contains functionally distinct nuclei: 2 \ngermline micronuclei (MICs) and a somatic macronucleus (MAC). During sexual 3 \nreproduction, the MIC genome is reorganized into a new MAC genome and the old 4 \nMAC is lost. Almost 45,000 unique Internal Eliminated Sequences (IESs) distributed 5 \nthroughout the genome require precise excision to guarantee a functional new MAC 6 \ngenome. Here, we characterize a pair of paralogous PHD finger proteins involved in 7 \nDNA elimination. DevPF1, the early-expressed paralog, is present in only some of the 8 \ngametic and post-zygotic nuclei during meiosis. Both DevPF1 and DevPF2 localize in 9 \nthe new developing MACs, where IESs excision occurs. In DevPF2 knockdown (KD) 10 \nlong IESs are preferentially retained and late-expressed small RNAs decrease; no 11 \nlength preference for retained IESs was observed in DevPF1-KD and development-12 \nspecific small RNAs were abolished. The expression of at least two genes from the new 13 \nMAC with roles in genome reorganization seems to be influenced by DevPF1- and 14 \nDevPF2-KD. Thus, both PHD fingers are crucial for new MAC genome development, 15 \nwith distinct functions, potentially via regulation of non-coding and coding transcription 16 \nin the MICs and new MACs. 17 \n 18 \nIntroduction 19 \nA unique feature shared by all ciliates is the presence of nuclear dimorphism. In 20 \nParamecium tetraurelia (henceforth Paramecium) the two micronuclei (MICs) resemble 21 \nthe germline of multicellular organisms, being transcriptionally silent throughout most of 22 \nthe life cycle and generating haploid nuclei during meiosis that develop and give rise to 23 \nall nuclei in the subsequent generation. Also similar to the multicellular soma, the 24 \nmacronucleus (MAC) is optimized for most gene expression, and originates from a MIC 25 \ncopy. The old MAC is fragmented during sexual division and subsequently diluted 26 \nacross cell divisions, with the new MAC completely taking over somatic expression. The 27 \ndevelopment from the MIC genome to the MAC genome in Paramecium is a natural 28 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 3 \nform of genome editing that requires extensive reorganization, including genome 29 \namplification (~800n), chromosome fragmentation and the elimination of about 25% of 30 \nthe sequence content (Arnaiz et al., 2012; Guérin et al., 2017). These MIC genome-31 \nspecific sequences comprise repeats, transposable elements and Internal Eliminated 32 \nSequences (IESs).  33 \n 34 \nIn contrast to other elimination events, IES elimination requires precise excision in 35 \nParamecium. Precise IES excision is not characteristic of all ciliates. Notably, in 36 \nParamecium’s oligohymenophorean relative Tetrahymena, IESs are predominantly 37 \nimprecisely excised and only tolerated in intergenic regions (Hamilton et al., 2016). The 38 \nroughly 45,000 IESs in Paramecium are scattered throughout the genome in both non-39 \ncoding and coding regions and vary from tens to thousands of base pairs in length 40 \n(Arnaiz et al., 2012). Since the coding density of the Paramecium MAC genome is high, 41 \nmost IESs are intragenic (Arnaiz et al., 2012). Paramecium IESs are flanked by 42 \nconserved 5’-TA-3’ dinucleotides (Klobutcher & Herrick, 1995) and excised by 43 \nPiggyMAC (Pgm). Pgm is a domesticated transposase derived from PiggyBac 44 \ntransposases (Baudry et al., 2009) like the excisase responsible for IES excision in 45 \nTetrahymena (Cheng et al., 2010). The weakly conserved ~5 bp long inverted repeats at 46 \nParamecium IES ends (Klobutcher & Herrick, 1995) fail to provide enough specificity for 47 \nreliable Pgm recruitment (Arnaiz et al., 2012). This suggests that other factors are 48 \nneeded for precise IES targeting.  49 \n 50 \nThe targeting of MIC-specific sequences for elimination is thought to be assisted by 51 \nsmall non-coding RNAs, first characterized in Tetrahymena (Chalker & Yao, 2001; 52 \nMochizuki et al., 2002). Like Tetrahymena, the biogenesis of the 25 nucleotide (nt) scan 53 \nRNAs (scnRNAs) occurs during meiosis in the Paramecium MICs. Bidirectional non-54 \ncoding transcription of the MIC genome is thought to be initiated by the putative 55 \ntranscription elongation factor Spt5m (Gruchota et al., 2017) and followed by the 56 \ncleavage of long double-stranded RNA (dsRNA) by the closely related Dicer-like protein 57 \nparalogs Dcl2 and Dcl3 (Hoehener et al., 2018; Lepère et al., 2009; Sandoval et al., 58 \n2014). Argonaute/Piwi proteins Ptiwi01/09 (also close paralogs) process the resulting 59 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 4 \nshort dsRNAs, removing one of the two strands, and stabilize single-stranded scnRNAs 60 \nthroughout the selection process in the parental MAC and targeting of MIC-specific 61 \nsequences in the new MACs (Bouhouche et al., 2011; Furrer et al., 2017). In the 62 \nparental MAC, Gtsf1 was recently proposed to promote ubiquitination and subsequent 63 \ndegradation of the Ptiwi01/09 complexes harboring MAC-matching scnRNAs (Charmant 64 \net al., 2023; Wang et al., 2023). In the new MACs, the putative transcription elongation 65 \nfactor TFIIS4 was proposed to promote non-coding transcription required for scanning 66 \nthe developing genome (Maliszewska-Olejniczak et al., 2015).  67 \n 68 \nIn Tetrahymena, H3K9 and H3K27 methylation precede IES excision (Y. Liu et al., 2007; 69 \nTaverna et al., 2002) and it was shown in Paramecium that development-specific 70 \nH3K9me3 and H3K27me3 histone mark deposition by the PRC2 complex depends on 71 \nscnRNAs and is essential for the elimination of transposons and IESs (Frapporti et al., 72 \n2019; Ignarski et al., 2014; Lhuillier-Akakpo et al., 2014; Miró-Pina et al., 2022; Wang et 73 \nal., 2022). We recently showed that the ISWI1 chromatin remodeling complex is 74 \nnecessary for IES excision precision and Ptiwi01/09 co-immunoprecipitated with ISWI1 75 \nin a crosslinked treatment (Singh et al., 2022, 2023). After the initial onset of IES 76 \nexcision, additional single-stranded sRNAs, iesRNAs, ranging in size from ~26 to 30 bp, 77 \nare produced by Dcl5 from excised IES fragments and stabilized on Ptiwi10/11 (Furrer 78 \net al., 2017; Sandoval et al., 2014). iesRNAs were proposed to participate in a positive 79 \nfeedback loop for the efficient removal of all IES copies (Sandoval et al., 2014). 80 \nNevertheless, only a fraction of IES excision appears to depend on scnRNAs or 81 \niesRNAs (Nowacki et al., 2005; Sandoval et al., 2014). 82 \n 83 \nDespite the knowledge gained in the past decades, the picture of IES excision is far 84 \nfrom complete. To identify novel genes involved in IES excision, we examined proteins 85 \npotentially associated with ISWI1, a chromatin remodeler we recently showed to 86 \nfacilitate precise IES excision (Singh et al., 2022).  87 \n 88 \n 89 \n 90 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 5 \nResults 91 \nIdentification of a novel protein involved in IES excision  92 \nRecently, we reported evidence supporting the formation of a protein complex involving 93 \nISWI1 and the ICOP proteins (Singh et al., 2023). We conducted an RNAi screen of 94 \nadditional genes that were unique in the ISWI1 co-immunoprecipitation (IP)-mass 95 \nspectrometry (MS) and exhibited upregulation in a developmental gene expression time 96 \ncourse from ParameciumDB (Arnaiz et al., 2017) (Fig. S1A).  97 \n 98 \nIn the screening, we sought phenotypic evidence for failed genome reorganization in the 99 \nform of growth defects (assessed by survival tests), and substantial IES retention 100 \n(assessed by IES retention PCRs). ND7, a gene involved in trichocyst discharge 101 \n(Lefort-Tran et al., 1981), was used as a negative control as its silencing does not impair 102 \ngenome reorganization (Nowacki et al., 2005). Nowa1-KD, which affects the excision of 103 \nscnRNA-dependent IESs (Nowacki et al., 2005), was used as a positive control. 104 \nCandidate 2 (PTET.51.1.G0620188) displayed both IES retention and lethality in the 105 \nnew progeny, whereas candidate 1 (PTET.51.1.G0990120) showed high lethality 106 \nwithout IES retention (Fig. S1B,C). Therefore, candidate 2 was selected for further 107 \ninvestigations.  108 \n 109 \nDevPF2 and DevPF1 are paralogous PHD finger proteins  110 \nThe Paramecium aurelia species complex, to which P. tetraurelia belongs, underwent 111 \nmultiple whole-genome duplications, with many closely related paralogs generated from 112 \nthe most recent of these (Sellis et al., 2021). The chosen candidate has a closely related 113 \nparalog (PTET.51.1.G0240213) with which it shares 86.6% identity at both the 114 \nnucleotide and amino acid levels. The paralog is upregulated during sexual 115 \ndevelopment as well, although earlier (Fig. 1A). HMMER3 searches of the Pfam 116 \ndatabase (Finn et al., 2003) predicted two domains in both proteins: a PHD and a PHD 117 \nzinc-finger-like domain (Fig. 1B,D,E).  118 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 6 \n 119 \nThe highly conserved PHD domain has often been reported to mediate the interaction of 120 \nnuclear proteins with histone modifications (Sanchez & Zhou, 2011), but other binding 121 \naffinities have also been described (see Discussion). PHD domains possess a well-122 \nconserved motif consisting of eight cysteine and histidine residues (C4HC3) that 123 \ncoordinate two zinc ions, thereby providing it with structural stability. The presence of 124 \nthe C4HC3 motif in both paralogs was confirmed using a multiple sequence alignment 125 \nwith PHD domains from well-established PHD finger proteins from Homo sapiens and 126 \nDrosophila melanogaster (Fig. 1C).  127 \n 128 \nAlphaFold2 predicted the structures of both paralogs with high confidence for the 129 \ndomains (Fig. 1F,G). We compared the PHD predictions with the published structure of 130 \nthe WSTF (Williams Syndrome Transcription Factor) PHD finger (Pascual et al., 2000). 131 \nWSTF, associated with the Williams Syndrome (Lu et al., 1998), is a subunit of the 132 \nISWI-containing chromatin remodeling complex WICH (Bozhenok et al., 2002). The 133 \nsuperimposition confirmed the orientation of the eight C4HC3 residues in the DevPFs 134 \ntowards the two zinc ions (Fig. 1H), supporting the idea that both paralogs function as 135 \nPHD finger proteins. Since they show development-specific upregulation (Fig. 1A), we 136 \nnamed the paralogs development-specific PHD finger 1 (DevPF1; early-expressed 137 \nparalog) and 2 (DevPF2; late-expressed paralog). 138 \n 139 \nDevPF1 and DevPF2 show distinct nuclear localization  140 \nTo determine the localization of both paralogs, we injected DNA constructs encoding 141 \nDevPF1 and 2 C-terminally tagged with green fluorescent protein (GFP) into MACs of 142 \nvegetative paramecia. The cells were collected during Paramecium sexual development 143 \nfor confocal microscopy. The injected cultures displayed no growth defects compared to 144 \nnon-transformed cells (Fig. S2A). However, we observed variable numbers for gametic 145 \nMICs (Figs 2, 3) and new MACs (Fig. S2C) in some cells, which has been observed 146 \nfrequently for transgenes (e.g, Nowa1-GFP fusion; (Nowacki et al., 2005)). 147 \n 148 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 7 \nConsistent with DevPF1’s early peak in mRNA expression from the developmental time 149 \ncourse in ParameciumDB, DevPF1-GFP was expressed during the onset of sexual 150 \ndevelopment, but not in vegetative cells with food vacuoles containing bacteria (Figs 2A, 151 \nS2B). DevPF1-GFP was distributed throughout the cytoplasm and localized in both 152 \nMICs before and during the S-phase of meiosis, when these nuclei swell (Fig. 2A). 153 \nThroughout the subsequent meiotic divisions, DevPF1-GFP localized to only a few of 154 \nthe gametic MICs (Fig. 3A). Its micronuclear localization appeared independent of 155 \nnuclear division as detected by the presence of the spindle apparatus (Fig. 3A,B). 156 \nDuring post-zygotic mitotic divisions, DevPF1-GFP was observable in certain post-157 \nzygotic nuclei, but not in all of them (Fig. 3B). Later during development, DevPF1-GFP 158 \nwas present in the early new MACs and remained in the new MACs throughout 159 \ndevelopment up to very late stages (Fig. 2A) despite the drop in its mRNA levels (Fig. 160 \n1B). During new MAC development there was also comparatively little cytoplasmic 161 \nDevPF1-GFP compared to that during meiosis. 162 \n 163 \nConsistent with its mRNA expression profile, DevPF2-GFP emerged after the onset of 164 \nnew MAC development and localized within the new MACs, where it remained up to the 165 \nlate stages (Fig. 2B). 166 \n 167 \nSilencing constructs partially co-silence both paralogs  168 \nWe utilized RNAi by feeding to investigate the influence of the DevPFs on IES excision. 169 \nTwo silencing regions were selected (a and b) on each DevPF1 and DevPF2 (Fig. 4A). 170 \nDue to the lack of regions with sufficient specificity for either of the paralogs, co-171 \nsilencing was predicted (see Methods). Hence, we first experimentally verified the 172 \npossibility of co-silencing with mRNA and protein levels using silencing region a, since it 173 \nexhibited less off-target hits.  174 \n 175 \nThe mRNA levels of DevPF1 and DevPF2 were examined during a time course 176 \nexperiment (more details and further analysis follow in subsequent sections) (Fig. 4B). 177 \nConsistent with the published expression profiles (Arnaiz et al., 2017), DevPF1 178 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 8 \nexpression in the ND7 control knockdown (KD) was highest during onset of 179 \ndevelopment and gradually declined to almost no expression at the “very late” time 180 \npoint. The late-expressed DevPF2 peaked at the “late” time point in the control KD. The 181 \nexpression of both genes was strongly reduced upon their respective KDs (DevPF1 182 \nmRNA levels were reduced upon DevPF1-KD; DevPF2 mRNA levels were reduced 183 \nupon DevPF2-KD). A lesser reduction was also observed upon silencing of the 184 \nrespective paralog (DevPF1 levels were reduced in DevPF2-KD and vice versa). Thus, 185 \nthe DevPF1 and DevPF2 silencing constructs lead to co-silencing which is less efficient 186 \nthan the target gene silencing. 