{"paper_id":"10f15b78-5a86-4f2e-892f-cb98ee5e2f6d","body_text":"Inflammasome Modulation Enhances the Immunoregulatory Function of Mesenchymal Stromal Cells under Bacterial and Titanium-induced Inflammation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Inflammasome Modulation Enhances the Immunoregulatory Function of Mesenchymal Stromal Cells under Bacterial and Titanium-induced Inflammation Ana Belén Carrillo-Gálvez, José Antonio Guerra-Valverde, Miguel Padial-Molina, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9293324/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Background Chronic inflammatory oral diseases such as periodontitis and peri-implantitis are characterized by persistent bacterial challenge and biomaterial-associated stress, leading to sustained immune dysregulation and progressive tissue destruction. Mesenchymal stromal cells represent a promising therapeutic approach due to their immunomodulatory properties. However, the inflammatory microenvironment, including exposure to bacterial components and titanium particles, impairs their regulatory function. Activation of inflammasome pathways, particularly NLRP3 and AIM2, may contribute to this dysfunction. This study aimed to determine whether CRISPR/Cas9-mediated knockout of NLRP3 or AIM2 enhances the immunomodulatory resilience of alveolar bone-derived mesenchymal stromal cells under inflammatory stress. Methods Human alveolar bone-derived mesenchymal stem cells (hABSCs) were edited using CRISPR/Cas9 technology to generate NLRP3 or AIM2-deficient cells. Edited and non-edited cells were exposed to LPS or combined LPS and titanium stimuli and subsequently evaluated for their immunomodulatory capacity. Specifically, T cell proliferation, macrophage polarization and inflammatory cytokine profiling was analyzed. Results Inflammatory stimulation reduced the immunosuppressive capacity of wild-type hABSCs. Under LPS exposure, NLRP3-deficient cells maintained a stronger suppression of T cell proliferation and more effectively limited pro-inflammatory M1 macrophage polarization compared with unedited cells, while AIM2-deficient cells showed a moderate but consistent improvement. Under combined LPS and titanium stress, NLRP3-deficient cells preserved high immunomodulatory function, whereas unedited cells exhibited marked functional impairment. Conclusions Targeted disruption of inflammasome components enhances the functional stability of hABSCs in inflammatory environments. In particular, NLRP3 deficiency confers superior resilience while AIM2 deficiency also provides functional improvement. Inflammasome-directed genome editing may represent a promising strategy to optimize mesenchymal stromal cell-based therapies for chronic inflammatory oral diseases. Inflammation hABSCs periodontitis peri-implantitis inflammasome NLRP3 AIM2 titanium immunomodulation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 BACKGROUND Chronic inflammation is a central pathological process underlying a wide range of human diseases, including autoimmune disorders, metabolic and cardiovascular diseases, neurodegeneration, and tissue-destructive conditions. Sustained inflammatory responses disrupt tissue homeostasis, drive structural damage, and impair regeneration, ultimately contributing to organ dysfunction ( 1 ). Within this broad context, periodontal and peri-implant diseases represent highly prevalent examples of chronic inflammatory disorders involving oral tissues. Affecting approximately 60% of the global adult population, periodontitis is a multifactorial disease primarily initiated by dysbiotic bacterial biofilms that trigger an exacerbated immune response, leading to connective tissue degradation and alveolar bone loss ( 2 ). Peri-implantitis, the analogous pathology occurring around dental implants, is characterized by inflammation of peri-implant tissues accompanied by progressive bone resorption ( 3 ). Although both diseases share major microbiological and clinical features, increasing evidence indicates that they also present significant biological differences; notably, peri-implant lesions often exhibit a denser immune infiltrate and a faster rate of bone loss than periodontitis, suggesting that additional inflammatory drivers may contribute to disease progression ( 4 – 6 ). Among the factors that may account for these differences is the release of metallic particles and ions from the implant surface. Titanium is widely used in oral implantology due to its excellent biocompatibility and mechanical properties, however, under inflammatory conditions, titanium particles and ions can act as danger-associated molecular patterns (DAMPs), amplifying local immune responses ( 7 – 9 ). Inflammation can be triggered by multiple stimuli, including the activation of inflammasome pathways ( 10 ). Inflammasomes are multiprotein complexes belonging to the innate immune system that promote the proteolytic maturation of pro-inflammatory cytokines interleukin-1β (IL-1β) and interleukin-18 (IL-18), as well as Gasdermin-D–mediated pyroptotic cell death ( 11 ). Among them, the NLRP3 (NLR family pyrin domain