{"paper_id":"11260a99-2fe0-403c-81d1-474353f9c2f3","body_text":"Olfm4 Is Highly Expressed In Liver Cancer Patients And As A Biomarker And Therapeutic Target For Liver Cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Olfm4 Is Highly Expressed In Liver Cancer Patients And As A Biomarker And Therapeutic Target For Liver Cancer Qingzhu Song This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-686335/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Liver cancer is one of important cancer types causing a large number death in the world, and the incidence is still increasing. Conventional therapies against liver cancer are not satisfied and pathogenesis of liver cancer remains unclear. Thus, the more effective therapies are needed to treat liver cancers, and the discovery of key genes involving in pathogenesis of liver cancers is important for developing more effective therapies to treat liver cancer. In the present study, we found that OLFM4 blood level is higher in liver cancer patients than in healthy individuals, and mRNA expression level in liver cancer tissue than in liver paracancerous tissues. OLFM4 has high predictive capacity as a biomarker for liver cancer and closely correlated to tumor size. Importantly, it is confirmed that OLFM4 contributes to cancer cell proliferation, and HIF-1α involves in this activity. We believe that OLFM4/HIF-1α axis might be a target signaling pathway for developing novel drugs to treat liver cancer. General Cell Biology & Physiology Molecular Biology OLFM4 biomarker therapeutic targets diagnosis liver cancer Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Liver cancer has been the fourth leading cause of cancer death after lung, colorectal, and stomach cancer, and the incidence is still increasing in the world [ 1 ]. For liver cancer, the most common type is hepatocellular carcinoma, followed by cholangiocarcinoma [ 2 ]. The pathogenesis of liver cancer is complicated, among them, infections including hepatitis B virus (HBV), hepatitis C virus (HCV), behavioral factors (alcohol, tobacco), metabolic factors (excess body fatness), and aflatoxins are thought to be the major risks [ 3 ]. In general, chemotherapy and immunotherapy are the mostly used in treating hepatocellular carcinomas (HCCs) [ 4 ]. For the more advanced stages of liver cancers,trans-arterial chemoembolization (TACE) is often used, which is reported to reach a 23% improvement in the 2-year survival compared with the conservative therapy for intermediate stage HCC patients [ 5 ]. As a kinase inhibitor, the oral format of sorafenib is also often used in the late-stage liver cancers, while its effects are far away from satisfactions and long-term utilization of the drug may cause toxicity and/or drug inefficacy [ 6 ]. Moreover, the prognosis of the liver cancer is low; resulting in that only low ratio of liver cancer patients is eligible for surgical removal [ 6 ]. Therefore, the more effective therapies are needed to treat liver cancers. Importantly, the discovery of key genes involving in pathogenesis of liver cancers plays an important role in developing novel therapies treating liver cancers. OLFM4 (olfactomedin 4) belongs to the olfactomedin family, which is also known as hGC-1 (human granulocyte colony-stimulating factor-stimulated clone 1) [ 7 ]. Initially, OLFM4 was found to regulate inflammatory response and innate immunity [ 8 ]. Moreover, as a secreted protein OLFM4 is closely involved in a variety of cellular functions including proliferation, differentiation, apoptosis, and cell adhesion [ 9 ]. Recently, accumulating evidence confirming that OLFM4 plays an important role in regulating growth and proliferation of several types of cancer cells [ 9 ]. In esophageal adenocarcinoma, it was found that OLFM4 is closely linked to the nodal metastases [ 10 ]. The expression level is found to significantly increased in intestinal metaplasia (IM), while it is absent in normal gastric mucosa [ 11 ]. In terms of metastatic breast cancer, it was found that the expression level of OLFM4 is remarkably associated to pathological T factor, distant metastasis and Ki67 status in the ER-positive breast carcinomas [ 12 ]. OLFM4 is thought to be a potential biomarker for gastrointestinal cancers [ 13 ]. In fact, OLFM4 serum level has been biomarker of a variety of diseases including asthmatics [ 14 ], non-small cell lung cancer [ 15 ], pancreatic, head and neck, and prostate cancers [ 16 ]. However, effects of OLFM4 in liver cancers remain unclear, which needs more investigations. OLFM4/HIF-1α axis was found to involve in regulation of hypoxia-induced invasion, epithelial-mesenchymal transition, and chemotherapy resistance in non-small-cell lung cancer [ 17 ]. HIF-1α is a subunit of a heterodimeric transcription factor hypoxia-inducible factor 1 (HIF-1), which exerts an essential role in cellular response to systemic oxygen levels in mammals [ 17 ]. HIF-1α closely involves in pathogenesis of cancers. HIF-1α and GATA3 forms a complex to enhance cancer cell invasiveness [ 18 ]. Targeting HIF-1α is considered to be a potential therapy for alleviating chemoresistance to enhance the efficacy of chemotherapies in colon cancers [ 19 ]. Interestingly, it was found that inhibition of OLFM4/HIF-1α axis could improve hypoxia-induced invasion, epithelial-mesenchymal transition, and chemotherapy resistance of non-small-cell lung cancer [ 17 ]. Therefore, in the study, we first measured the blood level of OLFM4 in the healthy control and liver cancer patients, and OLFM4 RNA and protein level in liver para-carcinoma tissue and tumor. We confirmed that OLFM4 might be a potential biomarker for liver cancer diagnosis with high sensitivity and specificity. Finally, we confirmed that silencing OLFM4 could reduce liver cancer cell proliferation, which was through targeting HIF-1α. Herein, the study proposes OLFM4 as a potential biomarker and therapeutic target for liver cancer, which provides important information for studying pathogenesis and developing novel drugs against liver cancer. Materials And Methods Patients selection In the study, we recruited 100 liver cancer patients and 100 healthy controls, from Bayannur Hospital, from May 2016 to May 2020. Liver cancer patients were diagnosed using histopathological analysis. Among 100 liver cancer patients, 80 received surgery, and 20 patients underwent interventional therapy. Liver cancer was diagnosed according to immunohistochemistry according to the AASLD guide lines. Patients who received radiotherapy or had a history of other solid tumors were excluded. NASH was confirmed based on histopathology of liver biopsy samples, and supported by imaging evidences such as CT and liver ultrasound. Chronic HBV infection was confirmed by HBsAg presence for the last 6 months with an HBV DNA concentration to > 1×10 3 copies per mL as well as abnormal concentration of serum alanine amino transferase. Confirmation of chronic HCV infection is used qualitative HCV RNA measurement, and more than 1× 103 copies of HCV-RNA in the serum were confirmed to be positive. Healthy controls were identified as without liver or other systematic diseases, or HBV markers (HBsAg, HBeAg, anti-HBe, and anti-HBc), as well as normal concentrations of liver function enzymes. The study was approved by the institutional ethics review committee at Bayannur Hospital. Informed consents were obtained from all participants based on each committee's regulations. Informed written consent was obtained from all patients. Serum samples Serum samples were obtained from patients who were diagnosed with primary liver cancer at Bayannur Hospital. Serum from healthy individuals were simultaneously collected at Bayannur Hospital as control samples. Serum samples were collected under institutional approval. The serum was centrifuged, aliquoted and stored at -80°C for diagnosis utilization. Enzyme linked immunosorbent assay The concentrations of OLFM4 were detected using ELISA. ELISA kits were purchased from Abcam (catalog number: ab267805). ELISA experiments were performed in strict accordance with the manufacturers’ instructions. Reverse transcription polymerase chain reaction (qRT-PCR) Total RNA was extracted from HepG2 cells and liver biopsy using Trizol reagent from Invitrogen (Thermo Fisher, catalog number: 15596026). cDNA synthesis was performed using Maxima Universal First Strand cDNA Synthesis Kit from Thermo Scientific (catalog number: EP0742). qRT-PCR reactions were performed with FastStart Universal SYBR Green Master (Rox) from Roche (catalog number: 04913850001). The experiments were performed according to the manufacturer’s instructions. The sequences of the primers used for qRT-PCR analyses were listed in Table 1 . Table 1 Primers of OLFM4 and HIF1α. Gene Primer type sequence Tm Product size OLFM4 Sense TCAGCAAACCGTCTGTGGTT 60.11 70 Anti-sense TCCCTACCCCAAGCACCATA 59.95 HIF1α Sense GTCTGAGGGGACAGGAGGAT 60.03 80 Anti-sense CTCCTCAGGTGGCTTGTCAG 60.04 Immunohistochemical staining (IHC) For IHC analysis, liver cancer and paracancerous tissues from liver patients were formalin-fixed, followed by being embedded using paraffin method. Then, paraffin blocks were prepared into slides, followed by IHC process using standard instructions. Slides were probed with anti-OLFM4 antibody (ab10586, Abcam1), followed by were visualized using DAB + as a chromogen. Cell culture and transfection Human hepatocellular carcinoma (HepG2) cells were purchased from ATCC (ATCC HB-8065). HepG2 cells were maintained in Dulbecco modified Eagle medium (DMEM, catalog number: 11965118) containing 10% fetal bovine serum (Gibco, catalog number: 10099141C), 100 units/ml penicillin, and 0.1% (w/v) streptomycin (catalog number: 15140163) at 37°C in a humidified atmosphere of 5% CO2. SiRNAs against OLFM4 and HIF-1α against OLFM4 were synthesized by ThermoFisher Scientific. The sequences of siRNAs were listed in Table 2 . The full-length coding sequence of OLFM4 was cloned into pcDNA3.1 vector (Yuanjing Biotechnology, Guangzhou, Guangdong, China). For transfection, siRNAs