187 \n 188 \nTo investigate how the changes in mRNA levels affect protein levels, we checked the 189 \nlocalization of the GFP-tagged DevPFs upon KDs. Since DevPF1 is expressed 190 \nthroughout the whole development, multiple developmental time points were collected 191 \n(Fig. S3A). For the late-expressed DevPF2, only cell stages with clearly visible new 192 \nMACs were considered (Fig. S3B). In addition to ND7-KD, the knockdown of PGM, the 193 \ngene encoding the PiggyMac IES excisase (Baudry et al., 2009), was performed to test 194 \nwhether the disturbance of IES excision alters DevPF localization. Neither the 195 \nlocalization of DevPF1-GFP nor of DevPF2-GFP was impaired by either of the control 196 \nKDs. In contrast, the GFP signals were almost completely lost upon DevPF1- or 197 \nDevPF2-KD. To quantify this observation, GFP fluorescence signals were measured in 198 \nnew MACs (Fig. 4C) as both paralogs exclusively localize to the new MACs during late 199 \nstages. In line with the observed reduction in mRNA levels, DevPF1-GFP expression 200 \nwas efficiently reduced upon DevPF1-KD, whereas DevPF2-KD led to a weaker 201 \nreduction. For DevPF2-GFP, the levels were almost equally reduced in DevPF1- and 202 \nDevPF2-KD. Thus, we confirmed co-silencing on both mRNA and protein levels with 203 \nreduced silencing efficiency compared to the targeted KD. Therefore, all results 204 \nobtained in KD experiments must be considered, at least in part, as a combined effect 205 \nof silencing both DevPF1 and DevPF2, albeit with only a partial contribution from the 206 \nnon-targeted gene silencing.  207 \n 208 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 9 \nTo further investigate the impact of co-silencing on the KD analysis we examined IES 209 \nretention score (IRS) correlations of multiple KD replicates (more details and further 210 \nanalysis in subsequent sections). The DevPF2-KD replicates showed high to moderate 211 \ncorrelation among each other while they correlated less well with two out of four 212 \nDevPF1-KD replicates (Fig. 4D). This suggests that despite the partial co-silencing, 213 \nindividual KD effects might be observed. 214 \n 215 \nDevPF1 and DevPF2 affect IES excision genome-wide 216 \nThe influence of the DevPFs on genome reorganization was initially investigated with 217 \nsurvival tests and IES retention PCRs upon KDs. Reduced protein levels during sexual 218 \ndevelopment can induce errors including IES retention, impacting the survival of the 219 \nsubsequent generation. For survival tests, the growth of the cells that completed their 220 \nsexual development was followed for several divisions. IES retention PCRs test for the 221 \npresence (failed excision) of specific IESs in the new MAC genome. ND7-KD and PGM-222 \nKD were used as negative and positive control, respectively. To investigate the 223 \npossibility that the observed effects result from off-target silencing of an unrelated gene, 224 \ntwo silencing probes (a and b) were tested for each paralog (Fig. 4A). DevPF1 and 225 \nDevPF2 KDs with either of the silencing probes resembled PGM-KD, with high lethality 226 \nin the new progeny (Fig. 5A) and retention of selected IESs (Fig. 5B). This indicates that 227 \nboth DevPF1 and DevPF2 contribute to IES excision. 228 \n 229 \nNext, we tested genome-wide IES retention in enriched new MAC DNA samples. We 230 \nobserved considerably elevated levels of retained IESs in both DevPF1- and DevPF2-231 \nKD (Fig. 5C,D). Notably, differences between replicates of the same KDs were 232 \nobserved, whereas replicate pairs processed in parallel (see Methods) exhibited similar 233 \nprofiles. Correlations among the paralog replicates indicated that despite varying IES 234 \nretention distributions, DevPF2-KD replicates demonstrated high correlations among 235 \nthemselves (Fig. 4D). DevPF1-KD replicates correlated less well with each other, and 236 \nDevPF1-KD replicate 3 (3) showed a high correlation with the DevPF2-KDs. This 237 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 10 \nindicates that DevPF2-KD replicates were more consistent than the DevPF1-KD 238 \nreplicates.  239 \n 240 \nGenes that work closely together are expected to show similar KD effects on IES 241 \nretention. To identify functionally related genes, DevPF1-KD and DevPF2-KD IRS data 242 \nwas correlated with published data from other gene KDs (Fig. 5E). DevPF2-KD (4) was 243 \nselected from the DevPF2 replicates. DevPF1-KD (2) and DevPF1-KD (4) were 244 \nselected as representative of the variability observed in the DevPF1-KDs. DevPF2-KD 245 \n(4) displayed high correlation with other KDs, such as TFIIS4 and DCL2/3/5 (Fig. 5E). 246 \nModerate correlation was observed for DevPF1-KD (4) with SPT5m, whereas DevPF1-247 \nKD (2) did not correlate well with any of the tested KDs. 248 \n 249 \nShort IESs are proposed to predominantly rely on the excision complex (specifically 250 \nPgm (Baudry et al., 2009) and Ku80c (Marmignon et al., 2014)) for removal, while long 251 \nIESs tend to require additional molecules for excision (Sellis et al., 2021). To determine 252 \nwhether DevPF1- and DevPF2-KD preferentially affect long IESs, the length distribution 253 \nof the top 10% of highly retained IESs in each KD was plotted (Fig. S4A,B, Table S1). In 254 \ncomparison to the length distribution of all IESs, DevPF2-KD (4) showed an 255 \noverrepresentation of long IESs, similar to observations in EZL1-KD, silencing of the 256 \ncatalytic subunit of the PCR2 complex (Frapporti et al., 2019; Lhuillier-Akakpo et al., 257 \n2014), or DCL2/3/5-KD, silencing of the scnRNA and iesRNA biogenesis proteins 258 \n(Lepère et al., 2009; Sandoval et al., 2014), (Fig. S4A). Conversely, the highly retained 259 \nIESs in DevPF1-KD (2) did not show the same overrepresentation and resembled the 260 \nprofile in PGM- and KU80c-KD, silencing of two members of the excision complex. 261 \nAgain, the replicates of the DevPF KDs exhibited variation in the extent of the observed 262 \neffect (Fig. S4B). 263 \n 264 \nDefects in IES excision not only result in the retention of IESs but can also lead to 265 \nexcision at alternative TA boundaries. So far, alternative excision above background 266 \nlevels has only been reported for silencing of ISWI1 and its complex partners (Singh et 267 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 11 \nal., 2022, 2023). Neither DevPF1-KD nor DevPF2-KD resulted in elevated levels of 268 \nalternative excision (Fig. S4; Table S2). 269 \n 270 \nDevPF1- and DevPF2-KD alter the small RNA population 271 \nThe early-produced 25 nt scnRNAs and the late-produced 26-30 nt iesRNAs have been 272 \nproposed to assist MIC-specific sequence targeting in the new MACs (Sandoval et al., 273 \n2014). Therefore, the small RNA populations across developmental time points upon 274 \nDevPF KDs were analyzed (Figs 6A, S6A). In DevPF1-KD (2), scnRNA production was 275 \ncompletely abolished, an effect also observed in the KD of genes proposed to be 276 \ninvolved in scnRNA production: the two scnRNA-processing genes DCL2 and DCL3 277 \n(Sandoval et al., 2014), and STP5m, involved in the generation of the transcripts serving 278 \nas substrates for Dcl2/3 cleavage (Gruchota et al., 2017). The KD of the late-expressed 279 \nDevPF2 showed a much weaker reduction of scnRNA production, which might be 280 \ncaused by co-silencing of DevPF1.  281 \n 282 \nTo further investigate DevPF1’s effect on the scnRNA pathway, we observed Ptiwi09-283 \nGFP localization upon DevPF1-KD. Ptiwi09, together with Ptiwi01, stabilizes the 284 \nscnRNAs throughout scnRNA selection in the parental MAC and targeting of MIC-285 \nspecific sequences in the new MACs (Bouhouche et al., 2011; Furrer et al., 2017). As 286 \npreviously described (Bouhouche et al., 2011; Singh et al., 2023), Ptiwi09-GFP localizes 287 \nfirst to the cytoplasm and parental MAC with a transient localization in the swelling MICs 288 \nbefore shifting to the new MAC (Fig. 6B). Upon DevPF1-KD (Fig. 6B), the localization to 289 \nthe MICs before meiosis I is not impaired; however, the translocation into the parental 290 \nMAC is strongly reduced and Ptiwi09-GFP predominantly remains in the cytoplasm 291 \nthroughout meiosis II and MAC fragmentation. We have reported a similar change in 292 \nPtiwi09-GFP localization upon DCL2/3-KD (Singh et al., 2023), suggesting that the loss 293 \nof scnRNAs is responsible for the failed protein transfer into the parental MAC. Similar 294 \nto DCL2/3-KD, DevPF1 depletion does not affect Ptiwi09-GFP’s localization to the new 295 \nMACs (Fig. 6B).  296 \n 297 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 12 \nInterestingly, DevPF1-HA IP at two developmental time points (early: about 30% 298 \nfragmentation; late: visible new MACs in fragmented cells) identified Ptiwi01/09 as 299 \npotential interaction partners of DevPF1 with a higher enrichment in the early than the 300 \nlate time point (Fig. S6B, Table S3). None of the other small RNA-related proteins were 301 \ndetected (Dcls, Spt5m, TFIIS4 or Ptiwi10/11).  302 \n 303 \nFor both DevPF1- and DevPF2-KD, iesRNA production was impaired. iesRNAs are 304 \nproposed to derive from dsRNAs transcribed from excised IESs (Allen et al., 2017; 305 \nSandoval et al., 2014). Hence, failed excision of IESs in DevPF1- or DevPF2-KD 306 \ncontributes to reduced iesRNA levels, as has consistently been observed for many 307 \nother KDs of genes involved in Paramecium genome editing (Charmant et al., 2023; de 308 \nVanssay et al., 2020; Ignarski et al., 2014; Maliszewska-Olejniczak et al., 2015; Singh et 309 \nal., 2022; Wang et al., 2023). The lack of scnRNAs in the DevPF1-KD cannot explain 310 \nthe absence of iesRNAs, as these accumulate even if the preceding scnRNA production 311 \nis blocked (Sandoval et al., 2014). In the late time point analyzed for DevPF IPs, 312 \npeptides mapping to Ptiwi10/11/06 were detected in DevPF2-IP (Fig. S6C, Table S3), 313 \nbut not DevPF1-IP (Fig. S6B). Therefore, DevPF2 might contribute to iesRNA 314 \nbiogenesis by an interaction with Ptiwi proteins. 315 \n 316 \nDevPF1- and DevPF2-KD affect mRNA expression 317 \nSince PHD fingers have often been reported to be involved in gene expression 318 \nregulation (Aasland et al., 1995; Sanchez & Zhou, 2011) we sought to investigate 319 \nwhether the DevPF KDs alter mRNA expression levels during development. Batch 320 \neffects had a major influence on the variance within the replicates (Fig. S7A), as 321 \nobserved for IES retention (Fig. 5C,D).  322 \n 323 \nDevPF1-KD showed almost no differentially expressed genes compared to ND7-KD 324 \nduring onset of development (Fig. 7A). During this early stage, genes are transcribed 325 \nsolely from the parental MAC, where DevPF1-GFP does not localize (Figs 2A, 3). 326 \nSurprisingly, in DevPF2-KD, a high number of genes were differentially expressed 327 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 13 \nduring the onset of development (Fig. 7A). Since DevPF2 is late-expressed and 328 \nDevPF1-KD showed no effect, the observed difference might be caused by differing cell 329 \nstages within the collected populations of DevPF2-KD and ND7-KD. During the “early”, 330 \n“late” and “very late” time points, DevPF1- and DevPF2-KD showed similar changes in 331 \nmRNA expression. 332 \n 333 \nThe abolishment of development-specific small RNAs in the DevPF-KDs might result 334 \nfrom downregulation of genes involved in scnRNA or iesRNA production. We observed 335 \nno general trend indicating a drastic reduction of expression of scnRNA-related genes, 336 \nlike DCL2, PTIWI01 or SPT5m (Figs 7B, S7B, Table S4, S5). However, these trends in 337 \nexpression should be considered with the caveat of considerable expression variability 338 \nand limitation of the number of replicates that could practically be obtained. At least for 339 \nPtiwi09, the localization experiments upon DevPF1-KD confirmed no loss in protein 340 \nlevels (Fig. 6B).  341 \n 342 \nThe expression of iesRNA-related genes was altered in both DevPF1- and DevPF2-KD 343 \ncompared to ND7-KD (Figs 7D, S7B, Table S4, S5). DCL5, the Dicer-like protein 344 \nresponsible for the initial cleavage of IES derived dsRNAs into small iesRNAs 345 \n(Sandoval et al., 2014), was downregulated (Table S4, S5) in early stages, but tended to 346 \nbe upregulated in the very late stage (Table S4, S5). PTIWI10 and PTIWI11, the Piwi 347 \nproteins responsible for further processing and stabilization of iesRNAs during the 348 \npositive feedback loop (Furrer et al., 2017), were downregulated in both DevPF1- and 349 \nDevPF2-KD (Table S4, S5). Successful expression of PTIWI10/11 has been proposed 350 \nto depend on IES excision since both genes are expressed from the new MAC and 351 \nharbor IESs in their flanking/coding regions (Furrer et al., 2017) (Fig. S7C). If IES 352 \nretention was the only cause for downregulation, one would expect higher IRSs for 353 \nthese IESs in KDs with lower mRNA levels. While the mRNA reduction is stronger in 354 \nDevPF1-KD than in DevPF2-KD (Fig. 7D, Table S4, S5), this trend is not reflected in the 355 \nIRSs of the IESs whose retention is proposed to interfere with PTIWI10/11 expression 356 \n(Table 1). In most of the KD replicates, there is no or low retention (IRS < 0.1) and the 357 \nreplicates showing moderate to high retention (0.1 < IRS < 0.3) belong to both DevPF1- 358 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 14 \nand DevPF2-KD. Hence, the reduced mRNA levels of PTIWI10/11 cannot only be 359 \nexplained by IES retention.  360 \n 361 \nDiscussion 362 \nImplications of the PHD domain for DevPF1 and DevPF2 functions  363 \nGenome reorganization is a fundamental process underlying cell and immune system 364 \ndevelopment and some diseases (Bassing et al., 2002; Forment et al., 2012; Mani & 365 \nChinnaiyan, 2010; Rooney et al., 2004). Ciliates undergo massive genome 366 \nreorganization during the maturation of their somatic genome. This makes them 367 \nexcellent models for studying the complex mechanisms involved in the targeted 368 \nelimination of genomic sequences (Beisson et al., 2010d). In the present study, we 369 \ndescribed two paralogous PHD finger proteins, DevPF1 and DevPF2, involved in IES 370 \nexcision in Paramecium. Both paralogs harbor a PHD and a PHD zinc finger-like 371 \ndomain (Fig. 1). These domains belong to the zinc-finger family and the PHD domain is 372 \ncharacterized by a well-conserved C4HC3 motif (Aasland et al., 1995; Schindler et al., 373 \n1993). The eight core amino acids of this motif coordinate two zinc ions and thereby 374 \nprovide structural stability to the domain (Pascual et al., 2000). Among other histone-375 \nbinding domains, such as bromodomains or PWWP domains, PHD fingers are the 376 \nsmallest (Fleck et al., 2021; Miller et al., 1985). Multiple sequence alignment and 377 \nstructure predictions confirmed the presence of the characteristic C4HC3 motif in both 378 \nDevPF1 and DevPF2 (Fig. 1), suggesting that both PHDs might be functional. 