containing 3) inflammasome is one of the most widely studied due to its ability to sense a large variety of PAMPs (pathogen-associated molecular patterns) and DAMPs, including microbial components, ATP, and crystalline or metallic particles ( 12 ). In contrast, AIM2 (absent in melanoma 2) inflammasome is specifically activated by cytosolic double-stranded DNA ( 13 ). Inflammasomes are classically associated with cells of the innate immune system, particularly macrophages and neutrophils ( 14 , 15 ); however, they are also expressed in other cell types, such as epithelial and mesenchymal stromal cells (MSCs) ( 16 , 17 ). MSCs are multipotent stromal cells present in multiple tissues and are of particular interest because of their immunoregulatory, anti-inflammatory, and regenerative properties ( 18 ). These characteristics have positioned MSC-based approaches as attractive therapeutic strategies for the treatment of chronic inflammatory disorders, including periodontal and peri-implant diseases ( 19 , 20 ). Despite this potential, the molecular mechanisms linking inflammasome signaling to the immunomodulatory function of MSCs remain poorly defined. In a previous study from our group, we showed that human alveolar bone–derived MSCs (hABSCs) exposed to bacterial components (LPS) and titanium ions (Ti) upregulate the expression of NLRP3 and AIM2, accompanied by increased IL-1β release. Moreover, genetic disruption of NLRP3 or AIM2 markedly reduced IL-1β secretion and modified MSC survival and proliferative behavior under inflammatory conditions. Interestingly, although NLRP3-KO and AIM2-KO MSCs showed slightly reduced basal proliferation, they were less affected by LPS or LPS/Ti-induced growth inhibition than control MSCs, suggesting that attenuated inflammasome activation may enhance MSC resilience in inflammatory environments ( 21 ). In the present work, we investigated the immunomodulatory properties of wild-type (WT) and inflammasome-deficient MSCs under inflammatory stimulation with LPS and LPS/Ti. We evaluated their effects on T-cell proliferation and cytokine secretion, as well as on macrophage inflammatory responses in vitro . By elucidating how inflammasome signaling modulates MSC activity, our findings may help optimize the efficacy of MSC-based therapies for periodontal and peri-implant diseases, with potential applicability to other inflammatory conditions. MATERIALS AND METHODS Cell culture and maintenance Bone specimens were obtained from multiple donors at the University of Granada School of Dentistry during dental implant surgery. Human MSCs derived from alveolar bone (hABSCs) were isolated from these samples following previously established protocols ( 22 ). Cells were expanded in low-glucose DMEM (Gibco) supplemented with 10% of fetal bovine serum (FBS, Sigma-Aldrich), non-essential amino acids (1:100, Gibco), basic fibroblast growth factor (bFGF) (0.01 µg/mL, PeproTech), penicillin/streptomycin (100 U/mL), and amphotericin B (0.25 µg/mL). Cell cultures were incubated at 37°C under standard culture conditions (5% CO₂, 21% O₂). All hABSCs used in this study were positive for CD90, CD73, and CD105 and negative for CD14, CD34, CD45, and CD31, and retained their ability to differentiate into adipogenic, osteogenic, and chondrogenic lineages (data not shown). The human monocytic cell line THP-1 was obtained from the “Centro de Instrumentación Científica (CIC)” (University of Granada) and cultured in RPMI 1640 (Biowest) supplemented with 10% of heat inactivated FBS, 50 µM of 2-Mercaptoethanol and 100 U/mL of penicillin/streptomycin. THP-1 cells were incubated and maintained at 21% O 2 , 5% CO 2 at 37°C. Genome editing of hABSCs NLRP3 and AIM2-knockout (KO)-hABSCs were generated using a CRISPR/Cas9-based lentiviral approach. Lentiviral vectors encoding Cas9 and a gene-specific guide RNA (gRNA) targeting either NLRP3 or AIM2 were used. A non-targeting gRNA served as a control. The efficiency and specificity of the gRNAs employed in this study had been previously validated in hABSCs by our group ( 21 ). Lentiviral particles were obtained from VectorBuilder Inc. and exhibited titers higher than 1 × 10⁹ infectious units/mL. The sequences of the gRNAs used were as follows: NLRP3 gRNA: CGGTCCTATGTGCTCGTCAA AIM2 gRNA: TCTTGGGTCTCAAACGTGAA Control gRNA: GTGTAGTTCGACCATTCGTG Transduction of hABSCs Lentiviral transduction of hABSCs was carried out following a previously described protocol with minor modifications ( 23 ). Briefly, 1 × 10⁶ hABSCs were incubated with concentrated lentiviral particles at a multiplicity of infection (MOI) of 50, were maintained at room temperature for 10 minutes and subsequently seeded in six-well culture plates, followed by incubation at 37°C under 21% O₂ and 5% CO₂. After 5 hours of incubation, the viral containing medium was replaced with fresh culture medium. On the following day, cells were detached and subjected to a second round of transduction using the same viral conditions. After an additional 5-hour incubation period, cells were washed to remove residual viral particles and transferred to T75 flasks for expansion under