or plasmids were transfected in HepG2 cells using Lipofectamine 3000 (ThermoFisher Scientific, catalog number: L3000001) according to the manufacturer’s instructions. Table 2 sequences of siRNAs. Genes siRNA sequence GC% OLFM4 OLFM4#1 AAGACCAAGCTGAAAGAGTGT 42.86 OLFM4#1 AAGGATACCATTTCTTACACT 33.33 HIF1α HIF1α#1 AAGGATGCAAATCTAGTGAAC 38.10 HIF1α#2 AAGGACAAGTCACCACAGGAC 52.38 Western blotting It was used the conventional protocol for Western blotting (WB). Briefly, cells were lysed for total protein isolation using RIPA lysis buffer (Beyotime, catalog: P0013B). The protein concentration was determined using the Bradford assay. Equal amounts of total protein were separated by SDS-PAGE electrophoresis, transferred to PVDF membranes, and blocked with 5% skim milk powder at room temperature for 1 h. Next, the PVDF membranes were washed with TBST containing NaCl, Tris-HCl, and Tween-20 and incubated with primary antibodies against target proteins including OLFM4 (Abcam, catalog number: ab267805) and β-actin (Abcam, ab8226) at 4°C overnight, followed by two washes with TBST. Then, membranes were incubated with the appropriate secondary antibodies at room temperature for 1 h and washed three times with TBST. Protein bands were visualized by chemiluminescence (BeyoECL Plus, Beyotime, P0018S, Shanghai, China). Statistical analysis Tests to examine the differences between groups included Student’s t test and one-way ANOVA. The levels of mRNA expression between cancer tissues and normal tissues were analysed by t-test. All analyses related to patient survival were tested by Kaplan–Meier survival analysis (log-rank method). A p < 0.05 was regarded as statistically significant. Results Patient Characteristics The clinical characteristics of the100 liver cancer patients were presented in Table 3 , including age, gender, BMI (body mass index), hepatitis infections, NASH status, OLFM4 blood levels, and tumor size. It is indicated that there are 62 females and 58 males; the age of male patients is 61.87 ± 1.40, while the age of female patients is 56.75 ± 2.37 (P = 0.0778); in female patients, BMI is 20.67 ± 0.27, while BMI is 20.49 ± 1.86 for male patients (P = 0.4683); there are 20 HBV infected female patients, and 31 HBV infected male patients (P = 0.895); there are 6 HCV infected female patients, and 7 HCV infected male patients (P = 0.668); there are 5 NASH female patients, and 18 NASH male patients (P = 0.059); for OLFM4 level in blood, female patients are 44.06 ± 1.67 (U/L), and male patients are 43.16 ± 2.23 (U/L) (P = 0.7815); in terms of tumor size, female patients are 2.683 ± 0.30 (mm, diameter), and male patients are 43.16 ± 2.23 (mm, diameter) (P = 1.72 ± 0.14). Table 3 basic physiological characteristics of liver cancer. Female Male P value Patients (n) 38 62 Age (years; means ± SEM) 61.87 ± 1.40 56.75 ± 2.37 0.0778 BMI 20.67 ± 0.27 20.49 ± 1.86 0.4683 Hepatitis infections HBV+ 20 31 0.895 HCV+ 6 17 0.668 NASH 5 18 0.059 OLFM4 blood levels (U/L) (mean ± SEM) 44.06 ± 1.67 43.16 ± 2.23 0.7815 Tumor size (mm, diameter) (means ± SEM) 2.683 ± 0.30 1.72 ± 0.14 0.7760 OLFM4 expression in blood and tissues To test the potential of OLFM4 as a biomarker of liver cancer, OLFM4 blood level was measured using ELISA, which indicated that OLFM4 blood level in liver cancer patients was significantly higher than in healthy individuals (Fig. 1 , P < 0.001). To further demonstrate, mRNA expression level of OLFM4 in liver paracancerous and cancer tissues was measured, which indicated that mRNA expression level of OLFM4 in liver cancer tissues was remarkably higher than liver paracancerous tissues (Fig. 2 A, P < 0.001). OLFM4 staining was observed in liver cancer tissues but not in liver paracancerous tissues (Fig. 2 B, P < 0.001). Taken together, OLFM4 expression level is significantly up-regulated in liver cancer patients. Diagnostic capability of OLFM4 expression and correlation with tumor size The receiver operating characteristic (ROC) analysis was performed to determine the diagnostic value of OLFM4 expression for liver cancer (Fig. 3 ). It indicated that both OLFM4 blood level (Fig. 3 A) and mRNA expression level in liver tissues (Fig. 3 B) had excellent diagnostic value overall, manifesting the AUCs were 0.9292 (P < 0.0001) and 0.8844 (P < 0.0001), respectively. To further assess the diagnostic value of OLFM4 for liver cancer, the correlation between OLFM4 expression and tumor size was analyzed. As shown in Fig. 4 , BMI had no clear correlation to tumor size (Fig. 4 A). Interesting, OLFM4 blood level has significant correlation to tumor size (R 2 = 0.4646, P < 0.0001) (Fig. 4 B). OLFM4 mRNA expression in liver cancer tissue has significant correlation to tumor size (R 2 = 0.5113, P < 0.0001) (Fig. 4 C). Collectively, OLFM4 has a diagnostic value to predict liver cancer, and it significantly correlated to tumor size. OLF4M closely regulated proliferation of HepG2 cells To investigate effects of OLFM4 on liver cancer, a human liver carcinoma cell line (e.g. HepG2) was used. First of all, two siRNAs against OLFM4 were constructed and both siRNAs showed knockdown effects on OLFM4 in HepG2 cells, while second siRNA showed better knockdown efficient (Fig. 5 A). Knockdown was further verified by WB assay (Fig. 5 B). Effects of siRNAs against OLFM4 on hepG2 proliferation were measured using CCK8 assay, which indicated that two siRNAs significantly reduced HepG2 proliferation (Fig. 5 C). In parallel, OLFM4 over-expression plasmids were constructed, which indicated significantly regulation of OLFM4 gene in HepG2 cells after transfection (Fig. 5 D). WB assay confirmed over-expression in HepG2 cells (Fig. 5 E). Moreover, OLFM4 over-expression significantly promoted cell proliferation in HepG2 cells (Fig. 5 F). Collectively, it is demonstrated that OLFM4 closely regulates liver cancer cell proliferation. HIF-1α involved in the regulation of OLFM4 on liver cancer HIF-1α was found to be the downstream gene of OLFM4, which encouraged to study whether HIF-1α involves in the regulation of OLFM4 on liver cancer. To this aim, two siRNAs against HIF-1α were synthesized and transfected in HepG2 cells, which indicated a significant knockdown (Fig. 6 A). Importantly, it was found that knockdown of HIF-1α significantly alleviated promotion of OLFM4 on HepG2 proliferation (Fig. 6 B). Thus, we confirmed that HIF-1α involves the regulation of OLFM4 on liver cancer cell proliferation. Discussion Liver cancer has been become one of most severe cancers causing a large number population dead in the world [ 20 ]. Although several therapies including chemotherapy, arterial embolization, surgical resection, and radiofrequency ablation have been developed to treat the diseases, while none of them is ideal due to native side effects [ 3 ]. Especially, the pathogenesis of liver cancer is not yet completely understood. Non-invasive diagnosis for liver cancers is wanted due to conventional method such as liver biopsy may cause significant morbidity [ 21 ]. In the present study, we first measured OLFM4 blood level in liver cancer patients and healthy controls, and mRNA expression in liver paracancerous and cancer tissues. It was found liver cancer patients had higher OLFM4 blood level, and liver cancer tissues had higher OLFM4 expression level than liver paracancerous tissues. ROC analysis indicated that OLFM4 had a high diagnostic value for liver cancer. OLFM4 had a strong correlation to tumor size. Last but not least, we confirmed that OLFM4 contributed to liver cancer cell proliferation in HepG2 cells, and HIF-1α involves in regulation of OLFM4 on liver cancer cell proliferation. Incidence of cancers is often different in different gender. For example, it was found that gender differences existed in cancer-associated venous thromboembolism [ 22 ]. Yang et al found that females and males had different colorectal cancer survival [ 23 ]. In lung cancer, it was found that long-time survival post curative resection in early stage non-small-cell lung cancer in women is better than in men, and women showed often more molecular changes than men [ 24 ]. However, in our study, we did found gender differences for OLFM4 blood level and tumor size in liver cancer (Table 3 ). Whether gender is different in liver cancer needs further discussion since our number of patients in our cohort is limited. Liver cancer has been found to induce the expression modification of a large body of genes. Zhang et al used bioinformatics analysis to identifying several key genes and pathways in hepatocellular carcinoma including GMPS, ACACA, ALB, TGFB1, KRAS, ERBB2, BCL2, EGFR, STAT3, and CD8A [ 25 ]. Similarly, Shen et al also found the expression level of a panel of genes such as TOP2A, NDC80, FOXM1, HMMR, KNTC1, PTTG1, FEN1, RFC4, SMC4, and PRC1 was significantly changed in hepatocellular carcinoma [ 26 ]. These genes might be potential non-invasive biomarkers for diagnosis of liver cancer. Pan et al found that SLC25A11 was downregulated in liver cancer compared to normal controls and low expression of SLC25A11 was significantly associated with clinical stage, vital status, histologic grade, overall survival (OS) and relapse-free survival (RFS), thus SLC25A11 may serve as a prognostic marker for liver cancer [ 27 ]. OLFM4 is generally considered as a marker o stem cells. Interestingly, Suzuki et al found OLFM4 expression was associated with nodal metastases in esophageal adenocarcinoma, and might be an informative marker with the potential to improve preoperative assessment in patients with esophageal adenocarcinoma [ 10 ]. Van der Flier found that OLFM4 was a robust marker for stem cells in human intestine and marks a subset of colorectal cancer cells [ 28 ]. Myama et al found that OLFM4, LY6D and S100A7 could be potent markers for distant metastasis in estrogen receptor-positive breast carcinoma [ 29 ]. Consistently, we found that blood level of OLFM4 was higher in liver cancer patients compared to healthy control, and mRNA expression was higher in liver cancer tissues than liver paracancerous