379 \n 380 \nPHD fingers, mainly nuclear proteins, are often considered epigenetic readers, 381 \nrecognizing histone modifications, primarily on the histone 3 (H3) N-terminal tail 382 \n(Sanchez & Zhou, 2011). Peptides matching to histones were enriched in the DevPF-383 \nIPs of late developmental time points (Fig. S6B,D, Table S3), however none of them 384 \nwas specific to H3. PHD fingers have been reported to bind non-H3 partners, like DNA, 385 \nhistone 4, or other proteins (Bienz, 2006; Black & Kutateladze, 2023; Gaurav & 386 \nKutateladze, 2023; L. Liu et al., 2012; Oppikofer et al., 2017). The combination of the 387 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 15 \nPHD and PHD-zinc-finger-like domain in the DevPFs may enable the paralogs to 388 \nsimultaneously recognize two adjacent histone modifications, as demonstrated for 389 \ntandem PHD domains (Zeng et al., 2010). PHD domains are also found in various 390 \nchromatin associated proteins involved in gene regulation. Notably, ISWI-containing 391 \nchromatin remodeling complexes often include a subunit with a PHD domain, such as 392 \nthe ACF (Eberharter et al., 2004), NURF (Haitao Li et al., 2006; Wysocka et al., 2006) or 393 \nWICH (Bozhenok et al., 2002) complexes.  394 \n 395 \nDevPF2 was initially identified in pulldowns of the ISWI1 protein, and, thus far, no PHD-396 \ncontaining protein has been shown to be a part of this remodeling complex (Singh et al., 397 \n2022, 2023). It is intriguing to consider that DevPF2 might contribute PHD functionality 398 \nto the ISWI1 chromatin remodeling complex. However, DevPF2-KD does not show 399 \nelevated levels of alternative excision (Fig. S4C-E) that are characteristic of other 400 \nmembers of the complex so far (Singh et al., 2022, 2023) and ISWI1 was not identified 401 \nas a potential interaction partner in the DevPF2-IP (Fig. S6C). If DevPF2 interacts with 402 \nthe ISWI1 complex, we infer that it may not be a core complex component, particularly 403 \nas it does not contribute to excision precision. 404 \n 405 \nA potential role for DevPF1 and DevPF2 as transcription factors?  406 \nA potential role in non-coding transcription in the MICs (for scnRNA production)  407 \nDevPF1’s localization in the MICs (Figs 2A, 3) and its importance for scnRNA 408 \nproduction (Fig. 6A) could point towards its involvement in the bidirectional transcription 409 \nof the MIC genome for scnRNA production. Spt5m (Gruchota et al., 2017) and TFIIS2/3 410 \n(Maliszewska-Olejniczak et al., 2015) are proposed to be involved in this micronuclear 411 \ntranscription. One of the DevPF1-KD replicates showed moderate IRS correlation with 412 \nSPT5m (Fig. 5E) (to our knowledge, no IRS data exists for TFIIS2 or TFIIS3) and 413 \nSPT5m-KD also reduces scnRNA production. The localization of Dcl2-GFP (Lepère et 414 \nal., 2009), Ptiwi09-GFP (Fig. 6B) and DevPF1-GFP (Fig. 2A) in the swelling MICs 415 \nsuggests that scnRNA biogenesis occurs during the S-phase of meiosis. Ptiwi09 and 416 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 16 \nDevPF1 may interact in the MICs or the cytoplasm. Non-crosslinked IP’s would be 417 \nneeded to further verify this interaction. However, PTIWI01/09-KD does not completely 418 \nabolish scnRNAs (Furrer et al., 2017), indicating that DevPF1 acts upstream of scnRNA 419 \nloading and guide strand removal. Future investigations of bi-directional transcription 420 \nand scnRNA biogenesis will allow to identify how all these molecules cooperate. 421 \n 422 \nSpt5m-GFP, TFIIS2/3-GFP and DevPF1-GFP are present in the MICs beyond S-phase 423 \nand localize to the new MACs at later stages (Gruchota et al., 2017; 424 \nMaliszewska-Olejniczak et al., 2015). Their role in the MIC during meiotic divisions 425 \nremains unknown. It was speculated that Spt5m might be involved in co-transcriptional 426 \ndeposition of epigenetic marks that sustain meiotic processes, ultimately aiding in IES 427 \ntargeting. The potential of PHD domains to bind histone modifications raises a similar 428 \npossibility for DevPF1. However, its role appears to be more specific, as DevPF1 is not 429 \npresent in all gametic and zygotic nuclei simultaneously (Fig. 2&3).  430 \n 431 \nMsh4/5, homologs of proteins essential for crossover, are also present in all gametic 432 \nnuclei during the first and second meiotic division, and their silencing leads to 433 \nsubstantial IES retention (Rzeszutek et al., 2022). However, their non-canonical 434 \nfunctions that lead to IES retention are not yet fully understood (Rzeszutek et al., 2022). 435 \nSince new MACs develop in DevPF1-KD (Figs 6B,S3) and MSH5-KD cells, neither of 436 \nthe genes are essential for crossover or karyogamy. More research will be needed in 437 \nfuture to decipher the functions of the DevPF proteins in the gametic nuclei. 438 \n  439 \nA potential role in non-coding transcription in the new MAC (for scnRNA-based 440 \ntargeting and iesRNA production) 441 \nNon-coding transcription in the new MAC, which is hypothized to generate substrates 442 \nfor scnRNA pairing, was proposed to be regulated by the putative transcription 443 \nelongation factor TFIIS4 that specifically localizes to the early new MACs 444 \n(Maliszewska-Olejniczak et al., 2015). DevPF2-KD IRSs of some replicates correlated 445 \nmost strongly with TFIIS4-KD (Fig. 5E), pointing towards a shared functionality. Both 446 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 17 \nDevPF1 and DevPF2 have the potential to act in the same regulatory process as TFIIS4 447 \nbecause both their GFP-fusions localize to the new MACs. In fact, there are reports of 448 \ntranscription factors that combine the TFIIS and PHD domains: Bypass of Ess1 (Bye1) 449 \nprotein in Saccharomyces cerevisiae harbors a PHD and a TFIIS-like domain, with the 450 \nformer recognizing histone 3 lysine 4 trimethylation and the latter establishing contact 451 \nwith polymerase II for transcriptional regulation (Kinkelin et al., 2013; Pinskaya et al., 452 \n2014). It is possible that similar functionality is separated on two individual proteins in 453 \nParamecium. However, TFIIS4 was not detected in either of the DevPF-IPs in the late 454 \ndevelopmental stage.  455 \n 456 \nThe production of iesRNAs was also proposed to depend on the non-coding 457 \ntranscription of concatenated excised IES fragments (Allen et al., 2017; Sandoval et al., 458 \n2014). Although it was established that IES concatemers are likely formed by DNA 459 \nligase 4 (Lig4) (Allen et al., 2017), little is known about the proposed bidirectional 460 \ntranscription to produce substrates for Dcl5 cleavage. Allen et al. speculated on the 461 \ninvolvement of TFIIS4. Since iesRNA production is almost completely abolished in 462 \nDevPF1- and DevPF2-KD, a contribution to this transcription is plausible.  463 \n 464 \nThe potential function of the DevPFs may extend far beyond TFIIS4-dependent 465 \ntranscription: whereas TFIIS4-GFP localizes transiently to early new MACs 466 \n(Maliszewska-Olejniczak et al., 2015), DevPF2-GFP and DevPF1-GFP remain in the 467 \nnew MACs for much longer (Fig. 2).  468 \n 469 \nA potential role in gene transcription in the parental and the new MAC  470 \nEarly in development, the parental MAC is solely responsible for gene expression and, 471 \nafter genome reorganization progresses, the new MAC contributes at later stages 472 \n(Berger, 1973). In Tetrahymena, E2F family transcription factors were shown to control 473 \nthe cell cycle through gene expression during meiosis (Zhang et al., 2018). DevPF1 and 474 \nDevPF2 are unlikely to be active in the parental MAC since none of the GFP-fusion 475 \nproteins localized there (Fig. 2). Consistently, DevPF1-KD showed no differential gene 476 \nexpression compared to ND7-KD during the onset of development (Fig. 7C) and 477 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 18 \nPtiwi09-GFP expression was not impaired upon DevPF1-KD (Fig. 6B). However, it is 478 \ndifficult to reach a definite conclusion for other genes due to the high variability in 479 \nexpression between the replicates (Figs 7D, S7B) and the high number of differentially 480 \nexpressed genes in DevPF2-KD (Fig. 7C) observed during the onset of development. 481 \nCells in the “onset” time point are challenging to collect because cell staging relies on 482 \nMAC morphology changes visualized by DAPI staining. Truly vegetative cells cannot be 483 \ndistinguished from cells initiating meiosis since their MACs look the same; however, the 484 \ngene expression profiles are expected to differ substantially (Figs 2A, S2B). The 485 \ncollection of subsequent time points is more reliable because the alteration of old MAC   486 \nshape as development progresses is pronounced.  487 \n 488 \nAt the subsequent stages, DevPF1- and DevPF2-KD affected similar genes. Either, the 489 \nchanges are nonspecific to the DevPF-KDs and result from the proposed nuclear 490 \ncrosstalk to adjust transcription levels to accommodate for failed IES excision 491 \n(Bazin-Gélis et al., 2023) or they are specific to the DevPF-KDs and both paralogs 492 \nexhibit similar functions in the regulation of gene expression. Interestingly, differential 493 \nexpression was observed at the “early” time point (Fig. 7C). GTSF1-KD, also causing 494 \nsubstantial IES retention, hardly shows any differentially expressed genes at a 495 \ncomparable stage (DevPF1/2-KD: 282/231 differentially expressed genes, respectively, 496 \nat about 30% fragmentation (Fig. 7C); GTSF1-KD: 10 differentially expressed genes at 497 \nabout 30-50% fragmentation; (Wang et al., 2023)). This indicates that the early change 498 \nin gene expression might be specific to DevPF-KDs, potentially mediated by other 499 \nproteins shuttling into the parental MAC. Since Ptiwi09-GFP translocates efficiently to 500 \nthe parental MAC upon GTSF1-KD (Wang et al., 2023) but not upon DevPF1-KD (Fig. 501 \n6B), it might be worth investigating differential expression upon PTIWI01/09-KD. 502 \n 503 \nLate in development, gene expression starts from the new MACs (Berger, 1973), where 504 \nboth DevPF paralogs localized (Fig. 2). Some late-expressed genes, like PTIWI10, are 505 \nexpressed only from the new MAC after the initial onset of IES excision (Furrer et al., 506 \n2017). Indeed, PTIWI10/11 mRNA levels are downregulated in DevPF1-KD or DevPF2-507 \nKD (Fig. 7D, S7B, Table S4, S5). This trend cannot be explained solely by the strength 508 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 19 \nof retention observed for the IESs interfering with PTIWI10/11 expression (Table 1). It 509 \nsuggests that DevPF1 and DevPF2 may regulate gene expression in the new MAC, 510 \nalbeit specifically for some genes like PTIWI10 and PTIWI11. The extent of gene 511 \nexpression regulation by the DevPFs beyond these genes remains uncertain. To further 512 \ninvestigate if the DevPFs serve as transcription factors, and if so, which genes they 513 \nregulate, genes associated with DevPF binding could be identified by techniques like 514 \nCut-and-Run (Skene et al., 2018) and compared to mRNA expression changes upon 515 \nDevPF-KDs.  516 \n 517 \nPotential cytoplasmic functions 518 \nIn contrast to the other putative transcription factors discussed so far (Spt5m, 519 \nTFIIS2/3/4, DevPF2), DevPF1-GFP exhibits a pronounced cytoplasmic distribution in 520 \nthe early stages of development (Fig. 2A). While most described PHD fingers are 521 \nnuclear proteins, some can be recruited to the cytoplasm or plasma membrane by 522 \nbinding partners (Betz et al., 2004; Gozani et al., 2003). DevPF1 may play a role in 523 \ntransmitting signals of sensed starvation to the MICs, initiating sexual development. As 524 \nDevPF1 is not constitutively expressed during vegetative growth (Figs 1B, S2B), 525 \nanother factor is needed to first initiate DevPF1’s gene expression in the parental MAC. 526 \nHowever, DevPF1 might interact with specific markers of starvation in the cytosol, 527 \npromoting early sexual processes. If that is the case, DevPF1 is not essential for 528 \ngeneral meiotic processes, as meiosis and new MACs development show no defects in 529 \nDevPF1-depleted cells (Figs 6B,S3). Since peptides matching Ptiwi01/09 were identified 530 \nin the DevPF1-IP, the Ptiwi01/09 complex is a potential binding partner of DevPF1 in 531 \nthe cytoplasm. However, since Ptiwi01/09 are highly expressed proteins (Bouhouche et 532 \nal., 2011), further IP experiments would be needed to verify this interaction.  