standard culture conditions for 3–4 days. To select successfully transduced cells, cultures were treated with puromycin (0.5 µg/mL; Sigma-Aldrich) for 7 days. Only puromycin-resistant cells were used for subsequent experiments. Verification of CRISPR gene editing efficiency To evaluate the efficiency of CRISPR/Cas9-mediated gene disruption, genomic DNA was extracted from bulk-edited hABSCs using the Quick-DNA Miniprep Kit (Zymo Research). Genomic regions flanking the target sites recognized by each guide RNA were amplified by polymerase chain reaction (PCR) using the MyTaq™ Red Mix 2× kit (Bioline). PCR products were purified with the DNA Clean & Concentrator-5 Kit (Zymo Research) and analyzed by Sanger sequencing (STABvida) using the same primers employed for amplification. Sequencing chromatograms were processed with the Inference of CRISPR Edits (ICE) analysis tool (Synthego), using sequences obtained from non-transduced hABSCs as reference controls. ICE analysis confirmed the presence of gene editing events consistent with non-homologous end joining (NHEJ). Primer sequences are provided in Table 1 . Immunofluorescence Edited and non-edited hABSCs were plated in 24-well culture plates (50,000 cells per well) and maintained under standard culture conditions. After allowing cell attachment for 24 hours, cultures were chemically fixed using 4% paraformaldehyde (PFA, Sigma-Aldrich). Cell membranes were then permeabilized with 0.25% Triton X-100 (Sigma-Aldrich), followed by a blocking step with 2% bovine serum albumin (BSA, Sigma-Aldrich) to minimize non-specific antibody binding. Samples were incubated overnight at 4°C with antibodies recognizing human NLRP3 or AIM2 (Invitrogen and MyBioSource, respectively). After extensive washing, fluorescent labeling was achieved by incubation with an Alexa Fluor 488–conjugated goat anti-rabbit secondary antibody (Invitrogen) for 1 hour at room temperature. Nuclear staining was performed using Hoechst dye. Control conditions included samples processed in the absence of either primary or secondary antibodies. Images were acquired using a Nikon Eclipse Ts2 fluorescence microscope. Quantitative analysis of fluorescence intensity was performed with ImageJ software. Assessment of MSC-mediated immunosuppression of T cells MSC-mediated immunosuppression of T cells was evaluated using a direct co-culture system, as schematically illustrated in Fig. 1 A. hABSCs, including Control (CTRL), NLRP3-knockout (NLRP3-KO), and AIM2-knockout (AIM2-KO) cells, were seeded in 96-well plates at a density of 1,000 cells per well and allowed to adhere overnight. Next day, hABSCs were either left untreated or stimulated with 1µg/mL Lipopolysaccharide (LPS, E.coli O111:B4, Sigma-Aldrich) or LPS in combination with 20µg/mL Ti (Titanium atomic absorption standard solution, Sigma-Aldrich) (LPS/Ti) for 24 hours. The following day, peripheral blood mononuclear cells (PBMCs) were isolated from healthy donors by density gradient centrifugation using Ficoll-Paque (Sigma-Aldrich). Freshly isolated PBMCs were labeled with carboxyfluorescein succinimidyl ester (CFSE, Invitrogen) according to the manufacturer’s instructions and subsequently activated with 1µg/mL phytohemagglutinin (PHA, Sigma-Aldrich) to induce T cell proliferation. After hABSCs stimulation, culture media were removed, and CFSE-labeled PBMCs were added to the wells containing hABSCs at a density of 2 × 10⁵ cells per well. Control conditions included PBMCs cultured alone in the presence or absence of PHA, without hABSCs. Co-cultures were maintained for 5 days under standard culture conditions. At the end of the co-culture period, cell-free supernatants were collected and stored at − 20°C for subsequent cytokine analysis by ELISA. PBMCs were then harvested and stained with a human anti-CD4 antibody (Invitrogen) to identify T cells. CFSE dilution within the CD4⁺ T cell population was analyzed by flow cytometry using a FACSCanto II flow cytometer (BD Biosciences). T cell proliferation and division indices were quantified using FlowJo software (Tree Star Inc., Ashland, OR). Assessment of MSC-mediated immunomodulation of macrophages cells MSC-mediated immunomodulation of macrophages was evaluated using a conditioned medium–based approach, as illustrated in Fig. 1 B. First, 100,000 CTRL, NLRP3-KO and AIM2-KO hABSCs were seeded in 6-well plates and allowed to adhere overnight under standard culture conditions. In parallel, 250,000 THP-1 monocytes were plated in 12-well plates and differentiated into macrophage-like cells by treatment with 100 ng/mL phorbol 12-myristate-13-acetate (PMA; Sigma-Aldrich). The following day, hABSCs were either left untreated or stimulated with LPS or LPS/Ti for 24 hours. After this stimulation period, the culture medium was replaced with fresh medium and hABSCs were maintained for an additional 48 hours to allow the release of conditioned factors. On the other hand, seventy-two hours after PMA treatment, THP-1–derived macrophages were washed and incubated in fresh medium for 24 hours. At this time point, conditioned medium from hABSCs cultures (collected 48 hours