tissues (Figs. 1 and 2 ). We also found that OLFM4 has a high predictive value for diagnosing liver cancer and closely correlated to tumor size (Figs. 3 and 4 ). However, Clemmensen et al analyzed the plasma levels of OLFM4 in normals and patients with gastrointestinal cancer, while there was no association being found between blood level of OLFM4 and colorectal malignancies [ 13 ]. Therefore, OLFM4 might be potential non-invasive biomarkers for several cancer types including liver cancer, while more clinical and experimental data should be accumulated to further verify the predictive capacity for liver cancers. Seeking a therapeutic target is very important for developing effective drugs to treat cancers. In the present study, it was found that OLFM4 promoted liver cancer cell proliferation (Fig. 5 ). In gastric cancer cells, it was found that depletion of OLFM4 gene inhibited cell growth and increased sensitization to hydrogen peroxide and TNFα induced apoptosis [ 30 ]. Consistent with our results, Ashizawa et al reported that OLFM4 could activate STAT3 and affiliate tumor progression by decreasing expression level of GRIM19 in human hepatocellular carcinoma [ 31 ]. Interestingly, Gao et al demonstrated that HIF-1α involved in the regulation of OLFM4 on hypoxia-induced invasion, epithelial-mesenchymal transition, and chemotherapy resistance in non-small-cell lung cancer [ 17 ]. In the present study, we also confirmed that HIF-1α involved in the regulation of OLFM4 on liver cancer cell proliferation (Fig. 6 ). Thus, OLFM4/HIF-1α axis might be a target signaling pathway for developing novel drugs to treat liver cancer. In summary, OLFM4 blood level is higher in liver cancer patients than in healthy individuals and mRNA expression level in liver cancer tissue than in liver paracancerous tissues. OLFM4 has high predictive capacity as a biomarker for liver cancer and closely correlated to tumor size. Importantly, it is confirmed that OLFM4 contributes to cancer cell proliferation, and HIF-1α involves in this activity. We believe that OLFM4/HIF-1α axis might be a target signaling pathway for developing novel drugs to treat liver cancer. Declarations Acknowledgement There is no funding to sponsor the study. Author contributions Conceptualization by Y.W. and Q.S.; data curation by F.Z. and Y.T.; formal analysis by Y.W. and Q.S.; methodology by F.Z. and Y.T.; project administration by Y.W.; supervision by Q.S.; validation by Y.W. and Q.S.; writing—original draft by Y.W.; and, writing—review & editing by Q.S. Conflict of interests All authors have no conflict of interests. Data availability statement The authors confirm that the data supporting the findings of this study are available within the article [and/or] its supplementary materials. References Global Burden of Disease Liver Cancer, Akinyemiju C, Abera T, Ahmed S, Alam M, Alemayohu N, Allen MA, Al-Raddadi C, Alvis-Guzman R, Amoako N, Artaman Y, Ayele A, Barac TA, Bensenor A, Berhane I, Bhutta A, Castillo-Rivas Z, Chitheer J, Choi A, Cowie JY, Dandona B, Dandona L, Dey R, Dicker S, Phuc D, Ekwueme H, Zaki DU, Fischer MS, Furst F, Hancock T, Hay J, Hotez SI, Jee P, Kasaeian SH, Khader A, Khang Y, Kumar YH, Kutz A, Larson M, Lopez H, Lunevicius A, Malekzadeh R, McAlinden R, Meier C, Mendoza T, Mokdad W, Moradi-Lakeh A, Nagel M, Nguyen G, Nguyen Q, Ogbo G, Patton F, Pereira G, Pourmalek DM, Qorbani F, Radfar M, Roshandel A, Salomon G, Sanabria JA, Sartorius J, Satpathy B, Sawhney M, Sepanlou M, Shackelford S, Shore K, Sun H, Mengistu J, Topor-Madry DT, Tran R, Ukwaja B, Vlassov KN, Vollset V, Vos SE, Wakayo T, Weiderpass T, Werdecker E, Yonemoto A, Younis N, Yu M, Zaidi C, Zhu Z, Murray L, C. J. L.; Naghavi M, Fitzmaurice C, The Burden of Primary Liver Cancer and Underlying Etiologies From 1990 to 2015 at the Global, Regional, and National Level: Results From the Global Burden of Disease Study 2015. JAMA Oncol 2017 , 3, (12), 1683–1691 Yamashita T, Kaneko S, [Liver Cancer]. Rinsho Byori 2016, 64, (7), 787–796 Sun JH, Luo Q, Liu LL, Song GB (2016) Liver cancer stem cell markers: Progression and therapeutic implications. World J Gastroenterol 22(13):3547–3557 Li L, Wang H, Heterogeneity of liver cancer and personalized therapy. Cancer Lett 2016 , 379, (2), 191–7 Raoul JL, Forner A, Bolondi L, Cheung TT, Kloeckner R, de Baere T (2019) Updated use of TACE for hepatocellular carcinoma treatment: How and when to use it based on clinical evidence. Cancer Treat Rev 72:28–36 Anwanwan D, Singh SK, Singh S, Saikam V, Singh R (2020) Challenges in liver cancer and possible treatment approaches. Biochim Biophys Acta Rev Cancer 1873(1):188314 Valo I, Raro P, Boissard A, Maarouf A, Jezequel P, Verriele V, Campone M, Coqueret O, Guette C (2019) OLFM4 Expression in Ductal Carcinoma In Situ and in Invasive Breast Cancer Cohorts by a SWATH-Based Proteomic Approach. Proteomics 19(21–22):e1800446 Liu W, Rodgers GP (2016) Olfactomedin 4 expression and functions in innate immunity, inflammation, and cancer. Cancer Metastasis Rev 35(2):201–212 Wang XY, Chen SH, Zhang YN, Xu CF (2018) Olfactomedin-4 in digestive diseases: A mini-review. World J Gastroenterol 24(17):1881–1887 Suzuki L, Ten Kate FJC, Gotink AW, Stoop H, Doukas M, Nieboer D, Spaander MCW, van Lanschot JJB, van Wijnhoven BPL, Koch AD, Bruno MJ, Looijenga LHJ, Biermann K, Olfactomedin 4 (OLFM4) expression is associated with nodal metastases in esophageal adenocarcinoma. PLoS One 2019, 14, (7), e0219494 Jang BG, Lee BL, Kim WH, Olfactomedin-related proteins 4 (OLFM4) expression is involved in early gastric carcinogenesis and of prognostic significance in advanced gastric cancer. Virchows Arch 2015, 467, (3), 285 – 94 Li J, Liu C, Li D, Wan M, Zhang H, Zheng X, Jie X, Zhang P, Li J, Hou H, Sun Q (2019) OLFM4 Inhibits Epithelial-Mesenchymal Transition and Metastatic Potential of Cervical Cancer Cells. Oncol Res 27(7):763–771 Clemmensen SN, Glenthoj AJ, Heeboll S, Nielsen HJ, Koch C, Borregaard N (2015) Plasma levels of OLFM4 in normals and patients with gastrointestinal cancer. J Cell Mol Med 19(12):2865–2873 Chen X, Khalid K, Chen D, Qiu C, Serum levels of olfactomedin 4: a biomarker for asthma control state in asthmatics. Ann Transl Med 2020 , 8, (7), 494 Su W, Luo L, Wu F, Lai Z, Li X, Xie Z, Tang Z, Yang Z, Liang R, Low expression of olfactomedin 4 correlates with poor prognosis in smoking patients with non-small cell lung cancer. Hum Pathol 2015, 46, (5), 732–8 Guette C, Valo I, Vetillard A, Coqueret O, Olfactomedin-4 is a candidate biomarker of solid gastric, colorectal, pancreatic, head and neck, and prostate cancers. Proteomics Clin Appl 2015, 9, (1–2), 58–63 Gao XZ, Wang GN, Zhao WG, Han J, Diao CY, Wang XH, Li SL, Li WC, Blocking OLFM4/HIF-1alpha axis alleviates hypoxia-induced invasion, epithelial-mesenchymal transition, and chemotherapy resistance in non-small-cell lung cancer. J Cell Physiol 2019 Lin MC, Lin JJ, Hsu CL, Juan HF, Lou PJ, Huang MC, GATA3 interacts with and stabilizes HIF-1alpha to enhance cancer cell invasiveness. Oncogene 2017 , 36, (30), 4380 Wei TT, Lin YT, Tang SP, Luo CK, Tsai CT, Shun CT, Chen CC (2020) Metabolic targeting of HIF-1alpha potentiates the therapeutic efficacy of oxaliplatin in colorectal cancer. Oncogene 39(2):414–427 Marengo A, Rosso C, Bugianesi E, Liver Cancer: Connections with Obesity, Fatty Liver, and Cirrhosis. Annu Rev Med 2016, 67, 103 – 17 Moreno C, Mueller S, Szabo G (2019) Non-invasive diagnosis and biomarkers in alcohol-related liver disease. J Hepatol 70(2):273–283 Riondino S, Guadagni F, Formica V, Ferroni P, Roselli M, Gender Differences in Cancer-associated Venous Thromboembolism. Curr Med Chem 2017, 24, (24), 2589–2601 Yang Y, Wang G, He J, Ren S, Wu F, Zhang J, Wang F (2017) Gender differences in colorectal cancer survival: A meta-analysis. Int J Cancer 141(10):1942–1949 Welcker K, [Gender Differences in Lung Cancer]. Zentralbl Chir 2015, 140, (3), 260–5 Zhang C, Peng L, Zhang Y, Liu Z, Li W, Chen S, Li G, The identification of key genes and pathways in hepatocellular carcinoma by bioinformatics analysis of high-throughput data. Med Oncol 2017, 34, (6), 101 Shen S, Kong J, Qiu Y, Yang X, Wang W, Yan L (2019) Identification of core genes and outcomes in hepatocellular carcinoma by bioinformatics analysis. J Cell Biochem 120(6):10069–10081 Pan G, Wang R, Jia S, Li Y, Jiao Y, Liu N (2020) SLC25A11 serves as a novel prognostic biomarker in liver cancer. Sci Rep 10(1):9871 van der Flier LG, Haegebarth A, Stange DE, van de Wetering M, Clevers H, OLFM4 is a robust marker for stem cells in human intestine and marks a subset of colorectal cancer cells. Gastroenterology 2009, 137, (1), 15 – 7 Mayama A, Takagi K, Suzuki H, Sato A, Onodera Y, Miki Y, Sakurai M, Watanabe T, Sakamoto K, Yoshida R, Ishida T, Sasano H, Suzuki T, OLFM4, LY6D and S100A7 as potent markers for distant metastasis in estrogen receptor-positive breast carcinoma. Cancer Sci 2018 , 109, (10), 3350–3359 Liu RH, Yang MH, Xiang H, Bao LM, Yang HA, Yue LW, Jiang X, Ang N, Wu LY, Huang Y (2012) Depletion of OLFM4 gene inhibits cell growth and increases sensitization to hydrogen peroxide and tumor necrosis factor-alpha induced-apoptosis in gastric cancer cells. J Biomed Sci 19:38 Ashizawa Y, Kuboki S, Nojima H, Yoshitomi H, Furukawa K, Takayashiki T, Takano S, Miyazaki M, Ohtsuka M, OLFM4 Enhances STAT3 Activation and Promotes Tumor Progression by Inhibiting GRIM19 Expression in Human Hepatocellular Carcinoma. Hepatol Commun 2019, 3, (7), 954–970 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-686335\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":38589198,\"identity\":\"f721f885-a461-4106-a47f-065f6e5f413b\",\"order_by\":0,\"name\":\"Qingzhu Song\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABCElEQVRIiWNgGAWjYNACAyCWYGD//KPCRo6Nvf0A0VrYmBnOpBnz8ZxJINImkBbGlkOJ8yQcDPAqlG/vPfziTcEdu/mze8weFzYcSG+TYEhg+FGxDbeTzpxLs5xj8Cy5cc4Zc+OZO+7ktkk3HmDsOXMbtxaJHDNjHoPDycwSOQYSvGee5bbJHEhgZmzDrUV+BlQLG1hL2+F0NokEA7xaGG7kGD8GarHjAVonDdSSQFCLwZkzZoxzDA4nSEikFRvOOJNm2AYM5IP4/CLf3mP84c2fw/byM5I3PvhQYSMv395+8MGPCjwOY2Bgk+BhYEhsQBY6gE89EDB/AGqxJ6BoFIyCUTAKRjIAAIFCW1JwvSSqAAAAAElFTkSuQmCC\",\"orcid\":\"https://orcid.org/0000-0003-2055-7300\",\"institution\":\"Bayannur