533 \n 534 \nDevPF1’s selective localization to gametic and post -zygotic nuclei 535 \nThe selective localization of DevPF1 to certain gametic and post-zygotic nuclei (Fig. 3) 536 \nraises intriguing questions about its potential role in nuclear fate decisions. The survival 537 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 20 \nand destruction of the gametic nuclei depends on their subcellular positioning 538 \n(Grandchamp & Beisson, 1981). DevPF1 may play a role in either promoting their 539 \nmovement or preparing for their degradation. However, the observed number of nuclei 540 \nsimultaneously containing DevPF1-GFP (zero to four) neither fits the number of nuclei 541 \nselected for survival (one) nor for degradation (seven). DevPF1 may either contribute to 542 \nthis process successively or may not be directly related to the nuclear fate itself. The 543 \nfate of the post-zygotic nuclei is decided during the second mitotic division by the 544 \nsubcellular localization of the division products (Grandchamp & Beisson, 1981). This 545 \nmeans, from each post-zygotic nucleus, one of the division products will remain as MIC 546 \nand one develops into a new MAC. During the second mitotic division, DevPF1-GFP 547 \nwas observed in one of the two dividing nuclei. Its localization in the precursor of one 548 \nMIC and one MAC without being present in the precursor of the other MIC and MAC, 549 \ndoes not imply its involvement in the nuclear fate decision. Furthermore, DevPF1-KD 550 \nneither impaired the selection of gametic nuclei nor the differentiation of the new MACs.  551 \n 552 \nThe specific localization of nuclear proteins to certain nuclei in multinuclear cells has 553 \nbeen studied extensively in insect embryos. In Drosophila, the transcription factors 554 \nBicoid (Driever & Nüsslein-Volhard, 1988) and Dorsal (Roth et al., 1989) establish the 555 \nanterior-posterior, and dorsal-ventral axis, respectively, by initiating gene expression 556 \ndepending on the cytoplasmic localization of the nuclei. The activity of the transcription 557 \nfactors is restricted by gradients to a certain cytoplasmic region (Morisato & Anderson, 558 \n1995; Spirov et al., 2009). However, DevPF1-GFP’s nuclear localization does not 559 \nappear associated with subcellular localization of the nuclei and it remains unclear how 560 \nDevPF1-GFP is specifically recruited.  561 \n 562 \nAs only fixed cells were examined, the dynamics of DevPF1-GFP localization were not 563 \ncaptured. The fact that DevPF1-GFP localization is independent of nuclear divisions 564 \n(Fig. 3B), combined with observations of cells at the meiotic or mitotic division stage 565 \nwith an absence of DevPF1-GFP in all nuclei (Fig. S2C), suggests that DevPF1 566 \nlocalization might be asynchronous and transient. Possibly it is recruited to each of the 567 \ngametic nuclei at some point before the completion of the second meiotic division and to 568 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 21 \neach of the post-zygotic nuclei before completion of the second mitotic divisions. Live 569 \ncell imaging could illuminate the dynamics of DevPF1 localization and its correlation 570 \nwith nuclear fate. However, this approach presents challenges, as it requires confocal 571 \nimaging to capture the DevPF1-GFP signal in the MICs, and the observation time scale 572 \nwould need to span across multiple hours of Paramecium development. 573 \n 574 \nDevPF1: a general factor for IES excision 575 \nDevPF1 plays a role throughout sexual development: from the early stages before 576 \nmeiosis to the very late stages (Fig. 2A). It appears to influence various aspects of 577 \ngenome reorganization in the MICs and the new MACs, including scnRNA production 578 \nand potentially expression of certain genes. Consequently, the depletion of DevPF1 579 \naffects the excision of a wide range of IESs (Fig. 5C). However, it is important to 580 \nreiterate that we observed high batch-to-batch variability in the DevPF replicates in both 581 \nIES retention (Fig. 5C, D) and mRNA expression (Figs 7D, S7B). The time point 582 \ncollection had a major influence on mRNA levels (Fig. S7A). Variable new MAC 583 \nenrichment by a sucrose gradient might introduce variation into the IRS analysis, as 584 \nfragments of the parental MAC add unexcised IES sequences, diluting the effect of IES 585 \nretention (Charmant et al., 2023). Fluorescence-activated nuclear sorting (FANS) 586 \nenables better nuclear separation in Paramecium (Charmant et al., 2023; Guérin et al., 587 \n2017) and should be able to eliminate most of such variation. Additionally, 588 \nmicroinjection of DNA into macronuclei before RNAi experiments can be used to control 589 \nfor contaminating DNA from old MAC fragments.  590 \n 591 \nRevisiting previous KD experiments with additional replicates would be worthwhile to 592 \nexplore the extent of batch-to-batch IRS and expression variance for other KDs. 593 \nNoteworthy, variability in IES retention across replicates has recently been shown for 594 \nGTSF1 (Charmant et al., 2023; Wang et al., 2023), suggesting this phenomenon is not 595 \nrestricted to DevPF1 and DevPF2. In general, KD experiments are challenging to tightly 596 \ncontrol for reproducibility, and more effort should be invested in generating knockouts in 597 \nParamecium, as established in Tetrahymena (Chalker, 2012). 598 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 22 \nIt has been shown that evolutionarily old IESs tend to be short and are excised early in 599 \ndevelopment, independent of additional factors apart from the excision machinery 600 \n(Sellis et al., 2021). On the other hand, evolutionarily young IESs tend to be long, later 601 \nexcised and dependent on the scnRNA pathway and the deposition of histone 602 \nmodifications in the new MAC for their excision (Sellis et al., 2021; Swart et al., 2014; 603 \nZangarelli et al., 2022). In line with this, most gene KDs tested in this study exhibited an 604 \noverrepresentation of long IESs among their most highly retained IESs, including 605 \nDevPF2 (Fig. S4A,B). Only PGM-KD, KU80c-KD and two of the DevPF1-KD replicates 606 \nshowed no preference for long IESs. Pgm and Ku80c are components of the excision 607 \nmachinery and are therefore expected to affect all IESs. While DevPF1 may not be a 608 \ndirect part of the excision machinery, it appears to have a general contribution to IES 609 \nexcision, regardless of the length of the IES. Consequently, we propose that DevPF2 610 \ncontributes to the excision of long IESs, while DevPF1 may serve as a more general 611 \nfactor.  612 \n 613 \nMethods 614 \nParamecium tetraurelia cultivation  615 \nMating type 7 (MT7) cells from strain 51 of Paramecium tetraurelia were grown in 616 \nWheat Grass Powder (WGP, Pines International) medium supplemented with 10 mM 617 \nsodium phosphate buffer (pH 7.3). WGP medium was bacterized with E.coli strain 618 \nHT115 to feed paramecia, and the cultures were maintained either at 27°C or at 18°C 619 \naccording to the standard protocol (Beisson et al., 2010b, 2010c).  620 \n 621 \nProtein localization imaging by fluorescence microscopy  622 \nPlasmids for microinjection were generated by amplifying the coding and flanking 623 \nsequences from MT7 genomic DNA and introducing them with the PCR-based method 624 \nCPEC (Quan & Tian, 2011) into the L4440 plasmid (Addgene, USA). DevPF1 was 625 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 23 \nexpressed with its endogenous flanking regions (304 bp upstream of the DevPF1 start 626 \ncodon and 272 bp downstream of the DevPF1 stop codon). DevPF2 endogenous 627 \nflanking regions (455 bp upstream the DevPF2 start codon and 273 bp downstream of 628 \nthe DevPF2 stop codon) yielded no expression. Therefore, as PGM exhibits a similar 629 \nexpression profile to DevPF2 (Fig. 1B), DevPF2 genomic coding sequence was inserted 630 \nbetween the PGM flanking regions (96 bp upstream of the PGM start codon and 54 bp 631 \ndownstream of the PGM stop codon). Before the stop codon, the GFP coding sequence 632 \nwas connected to the protein coding sequences via a glycine-serine-linker 633 \n(SSGGGSGGSGGGS). 60 μg of plasmid DNA was linearized with AhdI (New England 634 \nBiolabs, UK) and extracted with phenol-chloroform for injection.  635 \n 636 \nParamecia were microinjected with either C-terminally GFP-tagged DevPF1 637 \n(endogenous regulatory regions) or C-terminally GFP-tagged DevPF2 (PGM regulatory 638 \nregions) following the standard protocol (Beisson et al., 2010a). Sexual development 639 \nwas induced by starvation and cells of different developmental stages were collected 640 \nand stored in 70% ethanol at -20°C. To stain cells with DAPI (4,6-diamidino-2-2-641 \nphenylindole), cells were dried on a microscopy slide, washed twice with phosphate-642 \nbuffered saline (PBS) and permeabilized for 10 min at RT (room temperature) with 1% 643 \nTriton X-100 in PHEM (PIPES, HEPES, EGTA, magnesium sulfate), fixed with 2% 644 \nparaformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA 645 \n(bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM 646 \nEGTA and 2 mM MgCl2 (TBSTEM). After DAPI (2 μg/ml in 3% BSA) incubation for 7-10 647 \nmin at RT, the cells were mounted 40 µl of ProLong Gold Antifade mounting medium 648 \n(Invitrogen, USA) or ProLong Glass Antifade mounting medium (Invitrogen, USA). For 649 \nα-tubulin staining, after permeabilization and fixation, cells were blocked for 1 h at RT 650 \nwith 3% BSA and 0.1% Triton X-100. Primary rat anti-α-tubulin antibody (Abcam, UK) 651 \nwas diluted 1:200 in 3% BSA and 0.1% Triton X-100 in TBSTEM and incubated 652 \novernight at 4°C. After 3 washes with 3% BSA, the goat anti-rat secondary antibody 653 \nconjugated to Alexa fluorophore 568 (Abcam, UK) was diluted 1:500 in 3% BSA and 654 \n0.1% Triton X-100 in TBSTEM and incubated for 1 h at RT. After two washes, cells 655 \nwere stained with DAPI and mounted with Prolong Glass Antifade mounting medium.  656 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 24 \nImages were acquired on a confocal SP8 Leica fluorescence microscope (60x/1.4 oil 657 \nobjective) with constant laser settings. The detector (photon multiplier) gain for the DAPI 658 \nsignal (430-470 nm) varied to accommodate differences in signal strength (500-550 V). 659 \nPostprocessing was done in Fiji (version 2.14.0/1.54f) (Schindelin et al., 2012). 660 \nBrightness and contrast in the GFP channel was set the same in all the images to be 661 \ncompared (Figs 2, S2B: DevPF1-GFP: Min 0, Max 681 and DevPF2-GFP: Min 0, Max 662 \n170; Figs 3, S2C: DevPF1-GFP: Min 0, Max 703; Fig. S3: constant settings for each cell 663 \nstage). 664 \n 665 \nKnockdown efficiency validation using fluorescence intensity  666 \nCells injected with either DevPF2-GFP or DevPF1-GFP were subjected to KDs of ND7, 667 \nPGM, DevPF2 and DevPF1 genes. Cells during new MAC development were collected 668 \n(for details see methods on silencing experiments), then stained with DAPI and 669 \nmounted on ProLong Glass Antifade as described above. Images of a single z-plane 670 \nthrough the new MAC were acquired on a SP8 Leica Confocal microscope with 60x/1.4 671 \noil objective using the same laser settings for all images. For each KD, 10 cells were 672 \nimaged. In Fiji software (version 2.14.0/1.54f), the brightness and contrast in the GFP 673 \nchannel was set the same values for all images compared in the same analysis 674 \n(DevPF1-GFP injected cells: Min 0, Max 1078; DevPF2-GFP injected cells: Min 0, Max 675 \n298). Fluorescent signal was measured in a constant area in 1 MAC of each cell and 676 \nthe area mean was used as intensity for this nucleus. The area was set in the DAPI 677 \nchannel and the fluorescence was measured in the GFP channel. Since the same area 678 \nwas measured for each nucleus, no normalization was used to account for nuclear size 679 \nvariation. To account for background fluorescence, GFP fluorescence in non-680 \ntransformed wild type cells was measured and the mean of all wild type cells was 681 \nsubtracted from all measured intensities. All intensities were normalized to the mean of 682 \nall ND7-KD cells in the corresponding injection. All scripts are available from 683 \nhttps://github.com/Swart-lab/DevPF_code. 684 \n 685 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 25 \nCo-immunoprecipitation 686 \nParamecia were injected with either Human influenza hemagglutinin (HA)-tagged 687 \nDevPF1 (same cloning strategy as described before) or GFP-tagged DevPF2. For 688 \nDevPF1-HA, an early time point (about 30% fragmentation) and late time point (new 689 \nMACs clearly visible in fragmented cells) was collected, while for DevPF2-GFP, only the 690 \nlate time point was collected. Non-transformed wild type cells were collected as 691 \ncontrols. Cells were washed twice with 10 mM Tris and as much liquid was removed as 692 \npossible. For 300 ml initial culture volume, cells were fixed with 1 ml 1% PFA for 10 min 693 \nat RT and quenched with 100 µl of 1.25 M glycine for 5 min at RT. After one wash with 694 \nPBS (centrifugation for 1 min at 4°C and 1000 g), 2 ml lysis buffer (50 mM Tris, 150 mM 695 \nNaCl, 5 mM MgCl2, 1% Triton X-100, 10% Glycerol and cOmplete protease inhibitor 696 \nEDTA-free (Roche, Germany)) were added and cells were sonicated using an MS72 tip 697 \non a Bandelin Sonopulse device with 52% amplitude for 15 s on ice. The pellet and 698 \ninput fraction were separated by centrifugation (13,000 g, 4°C, 30 min).  699 \n 700 \nTo enrich HA-tagged proteins, 50 µl beads (Anti-HA-affinity matrix, Merck-Sigma, 701 \nGermany) were washed thrice (500 g, 4°C, 2 min) in ice-cold IP buffer (10 mM Tris pH 702 \n8, 150 mM NaCl, 1 mM MgCl2, 0.01% NP-40, 5% Glycerol, cOmplete protease inhibitor 703 \nEDTA-free (Roche, Germany) and incubated with 1 ml of cleared input lysate overnight 704 \nat 4°C. After four washes with ice-cold IP buffer, the bound proteins were eluted from 705 \nthe beads in 50 µl 2× PLB (10% SDS, 0.25 M Tris pH 6.8, 50% Glycerol, 0.2 M DTT, 706 \n0.25% Bromophenol blue) at 98°C for 20 min (IP fraction). 707 \n 708 \nTo enrich GFP-tagged proteins, 25 µl beads (GFP-Trap Agarose beads, Chromotek, 709 \nGermany) were washed once with ice-cold 20 mM Tris pH 7.5 with 100mM NaCl (2,500 710 \ng, 4°C, 5 min) and thrice in ice-cold IP buffer. Beads were incubated with 1 ml cleared 711 \ninput lysate for 1 to 2 h at 4°C and washed four times with ice-cold IP buffer. Bound 712 \nproteins were eluted in 30 µl 2× PLB at 98°C for 20 min (IP fraction).  713 \n 714 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 26 \nFor western blots, 0.5% of total input and 15% of total IP fraction were resolved on 10% 715 \nSDS-PAGE gels and wet transferred onto a 0.45 µm nitrocellulose membrane for 2 h at 716 \n80 V and 4°C (Bio-Rad, Germany). The membrane was blocked for 1 h in 5% BSA in 717 \nPBST (PBS + 0.2% Tween20). HA-tagged proteins were detected with an HRP-718 \nconjugated anti-HA antibody (sc-7392 HRP, Santa Cruz, USA) diluted 1:500 in PBST 719 \nand incubated overnight at 4°C. GFP-tagged proteins were detected with an primary 720 \nanti-GFP antibody (ab290, Abcam, UK) diluted 1:2000 and incubated overnight at 4°C 721 \nfollowed by an secondary anti-rabbit HRP conjugated antibody (12-348, Merck Millipore, 722 \nGermany) diluted 1:5000 in PBST and incubated for 1 h at RT. Membranes were 723 \nscreened using AI600 (GE Healthcare, Germany).  