after medium replacement) was harvested and transferred onto THP-1–derived macrophages to induce macrophage conditioning. THP-1 cells were exposed to hABSC-conditioned media for 48 hours. Following the conditioning period, macrophages were washed and stimulated with 20 ng/mL interferon gamma (IFN-γ, Invivogen) for 24 hours to induce M1 polarization. After IFN-γ treatment, cell-free supernatants were collected and stored at − 20°C for subsequent cytokine analysis by ELISA. For gene expression analysis, TRIzol™ Reagent (Invitrogen) was directly added to the cells, and samples were stored at − 80°C until RNA extraction. Control conditions included THP-1 cells treated with PMA alone (negative control) and THP-1 cells treated with PMA followed by IFN-γ stimulation (positive control for M1 polarization). (A) Schematic representation of T cell immunomodulation assay. CTRL, NLRP3-KO and AIM2-KO hABSCs were left untreated (NT) or preconditioned with LPS or LPS/Ti. After stimulation, hABSCs were co-cultured with human PBMCs activated with PHA for 5 days. T cell proliferation was assessed by CFSE dilution using flow cytometry, and supernatants were collected for cytokine analysis. (B) Schematic representation of macrophage polarization assay. CTRL, NLRP3-KO and AIM2-KO hABSCs were NT or pretreated with LPS or LPS/Ti, and conditioned medium (CM) was collected. THP-1 monocytes were differentiated into macrophages using PMA and subsequently exposed to CM for 48 hours. Cells were then polarized toward an M1 phenotype with IFNγ for 24 hours. Gene expression and cytokine production were analyzed. Figure created with NotebookLM (Google, 2026). Quantitative PCR (RT-qPCR) Total RNA was isolated using TRIzol™ Reagent according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized from purified RNA using the PrimeScript® RT Master Mix (Perfect Real Time; TaKaRa Bio Inc.). Quantitative real-time PCR (RT-qPCR) was subsequently performed using TB Green® Premix Ex Taq™ (Tli RNase H Plus; TaKaRa Bio Inc.) on a qTOWER³ Real-Time PCR System. Primer sequences used for gene amplification are provided in Table 1 . Ratio M1/M2 The inflammatory polarization status of THP-1–derived macrophages was assessed by analyzing the expression of established M1 and M2 macrophage-associated genes by RT-qPCR. Following the experimental procedures described above, total RNA was extracted and reverse-transcribed, and relative gene expression levels were determined by quantitative PCR. The pro-inflammatory (M1) phenotype was evaluated using the markers CD80, CXCL10 and IL-6, whereas the anti-inflammatory (M2) phenotype was assessed through the expression of CD206, CCL17 and ALOX15. Relative expression values were calculated for each gene, and an M1/M2 polarization index was generated by computing the ratio between the mean expression levels of M1-associated genes and those of M2-associated genes. An M1/M2 ratio greater than 1 was interpreted as a predominance of the pro-inflammatory M1 phenotype, whereas values below 1 indicated a shift toward an M2-like polarization. Primer sequences used for gene expression analysis are listed in Table 1 . Table 1 Sequence of primers used for PCR and RT-qPCR analyzes. Primers Gene Forward sequence Reverse sequence NLRP3-KO check 5´-CAGGAAGATGATGTTGGACT-3´ 5´-AAGGAAGAAGACGTACACCG-3´ AIM2-KO check 5´-CTTCCCTTGATTCCACCTAT-3´ 5´-CTGAGTTTGAAGCGTGTTGA-3´ CD80 5´-CTCTTGGTGCTGGCTGGTCTTT-3´ 5´-GCCAGTAGATGCGAGTTTGTGC-3´ CXCL10 5´-CGCTGTACCTGCATCAGCAT-3´ 5´-CGTGGACAAAATTGGCTTGC-3´ IL-6 ´5´-AGGAGACTTGCCTGGTGAAA-3´ 5´-CAGGGGTGGTTATTGCATCT-3´ CD206 5´-AGCCAACACCAGCTCCTCAAGA-3´ 5´-CAAAACGCTCGCGCATTGTCCA-3´ CCL17 5´-CTTCTCTGCAGCACATCCAC-3´ 5´-CAGATGTCTGGTACCACGTC-3´ ALOX15 5´-CAGATGTCCATCACTTGGCAG-3´ 5´-CTCCTCCCTGAACTTCTTCAG-3´ IDO 5´-GCCTGATCTCATAGAGTCTGGC-3´ 5´-TGCATCCCAGAACTAGACGTGC-3´ COX-2 5´-CGGTGAAACTCTGGCTAGACAG-3´ 5´-GCAAACCGTAGATGCTCAGGGA-3´ PD-L1 5´-TGCCGACTACAAGCGAATTACTG-3´ 5´-CTGCTTGTCCAGATGACTTCGG-3´ GAPDH 5´-AGCTCATTTCCTGGTATGACAAC-3´ 5´-TTACTCCTTGGAGGCCATGTG-3´ Enzyme-Linked Immunosorbent Assay (ELISA) Cell-free supernatants collected from hABSCs–PBMCs co-cultures and from THP-1 cultures treated with hABSCs-conditioned media were clarified by centrifugation at 1,000 × g for 10 minutes at 4°C. Levels of interleukin-1 beta (IL-1β), tumor necrosis factor alpha (TNF-α), and interleukin-10 (IL-10) were quantified using Human IL-1β, Human TNF-α and Human IL-10 Uncoated ELISA kits (Invitrogen), respectively, according to the manufacturers’ instructions. Absorbance was measured at 450 nm using an Infinite M200 Pro microplate reader (Tecan). Cytokine concentrations were calculated by interpolation from standard curves generated with recombinant cytokines provided in each kit. hABSCs proliferation The proliferative capacity of hABSCs, either gene-edited or control, was evaluated using the CellTiter-Blue® cell viability assay. Briefly, 1,000 hABSCs per well were plated in 96-well culture plates and allowed to attach overnight. Cells were subsequently left untreated or exposed to LPS or LPS in combination with titanium ions, as described above. Cell proliferation was assessed