Hospital\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Qingzhu\",\"middleName\":\"\",\"lastName\":\"Song\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2021-07-04 14:32:38\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-686335/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-686335/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":11430195,\"identity\":\"5bae5229-d556-4b38-9997-1f9978292d05\",\"added_by\":\"auto\",\"created_at\":\"2021-07-13 21:16:28\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":9911,\"visible\":true,\"origin\":\"\",\"legend\":\"The blood level of OLFM4 in healthy individuals and liver cancer patients. ***P\\u003c0.001. \",\"description\":\"\",\"filename\":\"fig1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-686335/v1/a7b4030354d04bf6a32ab175.png\"},{\"id\":11430261,\"identity\":\"d8a499a2-b418-457a-88c1-8f8d042170b2\",\"added_by\":\"auto\",\"created_at\":\"2021-07-13 21:19:28\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2145806,\"visible\":true,\"origin\":\"\",\"legend\":\"mRNA and protein levels of OLFM4 in para-carcinoma tissue and cancer tissue in liver cancer patients. (A) mRNA expression of OLFM4 in para-carcinoma tissue and cancer tissue in liver cancer patients measured by qRT-PCR assay, ***P\\u003c0.001; (B) protein levels of OLFM4 in para-carcinoma tissue and cancer tissue in liver cancer patients measured by IHC assay.\",\"description\":\"\",\"filename\":\"fig2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-686335/v1/dc03f9ccd41e26072b076d7c.png\"},{\"id\":11430196,\"identity\":\"2a5156c9-6a01-4b60-8bde-47482f42fed8\",\"added_by\":\"auto\",\"created_at\":\"2021-07-13 21:16:28\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":29922,\"visible\":true,\"origin\":\"\",\"legend\":\"ROC analysis of the performance of OLFM4 expression in identification of liver cancer. (A) ROC analysis using blood level of OLFM4 to predict liver cancer; (B) ROC analysis using mRNA expression of OLFM4 in liver cancer tissue to predict liver cancer. \",\"description\":\"\",\"filename\":\"fig3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-686335/v1/e1b9982e66c7e5b18b8ea7d1.png\"},{\"id\":11430199,\"identity\":\"8217e220-8e7b-4843-aa8a-17e3dc276d8e\",\"added_by\":\"auto\",\"created_at\":\"2021-07-13 21:16:28\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":30008,\"visible\":true,\"origin\":\"\",\"legend\":\"Correlation of OLFM4 to tumor size. (A) correlation analysis about BMI to tumor size; (B) correlation analysis about OLFM4 blood level to tumor size; (C) correlation analysis about mRNA expression of OLFM4 in liver cancer tissue to tumor size. \",\"description\":\"\",\"filename\":\"fig4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-686335/v1/e19b23456bbe888d366ba706.png\"},{\"id\":11430200,\"identity\":\"d2e99d5f-b3b5-41f1-b320-8cb73a054521\",\"added_by\":\"auto\",\"created_at\":\"2021-07-13 21:16:29\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":435975,\"visible\":true,\"origin\":\"\",\"legend\":\"OLFM4 regulated liver cancer cell proliferation in HepG2 cells. (A) siRNAs against OLFM4 successfully inhibited mRNA expression of OLFM4 in HepG2 cells measured by qRT-PCR assay (**P\\u003c0.01); (B) siRNAs against OLFM4 successfully inhibited protein level of OLFM4 in HepG2 cells measured by western blot assay; (C) siRNAs against OLFM4 could inhibit proliferation of HepG2 cells (*P\\u003c0.05, **P\\u003c0.01); (D) OLFM4 plasmid transfection could over-express the gene in HepG2 cells detected by qRT-PCR assay (***P\\u003c0.001); (E) OLFM4 plasmid transfection could up-regulate the protein level of OLFM4 in HepG2 cells detected by western blot assay; (F) OLFM4 plasmid could affiliate proliferation of HepG2 cells (**P\\u003c0.01).\",\"description\":\"\",\"filename\":\"fig5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-686335/v1/5c90283ff2176433e0a82042.png\"},{\"id\":11430197,\"identity\":\"9e2a397f-bc0e-4b6f-adaa-b52676b39f4b\",\"added_by\":\"auto\",\"created_at\":\"2021-07-13 21:16:28\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":15271,\"visible\":true,\"origin\":\"\",\"legend\":\"HIF1α involved in regulation of OLFM4 on liver cancer proliferation. (A) siRNAs against HIF1α successfully inhibited mRNA expression of HIF1α in HepG2 cells measured by qRT-PCR assay (**P\\u003c0.01, ***P\\u003c0.001); (B) the knockdown of HIF1α alleviated increase of OLFM4 plasmid on liver cancer proliferation in HepG2 cells. \",\"description\":\"\",\"filename\":\"fig6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-686335/v1/c59eb4c7c30a8b82e63f8221.png\"},{\"id\":13885982,\"identity\":\"d6b2cfab-465c-4f75-949c-3931801aee89\",\"added_by\":\"auto\",\"created_at\":\"2021-09-22 20:06:35\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1315965,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-686335/v1/7fa4ce8d-10e8-4dab-b3e6-b9059480231d.pdf\"}],\"financialInterests\":\"\",\"formattedTitle\":\"\\u003cp\\u003eOlfm4 Is Highly Expressed In Liver Cancer Patients And As A Biomarker And Therapeutic Target For Liver Cancer\\u003c/p\\u003e\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eLiver cancer has been the fourth leading cause of cancer death after lung, colorectal, and stomach cancer, and the incidence is still increasing in the world [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. For liver cancer, the most common type is hepatocellular carcinoma, followed by cholangiocarcinoma [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. The pathogenesis of liver cancer is complicated, among them, infections including hepatitis B virus (HBV), hepatitis C virus (HCV), behavioral factors (alcohol, tobacco), metabolic factors (excess body fatness), and aflatoxins are thought to be the major risks [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. In general, chemotherapy and immunotherapy are the mostly used in treating hepatocellular carcinomas (HCCs) [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. For the more advanced stages of liver cancers,trans-arterial chemoembolization (TACE) is often used, which is reported to reach a 23% improvement in the 2-year survival compared with the conservative therapy for intermediate stage HCC patients [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. As a kinase inhibitor, the oral format of sorafenib is also often used in the late-stage liver cancers, while its effects are far away from satisfactions and long-term utilization of the drug may cause toxicity and/or drug inefficacy [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. Moreover, the prognosis of the liver cancer is low; resulting in that only low ratio of liver cancer patients is eligible for surgical removal [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. Therefore, the more effective therapies are needed to treat liver cancers. Importantly, the discovery of key genes involving in pathogenesis of liver cancers plays an important role in developing novel therapies treating liver cancers.\\u003c/p\\u003e \\u003cp\\u003eOLFM4 (olfactomedin 4) belongs to the olfactomedin family, which is also known as hGC-1 (human granulocyte colony-stimulating factor-stimulated clone 1) [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. Initially, OLFM4 was found to regulate inflammatory response and innate immunity [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. Moreover, as a secreted protein OLFM4 is closely involved in a variety of cellular functions including proliferation, differentiation, apoptosis, and cell adhesion [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. Recently, accumulating evidence confirming that OLFM4 plays an important role in regulating growth and proliferation of several types of cancer cells [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. In esophageal adenocarcinoma, it was found that OLFM4 is closely linked to the nodal metastases [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. The expression level is found to significantly increased in intestinal metaplasia (IM), while it is absent in normal gastric mucosa [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. In terms of metastatic breast cancer, it was found that the expression level of OLFM4 is remarkably associated to pathological T factor, distant metastasis and Ki67 status in the ER-positive breast carcinomas [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. OLFM4 is thought to be a potential biomarker for gastrointestinal cancers [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. In fact, OLFM4 serum level has been biomarker of a variety of diseases including asthmatics [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e], non-small cell lung cancer [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e], pancreatic, head and neck, and prostate cancers [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. However, effects of OLFM4 in liver cancers remain unclear, which needs more investigations.\\u003c/p\\u003e \\u003cp\\u003eOLFM4/HIF-1α axis was found to involve in regulation of hypoxia-induced invasion, epithelial-mesenchymal transition, and chemotherapy resistance in non-small-cell lung cancer [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. HIF-1α is a subunit of a heterodimeric transcription factor hypoxia-inducible factor 1 (HIF-1), which exerts an essential role in cellular response to systemic oxygen levels in mammals [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. HIF-1α closely involves in pathogenesis of cancers. HIF-1α and GATA3 forms a complex to enhance cancer cell invasiveness [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. Targeting HIF-1α is considered to be a potential therapy for alleviating chemoresistance to enhance the efficacy of chemotherapies in colon cancers [\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. Interestingly, it was found that inhibition of OLFM4/HIF-1α axis could improve hypoxia-induced invasion, epithelial-mesenchymal transition, and chemotherapy resistance of non-small-cell lung cancer [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. Therefore, in the study, we first measured the blood level of OLFM4 in the healthy control and liver cancer patients, and OLFM4 RNA and protein level in liver para-carcinoma tissue and tumor. We confirmed that OLFM4 might be a potential biomarker for liver cancer diagnosis with high sensitivity and specificity. Finally, we confirmed that silencing OLFM4 could reduce liver cancer cell proliferation, which was through targeting HIF-1α. Herein, the study proposes OLFM4 as a potential biomarker and therapeutic target for liver cancer, which provides important information for studying pathogenesis and developing novel drugs against liver cancer.