724 \n 725 \nSamples were sent to EMBL’s Proteomics Core Facility in Germany for mass 726 \nspectrometry experiments and analysis. Using R, contaminants were removed from the 727 \nFragPipe output files (protein.tsv, (Kong et al., 2017)), and only proteins quantified with 728 \na minimum of two razor peptides were included for subsequent analysis. After log2 729 \ntransformation of raw TMT reporter ion intensities, batch effect correction (limma 730 \npackage’s (Ritchie et al., 2015) ‘removeBatchEffects’ function), and variance 731 \nstabilization normalization (vsn) with vsn package (Huber et al., 2002), the abundance 732 \ndifference in WT and DevPF samples was maintained by determining different 733 \nnormalization coefficients. To investigate differential protein expression (limma 734 \npackage), replicate information was incorporated in the design matrix with the ‘lmFit’ 735 \nlimma function. “hit” annotation: false discovery rate (FDR) smaller 5% and a fold 736 \nchange of at least 100%. “candidate” annotation: FDR smaller 20% and a fold change of 737 \nat least 50%. Scripts to generate volcano plots are available from 738 \nhttps://github.com/Swart-lab/DevPF_code. 739 \n 740 \nSilencing experiments, survival test and IES retention PCR  741 \nSilencing constructs for DevPF2 and DevPF1 were generated by cloning genomic gene 742 \nfragments into a T444T plasmid (Sturm et al., 2018) (Addgene, USA) using CPEC 743 \n(Quan & Tian, 2011). For both DevPF1 and DevPF2, two silencing regions were 744 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 27 \nselected: DevPF1 silencing region a (525 bp fragment from 3-527; position 1 is the first 745 \nnucleotide of the start codon); DevPF1 silencing region b (733 bp fragment from 532-746 \n1264); DevPF2 silencing region a (525 bp fragment from 3-527); DevPF2 silencing 747 \nregion b (731 bp fragment from 532-1262). Co-silencing was predicted with the RNAi 748 \noff-target tool from ParameciumDB (Heng Li & Durbin, 2009) for both silencing regions 749 \n(DevPF1 silencing region a and b: 19 and 30 hits, respectively, in DevPF2 gene; 750 \nDevPF2 silencing region a and b: 19 and 30 hits, respectively, in DevPF1 gene). The 751 \nplasmids were transformed into HT1115 (DE3) E. coli strain and expression was 752 \ninduced overnight at 30°C with Isopropyl ß-D-1-thiogalactopyranoside (IPTG; Carl Roth, 753 \nGermany). Paramecia were seeded into the silencing medium at a density of 100 754 \ncells/ml to induce sexual development by starvation after 4 to 6 divisions. KD 755 \nexperiments were performed as previously described (Beisson et al., 2010e).  756 \n 757 \nAfter the paramecia finished sexual development, 15 cells were transferred into a 758 \nregular, non-induced, feeding medium for the survival test. Paramecia were monitored 759 \nfor three days to observe growth effects. For IES retention PCRs, genomic DNA was 760 \nextracted from cultures that finished sexual development using GeneElute – Mammalian 761 \nGenomic DNA Miniprep Kit (Merck-Sigma, Germany). PCRs were done on specific 762 \ngenomic regions flanking an IES (Table S6) to check for the retention of IESs. 1-12.5 ng 763 \nDNA was used as input andPCR products were resolved on 1-2% agarose gels. 764 \n 765 \nTime course silencing experiments 766 \nThe time course experiments were conducted in three batches, each processing two KD 767 \nreplicates in parallel (batch A: replicates 1 and 2 of ND7-, DevPF1- and DevPF2-KD; 768 \nbatch B: replicates 3 and 4 of ND7-, DevPF1- and DevPF2-KD; batch C: replicates 5 769 \nand 6 of ND7- and DevPF2-KD). In batch A and B, cells were collected as soon as the 770 \nfirst meiotic cells were observed in the population (onset), between 20 to 40% 771 \nfragmentation (early), at 80-90% fragmentation (late) and 6 h after the late time point 772 \n(very late). In batch C, cells were collected before the onset of autogamy (vegetative), at 773 \n50% fragmentation (early), at 100% fragmentation + visible anlagen (very late) and 6 h 774 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 28 \nlater (very late + 6h). Since batch C was collected at different stages, only the “very late” 775 \ntime point of batch C was considered for differential expression analysis. For all time 776 \ncourse replicates, enriched new MAC DNA was analyzed for IES retention and total 777 \nRNA was collected from the collected time points for sRNA and/or mRNA analysis. 778 \n 779 \nMacronuclear isolation and Illumina DNA-sequencing 780 \nSamples for new MAC isolation were collected from the KD cultures of all time course 781 \nexperiments three days after completion of sexual development as described previously 782 \n(Arnaiz et al., 2012). DNA library preparation (350 bp fragment sizes) and Illumina 783 \nsequencing (paired-end, 150 bp reads) were done at Novogene (UK) Company Limited, 784 \nCambridge according to their standard protocols.  785 \n 786 \nIES retention and alternative boundary analysis 787 \nFor IES retention score analysis, whole genome sequencing reads of enriched new 788 \nMAC DNA after KD were adaptor trimmed using TrimGalore (Krueger, 2019) if 789 \nsignificant Illumina adapter content was observed using FastQC v0.11.9 (Andrews, 790 \n2010) (see Table S7 for adapter sequences). The “Map” module of ParTIES v1.05 791 \npipeline was used to map the reads on MAC and MAC+IES reference genomes with 792 \nchanges in the /lib/PARTIES/Map.pm file as described in (Singh et al., 2023). The IES 793 \nretention scores (IRS) were calculated by the “MIRET” module (provided as 794 \nDevPF_IRS.tab.gz). All scripts are available from https://github.com/Swart-795 \nlab/DevPF_code. IRS correlations were calculated as described previously (Swart et al., 796 \n2014).  797 \n 798 \nAlternative excision was analyzed as described previously (Singh et al., 2023). In brief, 799 \nproperly paired and mapped reads were selected from the output from the ParTIES 800 \n\"Map\" module for the MAC+IES reference genome and downsampled to the same 801 \nlibrary size (DevPF1-KD (1) and DevPF2-KD (2) were excluded due to small library 802 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 29 \nsize). We then employed the \"MILORD\" module of a pre-release version of ParTIES (13 803 \nAugust 2015) with default parameters to annotate alternative and cryptic IES excision. 804 \nAll scripts are available from https://github.com/Swart-lab/DevPF_code.  805 \n 806 \nThe data generate in this study was compared with data of previously published KDs: 807 \nPGM-KD (Arnaiz et al., 2012), TFIIS4-KD (Maliszewska-Olejniczak et al., 2015), 808 \nSPT5m-KD (Gruchota et al., 2017), PTCAF1-KD (Ignarski et al., 2014), DCL2/3/5-KD 809 \n(Sandoval et al., 2014), KU80c-KD (Abello et al., 2020), EZL1-KD (Lhuillier-Akakpo et 810 \nal., 2014) and ISWI1-KD (Singh et al., 2022). 811 \n 812 \nRNA extraction and sequencing 813 \nTotal RNA was either extracted with phenol-chloroform followed by Monarch Total RNA 814 \nMiniprep kit (New England Biolabs) or with the Quick-RNA Miniprep kit (Zymo). For 815 \nphenol-chloroform extraction (batch C), 300 ml cells subjected to RNAi were washed 816 \ntwice with 10 mM Tris pH 7.5 (RT, 280 g, 2 min) and shock frozen by dropping them 817 \ndirectly into liquid nitrogen. 500 μl of 2× DNA/RNA protection reagent from the Monarch 818 \nkit were added to the frozen pellet and the cells thawed by vortexing. After adding 10 μl 819 \nproteinase K and 1 ml RNA lysis buffer, the manufacturer's instructions (RNA Binding 820 \nand Elution (Cultured Mammalian Cells)) were followed. On-column DNase I treatment 821 \nwas included.  822 \n 823 \nFor RNA extraction with Quick-RNA Miniprep kit (batch A and B), 100 ml of 824 \nParamecium cultures subjected to RNAi by feeding were washed twice in 10 mM Tris 825 \npH 7.5 in pear-shaped oil flasks by centrifugation (RT, 280 g, 2 min). After the final 826 \nwash, cells were collected on ice and spun at 2,000 g for 2 min and 4°C and as much 827 \nliquid as possible was removed. 3× volume of 1× DNA/RNA Shield (Biozym) was mixed 828 \nwith the cells and the samples were stored at -70°C until further processing. For RNA 829 \nextraction, samples were thawed at RT and mixed with 1× volume of RNA lysis buffer. 830 \nThe manufacturer’s instructions were followed (section: (III) Total RNA Purification). 831 \n 832 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 30 \nExtracted total RNA was send to Azenta Life Sciences for library preparation (sRNA: 833 \nNEBNext Small RNA Library Prep Set for Illumina; mRNA: NEBNext Ultra II RNA 834 \nLibrary Prep Kit for Illumina) and paired-end Illumina sequencing (NovaSeq 2×150bp).  835 \n 836 \nSmall RNA analysis 837 \nSmall RNA sequencing reads were trimmed using cutadapt (Martin, 2011) version 3.2 838 \nwith the parameter -a “AGATCGGAAGAGCACACGTCTGAACTCCAGTCA” to remove 839 \nthe relevant Illumina adaptor sequence. Trimmed reads were mapped to the 840 \nParamecium tetraurelia strain 51 MAC + IES genome and L4440 (ND7-KD) or T444T 841 \n(DevPF1/DevPF2-KD) silencing vector with bwa version 0.7.17-r1188 (Heng Li & 842 \nDurbin, 2009). GNU grep (version 2.14) was used to select 10-49 bp long, uniquely 843 \nmapped reads (possessing the SAM file format flags “XT:A:U”) and sRNA length 844 \nhistograms were generated by a Python script. All scripts are available from 845 \nhttps://github.com/Swart-lab/DevPF_code. 846 \n 847 \nmRNA analysis  848 \nIllumina adapter sequences (Table S7) were trimmed from reads with TrimGalore 849 \n(Krueger, 2019). Reads were mapped to the Paramecium tetraurelia strain 51 850 \ntranscriptome with hisat2 (Kim et al., 2019) allowing 20 multimappings (-k 20). Using 851 \nsamtools (Heng Li et al., 2009), the properly paired and mapped reads were filtered (-f2 852 \nflag) and sorted by the read name (-n flag). Unique mapping reads were acquired with 853 \neXpress (Roberts & Pachter, 2013) with 5 additional online expectation-maximization 854 \nrounds to perform on the data after the initial online round (-O 5 flag) to improve 855 \naccuracy. Scripts are available from https://github.com/Swart-lab/DevPF_code.  856 \n 857 \nRead counts were normalized with DEseq2 (Love et al., 2014) package in R (version 858 \n3.6.3). For plotting, DEseq2 in-build functions plotPCA, plotMA and plotCounts were 859 \ncombined with ggplot2 (Villanueva & Chen, 2019) package (version 3.4.3). Differentially 860 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 31 \nexpressed genes were identified for each time point with a Wald test (false discovery 861 \nrate (alpha) = 0.1). Differentially expressed genes were filtered with an absolute 862 \nlog2(Fold Change) > 2 (corresponding to a 4-fold change) and an adjusted p-value < 863 \n0.01. The time point, KD and batch were known sources of variation in the dataset 864 \n(design = ~ batch + timepoint + KD+ timepoint:KD). All scripts are available from 865 \nhttps://github.com/Swart-lab/DevPF_code.  866 \n 867 \nStructure prediction with AlphaFold 868 \nProtein structures were predicted with AlphaFold2 multimer (Evans et al., 2021; Jumper 869 \net al., 2021) using the ColabFold v1.5.2-patch (Mirdita et al., 2022) in Google Colab with 870 \ndefault parameters. 871 \n 872 \nSequence alignment 873 \nDomains were predicted using InterProScan (Paysan-Lafosse et al., 2023). The 874 \nnucleotide sequence of DevPF2 and DevPF1 (including introns) were aligned with 875 \nclustalOmega (Sievers et al., 2011) (version 1.2.3) pairwise sequence alignment tool in 876 \nGeneious prime (version 2023.2.1) with default parameters (Fig 4A). 877 \n 878 \nMultiple sequence alignment of PHD domains was done with clustalOmega (version 879 \n1.2.1) using the MPI bioinformatics toolkit’s web interface (Zimmermann et al., 2018) 880 \nwith default parameters. 881 \n 882 \nManuscript writing 883 \nGrammar and language refinement were assisted by an AI language model developed 884 \nby OpenAI (GPT-3.5 architecture) (OpenAI, 2023). 885 \n 886 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 32 \nAcknowledgements 887 \nWe thank the BioOptics core facility and Genome center of MPI for Biology (Tübingen, 888 \nGermany) for their assistance and Andre Noll for computer system administration. 889 \n 890 \nCompeting interests 891 \nThe authors declare no competing interests. 892 \n 893 \nFunding 894 \nThis work was funded by the Max Planck Society.  895 \n 896 \nData availability 897 \nSupplementary files, including uncropped blot images, microcopy raw files and IES 898 \nretention scores have been deposited to the open research data repository of the Max 899 \nPlanck Society EDMOND (https://doi.org/10.17617/3.VKJBJ0). Sequencing raw files 900 \nhave been deposited to the European Nucleotide Archive (ENA; 901 \nhttps://www.ebi.ac.uk/ena/browser/home) (Leinonen et al., 2011) (accession number: 902 \nPRJEB67678). The mass spectrometry proteomics data have been deposited to the 903 \nProteomeXchange Consortium (Deutsch et al., 2023) via the PRIDE (Perez-Riverol et 904 \nal., 2022) partner repository (accession number: PXD046704).  905 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 33 \nReferences 906 \nAasland, R., Gibson, T. J., & Stewart, A. F. (1995). The PHD finger: implications for 907 \nchromatin-mediated transcriptional regulation. Trends in Biochemical Sciences, 20(2), 908 \n56–59. https://doi.org/10.1016/s0968-0004(00)88957-4 909 \nAbello, A., Régnier, V., Arnaiz, O., Le Bars, R., Bétermier, M., & Bischerour, J. (2020). 910 \nFunctional diversification of Paramecium Ku80 paralogs safeguards genome integrity 911 \nduring precise programmed DNA elimination. PLoS Genetics, 16(4), e1008723. 912 \nhttps://doi.org/10.1371/journal.pgen.1008723 913 \nAllen, S. E., Hug, I., Pabian, S., Rzeszutek, I., Hoehener, C., & Nowacki, M. (2017). 914 \nCircular Concatemers of Ultra-Short DNA Segments Produce Regulatory RNAs. Cell, 915 \n168(6), 990-999.e7. https://doi.org/10.1016/j.cell.2017.02.020 916 \nAndrews, S. (2010). FastQC: a quality control tool for high throughput sequence data. 917 \n(0.11.9) [Computer software]. Babraham Bioinformatics. 918 \nArnaiz, O., Mathy, N., Baudry, C., Malinsky, S., Aury, J.-M., Denby Wilkes, C., Garnier, 919 \nO., Labadie, K., Lauderdale, B. E., Le Mouël, A., Marmignon, A., Nowacki, M., 920 \nPoulain, J., Prajer, M., Wincker, P., Meyer, E., Duharcourt, S., Duret, L., Bétermier, 921 \nM., & Sperling, L. (2012). The Paramecium germline genome provides a niche for 922 \nintragenic parasitic DNA: evolutionary dynamics of internal eliminated sequences. 