at day 5 after treatment by incubating cultures with CellTiter-Blue® reagent for 4 hours. Fluorescence was then recorded at 560 nm using an Infinite M200 Pro microplate reader. Intracellular Reactive Oxygen Species (ROS) measurement ROS levels were determined in hABSCs, including CTRL, NLRP3-KO and AIM2-KO cells, using a fluorometric intracellular ROS detection assay (Sigma-Aldrich). Cells were seeded under standard culture conditions and subsequently left untreated or stimulated with LPS) or LPS/Ti, during 4 hours. Following stimulation, the ROS Detection Reagent was added directly to the cultures, and cells were incubated for 1 hour at 37°C according to the manufacturer’s instructions. Fluorescence signals were then recorded using an Infinite M200 Pro microplate reader at λex = 540 nm / λem = 570 nm. Statistical analysis All statistical analyses were performed using GraphPad Prism software. Results are expressed as mean values with corresponding standard deviations (SD) derived from a minimum of three independent experiments. Data distribution was evaluated for normality using the Shapiro–Wilk test. Comparisons among multiple experimental groups were carried out using one-way or two-way analysis of variance (ANOVA), as appropriate, followed by Tukey’s multiple comparisons test. Differences were considered statistically significant when p values were ≤ 0.05. RESULTS Generation and validation of NLRP3 and AIM2 deficient hABSCs To generate hABSCs deficient in NLRP3 or AIM2, a CRISPR/Cas9-based genome editing strategy was employed. Cells were transduced with lentiviral “all-in-one” vectors encoding both the Cas9 nuclease and gene-specific guide RNAs. Successfully transduced cells were selected using puromycin, and genomic DNA was subsequently extracted to evaluate editing efficiency. For each target gene, three independent knockout cell populations (N) were generated. In the case of NLRP3, ICE analysis revealed high editing efficiencies, with indel frequencies of 92%, 90%, and 97%, and corresponding KO-scores of 91, 90, and 92, respectively (Fig. 2 A, upper left table). Similarly, AIM2 knockout hABSCs showed indel frequencies of 97% in all three populations, with KO-scores of 97, 93, and 95 (Fig. 2 B, upper left table). Sequence analysis demonstrated that, for both NLRP3 and AIM2, Cas9-mediated DNA cleavage followed by non-homologous end joining predominantly resulted in the insertion of a single nucleotide at the target site, specifically a thymine (Fig. 2 A, 2 B, upper right panels). This single-nucleotide insertion is predicted to disrupt the open reading frame, leading to the generation of truncated or non-functional protein products due to frameshift mutations and/or premature stop codons. Consistent with the genomic data, immunofluorescence analysis revealed a marked reduction in NLRP3 and AIM2 protein expression in the corresponding knockout hABSCs compared to control cells (Fig. 2 A, 2 B, lower panels), confirming the effective disruption of both genes at the protein level. NLRP3 and AIM2 deficiency modulates the T cell immunosuppressive function of hABSCs under inflammatory conditions MSCs are widely recognized for their immunomodulatory and regenerative properties, which support their therapeutic potential ( 19 , 20 ). However, how inflammasome activation influences these functions remains poorly understood. In a previous study, we demonstrated that NLRP3 and AIM2 deficient hABSCs proliferate more efficiently than unedited cells under LPS or LPS/Ti induced inflammatory conditions ( 21 ). Based on these observations, we investigated whether an inflammatory microenvironment also modulates the immunosuppressive capacity of inflammasome deficient hABSCs. To address this, we evaluated the ability of control (CTRL), NLRP3-KO, and AIM2-KO hABSCs, either non-treated (NT) or pre-exposed to LPS or LPS/Ti, to suppress T cell proliferation in a CFSE-based assay. Under basal conditions, CTRL, NLRP3-KO, and AIM2-KO hABSCs exhibited a comparable capacity to suppress T cell proliferation, indicating that inflammasome deficiency does not intrinsically alter the immunosuppressive function of hABSCs. However, pre-treatment of CTRL hABSCs with LPS significantly impaired their suppressive capacity, an effect that was further exacerbated in the presence of LPS/Ti. In contrast, NLRP3-KO hABSCs maintained a significantly higher immunosuppressive activity under both LPS and LPS/Ti treatments compared to CTRL cells. AIM2-KO hABSCs also displayed an improved ability to suppress T cell proliferation in the presence of LPS when compared to CTRL hABSCs. Notably, this protective effect was lost upon exposure to LPS/Ti, suggesting that titanium-driven inflammatory conditions preferentially activate NLRP3 pathway, thereby limiting the contribution of AIM2 to the regulation of MSC immunomodulatory function under these conditions (Fig. 3 A). Quantitative analysis of T cell proliferation, expressed as proliferation index, supported these observations (Fig. 3 B). While all hABSCs populations significantly reduced T cell proliferation under basal conditions, only NLRP3-KO hABSCs