\\u003c/p\\u003e\"},{\"header\":\"Materials And Methods\",\"content\":\"\\u003cdiv class=\\\"Section2\\\" id=\\\"Sec3\\\"\\u003e\\n \\u003ch2\\u003ePatients selection\\u003c/h2\\u003e\\n \\u003cp\\u003eIn the study, we recruited 100 liver cancer patients and 100 healthy controls, from Bayannur Hospital, from May 2016 to May 2020. Liver cancer patients were diagnosed using histopathological analysis. Among 100 liver cancer patients, 80 received surgery, and 20 patients underwent interventional therapy. Liver cancer was diagnosed according to immunohistochemistry according to the AASLD guide lines. Patients who received radiotherapy or had a history of other solid tumors were excluded. NASH was confirmed based on histopathology of liver biopsy samples, and supported by imaging evidences such as CT and liver ultrasound. Chronic HBV infection was confirmed by HBsAg presence for the last 6 months with an HBV DNA concentration to \\u0026gt;\\u0026thinsp;1\\u0026times;10\\u003csup\\u003e3\\u003c/sup\\u003e copies per mL as well as abnormal concentration of serum alanine amino transferase. Confirmation of chronic HCV infection is used qualitative HCV RNA measurement, and more than 1\\u0026times; 103 copies of HCV-RNA in the serum were confirmed to be positive. Healthy controls were identified as without liver or other systematic diseases, or HBV markers (HBsAg, HBeAg, anti-HBe, and anti-HBc), as well as normal concentrations of liver function enzymes. The study was approved by the institutional ethics review committee at Bayannur Hospital. Informed consents were obtained from all participants based on each committee\\u0026apos;s regulations. Informed written consent was obtained from all patients.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv class=\\\"Section2\\\" id=\\\"Sec4\\\"\\u003e\\n \\u003ch2\\u003eSerum samples\\u003c/h2\\u003e\\n \\u003cp\\u003eSerum samples were obtained from patients who were diagnosed with primary liver cancer at Bayannur Hospital. Serum from healthy individuals were simultaneously collected at Bayannur Hospital as control samples. Serum samples were collected under institutional approval. The serum was centrifuged, aliquoted and stored at -80\\u0026deg;C for diagnosis utilization.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv class=\\\"Section2\\\" id=\\\"Sec5\\\"\\u003e\\n \\u003ch2\\u003eEnzyme linked immunosorbent assay\\u003c/h2\\u003e\\n \\u003cp\\u003eThe concentrations of OLFM4 were detected using ELISA. ELISA kits were purchased from Abcam (catalog number: ab267805). ELISA experiments were performed in strict accordance with the manufacturers\\u0026rsquo; instructions.\\u003c/p\\u003e\\n \\u003ch2\\u003eReverse transcription polymerase chain reaction (qRT-PCR)\\u003c/h2\\u003e\\n\\u003c/div\\u003e\\n\\u003cp\\u003eTotal RNA was extracted from HepG2 cells and liver biopsy using Trizol reagent from Invitrogen (Thermo Fisher, catalog number: 15596026). cDNA synthesis was performed using Maxima Universal First Strand cDNA Synthesis Kit from Thermo Scientific (catalog number: EP0742). qRT-PCR reactions were performed with FastStart Universal SYBR Green Master (Rox) from Roche (catalog number: 04913850001). The experiments were performed according to the manufacturer\\u0026rsquo;s instructions. The sequences of the primers used for qRT-PCR analyses were listed in Table \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e\\n\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable border=\\\"1\\\" id=\\\"Tab1\\\"\\u003e\\n \\u003ccaption language=\\\"En\\\"\\u003e\\n \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e\\n \\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\n \\u003cp\\u003ePrimers of OLFM4 and HIF1\\u0026alpha;.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003c/caption\\u003e\\n \\u003ccolgroup cols=\\\"5\\\"\\u003e\\u003c/colgroup\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGene\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003ePrimer type\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003esequence\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eTm\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eProduct size\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003eOLFM4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eSense\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eTCAGCAAACCGTCTGTGGTT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e60.11\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e70\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAnti-sense\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eTCCCTACCCCAAGCACCATA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e59.95\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003eHIF1\\u0026alpha;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eSense\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGTCTGAGGGGACAGGAGGAT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e60.03\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e80\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAnti-sense\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCTCCTCAGGTGGCTTGTCAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e60.04\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n \\u003c/table\\u003e\\n\\u003c/div\\u003e\\n\\u003ch2\\u003eImmunohistochemical staining (IHC)\\u003c/h2\\u003e\\n\\u003cp\\u003eFor IHC analysis, liver cancer and paracancerous tissues from liver patients were formalin-fixed, followed by being embedded using paraffin method. Then, paraffin blocks were prepared into slides, followed by IHC process using standard instructions. Slides were probed with anti-OLFM4 antibody (ab10586, Abcam1), followed by were visualized using DAB\\u0026thinsp;+\\u0026thinsp;as a chromogen.\\u003c/p\\u003e\\n\\u003cdiv class=\\\"Section2\\\" id=\\\"Sec8\\\"\\u003e\\n \\u003ch2\\u003eCell culture and transfection\\u003c/h2\\u003e\\n \\u003cp\\u003eHuman hepatocellular carcinoma (HepG2) cells were purchased from ATCC (ATCC HB-8065). HepG2 cells were maintained in Dulbecco modified Eagle medium (DMEM, catalog number: 11965118) containing 10% fetal bovine serum (Gibco, catalog number: 10099141C), 100 units/ml penicillin, and 0.1% (w/v) streptomycin (catalog number: 15140163) at 37\\u0026deg;C in a humidified atmosphere of 5% CO2.\\u003c/p\\u003e\\n \\u003cp\\u003eSiRNAs against OLFM4 and HIF-1\\u0026alpha; against OLFM4 were synthesized by ThermoFisher Scientific. The sequences of siRNAs were listed in Table\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e. The full-length coding sequence of OLFM4 was cloned into pcDNA3.1 vector (Yuanjing Biotechnology, Guangzhou, Guangdong, China). For transfection, siRNAs or plasmids were transfected in HepG2 cells using Lipofectamine 3000 (ThermoFisher Scientific, catalog number: L3000001) according to the manufacturer\\u0026rsquo;s instructions.\\u003c/p\\u003e\\n \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable border=\\\"1\\\" id=\\\"Tab2\\\"\\u003e\\n \\u003ccaption language=\\\"En\\\"\\u003e\\n \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e\\n \\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\n \\u003cp\\u003esequences of siRNAs.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003c/caption\\u003e\\n \\u003ccolgroup cols=\\\"4\\\"\\u003e\\u003c/colgroup\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGenes\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003esiRNA\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003esequence\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGC%\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003eOLFM4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eOLFM4#1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAAGACCAAGCTGAAAGAGTGT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e42.86\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eOLFM4#1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAAGGATACCATTTCTTACACT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e33.33\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003eHIF1\\u0026alpha;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHIF1\\u0026alpha;#1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAAGGATGCAAATCTAGTGAAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e38.10\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHIF1\\u0026alpha;#2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAAGGACAAGTCACCACAGGAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e52.38\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n \\u003c/table\\u003e\\n \\u003c/div\\u003e\\n \\u003c/div\\u003e\\n\\u003cdiv class=\\\"Section2\\\" id=\\\"Sec9\\\"\\u003e\\n \\u003ch2\\u003eWestern blotting\\u003c/h2\\u003e\\n \\u003cp\\u003eIt was used the conventional protocol for Western blotting (WB). Briefly, cells were lysed for total protein isolation using RIPA lysis buffer (Beyotime, catalog: P0013B). The protein concentration was determined using the Bradford assay. Equal amounts of total protein were separated by SDS-PAGE electrophoresis, transferred to PVDF membranes, and blocked with 5% skim milk powder at room temperature for 1 h. Next, the PVDF membranes were washed with TBST containing NaCl, Tris-HCl, and Tween-20 and incubated with primary antibodies against target proteins including OLFM4 (Abcam, catalog number: ab267805) and \\u0026beta;-actin (Abcam, ab8226) at 4\\u0026deg;C overnight, followed by two washes with TBST. Then, membranes were incubated with the appropriate secondary antibodies at room temperature for 1 h and washed three times with TBST. Protein bands were visualized by chemiluminescence (BeyoECL Plus, Beyotime, P0018S, Shanghai, China).