923 \nPLoS Genetics, 8(10), e1002984. https://doi.org/10.1371/journal.pgen.1002984 924 \nArnaiz, O., Van Dijk, E., Bétermier, M., Lhuillier-Akakpo, M., de Vanssay, A., 925 \nDuharcourt, S., Sallet, E., Gouzy, J., & Sperling, L. (2017). Improved methods and 926 \nresources for Paramecium genomics: transcription units, gene annotation and gene 927 \nexpression. BMC Genomics, 18(1), 483. https://doi.org/10.1186/s12864-017-3887-z 928 \nBassing, C. H., Swat, W., & Alt, F. W. (2002). The mechanism and regulation of 929 \nchromosomal V(D)J recombination. Cell, 109 Suppl, S45-55. 930 \nhttps://doi.org/10.1016/s0092-8674(02)00675-x 931 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 34 \nBaudry, C., Malinsky, S., Restituito, M., Kapusta, A., Rosa, S., Meyer, E., & Bétermier, 932 \nM. (2009). PiggyMac, a domesticated piggyBac transposase involved in programmed 933 \ngenome rearrangements in the ciliate Paramecium tetraurelia. Genes & 934 \nDevelopment, 23(21), 2478–2483. https://doi.org/10.1101/gad.547309 935 \nBazin-Gélis, M., Eleftheriou, E., Zangarelli, C., Lelandais, G., Sperling, L., Arnaiz, O., & 936 \nBétermier, M. (2023). Inter-generational nuclear crosstalk links the control of gene 937 \nexpression to programmed genome rearrangements during the Paramecium sexual 938 \ncycle. BioRxiv. https://doi.org/10.1101/2023.04.16.537068 939 \nBeisson, J., Bétermier, M., Bré, M.-H., Cohen, J., Duharcourt, S., Duret, L., Kung, C., 940 \nMalinsky, S., Meyer, E., Preer, J. R., & Sperling, L. (2010a). DNA microinjection into 941 \nthe macronucleus of paramecium. Cold Spring Harbor Protocols, 2010(1), 942 \npdb.prot5364. https://doi.org/10.1101/pdb.prot5364 943 \nBeisson, J., Bétermier, M., Bré, M.-H., Cohen, J., Duharcourt, S., Duret, L., Kung, C., 944 \nMalinsky, S., Meyer, E., Preer, J. R., & Sperling, L. (2010b). Maintaining clonal 945 \nParamecium tetraurelia cell lines of controlled age through daily reisolation. Cold 946 \nSpring Harbor Protocols, 2010(1), pdb.prot5361. https://doi.org/10.1101/pdb.prot5361 947 \nBeisson, J., Bétermier, M., Bré, M.-H., Cohen, J., Duharcourt, S., Duret, L., Kung, C., 948 \nMalinsky, S., Meyer, E., Preer, J. R., & Sperling, L. (2010c). Mass culture of 949 \nParamecium tetraurelia. Cold Spring Harbor Protocols, 2010(1), pdb.prot5362. 950 \nhttps://doi.org/10.1101/pdb.prot5362 951 \nBeisson, J., Bétermier, M., Bré, M.-H., Cohen, J., Duharcourt, S., Duret, L., Kung, C., 952 \nMalinsky, S., Meyer, E., Preer, J. R., & Sperling, L. (2010d). Paramecium tetraurelia: 953 \nthe renaissance of an early unicellular model. Cold Spring Harbor Protocols, 2010(1), 954 \npdb.emo140. https://doi.org/10.1101/pdb.emo140 955 \nBeisson, J., Bétermier, M., Bré, M.-H., Cohen, J., Duharcourt, S., Duret, L., Kung, C., 956 \nMalinsky, S., Meyer, E., Preer, J. R., & Sperling, L. (2010e). Silencing specific 957 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 35 \nParamecium tetraurelia genes by feeding double-stranded RNA. Cold Spring Harbor 958 \nProtocols, 2010(1), pdb.prot5363. https://doi.org/10.1101/pdb.prot5363 959 \nBerger, J. D. (1973). Nuclear differentiation and nucleic acid synthesis in well-fed 960 \nexconjugants of Paramecium aurelia. Chromosoma, 42(3), 247–268. 961 \nhttps://doi.org/10.1007/BF00284774 962 \nBetz, C., Schlenstedt, G., & Bailer, S. M. (2004). Asr1p, a novel yeast ring/PHD finger 963 \nprotein, signals alcohol stress to the nucleus. The Journal of Biological Chemistry, 964 \n279(27), 28174–28181. https://doi.org/10.1074/jbc.M401595200 965 \nBienz, M. (2006). The PHD finger, a nuclear protein-interaction domain. Trends in 966 \nBiochemical Sciences, 31(1), 35–40. https://doi.org/10.1016/j.tibs.2005.11.001 967 \nBlack, J. C., & Kutateladze, T. G. (2023). Atypical histone targets of PHD fingers. The 968 \nJournal of Biological Chemistry, 299(4), 104601. 969 \nhttps://doi.org/10.1016/j.jbc.2023.104601 970 \nBouhouche, K., Gout, J.-F., Kapusta, A., Bétermier, M., & Meyer, E. (2011). Functional 971 \nspecialization of Piwi proteins in Paramecium tetraurelia from post-transcriptional 972 \ngene silencing to genome remodelling. Nucleic Acids Research, 39(10), 4249–4264. 973 \nhttps://doi.org/10.1093/nar/gkq1283 974 \nBozhenok, L., Wade, P. A., & Varga-Weisz, P. (2002). WSTF-ISWI chromatin 975 \nremodeling complex targets heterochromatic replication foci. The EMBO Journal, 976 \n21(9), 2231–2241. https://doi.org/10.1093/emboj/21.9.2231 977 \nChalker, D. L., & Yao, M. C. (2001). Nongenic, bidirectional transcription precedes and 978 \nmay promote developmental DNA deletion in Tetrahymena thermophila. Genes & 979 \nDevelopment, 15(10), 1287–1298. https://doi.org/10.1101/gad.884601 980 \nChalker, D. L. (2012). Transformation and strain engineering of Tetrahymena. Methods 981 \nin Cell Biology, 109, 327–345. https://doi.org/10.1016/B978-0-12-385967-9.00011-6 982 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 36 \nCharmant, O., Gruchota, J., Arnaiz, O., Zangarelli, C., Bétermier, M., Nowak, K., 983 \nLegros, V., Chevreux, G., Nowak, J., & Duharcourt, S. (2023). The nuclear PIWI-984 \ninteracting protein Gtsf1 controls the selective degradation of small RNAs in 985 \nParamecium. BioRxiv. https://doi.org/10.1101/2023.09.19.558372 986 \nCheng, C.-Y., Vogt, A., Mochizuki, K., & Yao, M.-C. (2010). A domesticated piggyBac 987 \ntransposase plays key roles in heterochromatin dynamics and DNA cleavage during 988 \nprogrammed DNA deletion in Tetrahymena thermophila. Molecular Biology of the 989 \nCell, 21(10), 1753–1762. https://doi.org/10.1091/mbc.e09-12-1079 990 \nde Vanssay, A., Touzeau, A., Arnaiz, O., Frapporti, A., Phipps, J., & Duharcourt, S. 991 \n(2020). The Paramecium histone chaperone Spt16-1 is required for Pgm 992 \nendonuclease function in programmed genome rearrangements. PLoS Genetics, 993 \n16(7), e1008949. https://doi.org/10.1371/journal.pgen.1008949 994 \nDeutsch, E. W., Bandeira, N., Perez-Riverol, Y., Sharma, V., Carver, J. J., Mendoza, L., 995 \nKundu, D. J., Wang, S., Bandla, C., Kamatchinathan, S., Hewapathirana, S., Pullman, 996 \nB. S., Wertz, J., Sun, Z., Kawano, S., Okuda, S., Watanabe, Y., MacLean, B., 997 \nMacCoss, M. J., … Vizcaíno, J. A. (2023). The ProteomeXchange consortium at 10 998 \nyears: 2023 update. Nucleic Acids Research, 51(D1), D1539–D1548. 999 \nhttps://doi.org/10.1093/nar/gkac1040 1000 \nDriever, W., & Nüsslein-Volhard, C. (1988). A gradient of bicoid protein in Drosophila 1001 \nembryos. Cell, 54(1), 83–93. https://doi.org/10.1016/0092-8674(88)90182-1 1002 \nEberharter, A., Vetter, I., Ferreira, R., & Becker, P. B. (2004). ACF1 improves the 1003 \neffectiveness of nucleosome mobilization by ISWI through PHD-histone contacts. The 1004 \nEMBO Journal, 23(20), 4029–4039. https://doi.org/10.1038/sj.emboj.7600382 1005 \nEvans, R., O’Neill, M., Pritzel, A., Antropova, N., Senior, A. W., Green, T., Žídek, A., 1006 \nBates, R., Blackwell, S., Yim, J., Ronneberger, O., Bodenstein, S., Zielinski, M., 1007 \nBridgland, A., Potapenko, A., Cowie, A., Tunyasuvunakool, K., Jain, R., Clancy, E., … 1008 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 37 \nHassabis, D. (2021). Protein complex prediction with AlphaFold-Multimer. BioRxiv. 1009 \nhttps://doi.org/10.1101/2021.10.04.463034 1010 \nFinn, R., Griffiths-Jones, S., & Bateman, A. (2003). Identifying protein domains with the 1011 \nPfam database. Current Protocols in Bioinformatics, Chapter 2, Unit 2.5. 1012 \nhttps://doi.org/10.1002/0471250953.bi0205s01 1013 \nFleck, K., Nitz, M., & Jeffers, V. (2021). “Reading” a new chapter in protozoan parasite 1014 \ntranscriptional regulation. PLoS Pathogens, 17(12), e1010056. 1015 \nhttps://doi.org/10.1371/journal.ppat.1010056 1016 \nForment, J. V., Kaidi, A., & Jackson, S. P. (2012). Chromothripsis and cancer: causes 1017 \nand consequences of chromosome shattering. Nature Reviews. Cancer, 12(10), 663–1018 \n670. https://doi.org/10.1038/nrc3352 1019 \nFrapporti, A., Miró Pina, C., Arnaiz, O., Holoch, D., Kawaguchi, T., Humbert, A., 1020 \nEleftheriou, E., Lombard, B., Loew, D., Sperling, L., Guitot, K., Margueron, R., & 1021 \nDuharcourt, S. (2019). The Polycomb protein Ezl1 mediates H3K9 and H3K27 1022 \nmethylation to repress transposable elements in Paramecium. Nature 1023 \nCommunications, 10(1), 2710. https://doi.org/10.1038/s41467-019-10648-5 1024 \nFurrer, D. I., Swart, E. C., Kraft, M. F., Sandoval, P. Y., & Nowacki, M. (2017). Two Sets 1025 \nof Piwi Proteins Are Involved in Distinct sRNA Pathways Leading to Elimination of 1026 \nGermline-Specific DNA. Cell Reports, 20(2), 505–520. 1027 \nhttps://doi.org/10.1016/j.celrep.2017.06.050 1028 \nGaurav, N., & Kutateladze, T. G. (2023). Non-histone binding functions of PHD fingers. 1029 \nTrends in Biochemical Sciences, 48(7), 610–617. 1030 \nhttps://doi.org/10.1016/j.tibs.2023.03.005 1031 \nGozani, O., Karuman, P., Jones, D. R., Ivanov, D., Cha, J., Lugovskoy, A. A., Baird, C. 1032 \nL., Zhu, H., Field, S. J., Lessnick, S. L., Villasenor, J., Mehrotra, B., Chen, J., Rao, V. 1033 \nR., Brugge, J. S., Ferguson, C. G., Payrastre, B., Myszka, D. G., Cantley, L. C., … 1034 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 38 \nYuan, J. (2003). The PHD finger of the chromatin-associated protein ING2 functions 1035 \nas a nuclear phosphoinositide receptor. Cell, 114(1), 99–111. 1036 \nhttps://doi.org/10.1016/s0092-8674(03)00480-x 1037 \nGrandchamp, S., & Beisson, J. (1981). Positional control of nuclear differentiation in 1038 \nparamecium. Developmental Biology, 81(2), 336–341. https://doi.org/10.1016/0012-1039 \n1606(81)90297-9 1040 \nGruchota, J., Denby Wilkes, C., Arnaiz, O., Sperling, L., & Nowak, J. K. (2017). A 1041 \nmeiosis-specific Spt5 homolog involved in non-coding transcription. Nucleic Acids 1042 \nResearch, 45(8), 4722–4732. https://doi.org/10.1093/nar/gkw1318 1043 \nGuérin, F., Arnaiz, O., Boggetto, N., Denby Wilkes, C., Meyer, E., Sperling, L., & 1044 \nDuharcourt, S. (2017). Flow cytometry sorting of nuclei enables the first global 1045 \ncharacterization of Paramecium germline DNA and transposable elements. BMC 1046 \nGenomics, 18(1), 327. https://doi.org/10.1186/s12864-017-3713-7 1047 \nHamilton, E. P., Kapusta, A., Huvos, P. E., Bidwell, S. L., Zafar, N., Tang, H., 1048 \nHadjithomas, M., Krishnakumar, V., Badger, J. H., Caler, E. V., Russ, C., Zeng, Q., 1049 \nFan, L., Levin, J. Z., Shea, T., Young, S. K., Hegarty, R., Daza, R., Gujja, S., … 1050 \nCoyne, R. S. (2016). Structure of the germline genome of Tetrahymena thermophila 1051 \nand relationship to the massively rearranged somatic genome. ELife, 5. 1052 \nhttps://doi.org/10.7554/eLife.19090 1053 \nHoehener, C., Hug, I., & Nowacki, M. (2018). Dicer-like enzymes with sequence 1054 \ncleavage preferences. Cell, 173(1), 234-247.e7. 1055 \nhttps://doi.org/10.1016/j.cell.2018.02.029 1056 \nHuber, W., von Heydebreck, A., Sültmann, H., Poustka, A., & Vingron, M. (2002). 1057 \nVariance stabilization applied to microarray data calibration and to the quantification 1058 \nof differential expression. Bioinformatics, 18 Suppl 1, S96-104. 1059 \nhttps://doi.org/10.1093/bioinformatics/18.suppl_1.s96 1060 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 39 \nIgnarski, M., Singh, A., Swart, E. C., Arambasic, M., Sandoval, P. Y., & Nowacki, M. 1061 \n(2014). Paramecium tetraurelia chromatin assembly factor-1-like protein PtCAF-1 is 1062 \ninvolved in RNA-mediated control of DNA elimination. Nucleic Acids Research, 1063 \n42(19), 11952–11964. https://doi.org/10.1093/nar/gku874 1064 \nJumper, J., Evans, R., Pritzel, A., Green, T., Figurnov, M., Ronneberger, O., 1065 \nTunyasuvunakool, K., Bates, R., Žídek, A., Potapenko, A., Bridgland, A., Meyer, C., 1066 \nKohl, S. A. A., Ballard, A. J., Cowie, A., Romera-Paredes, B., Nikolov, S., Jain, R., 1067 \nAdler, J., … Hassabis, D. (2021). Highly accurate protein structure prediction with 1068 \nAlphaFold. Nature, 596(7873), 583–589. https://doi.org/10.1038/s41586-021-03819-2 1069 \nKim, D., Paggi, J. M., Park, C., Bennett, C., & Salzberg, S. L. (2019). Graph-based 1070 \ngenome alignment and genotyping with HISAT2 and HISAT-genotype. Nature 1071 \nBiotechnology, 37(8), 907–915. https://doi.org/10.1038/s41587-019-0201-4 1072 \nKinkelin, K., Wozniak, G. G., Rothbart, S. B., Lidschreiber, M., Strahl, B. D., & Cramer, 1073 \nP. (2013). Structures of RNA polymerase II complexes with Bye1, a chromatin-1074 \nbinding PHF3/DIDO homologue. Proceedings of the National Academy of Sciences of 1075 \nthe United States of America, 110(38), 15277–15282. 1076 \nhttps://doi.org/10.1073/pnas.1311010110 1077 \nKlobutcher, L. A., & Herrick, G. (1995). Consensus inverted terminal repeat sequence of 1078 \nParamecium IESs: resemblance to termini of Tc1-related and Euplotes Tec 1079 \ntransposons. Nucleic Acids Research, 23(11), 2006–2013. 1080 \nhttps://doi.org/10.1093/nar/23.11.2006 1081 \nKong, A. T., Leprevost, F. V., Avtonomov, D. M., Mellacheruvu, D., & Nesvizhskii, A. I. 1082 \n(2017). MSFragger: ultrafast and comprehensive peptide identification in mass 1083 \nspectrometry-based proteomics. Nature Methods, 14(5), 513–520. 1084 \nhttps://doi.org/10.1038/nmeth.4256 1085 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 40 \nKrueger, F. (2019). TrimGalore: A wrapper around Cutadapt and FastQC to consistently 1086 \napply adapter and quality trimming to FastQ files, with extra functionality for RRBS 1087 \ndata (0.6.10) [Computer software]. GitHub. 1088 \nLefort-Tran, M., Aufderheide, K., Pouphile, M., Rossignol, M., & Beisson, J. (1981). 1089 \nControl of exocytotic processes: cytological and physiological studies of trichocyst 1090 \nmutants in Paramecium tetraurelia. The Journal of Cell Biology, 88(2), 301–311. 1091 \nhttps://doi.org/10.1083/jcb.88.2.301 1092 \nLeinonen, R., Akhtar, R., Birney, E., Bower, L., Cerdeno-Tárraga, A., Cheng, Y., 1093 \nCleland, I., Faruque, N., Goodgame, N., Gibson, R., Hoad, G., Jang, M., Pakseresht, 1094 \nN., Plaister, S., Radhakrishnan, R., Reddy, K., Sobhany, S., Ten Hoopen, P., 1095 \nVaughan, R., … Cochrane, G. (2011). The european nucleotide archive. Nucleic 1096 \nAcids Research, 39(Database issue), D28-31. https://doi.org/10.1093/nar/gkq967 1097 \nLepère, G., Nowacki, M., Serrano, V., Gout, J.