preserved a robust and significative suppressive effect under inflammatory stimulation, particularly in the presence of titanium particles. Comparable results were obtained when using WT hABSCs instead of CTRL cells, both under basal and inflammatory conditions ( Supplementary Figure S1 ). As WT and CTRL hABSCs showed indistinguishable immunosuppressive behavior, subsequent experiments were performed using CTRL hABSCs as reference. Inflammasome activation in hABSCs alters their ability to regulate macrophage polarization MSCs are known to modulate macrophage activation by limiting pro-inflammatory M1 polarization and contributing to the maintenance of immune homeostasis ( 24 , 25 ). To evaluate whether inflammasome activation affects this function, macrophage polarization was analyzed in THP-1–derived macrophages exposed to conditioned medium (CM) from CTRL, NLRP3-KO, or AIM2-KO hABSCs, either NT or previously stimulated with LPS or LPS/Ti. As an initial validation of the experimental system, LPS/IFNγ stimulation robustly induced the expression of M1-associated genes (CXCL10, CD80, and IL6), while CM from WT hABSCs reduced this induction. In parallel, LPS/IFNγ treatment decreased the expression of M2-associated genes (CD206, CCL17, and ALOX15), which showed a modest recovery upon exposure to hABSCs-derived CM, confirming the suitability of the model to assess MSC-mediated modulation of macrophage polarization ( Supplementary Figure S2 ). Analysis of M1-associated gene expression revealed that CM from NT-hABSCs, regardless of inflammasome status, exerted comparable effects on macrophages. In contrast, CM derived from LPS or LPS/Ti-stimulated hABSCs increased the expression of M1 markers in all conditions, with an attenuated induction observed in macrophages exposed to CM from NLRP3-KO hABSCs, and to a lesser extent from AIM2-KO hABSCs (Fig. 4 A). Evaluation of M2-associated genes did not reveal marked differences among conditions, and no consistent trends were observed between CTRL and inflammasome-deficient hABSCs (Fig. 4 B). Given the limited differences observed at the level of individual markers, macrophage polarization was further assessed by analyzing the M1/M2 gene expression ratio. While CM from NT-hABSCs markedly reduced the M1/M2 ratio compared to pro-inflammatory controls (C+), CM from LPS or LPS/Ti-treated CTRL hABSCs showed a partial loss of this modulatory effect. Importantly, CM from both NLRP3-KO and AIM2-KO hABSCs preserved a significantly lower M1/M2 ratio under LPS stimulation compared to CTRL-derived CM. Under LPS/Ti conditions, a reduction in the M1/M2 ratio was still observed in macrophages exposed to CM from NLRP3-KO hABSCs compared to CTRL hABSCs, whereas this reduction was no longer evident in the AIM2-KO condition, consistent with enhanced involvement of the NLRP3 inflammasome in titanium-associated inflammatory environments (Fig. 4 C). Inflammasome-deficient hABSCs differentially regulate pro and anti-inflammatory cytokine secretion To further characterize the immunomodulatory effects of inflammasome-deficient hABSCs, we analyzed the secretion of key pro- and anti-inflammatory cytokines as functional readouts of immune activation. Tumor Necrosis Factor (TNF)-α and IL-10 were measured in supernatants from PBMC–hABSCs cocultures, while TNFα, IL-1β, and IL-10 were quantified in supernatants from THP-1–derived macrophages exposed to CM of hABSCs. In PBMCs cocultures, LPS stimulation markedly increased TNFα secretion compared to PHA alone, whereas coculture with hABSCs, edited or not, strongly suppressed TNFα release (Fig. 5 A, left panel). This suppressive effect was partially impaired when CTRL hABSCs were pre-exposed to LPS and further reduced under LPS/Ti treatments. In contrast, NLRP3-KO hABSCs largely preserved their ability to suppress TNFα secretion under inflammatory stimulation, reaching levels comparable to untreated hABSCs under LPS and remaining significantly lower than CTRL-derived cocultures under LPS/Ti. AIM2-KO hABSCs also reduced TNFα secretion, however, their effect did not significantly differ from that of CTRL hABSCs under either inflammatory condition. IL-10 secretion in PBMCs cocultures increased upon immune activation and was further enhanced in the presence of hABSCs (Fig. 5 A, right panel). Under LPS stimulation, cocultures with NLRP3-KO and AIM2-KO hABSCs showed significantly higher IL-10 levels than those with CTRL hABSCs, whereas under LPS/Ti conditions this increase was maintained only in the NLRP3-KO condition. In macrophage cultures, IFNγ-induced TNFα secretion was markedly reduced by CM from hABSCs irrespective of inflammasome status (Fig. 5 B, left panel). However, CM from LPS or LPS/Ti-treated CTRL hABSCs showed a reduced suppressive capacity, whereas CM from NLRP3-KO hABSCs consistently maintained lower TNFα levels under all inflammatory conditions, an effect that was also observed with AIM2-KO hABSCs but only under LPS stimulation. IL-10 secretion was enhanced by CM from CTRL hABSCs compared to the positive control, while CM from inflammasome-deficient hABSCs maintained IL-10 levels comparable