\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv class=\\\"Section2\\\" id=\\\"Sec10\\\"\\u003e\\n \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e\\n \\u003cp\\u003eTests to examine the differences between groups included Student\\u0026rsquo;s t test and one-way ANOVA. The levels of mRNA expression between cancer tissues and normal tissues were analysed by t-test. All analyses related to patient survival were tested by Kaplan\\u0026ndash;Meier survival analysis (log-rank method). A p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was regarded as statistically significant.\\u003c/p\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv class=\\\"Section2\\\" id=\\\"Sec12\\\"\\u003e\\n \\u003ch2\\u003ePatient Characteristics\\u003c/h2\\u003e\\n \\u003cp\\u003eThe clinical characteristics of the100 liver cancer patients were presented in Table \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e, including age, gender, BMI (body mass index), hepatitis infections, NASH status, OLFM4 blood levels, and tumor size. It is indicated that there are 62 females and 58 males; the age of male patients is 61.87\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.40, while the age of female patients is 56.75\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.37 (P\\u0026thinsp;=\\u0026thinsp;0.0778); in female patients, BMI is 20.67\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.27, while BMI is 20.49\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.86 for male patients (P\\u0026thinsp;=\\u0026thinsp;0.4683); there are 20 HBV infected female patients, and 31 HBV infected male patients (P\\u0026thinsp;=\\u0026thinsp;0.895); there are 6 HCV infected female patients, and 7 HCV infected male patients (P\\u0026thinsp;=\\u0026thinsp;0.668); there are 5 NASH female patients, and 18 NASH male patients (P\\u0026thinsp;=\\u0026thinsp;0.059); for OLFM4 level in blood, female patients are 44.06\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.67 (U/L), and male patients are 43.16\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.23 (U/L) (P\\u0026thinsp;=\\u0026thinsp;0.7815); in terms of tumor size, female patients are 2.683\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.30 (mm, diameter), and male patients are 43.16\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.23 (mm, diameter) (P\\u0026thinsp;=\\u0026thinsp;1.72\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.14).\\u003c/p\\u003e\\n \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable border=\\\"1\\\" id=\\\"Tab3\\\"\\u003e\\n \\u003ccaption language=\\\"En\\\"\\u003e\\n \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 3\\u003c/div\\u003e\\n \\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\n \\u003cp\\u003ebasic physiological characteristics of liver cancer.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003c/caption\\u003e\\n \\u003ccolgroup cols=\\\"5\\\"\\u003e\\u003c/colgroup\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eFemale\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eMale\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eP value\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003ePatients (n)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e38\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e62\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAge (years; means\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e61.87\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.40\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e56.75\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.37\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e0.0778\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eBMI\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e20.67\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.27\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e20.49\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.86\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e0.4683\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHepatitis infections\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHBV+\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e20\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e31\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e0.895\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHCV+\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e17\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e0.668\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eNASH\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e18\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e0.059\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eOLFM4 blood levels (U/L) (mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e44.06\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.67\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e43.16\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.23\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e0.7815\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eTumor size (mm, diameter) (means\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e2.683\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.30\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e1.72\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.14\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e0.7760\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n \\u003c/table\\u003e\\n \\u003c/div\\u003e\\n \\u003ch2\\u003eOLFM4 expression in blood and tissues\\u003c/h2\\u003e\\n\\u003c/div\\u003e\\n\\u003cp\\u003eTo test the potential of OLFM4 as a biomarker of liver cancer, OLFM4 blood level was measured using ELISA, which indicated that OLFM4 blood level in liver cancer patients was significantly higher than in healthy individuals (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001). To further demonstrate, mRNA expression level of OLFM4 in liver paracancerous and cancer tissues was measured, which indicated that mRNA expression level of OLFM4 in liver cancer tissues was remarkably higher than liver paracancerous tissues (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001). OLFM4 staining was observed in liver cancer tissues but not in liver paracancerous tissues (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001). Taken together, OLFM4 expression level is significantly up-regulated in liver cancer patients.\\u003c/p\\u003e\\n\\u003ch2\\u003eDiagnostic capability of OLFM4 expression and correlation with tumor size\\u003c/h2\\u003e\\n\\u003cp\\u003eThe receiver operating characteristic (ROC) analysis was performed to determine the diagnostic value of OLFM4 expression for liver cancer (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). It indicated that both OLFM4 blood level (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA) and mRNA expression level in liver tissues (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB) had excellent diagnostic value overall, manifesting the AUCs were 0.9292 (P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) and 0.8844 (P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001), respectively.\\u003c/p\\u003e\\n\\u003cp\\u003eTo further assess the diagnostic value of OLFM4 for liver cancer, the correlation between OLFM4 expression and tumor size was analyzed. As shown in Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e, BMI had no clear correlation to tumor size (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA). Interesting, OLFM4 blood level has significant correlation to tumor size (R\\u003csup\\u003e2\\u003c/sup\\u003e\\u0026thinsp;=\\u0026thinsp;0.4646, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB). OLFM4 mRNA expression in liver cancer tissue has significant correlation to tumor size (R\\u003csup\\u003e2\\u003c/sup\\u003e\\u0026thinsp;=\\u0026thinsp;0.5113, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC). Collectively, OLFM4 has a diagnostic value to predict liver cancer, and it significantly correlated to tumor size.\\u003c/p\\u003e\\n\\u003ch2\\u003eOLF4M closely regulated proliferation of HepG2 cells\\u0026nbsp;\\u003c/h2\\u003e\\n\\u003cp\\u003eTo investigate effects of OLFM4 on liver cancer, a human liver carcinoma cell line (e.g. HepG2) was used. First of all, two siRNAs against OLFM4 were constructed and both siRNAs showed knockdown effects on OLFM4 in HepG2 cells, while second siRNA showed better knockdown efficient (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA). Knockdown was further verified by WB assay (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB). Effects of siRNAs against OLFM4 on hepG2 proliferation were measured using CCK8 assay, which indicated that two siRNAs significantly reduced HepG2 proliferation (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC). In parallel, OLFM4 over-expression plasmids were constructed, which indicated significantly regulation of OLFM4 gene in HepG2 cells after transfection (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eD). WB assay confirmed over-expression in HepG2 cells (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eE). Moreover, OLFM4 over-expression significantly promoted cell proliferation in HepG2 cells (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eF). Collectively, it is demonstrated that OLFM4 closely regulates liver cancer cell proliferation.