-F., Guglielmi, G., Duharcourt, S., & 1098 \nMeyer, E. (2009). Silencing-associated and meiosis-specific small RNA pathways in 1099 \nParamecium tetraurelia. Nucleic Acids Research, 37(3), 903–915. 1100 \nhttps://doi.org/10.1093/nar/gkn1018 1101 \nLhuillier-Akakpo, M., Frapporti, A., Denby Wilkes, C., Matelot, M., Vervoort, M., 1102 \nSperling, L., & Duharcourt, S. (2014). Local effect of enhancer of zeste-like reveals 1103 \ncooperation of epigenetic and cis-acting determinants for zygotic genome 1104 \nrearrangements. PLoS Genetics, 10(9), e1004665. 1105 \nhttps://doi.org/10.1371/journal.pgen.1004665 1106 \nLiu, L., Qin, S., Zhang, J., Ji, P., Shi, Y., & Wu, J. (2012). Solution structure of an 1107 \natypical PHD finger in BRPF2 and its interaction with DNA. Journal of Structural 1108 \nBiology, 180(1), 165–173. https://doi.org/10.1016/j.jsb.2012.06.014 1109 \nLiu, Y., Taverna, S. D., Muratore, T. L., Shabanowitz, J., Hunt, D. F., & Allis, C. D. 1110 \n(2007). RNAi-dependent H3K27 methylation is required for heterochromatin formation 1111 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 41 \nand DNA elimination in Tetrahymena. Genes & Development, 21(12), 1530–1545. 1112 \nhttps://doi.org/10.1101/gad.1544207 1113 \nLi, Haitao, Ilin, S., Wang, W., Duncan, E. M., Wysocka, J., Allis, C. D., & Patel, D. J. 1114 \n(2006). Molecular basis for site-specific read-out of histone H3K4me3 by the BPTF 1115 \nPHD finger of NURF. Nature, 442(7098), 91–95. https://doi.org/10.1038/nature04802 1116 \nLi, Heng, & Durbin, R. (2009). Fast and accurate short read alignment with Burrows-1117 \nWheeler transform. Bioinformatics, 25(14), 1754–1760. 1118 \nhttps://doi.org/10.1093/bioinformatics/btp324 1119 \nLi, Heng, Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., 1120 \nAbecasis, G., Durbin, R., & 1000 Genome Project Data Processing Subgroup. (2009). 1121 \nThe Sequence Alignment/Map format and SAMtools. Bioinformatics, 25(16), 2078–1122 \n2079. https://doi.org/10.1093/bioinformatics/btp352 1123 \nLove, M. I., Huber, W., & Anders, S. (2014). Moderated estimation of fold change and 1124 \ndispersion for RNA-seq data with DESeq2. Genome Biology, 15(12), 550. 1125 \nhttps://doi.org/10.1186/s13059-014-0550-8 1126 \nLu, X., Meng, X., Morris, C. A., & Keating, M. T. (1998). A novel human gene, WSTF, is 1127 \ndeleted in Williams syndrome. Genomics, 54(2), 241–249. 1128 \nhttps://doi.org/10.1006/geno.1998.5578 1129 \nMaliszewska-Olejniczak, K., Gruchota, J., Gromadka, R., Denby Wilkes, C., Arnaiz, O., 1130 \nMathy, N., Duharcourt, S., Bétermier, M., & Nowak, J. K. (2015). TFIIS-Dependent 1131 \nNon-coding Transcription Regulates Developmental Genome Rearrangements. PLoS 1132 \nGenetics, 11(7), e1005383. https://doi.org/10.1371/journal.pgen.1005383 1133 \nMani, R.-S., & Chinnaiyan, A. M. (2010). Triggers for genomic rearrangements: insights 1134 \ninto genomic, cellular and environmental influences. Nature Reviews. Genetics, 1135 \n11(12), 819–829. https://doi.org/10.1038/nrg2883 1136 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 42 \nMarmignon, A., Bischerour, J., Silve, A., Fojcik, C., Dubois, E., Arnaiz, O., Kapusta, A., 1137 \nMalinsky, S., & Bétermier, M. (2014). Ku-mediated coupling of DNA cleavage and 1138 \nrepair during programmed genome rearrangements in the ciliate Paramecium 1139 \ntetraurelia. PLoS Genetics, 10(8), e1004552. 1140 \nhttps://doi.org/10.1371/journal.pgen.1004552 1141 \nMartin, M. (2011). Cutadapt removes adapter sequences from high-throughput 1142 \nsequencing reads. EMBnet.Journal, 17(1), 10. https://doi.org/10.14806/ej.17.1.200 1143 \nMiller, J., McLachlan, A. D., & Klug, A. (1985). Repetitive zinc-binding domains in the 1144 \nprotein transcription factor IIIA from Xenopus oocytes. The EMBO Journal, 4(6), 1145 \n1609–1614. https://doi.org/10.1002/j.1460-2075.1985.tb03825.x 1146 \nMirdita, M., Schütze, K., Moriwaki, Y., Heo, L., Ovchinnikov, S., & Steinegger, M. 1147 \n(2022). ColabFold: making protein folding accessible to all. Nature Methods, 19(6), 1148 \n679–682. https://doi.org/10.1038/s41592-022-01488-1 1149 \nMiró-Pina, C., Charmant, O., Kawaguchi, T., Holoch, D., Michaud, A., Cohen, I., 1150 \nHumbert, A., Jaszczyszyn, Y., Chevreux, G., Del Maestro, L., Ait-Si-Ali, S., Arnaiz, O., 1151 \nMargueron, R., & Duharcourt, S. (2022). Paramecium Polycomb repressive complex 1152 \n2 physically interacts with the small RNA-binding PIWI protein to repress 1153 \ntransposable elements. Developmental Cell, 57(8), 1037-1052.e8. 1154 \nhttps://doi.org/10.1016/j.devcel.2022.03.014 1155 \nMochizuki, K., Fine, N. A., Fujisawa, T., & Gorovsky, M. A. (2002). Analysis of a piwi-1156 \nrelated gene implicates small RNAs in genome rearrangement in tetrahymena. Cell, 1157 \n110(6), 689–699. https://doi.org/10.1016/s0092-8674(02)00909-1 1158 \nMorisato, D., & Anderson, K. V. (1995). Signaling pathways that establish the dorsal-1159 \nventral pattern of the Drosophila embryo. Annual Review of Genetics, 29, 371–399. 1160 \nhttps://doi.org/10.1146/annurev.ge.29.120195.002103 1161 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 43 \nNowacki, M., Zagorski-Ostoja, W., & Meyer, E. (2005). Nowa1p and Nowa2p: novel 1162 \nputative RNA binding proteins involved in trans-nuclear crosstalk in Paramecium 1163 \ntetraurelia. Current Biology, 15(18), 1616–1628. 1164 \nhttps://doi.org/10.1016/j.cub.2005.07.033 1165 \nOpenAI. (2023). ChatGPT [Large language model] (GPT-3.5) [Computer software]. 1166 \nhttps://chat.openai.com/chat. 1167 \nOppikofer, M., Sagolla, M., Haley, B., Zhang, H.-M., Kummerfeld, S. K., Sudhamsu, J., 1168 \nFlynn, E. M., Bai, T., Zhang, J., Ciferri, C., & Cochran, A. G. (2017). Non-canonical 1169 \nreader modules of BAZ1A promote recovery from DNA damage. Nature 1170 \nCommunications, 8(1), 862. https://doi.org/10.1038/s41467-017-00866-0 1171 \nPascual, J., Martinez-Yamout, M., Dyson, H. J., & Wright, P. E. (2000). Structure of the 1172 \nPHD zinc finger from human Williams-Beuren syndrome transcription factor. Journal 1173 \nof Molecular Biology, 304(5), 723–729. https://doi.org/10.1006/jmbi.2000.4308 1174 \nPaysan-Lafosse, T., Blum, M., Chuguransky, S., Grego, T., Pinto, B. L., Salazar, G. A., 1175 \nBileschi, M. L., Bork, P., Bridge, A., Colwell, L., Gough, J., Haft, D. H., Letunić, I., 1176 \nMarchler-Bauer, A., Mi, H., Natale, D. A., Orengo, C. A., Pandurangan, A. P., Rivoire, 1177 \nC., … Bateman, A. (2023). InterPro in 2022. Nucleic Acids Research, 51(D1), D418–1178 \nD427. https://doi.org/10.1093/nar/gkac993 1179 \nPerez-Riverol, Y., Bai, J., Bandla, C., García-Seisdedos, D., Hewapathirana, S., 1180 \nKamatchinathan, S., Kundu, D. J., Prakash, A., Frericks-Zipper, A., Eisenacher, M., 1181 \nWalzer, M., Wang, S., Brazma, A., & Vizcaíno, J. A. (2022). The PRIDE database 1182 \nresources in 2022: a hub for mass spectrometry-based proteomics evidences. 1183 \nNucleic Acids Research, 50(D1), D543–D552. https://doi.org/10.1093/nar/gkab1038 1184 \nPinskaya, M., Ghavi-Helm, Y., Mariotte-Labarre, S., Morillon, A., Soutourina, J., & 1185 \nWerner, M. (2014). PHD and TFIIS-Like domains of the Bye1 transcription factor 1186 \ndetermine its multivalent genomic distribution. Plos One, 9(7), e102464. 1187 \nhttps://doi.org/10.1371/journal.pone.0102464 1188 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 44 \nQuan, J., & Tian, J. (2011). Circular polymerase extension cloning for high-throughput 1189 \ncloning of complex and combinatorial DNA libraries. Nature Protocols, 6(2), 242–251. 1190 \nhttps://doi.org/10.1038/nprot.2010.181 1191 \nRitchie, M. E., Phipson, B., Wu, D., Hu, Y., Law, C. W., Shi, W., & Smyth, G. K. (2015). 1192 \nlimma powers differential expression analyses for RNA-sequencing and microarray 1193 \nstudies. Nucleic Acids Research, 43(7), e47. https://doi.org/10.1093/nar/gkv007 1194 \nRoberts, A., & Pachter, L. (2013). Streaming fragment assignment for real-time analysis 1195 \nof sequencing experiments. Nature Methods, 10(1), 71–73. 1196 \nhttps://doi.org/10.1038/nmeth.2251 1197 \nRooney, S., Chaudhuri, J., & Alt, F. W. (2004). The role of the non-homologous end-1198 \njoining pathway in lymphocyte development. Immunological Reviews, 200, 115–131. 1199 \nhttps://doi.org/10.1111/j.0105-2896.2004.00165.x 1200 \nRoth, S., Stein, D., & Nüsslein-Volhard, C. (1989). A gradient of nuclear localization of 1201 \nthe dorsal protein determines dorsoventral pattern in the Drosophila embryo. Cell, 1202 \n59(6), 1189–1202. https://doi.org/10.1016/0092-8674(89)90774-5 1203 \nRzeszutek, I., Swart, E. C., Pabian-Jewuła, S., Russo, A., & Nowacki, M. (2022). Early 1204 \ndevelopmental, meiosis-specific proteins - Spo11, Msh4-1, and Msh5 - Affect 1205 \nsubsequent genome reorganization in Paramecium tetraurelia. Biochimica et 1206 \nBiophysica Acta. Molecular Cell Research, 1869(6), 119239. 1207 \nhttps://doi.org/10.1016/j.bbamcr.2022.119239 1208 \nSanchez, R., & Zhou, M.-M. (2011). The PHD finger: a versatile epigenome reader. 1209 \nTrends in Biochemical Sciences, 36(7), 364–372. 1210 \nhttps://doi.org/10.1016/j.tibs.2011.03.005 1211 \nSandoval, P. Y., Swart, E. C., Arambasic, M., & Nowacki, M. (2014). Functional 1212 \ndiversification of Dicer-like proteins and small RNAs required for genome sculpting. 1213 \nDevelopmental Cell, 28(2), 174–188. https://doi.org/10.1016/j.devcel.2013.12.010 1214 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 45 \nSchindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., 1215 \nPreibisch, S., Rueden, C., Saalfeld, S., Schmid, B., Tinevez, J.-Y., White, D. J., 1216 \nHartenstein, V., Eliceiri, K., Tomancak, P., & Cardona, A. (2012). Fiji: an open-source 1217 \nplatform for biological-image analysis. Nature Methods, 9(7), 676–682. 1218 \nhttps://doi.org/10.1038/nmeth.2019 1219 \nSchindler, U., Beckmann, H., & Cashmore, A. R. (1993). HAT3.1, a novel Arabidopsis 1220 \nhomeodomain protein containing a conserved cysteine-rich region. The Plant Journal, 1221 \n4(1), 137–150. https://doi.org/10.1046/j.1365-313x.1993.04010137.x 1222 \nSellis, D., Guérin, F., Arnaiz, O., Pett, W., Lerat, E., Boggetto, N., Krenek, S., 1223 \nBerendonk, T., Couloux, A., Aury, J.-M., Labadie, K., Malinsky, S., Bhullar, S., Meyer, 1224 \nE., Sperling, L., Duret, L., & Duharcourt, S. (2021). Massive colonization of protein-1225 \ncoding exons by selfish genetic elements in Paramecium germline genomes. PLoS 1226 \nBiology, 19(7), e3001309. https://doi.org/10.1371/journal.pbio.3001309 1227 \nSievers, F., Wilm, A., Dineen, D., Gibson, T. J., Karplus, K., Li, W., Lopez, R., 1228 \nMcWilliam, H., Remmert, M., Söding, J., Thompson, J. D., & Higgins, D. G. (2011). 1229 \nFast, scalable generation of high-quality protein multiple sequence alignments using 1230 \nClustal Omega. Molecular Systems Biology, 7, 539. 1231 \nhttps://doi.org/10.1038/msb.2011.75 1232 \nSingh, A., Häußermann, L., Emmerich, C., Nischwitz, E., Seah, B. K., Butter, F. K. B., 1233 \nNowacki, M., & Swart, E. C. (2023). ISWI1 complex proteins facilitate developmental 1234 \ngenome editing in Paramecium. BioRxiv. https://doi.org/10.1101/2023.08.09.552620 1235 \nSingh, A., Maurer-Alcalá, X. X., Solberg, T., Häußermann, L., Gisler, S., Ignarski, M., 1236 \nSwart, E. C., & Nowacki, M. (2022). Chromatin remodeling is required for sRNA-1237 \nguided DNA elimination in Paramecium. The EMBO Journal, 41(22), e111839. 1238 \nhttps://doi.org/10.15252/embj.2022111839 1239 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 46 \nSkene, P. J., Henikoff, J. G., & Henikoff, S. (2018). Targeted in situ genome-wide 1240 \nprofiling with high efficiency for low cell numbers. Nature Protocols, 13(5), 1006–1241 \n1019. https://doi.org/10.1038/nprot.2018.015 1242 \nSpirov, A., Fahmy, K., Schneider, M., Frei, E., Noll, M., & Baumgartner, S. (2009). 1243 \nFormation of the bicoid morphogen gradient: an mRNA gradient dictates the protein 1244 \ngradient. Development, 136(4), 605–614. https://doi.org/10.1242/dev.031195 1245 \nSturm, Á., Saskoi, É., Tibor, K., Weinhardt, N., & Vellai, T. (2018). Highly efficient RNAi 1246 \nand Cas9-based auto-cloning systems for C. elegans research. Nucleic Acids 1247 \nResearch, 46(17), e105. https://doi.org/10.1093/nar/gky516 1248 \nSwart, E. C., Wilkes, C. D., Sandoval, P. Y., Arambasic, M., Sperling, L., & Nowacki, M. 1249 \n(2014). Genome-wide analysis of genetic and epigenetic control of programmed DNA 1250 \ndeletion. Nucleic Acids Research, 42(14), 8970–8983. 1251 \nhttps://doi.org/10.1093/nar/gku619 1252 \nTaverna, S. D., Coyne, R. S., & Allis, C. D. (2002). Methylation of histone h3 at lysine 9 1253 \ntargets programmed DNA elimination in tetrahymena. Cell, 110(6), 701–711. 1254 \nhttps://doi.org/10.1016/s0092-8674(02)00941-8 1255 \nVillanueva, R. A. M., & Chen, Z. J. (2019). ggplot2: Elegant Graphics for Data Analysis 1256 \n(2nd ed.). Measurement: Interdisciplinary Research and Perspectives, 17(3), 160–1257 \n167. https://doi.org/10.1080/15366367.2019.1565254 1258 \nWang, C., Lv, L., Solberg, T., Wen, Z., Zhang, H., & Gao, F. (2023). Conservation of the 1259 \nancestral function of GTSF1 in transposon silencing in the unicellular eukaryote 1260 \nParamecium tetraurelia. BioRxiv. https://doi.org/10.1101/2023.10.06.561219 1261 \nWang, C., Solberg, T., Maurer-Alcalá, X. X., Swart, E. C., Gao, F., & Nowacki, M. 1262 \n(2022). A small RNA-guided PRC2 complex eliminates DNA as an extreme form of 1263 \ntransposon silencing. Cell Reports, 40(8), 111263. 1264 \nhttps://doi.org/10.1016/j.celrep.2022.111263 1265 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 47 \nWysocka, J., Swigut, T., Xiao, H., Milne, T. A., Kwon, S. Y., Landry, J., Kauer, M., 1266 \nTackett, A. J., Chait, B. T., Badenhorst, P., Wu, C., & Allis, C. D. (2006). A PHD finger 1267 \nof NURF couples histone H3 lysine 4 trimethylation with chromatin remodelling. 1268 \nNature, 442(7098), 86–90. https://doi.org/10.1038/nature04815 1269 \nZangarelli, C., Arnaiz, O., Bourge, M., Gorrichon, K., Jaszczyszyn, Y., Mathy, N., 1270 \nEscoriza, L., Bétermier, M., & Régnier, V. (2022). Developmental timing of 1271 \nprogrammed DNA elimination in Paramecium tetraurelia recapitulates germline 1272 \ntransposon evolutionary dynamics. Genome Research, 32(11–12), 2028–2042. 1273 \nhttps://doi.org/10.1101/gr.277027.122 1274 \nZeng, L., Zhang, Q., Li, S., Plotnikov, A. N., Walsh, M. J., & Zhou, M.-M. (2010). 