to the control condition (Fig. 5 B, right panel). Unexpectedly, pre-exposure of hABSCs to LPS or LPS/Ti led to a generalized reduction in IL-10 secretion. This decrease was significantly more pronounced in macrophages exposed to CM from NLRP3-KO hABSCs under LPS and from AIM2-KO hABSCs under both LPS and LPS/Ti conditions. Finally, secretion analysis of the hallmark cytokine of inflammasome activation (IL-1β) in macrophages revealed a pattern closely resembling that observed for TNFα, with CM from NLRP3-KO hABSCs limiting IL-1β release under inflammatory conditions, whereas this effect was attenuated or lost in CTRL and AIM2-KO conditions, particularly in the presence of titanium (Fig. 5 C). Cell-intrinsic mechanisms associated with enhanced immunomodulation in inflammasome-deficient hABSCs To explore potential mechanisms underlying the enhanced immunomodulatory effects observed in inflammasome-deficient hABSCs, we evaluated cell proliferation, intracellular ROS production and the expression of key immunomodulatory mediators, including Indoleamine 2,3-dioxygenase (IDO), Cyclooxygenase-2 (COX-2), and Programmed death-ligand 1 (PD-L1), which are known to contribute to MSC-mediated immune regulation ( 26 – 29 ). Analysis of hABSCs proliferation over a 5-day period revealed no significant differences between CTRL, NLRP3-KO, or AIM2-KO cells, either under basal conditions or following stimulation with LPS or LPS/Ti, indicating that differences in immunomodulatory capacity are not attributable to altered cell expansion (Fig. 6 A). Inflammatory stimulation with LPS or LPS/Ti significantly increased intracellular ROS levels in all experimental conditions. Notably, this increase was significantly attenuated in NLRP3-KO hABSCs compared to CTRL cells, whereas AIM2-KO hABSCs displayed ROS levels comparable to those of CTRL cells (Fig. 6 B). Finally, expression of immunomodulatory genes was strongly induced by inflammatory stimulation. IDO expression increased in all conditions upon LPS and LPS/Ti exposure, with a more pronounced upregulation in inflammasome-deficient hABSCs, reaching statistical significance in NLRP3-KO cells under LPS/Ti stimulation compared to CTRL cells (Fig. 6 C, upper left panel). A similar pattern was observed for COX-2 and PD-L1 expression, both of which were significantly higher in NLRP3-KO hABSCs compared to CTRL cells under LPS and LPS/Ti conditions (Fig. 6 C, upper right and lower panels). Collectively, these findings indicate that NLRP3 deficiency in hABSCs is associated with reduced oxidative stress and enhanced expression of key immunomodulatory mediators under inflammatory conditions, which may contribute, at least in part, to the improved immunoregulatory effects observed in previous functional assays. DISCUSSION Chronic periodontal and peri-implant diseases remain challenging to treat, as current therapeutic approaches are largely based on mechanical debridement, often combined with antimicrobial strategies that fail to fully control the underlying dysregulated immune response ( 30 ). In particular, peri-implantitis has emerged as a distinct inflammatory entity, characterized by a more aggressive immune infiltrate and accelerated bone loss compared to periodontitis, likely driven not only by bacterial dysbiosis but also by the release of titanium particles and ions from implant surfaces ( 4 – 6 ). In this context, therapies aimed at modulating inflammation are increasingly recognized as essential. MSCs represent a promising immunoregulatory strategy tool ( 18 ), however, their function is highly dependent on the surrounding inflammatory environment. While inflammasome research has predominantly focused on innate immune cells ( 14 , 15 ), much less attention has been paid to how inflammasome activation within MSCs themselves may influence their regulatory and regenerative capacities. In our previous work, we demonstrated that exposure of hABSCs to LPS and Ti activates NLRP3 and AIM2 inflammasomes and triggers IL-1β release. Importantly, genetic disruption of these pathways enhanced MSC resilience under inflammatory stress, with knockout cells exhibiting improved long-term survival compared to wild-type controls in the presence of inflammatory stimuli ( 21 ). Based on these observations, the present study was designed to determine whether inflammasome activation also affects the immunomodulatory function of MSCs, specifically MSCs derived from alveolar bone (hABSCs), and whether selective inflammasome targeting can preserve hABSCs-mediated immune regulation in complex inflammatory environments relevant to periodontal and peri-implant diseases. To address this question, we first evaluated whether inflammasome activation influences the capacity of hABSCs to suppress T-cell proliferation, a defining feature of MSC immunomodulation ( 31 , 32 ). This function depends on soluble mediators and cell–cell interactions ( 33 , 34 ) and is known to be shaped by inflammatory priming. Indeed, LPS conditioning has been reported to either enhance or impair MSC immunosuppressive activity depending on experimental context ( 35 – 38 ). In our model, LPS