\\u003c/p\\u003e\\n\\u003ch2\\u003eHIF-1\\u0026alpha; involved in the regulation of OLFM4 on liver cancer\\u003c/h2\\u003e\\n\\u003cp\\u003eHIF-1\\u0026alpha; was found to be the downstream gene of OLFM4, which encouraged to study whether HIF-1\\u0026alpha; involves in the regulation of OLFM4 on liver cancer. To this aim, two siRNAs against HIF-1\\u0026alpha; were synthesized and transfected in HepG2 cells, which indicated a significant knockdown (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA). Importantly, it was found that knockdown of HIF-1\\u0026alpha; significantly alleviated promotion of OLFM4 on HepG2 proliferation (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eB). Thus, we confirmed that HIF-1\\u0026alpha; involves the regulation of OLFM4 on liver cancer cell proliferation.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eLiver cancer has been become one of most severe cancers causing a large number population dead in the world [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. Although several therapies including chemotherapy, arterial embolization, surgical resection, and radiofrequency ablation have been developed to treat the diseases, while none of them is ideal due to native side effects [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. Especially, the pathogenesis of liver cancer is not yet completely understood. Non-invasive diagnosis for liver cancers is wanted due to conventional method such as liver biopsy may cause significant morbidity [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. In the present study, we first measured OLFM4 blood level in liver cancer patients and healthy controls, and mRNA expression in liver paracancerous and cancer tissues. It was found liver cancer patients had higher OLFM4 blood level, and liver cancer tissues had higher OLFM4 expression level than liver paracancerous tissues. ROC analysis indicated that OLFM4 had a high diagnostic value for liver cancer. OLFM4 had a strong correlation to tumor size. Last but not least, we confirmed that OLFM4 contributed to liver cancer cell proliferation in HepG2 cells, and HIF-1α involves in regulation of OLFM4 on liver cancer cell proliferation.\\u003c/p\\u003e \\u003cp\\u003eIncidence of cancers is often different in different gender. For example, it was found that gender differences existed in cancer-associated venous thromboembolism [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. Yang et al found that females and males had different colorectal cancer survival [\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. In lung cancer, it was found that long-time survival post curative resection in early stage non-small-cell lung cancer in women is better than in men, and women showed often more molecular changes than men [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. However, in our study, we did found gender differences for OLFM4 blood level and tumor size in liver cancer (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). Whether gender is different in liver cancer needs further discussion since our number of patients in our cohort is limited.\\u003c/p\\u003e \\u003cp\\u003eLiver cancer has been found to induce the expression modification of a large body of genes. Zhang et al used bioinformatics analysis to identifying several key genes and pathways in hepatocellular carcinoma including GMPS, ACACA, ALB, TGFB1, KRAS, ERBB2, BCL2, EGFR, STAT3, and CD8A [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. Similarly, Shen et al also found the expression level of a panel of genes such as TOP2A, NDC80, FOXM1, HMMR, KNTC1, PTTG1, FEN1, RFC4, SMC4, and PRC1 was significantly changed in hepatocellular carcinoma [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. These genes might be potential non-invasive biomarkers for diagnosis of liver cancer. Pan et al found that SLC25A11 was downregulated in liver cancer compared to normal controls and low expression of SLC25A11 was significantly associated with clinical stage, vital status, histologic grade, overall survival (OS) and relapse-free survival (RFS), thus SLC25A11 may serve as a prognostic marker for liver cancer [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. OLFM4 is generally considered as a marker o stem cells. Interestingly, Suzuki et al found OLFM4 expression was associated with nodal metastases in esophageal adenocarcinoma, and might be an informative marker with the potential to improve preoperative assessment in patients with esophageal adenocarcinoma [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. Van der Flier found that OLFM4 was a robust marker for stem cells in human intestine and marks a subset of colorectal cancer cells [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. Myama et al found that OLFM4, LY6D and S100A7 could be potent markers for distant metastasis in estrogen receptor-positive breast carcinoma [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. Consistently, we found that blood level of OLFM4 was higher in liver cancer patients compared to healthy control, and mRNA expression was higher in liver cancer tissues than liver paracancerous tissues (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). We also found that OLFM4 has a high predictive value for diagnosing liver cancer and closely correlated to tumor size (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e and \\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). However, Clemmensen et al analyzed the plasma levels of OLFM4 in normals and patients with gastrointestinal cancer, while there was no association being found between blood level of OLFM4 and colorectal malignancies [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. Therefore, OLFM4 might be potential non-invasive biomarkers for several cancer types including liver cancer, while more clinical and experimental data should be accumulated to further verify the predictive capacity for liver cancers.\\u003c/p\\u003e \\u003cp\\u003eSeeking a therapeutic target is very important for developing effective drugs to treat cancers. In the present study, it was found that OLFM4 promoted liver cancer cell proliferation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e). In gastric cancer cells, it was found that depletion of OLFM4 gene inhibited cell growth and increased sensitization to hydrogen peroxide and TNFα induced apoptosis [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. Consistent with our results, Ashizawa et al reported that OLFM4 could activate STAT3 and affiliate tumor progression by decreasing expression level of GRIM19 in human hepatocellular carcinoma [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. Interestingly, Gao et al demonstrated that HIF-1α involved in the regulation of OLFM4 on hypoxia-induced invasion, epithelial-mesenchymal transition, and chemotherapy resistance in non-small-cell lung cancer [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. In the present study, we also confirmed that HIF-1α involved in the regulation of OLFM4 on liver cancer cell proliferation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e). Thus, OLFM4/HIF-1α axis might be a target signaling pathway for developing novel drugs to treat liver cancer.\\u003c/p\\u003e \\u003cp\\u003eIn summary, OLFM4 blood level is higher in liver cancer patients than in healthy individuals and mRNA expression level in liver cancer tissue than in liver paracancerous tissues. OLFM4 has high predictive capacity as a biomarker for liver cancer and closely correlated to tumor size. Importantly, it is confirmed that OLFM4 contributes to cancer cell proliferation, and HIF-1α involves in this activity. We believe that OLFM4/HIF-1α axis might be a target signaling pathway for developing novel drugs to treat liver cancer.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgement\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThere is no funding to sponsor the study. \\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eConceptualization by Y.W. and Q.S.; data curation by F.Z. and Y.T.; formal analysis by Y.W. and Q.S.; methodology by F.Z. and Y.T.; project administration by Y.W.; supervision by Q.S.; validation by Y.W. and Q.S.; writing\\u0026mdash;original draft by Y.W.; and, writing\\u0026mdash;review \\u0026amp; editing by Q.S.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll authors have no conflict of interests.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData availability statement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors confirm that the data supporting the findings of this study are available within the article [and/or] its supplementary materials.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e \\u003cli\\u003e\\u003cspan\\u003eGlobal Burden of Disease Liver Cancer, Akinyemiju C, Abera T, Ahmed S, Alam M, Alemayohu N, Allen MA, Al-Raddadi C, Alvis-Guzman R, Amoako N, Artaman Y, Ayele A, Barac TA, Bensenor A, Berhane I, Bhutta A, Castillo-Rivas Z, Chitheer J, Choi A, Cowie JY, Dandona B, Dandona L, Dey R, Dicker S, Phuc D, Ekwueme H, Zaki DU, Fischer MS, Furst F, Hancock T, Hay J, Hotez SI, Jee P, Kasaeian SH, Khader A, Khang Y, Kumar YH, Kutz A, Larson M, Lopez H, Lunevicius A, Malekzadeh R, McAlinden R, Meier C, Mendoza T, Mokdad W, Moradi-Lakeh A, Nagel M, Nguyen G, Nguyen Q, Ogbo G, Patton F, Pereira G, Pourmalek DM, Qorbani F, Radfar M, Roshandel A, Salomon G, Sanabria JA, Sartorius J, Satpathy B, Sawhney M, Sepanlou M, Shackelford S, Shore K, Sun H, Mengistu J, Topor-Madry DT, Tran R, Ukwaja B, Vlassov KN, Vollset V, Vos SE, Wakayo T, Weiderpass T, Werdecker E, Yonemoto A, Younis N, Yu M, Zaidi C, Zhu Z, Murray L, C. J. L.; Naghavi M, Fitzmaurice C, The Burden of Primary Liver Cancer and Underlying Etiologies From 1990 to 2015 at the Global, Regional, and National Level: Results From the Global Burden of Disease Study 2015. \\u003cem\\u003eJAMA Oncol\\u003c/em\\u003e \\u003cb\\u003e2017\\u003c/b\\u003e, 3, (12), 1683\\u0026ndash;1691\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYamashita T, Kaneko S, [Liver Cancer]. \\u003cem\\u003eRinsho Byori\\u003c/em\\u003e 2016, 64, (7), 787\\u0026ndash;796\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSun JH, Luo Q, Liu LL, Song GB (2016) Liver cancer stem cell markers: Progression and therapeutic implications. World J Gastroenterol 22(13):3547\\u0026ndash;3557\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi L, Wang H, Heterogeneity of liver cancer and personalized therapy. \\u003cem\\u003eCancer Lett\\u003c/em\\u003e \\u003cb\\u003e2016\\u003c/b\\u003e, 379, (2), 191\\u0026ndash;7\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRaoul JL, Forner A, Bolondi L, Cheung TT, Kloeckner R, de Baere T (2019) Updated use of TACE for hepatocellular carcinoma treatment: How and when to use it based on clinical evidence. Cancer Treat Rev 72:28\\u0026ndash;36\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAnwanwan D, Singh SK, Singh S, Saikam V, Singh R (2020) Challenges in liver cancer and possible treatment approaches. Biochim Biophys Acta Rev Cancer 1873(1):188314\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eValo I, Raro P, Boissard A, Maarouf A, Jezequel P, Verriele V, Campone M, Coqueret O, Guette C (2019) OLFM4 Expression in Ductal Carcinoma In Situ and in Invasive Breast Cancer Cohorts by a SWATH-Based Proteomic Approach. Proteomics 19(21\\u0026ndash;22):e1800446\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu W, Rodgers GP (2016) Olfactomedin 4 expression and functions in innate immunity, inflammation, and cancer. Cancer Metastasis Rev 35(2):201\\u0026ndash;212\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang XY, Chen SH, Zhang YN, Xu CF (2018) Olfactomedin-4 in digestive diseases: A mini-review. World J Gastroenterol 24(17):1881\\u0026ndash;1887\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSuzuki L, Ten Kate FJC, Gotink AW, Stoop H, Doukas M, Nieboer D, Spaander MCW, van Lanschot JJB, van Wijnhoven BPL, Koch AD, Bruno MJ, Looijenga LHJ, Biermann K, Olfactomedin 4 (OLFM4) expression is associated with nodal metastases in esophageal adenocarcinoma. \\u003cem\\u003ePLoS One\\u003c/em\\u003e 2019, 14, (7), e0219494\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJang BG, Lee BL, Kim WH, Olfactomedin-related proteins 4 (OLFM4) expression is involved in early gastric carcinogenesis and of prognostic significance in advanced gastric cancer. \\u003cem\\u003eVirchows Arch\\u003c/em\\u003e 2015, 467, (3), 285 \\u0026ndash; 94\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi J, Liu C, Li D, Wan M, Zhang H, Zheng X, Jie X, Zhang P, Li J, Hou H, Sun Q (2019) OLFM4 Inhibits Epithelial-Mesenchymal Transition and Metastatic Potential of Cervical Cancer Cells. Oncol Res 27(7):763\\u0026ndash;771\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eClemmensen SN, Glenthoj AJ, Heeboll S, Nielsen HJ, Koch C, Borregaard N (2015) Plasma levels of OLFM4 in normals and patients with gastrointestinal cancer. J Cell Mol Med 19(12):2865\\u0026ndash;2873\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen X, Khalid K, Chen D, Qiu C, Serum levels of olfactomedin 4: a biomarker for asthma control state in asthmatics. \\u003cem\\u003eAnn Transl Med\\u003c/em\\u003e \\u003cb\\u003e2020\\u003c/b\\u003e, 8, (7), 494\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSu W, Luo L, Wu F, Lai Z, Li X, Xie Z, Tang Z, Yang Z, Liang R, Low expression of olfactomedin 4 correlates with poor prognosis in smoking patients with non-small cell lung cancer. \\u003cem\\u003eHum Pathol\\u003c/em\\u003e 2015, 46, (5), 732\\u0026ndash;8\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGuette C, Valo I, Vetillard A, Coqueret O, Olfactomedin-4 is a candidate biomarker of solid gastric, colorectal, pancreatic, head and neck, and prostate cancers. \\u003cem\\u003eProteomics Clin Appl\\u003c/em\\u003e 2015, 9, (1\\u0026ndash;2), 58\\u0026ndash;63\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGao XZ, Wang GN, Zhao WG, Han J, Diao CY, Wang XH, Li SL, Li WC, Blocking OLFM4/HIF-1alpha axis alleviates hypoxia-induced invasion, epithelial-mesenchymal transition, and chemotherapy resistance in non-small-cell lung cancer. \\u003cem\\u003eJ Cell Physiol\\u003c/em\\u003e 2019\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLin MC, Lin JJ, Hsu CL, Juan HF, Lou PJ, Huang MC, GATA3 interacts with and stabilizes HIF-1alpha to enhance cancer cell invasiveness. \\u003cem\\u003eOncogene\\u003c/em\\u003e \\u003cb\\u003e2017\\u003c/b\\u003e, 36, (30), 4380\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWei TT, Lin YT, Tang SP, Luo CK, Tsai CT, Shun CT, Chen CC (2020) Metabolic targeting of HIF-1alpha potentiates the therapeutic efficacy of oxaliplatin in colorectal cancer. Oncogene 39(2):414\\u0026ndash;427\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMarengo A, Rosso C, Bugianesi E, Liver Cancer: Connections with Obesity, Fatty Liver, and Cirrhosis. \\u003cem\\u003eAnnu Rev Med\\u003c/em\\u003e 2016, 67, 103 \\u0026ndash; 17\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMoreno C, Mueller S, Szabo G (2019) Non-invasive diagnosis and biomarkers in alcohol-related liver disease. J Hepatol 70(2):273\\u0026ndash;283\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRiondino S, Guadagni F, Formica V, Ferroni P, Roselli M, Gender Differences in Cancer-associated Venous Thromboembolism. \\u003cem\\u003eCurr Med Chem\\u003c/em\\u003e 2017, 24, (24), 2589\\u0026ndash;2601\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYang Y, Wang G, He J, Ren S, Wu F, Zhang J, Wang F (2017) Gender differences in colorectal cancer survival: A meta-analysis. Int J Cancer 141(10):1942\\u0026ndash;1949\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWelcker K, [Gender Differences in Lung Cancer]. \\u003cem\\u003eZentralbl Chir\\u003c/em\\u003e 2015, 140, (3), 260\\u0026ndash;5\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang C, Peng L, Zhang Y, Liu Z, Li W, Chen S, Li G, The identification of key genes and pathways in hepatocellular carcinoma by bioinformatics analysis of high-throughput data. \\u003cem\\u003eMed Oncol\\u003c/em\\u003e 2017, 34, (6), 101\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShen S, Kong J, Qiu Y, Yang X, Wang W, Yan L (2019) Identification of core genes and outcomes in hepatocellular carcinoma by bioinformatics analysis. J Cell Biochem 120(6):10069\\u0026ndash;10081\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePan G, Wang R, Jia S, Li Y, Jiao Y, Liu N (2020) SLC25A11 serves as a novel prognostic biomarker in liver cancer. Sci Rep 10(1):9871\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003evan der Flier LG, Haegebarth A, Stange DE, van de Wetering M, Clevers H, OLFM4 is a robust marker for stem cells in human intestine and marks a subset of colorectal cancer cells. \\u003cem\\u003eGastroenterology\\u003c/em\\u003e 2009, 137, (1), 15 \\u0026ndash; 7\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMayama A, Takagi K, Suzuki H, Sato A, Onodera Y, Miki Y, Sakurai M, Watanabe T, Sakamoto K, Yoshida R, Ishida T, Sasano H, Suzuki T, OLFM4, LY6D and S100A7 as potent markers for distant metastasis in estrogen receptor-positive breast carcinoma. \\u003cem\\u003eCancer Sci\\u003c/em\\u003e \\u003cb\\u003e2018\\u003c/b\\u003e, 109, (10), 3350\\u0026ndash;3359\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu RH, Yang MH, Xiang H, Bao LM, Yang HA, Yue LW, Jiang X, Ang N, Wu LY, Huang Y (2012) Depletion of OLFM4 gene inhibits cell growth and increases sensitization to hydrogen peroxide and tumor necrosis factor-alpha induced-apoptosis in gastric cancer cells. J Biomed Sci 19:38\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAshizawa Y, Kuboki S, Nojima H, Yoshitomi H, Furukawa K, Takayashiki T, Takano S, Miyazaki M, Ohtsuka M, OLFM4 Enhances STAT3 Activation and Promotes Tumor Progression by Inhibiting GRIM19 Expression in Human Hepatocellular Carcinoma. \\u003cem\\u003eHepatol Commun\\u003c/em\\u003e 2019, 3, (7), 954\\u0026ndash;970\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"OLFM4, biomarker, therapeutic targets, diagnosis, liver cancer\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-686335/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-686335/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eLiver cancer is one of important cancer types causing a large number death in the world, and the incidence is still increasing. Conventional therapies against liver cancer are not satisfied and pathogenesis of liver cancer remains unclear. Thus, the more effective therapies are needed to treat liver cancers, and the discovery of key genes involving in pathogenesis of liver cancers is important for developing more effective therapies to treat liver cancer. In the present study, we found that OLFM4 blood level is higher in liver cancer patients than in healthy individuals, and mRNA expression level in liver cancer tissue than in liver paracancerous tissues. OLFM4 has high predictive capacity as a biomarker for liver cancer and closely correlated to tumor size. Importantly, it is confirmed that OLFM4 contributes to cancer cell proliferation, and HIF-1α involves in this activity. We believe that OLFM4/HIF-1α axis might be a target signaling pathway for developing novel drugs to treat liver cancer.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Olfm4 Is Highly Expressed In Liver Cancer Patients And As A Biomarker And Therapeutic Target For Liver Cancer\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2021-07-13 21:16:27\",\"doi\":\"10.21203/rs.3.rs-686335/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"c9249ab4-a328-4d49-9744-82bad4e118ca\",\"owner\":[],\"postedDate\":\"July 13th, 2021\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":5685516,\"name\":\"General Cell Biology \\u0026 Physiology\"},{\"id\":5685517,\"name\":\"Molecular Biology\"}],\"tags\":[],\"updatedAt\":\"2021-09-22T20:06:24+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2021-07-13 21:16:27\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-686335\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-686335\",\"identity\":\"rs-686335\",\"version\":[\"v1\"]},\"buildId\":\"7rjqhiLT3MXkJMwkYKINL\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}