1275 \nMechanism and regulation of acetylated histone binding by the tandem PHD finger of 1276 \nDPF3b. Nature, 466(7303), 258–262. https://doi.org/10.1038/nature09139 1277 \nZhang, J., Yan, G., Tian, M., Ma, Y., Xiong, J., & Miao, W. (2018). A DP-like 1278 \ntranscription factor protein interacts with E2fl1 to regulate meiosis in Tetrahymena 1279 \nthermophila. Cell Cycle, 17(5), 634–642. 1280 \nhttps://doi.org/10.1080/15384101.2018.1431595 1281 \nZimmermann, L., Stephens, A., Nam, S.-Z., Rau, D., Kübler, J., Lozajic, M., Gabler, F., 1282 \nSöding, J., Lupas, A. N., & Alva, V. (2018). A Completely Reimplemented MPI 1283 \nBioinformatics Toolkit with a New HHpred Server at its Core. Journal of Molecular 1284 \nBiology, 430(15), 2237–2243. https://doi.org/10.1016/j.jmb.2017.12.007  1285 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 1 \n \nFigure 1: Features of the PHD finger proteins DevPF1 and DevPF2 \n(A) mRNA expression profiles for DevPF1, DevPF2 and PGM during various \ndevelopmental stages: VEG (vegetative growth), MEI (micronuclear meiosis and \nmacronuclear fragmentation), FRG (~50% of the population with fragmented maternal \nMACs), DEV1 (significant proportion with visible anlagen), DEV2/3 (majority with visible \n0\n1000\n2000\n3000\n4000\nVEG MEI FRG DEV1 DEV2/3 DEV4\nmRNA [A.U.]\nDevPF1 DevPF2 PGM\nDevPF2\nPHD PHD-zinc-finger like domain\nDevPF2:\nDevPF1:\ncyan: DevPF1\ngreen: DevPF2\nyellow: WSTF\nmagenta: C4HC3\ngrey: zinc ion\nA B\nD\nC\nE\nHPHD\nPHD-zinc-finger like domain\npLDDT\n0-50 90-100>\n>\nDevPF1\nPHD\nPHD-zinc-finger like domain\nDevPF2\nDevPF1\nJade-3.human\np300.human\nWSTF.human\nNURF301.drosophila\nJade-1.human\nMLL.human\nC4HC3 motif\nF G\nDevPF2DevPF1\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 2 \nanlagen), DEV4 (majority with visible anlagen). Expression data retrieved from \nParameciumDB (Arnaiz et al., 2017). (B) Schematic representation of predicted domain \narchitecture for DevPF1 and DevPF2. (C) Multiple sequence alignment (Clustal Omega) \nof DevPF1 and DevPF2 amino acid sequence with PHD domains of published human \nand Drosophila PHD finger proteins. (D) to (F): Predicted protein structure (AlphaFold2) \nfor DevPF1 and DevPF2, colored by domain (PHD: orange; PHD-zinc-finger-like \ndomain: green) in (D) and (E), and by prediction confidence (pLDDT: predicted local \ndistance difference test) in (F) and (G). (H) Structure predictions of DevPF1 and \nDevPF2 PHD domain superimposed with NMR structure of WSTF PHD domain (PDB \naccession number 1F62). \n \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 3 \n \n \nGFP DAPI + GFP\nstarved\nvegetativemeiosis IImeiosis II\nDevPF1-GFP\nS-phase\nnew MAC\ndevelopment\nearly new MAC\ndevelopment\nlate new MAC\ndevelopment\nGFP DAPI + GFP\nDevPF2-GFPA B C\nMIC\nMAC\ngametic \nnuclei\nskein\nzygote\npost-zygotic \nnuclei\nfrag-\nments\nnew MIC\nnew MAC\n1\n2\n3\n4\n5\n6\n7\n1\n2\n3,4\n5\n6\n7\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 4 \nFigure 2: Subcellular localization of DevPF-GFP proteins \nDevPF1-GFP (A) and DevPF2-GFP (B) localization at various developmental stages. \nDNA (stained with DAPI) in magenta. GFP signal in yellow. No image of DevPF2-GFP \nduring S-phase was acquired. Green arrow: MIC. Cyan arrow: new MAC. Maximum \nintensity projections of multiple z-planes. Scale bar = 10 µm. (C) Schematic overview of \nnuclear morphology during sexual development, with corresponding cell stages in the \nimages indicated by numbers.  \n \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 5 \n \nindividual z-planes\nmaximum \nintensity projection\nmeiosis II meiosis II\nmeiosis IImeiosis I meiosis II post-zygote\nmaximum intensity projectionsindividual z-planes\nA\nB\nDAPIoverlayoverlay anti-α-tubulinGFP\nMIC with DevPF1-GFP \nMIC without DevPF1-GFP\nDevPF1-GFP\nDAPI\nanti-α-tubulin\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 6 \n \nFigure 3: Selective DevPF1-GFP localization in Paramecium MICs \n(A) Overlay of DAPI (DNA stain; pink) and GFP (yellow) signal in two DevPF1-GFP \ninjected Paramecium cells during meiotic stages. Maximum intensity projections (left) \nand individual z-planes of the same stack (right). (B) DevPF1-GFP localization with \nvisualization of nuclear spindle. DAPI (pink), GFP (yellow) and anti-α-tubulin staining \n(cyan). Maximum intensity projections (top) for DAPI and overlay (DAPI, GFP and anti-\nα-tubulin). Individual z-planes of the same stacks (bottom) for anti-α-tubulin, GFP and \noverlay. (A) and (B): Red arrows: MICs with DevPF1-GFP localization; White arrows: \nMICs without DevPF1-GFP localization. Scale bar = 10 µm. \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 7 \n \nD\nPGM\nDevPF2\n(1)\nDevPF2\n(2)\nDevPF2\n(3)\nDevPF2\n(4)\nDevPF2\n(5)\nDevPF2\n(6)\nDevPF1\n(1)\nDevPF1\n(2)\nDevPF1\n(3)\nDevPF1\n(4)\nPGM DevPF2\n(1)\nDevPF2\n(2)\nDevPF2\n(3)\nDevPF2\n(4)\nDevPF2\n(5)\nDevPF2\n(6)\nDevPF1\n(1)\nDevPF1\n(2)\nDevPF1\n(3)\nDevPF1\n(4)\nPGM\nDevPF2\n(1)\nDevPF2\n(2)\nDevPF2\n(3)\nDevPF2\n(4)\nDevPF2\n(5)\nDevPF2\n(6)\nDevPF1\n(2)\nDevPF1\n(1)\nDevPF1\n(3)\nDevPF1\n(4)\nND7 PGM DevPF1 DevPF2 KD\nnormalized mean fluorescence intensity\nGFP signal in new MACs\nDevPF1-GFP\nDevPF2-GFP\nA\nC\nonset early late very late\n0\n500\n1000\n1500\n2000\nst-veg early late very late\ntimepoint\nmRNA\n[normalized counts]\nbatch\nA\nB\nC\nKD\nND7\nPS17\nAS17\nDevPF2\nND7\nDevPF1\nDevPF20\n500\n1000\n1500\n2000\nst-veg early late very late\ntimepoint\nmRNA\n[normalized counts]\nbatch\nA\nB\nC\nKD\nND7\nPS17\nAS17\nDevPF2\nDevPF1\nDevPF2\nB\n0\n500\n1000\n1500\n2000\nonset early late very late\ntimepoint\nmRNA\n[normalized counts]\nbatch\nA\nB\nC\nKD\nND7\nPS17\nAS17\nDevPF2\nDevPF2\n0\n1000\n2000\nonset early late very late\ntimepoint\nmRNA\n[normalized counts]\nbatch\nA\nB\nC\nKD\nND7\nPS17\nAS17\nDevPF1\nDevPF1\ncells\n0%\n50%\n100%\nonset early late very late\nnumber of cells\nvegetative skein fragmented new MACs\ntime point\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 8 \nFigure 4: Co-silencing effects observed in DevPF knockdowns \n(A) Nucleotide identity across DevPF1 (bottom) and DevPF2 (top) genes. Screenshot of \npairwise sequence alignment in Geneious prime software. Silencing region (violet), \nexon (green), intron (white), perfect identity (gray) and mismatch/gap (black). Scale in \nbase pairs at the top. (B) mRNA expression levels of DevPF1 (top) and DevPF2 \n(bottom) upon KDs (ND7 (control), DevPF1 and DevPF2) at different developmental \ntime points (onset, early, late and very late). Lines represent the mean of all replicates \nfor a given KD and time point. The cell stage composition of each time point averaged \nover all KDs is shown at the top (individual compositions in Fig. S5), along with \nschematic representations of the considered cell stages. (C) Protein expression upon \nKD: fluorescence intensities of DevPF1-GFP (top) and DevPF2-GFP (bottom). Red line: \nmedian. Whiskers: 1.5 times the interquartile range from the lower or upper quartile. \nDots: data points outside the whiskers. Sample size = 10. (D) IES retention score (IRS) \ncorrelations between DevPF1- and DevPF2-KD replicates. Diagonal: IRS distributions \nof individual KDs. Below diagonal: correlation graphs of pairwise comparisons. Above \ndiagonal: corresponding Spearman correlation coefficients. Red lines: ordinary least-\nsquares (OLS) regression, orange lines: LOWESS, and gray lines: orthogonal distance \nregression (ODR). \n \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 9 \n \n263949\n30904513560135cells =\nn = CA\nDB\nE\nPGM TFIIS4 DCL2/3/5 SPT5m PTCAF1 ISWI1 DevPF2 (4) DevPF1 (4) DevPF1 (2)\nPGM\nTFIIS4\nDCL\n2/3/5\nSPT5m\nPTCAF1\nISWI1\nDevPF2\n(4)\nDevPF1\n(4)\nDevPF1\n(2)\nPGMTFIIS4DCL2/3/5SPT5mPTCAF1ISWI1DevPF2\n(4)\nDevPF1\n(4)\nDevPF1\n(2)\nMT IES\nIES+ 460 bp\nIES- 265 bp\nIES+\nIES-\nIES 5\nIES+ 501 bp\nIES- 299 bp\nND7-KD\nPGM-KD\nAS17-1-KD\nAS17-2-KD\nPS17-2-KD\nPS17-1-KD\nMT IES\nDevPF1-b-KD\nDevPF1-a-KD\nDevPF2-b-KD\nDevPF2-a-KD\nPGM-KD\nND7-KD\nIES+ (501 bp)\nIES- (299 bp)\nIES+ (460 bp)\nIES- (265 bp)\n51G4404 \n0%\n20%\n40%\n60%\n80%\n100%\nND7 PGM\nDevPF2-aDevPF2-bDevPF1-aDevPF1-b\nnumber of cells\nsurvival sickness death\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 10 \nFigure 5: Effects of DevPF knockdowns on genome-wide IES retention  \n(A) Viability of new progeny after KDs (ND7 (negative control), PGM (positive control), \nDevPF1 and DevPF2) during sexual development. For DevPF1 and DevPF2, two \nsilencing regions were targeted (a and b, see Fig. 4A). The numbers of experiments (n) \nand cells counted (cells) are indicated at the top. Survival: normal division. Sickness: \nreduced growth. Death: 3 or less cells after three days. (B) IES retention PCRs for two \nIESs on genomic DNA isolated from KD cells. (C) and (D): IES retention score (IRS) \nhistograms for DevPF1 (C) and DevPF2 (D) KD replicates, indicated in parentheses. (E) \nIRS correlation between KDs. Diagonal: IRS distributions of individual KDs. Below \ndiagonal: correlation graphs of pairwise comparisons. Above diagonal: corresponding \nSpearman correlation coefficients. Red lines: ordinary least-squares (OLS) regression, \norange lines: LOWESS, and gray lines: orthogonal distance regression (ODR). \n \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 11 \n \nAonsetearlylatevery late\nDevPF2-KD (1)ND7-KD (1)\nfraction of total reads\nsmall RNA length [nt]\nDevPF1-KD (2)\nsiRNA\n(23 nt)\nscnRNA\n(25 nt)\nsiRNA\n(23 nt)\nscnRNA (25 nt)\niesRNA\n(~26-30 nt)\n100%\n0%\n100%\n0%\n100%\n0%\n100%\n0%\n100%\n0%\n100%\n0%\n100%\n0%\n100%\n0%\n100%\n0%\n100%\n0%\n100%\n0%\n100%\n0%\nMAC\nIES\nsilencing \nvector\nsmall RNAs \nmatching to:\ncell stages:\nsiRNA\n(23 nt) siRNA\n(23 nt)\nscnRNA\n(25 nt)\nsiRNA\n(23 nt)\nsiRNA\n(23 nt) scnRNA (25 nt)\nvegetative\nskein\nfragmented\nnew MACs\nDevPF1-KD\nGFPoverlay\n GFPoverlay\nno KD\nS-phase meiosis I meiosis II fragments new MACsB\nS-Phasemeiosis Imeiosis IIfragmentsnew MACs\nC\nPtiwi09-GFP\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 12 \nFigure 6: Changes of small RNA populations upon DevPF knockdowns  \n(A) Small RNA populations (10-40 nt) at developmental time points (onset, early, late \nand very late) in different KDs (ND7 (control), DevPF1 and DevPF2), mapping to \nsilencing plasmid backbone (vector), MAC or IES sequences. Individual cell stage \ncompositions are indicated by the bar to the right of each diagram, along with schematic \nrepresentations of the cell stages considered. (B) Ptiwi09-GFP localization at different \ndevelopmental stages in the context of no (top) and DevPF1 KD (bottom). DAPI (pink) \nand GFP (yellow). Individual z-planes for GFP and overlay (DAPI and GFP). Green \narrows: MICs. Cyan arrows: new MAC. Scale bar = 10 µm. (C) Schematic \nrepresentation of cell stages in (B). \n \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2024. ; https://doi.org/10.1101/2024.01.23.576875doi: bioRxiv preprint \n\n 13  \nDevPF1vs ND7DevPF2vs ND7DevPF2vs DevPF1\nC\nD\nonsetearlylatevery late\ncells: 100%20%40%60%80%\nvegetativeskeinfragmentednew MACs\nA\nupregulateddownregulatedother\n0\n500\n1000\n1500\n2000\nst-veg early late very late\ntimepoint\nmRNA[normalized counts]\nbatch\nA\nB\nC\nKD\nND7\nPS17\nAS17\nDevPF2\nND7DevPF1DevPF2\nscnRNArelated\niesRNArelated\nKD:\nDevPF2-KDDevPF1-KDND7-KDtimepoint +-+onsetscnRNAs +-+early +-+late +-+very late ---onsetiesRNAs ---early --+late --+very late\nB\n0\n10000\n20000\n30000\n40000\nonsetearlylatevery late\ntimepoint\nmRNA[normalized counts]\nbatch\nA\nB\nC\nKD\nND7\nPS17\nAS17\nPTIWI01\n0\n100\n200\n300\n400\n500\nonsetearlylatevery late\ntimepoint\nmRNA[normalized counts]\nbatch\nA\nB\nC\nKD\nND7\nPS17\nAS17\nDCL2\n0\n5000\n10000\n15000\n20000\nonsetearlylatevery late\ntimepoint\nmRNA[normalized counts]\nbatch\nA\nB\nC\nKD\nND7\nPS17\nAS17\nPTIWI10\n0\n5000\n10000\n15000\n20000\n25000\nonsetearlylatevery late\ntimepoint\nmRNA[normalized counts]\nbatch\nA\nB\nC\nKD\nND7\nPS17\nAS17\nNOWA1\n0\n300\n600\n900\nonsetearlylatevery late\ntimepoint\nmRNA[normalized counts]\nbatch\nA\nB\nC\nKD\nND7\nPS17\nAS17\nDCL5\n0\n250\n500\n750\n1000\nonsetearlylatevery late\ntimepoint\nmRNA[normalized counts]\nbatch\nA\nB\nC\nKD\nND7\nPS17\nAS17\nSPT5m\n0\n500\n1000\n1500\nonsetearlylatevery late\ntimepoint\nmRNA[normalized counts]\nbatch\nA\nB\nC\nKD\nND7\nPS17\nAS17\nTFIIS4\n0%20%40%60%80%100%onsetearlylatevery late\nnumber of cells\nnew MACsfragmentedskeinvegetative\nDCL2 PTIWI01 NOWA1 SPT5m\nDCL5 PTIWI10 TFIIS4\n\n 14 \nFigure 7: Differential gene expression in DevPF knockdowns (A) Cell stage composition of each time point averaged over all KDs (individual compositions in Fig. S5), along with schematic representations of the considered cell stages. (B) Presence or absence of scnRNAs and iesRNAs in different KDs (ND7, DevPF1 and DevPF2) and time points (onset, early, late, very late). (C) Differentially expressed genes in DevPF1- (top) or DevPF2- (middle) compared to ND7-KD or DevPF1- compared to DevPF2-KD (bottom) at different developmental time points (onset, early, late and very late). Thresholds for up-/downregulation: adjusted p-value < 0.01; |log2(fold change)| > 2. The number of up-/downregulated genes is indicated in each diagram. For all comparisons, 35777 transcripts were analyzed, except for: DevPF1-ND7 onset (33696), DevPF2-ND7 early (35083), and DevPF2-DevPF1 onset (34389). (D) Gene expression levels of selected genes upon KDs (ND7 (control), DevPF1 and DevPF2) at different developmental time points (onset, early, late and very late). The lines represent the mean of all replicates in a given KD and time point.       \n\n 15 \nTable 1: IES retention scores of IESs at PTIWI10/11 genes The genes PTIWI10 and PTIWI11 contain IESs in their coding and/or flanking regions, which were proposed to impair their transcription when retained. The IRS values for the three relevant IESs (IDs with prefix IESPGM.PTET51.1) are provided for each KD. Rows are color-coded according to the KDs as shown in the mRNA read count diagrams (i. e. Figs 7D, S7B).  \nKD \nReplicate PTIWI11 PTIWI10 coding region flanking region coding region IESPGM.PTET51.1.62.345420 IESPGM.PTET51.1.24.407807 IESPGM.PTET51.1.24.408279 \nND7 3 0.00 0.00 0.00 4 0.00 0.00 0.00 5 0.00 0.00 0.00 \nDevPF1 1 0.09 0.29 0.11 2 0.08 0.15 0.06 3 0.04 0.03 0.06 4 0.02 0.01 0.01 \nDevPF2 \n1 0.10 0.07 0.01 2 0.02 0.24 0.15 3 0.00 0.00 0.00 4 0.00 0.00 0.01 5 0.03 0.00 0.00 6 0.01 0.00 0.00","source_license":"CC-BY-4.0","license_restricted":false}