reduced the suppressive capacity of hABSCs, an effect that was further aggravated by titanium ions, an observation not previously described and highly relevant to peri-implantitis. Although inflammasome signaling has been implicated in MSC biology ( 39 , 40 ), direct evidence linking specific inflammasomes to T-cell regulation remains limited. Here, we show that NLRP3 deficiency preserved hABSCs-mediated T-cell suppression under both LPS and LPS/Ti conditions, whereas AIM2 deletion conferred benefit only under LPS stimulation. Together, these findings point to NLRP3 as a key regulator limiting hABSCs immunomodulatory function, particularly in titanium-associated inflammatory environments. We next evaluated whether inflammasome activation in hABSCs modulates their ability to regulate macrophage polarization. MSCs are well known to reduce pro-inflammatory M1 phenotypes through paracrine mechanisms that support tissue homeostasis ( 41 , 42 ), although this function is sensitive to inflammatory priming. While LPS-conditioned MSC-derived extracellular vesicles have been reported to enhance pro-resolving macrophage responses ( 35 ), we observed that direct LPS exposure reduced the capacity of hABSCs to inhibit M1 polarization, an effect further exacerbated by titanium. Under LPS stimulation alone, both NLRP3 and AIM2 deficient hABSCs, more effectively reduced the M1/M2 ratio compared to non-edited cells, indicating enhanced control of M1 polarization in a bacterial inflammatory context. However, under combined LPS/Ti conditions, this superior regulatory effect was preserved only in NLRP3-deficient cells, whereas AIM2 deficiency no longer conferred additional benefit. As observed in T-cell assays, these findings reinforce a predominant role for NLRP3 in maintaining MSC immunoregulatory function in metal-associated inflammatory environments. Cytokine profiling further supported these functional observations. Consistent with the established immunosuppressive properties of MSCs ( 43 ), hABSCs markedly reduced TNFα production in activated PBMCs cultures, while simultaneously promoting IL-10 secretion. Notably, inflammasome disruption enhanced this regulatory balance under inflammatory priming, indicating that NLRP3 and AIM2 activation impose intrinsic constraints on hABSCs-mediated control of adaptive immune responses. The induction of IL-10 observed in stimulated PBMCs even in the absence of MSCs likely reflects the endogenous self-regulatory capacity of primary leukocytes to prevent excessive inflammation, as monocytes and T cells within PBMCs populations can produce IL-10 to maintain immune homeostasis ( 44 ). Thus, inflammasome-deficient hABSCs appear to amplify a physiological anti-inflammatory feedback loop rather than introducing an suppressive signal. In macrophage assays, conditioned media from hABSCs consistently attenuated TNFα and IL-1β secretion, supporting previous evidence that MSCs limit M1-associated inflammatory outputs ( 25 ). However, unlike in PBMCs, this modulation was not accompanied by increased IL-10 production. Given that THP-1–derived macrophages exhibit limited IL-10 secretion compared to primary macrophages ( 45 , 46 ), and that IFNγ-driven polarization may further restrict IL-10 expression ( 47 ), our data suggest that, in this model, MSCs primarily exert anti-inflammatory effects through suppression of pro-inflammatory cytokines rather than active induction of an M2 cytokine program. The enhanced immunomodulatory performance of inflammasome-deficient hABSCs cannot be attributed to differences in cell number, as no significant proliferation changes were detected during the 5-day experimental window. Although we previously reported improved long-term proliferative capacity of NLRP3 and AIM2-deficient hABSCs under sustained LPS or LPS/Ti exposure, these differences emerged only after prolonged culture ( 21 ), indicating that the functional advantages observed here are independent of short-term expansion dynamics. Instead, our data point to qualitative changes in cellular fitness and paracrine programming. Inflammasome-deficient cells displayed reduced ROS accumulation under inflammatory conditions, particularly NLRP3-KO hABSCs, suggesting improved resistance to oxidative stress. Excessive intracellular ROS is known to impair MSC fitness, promote premature senescence, and limit the secretion of key immunoregulatory mediators such as IDO and Prostaglandin E2 (PGE2) ( 48 , 49 ). Given that mitochondrial ROS act as upstream activators of the NLRP3 inflammasome, genetic ablation of NLRP3 likely disrupts a positive feedback loop of inflammasome activation, autocrine inflammatory signaling, and oxidative stress, thereby preserving cellular integrity and functional competence. Consistently, NLRP3 and, to a lesser extent, AIM2-deficient hABSCs exhibited increased expression of IDO, COX-2, and PD-L1 under inflammatory priming. IDO and COX-2 operate synergistically in MSC-mediated immunoregulation: IDO suppresses T-cell responses through tryptophan catabolism ( 50 , 51 ), while COX-2–derived PGE2 has been shown to promote macrophage reprogramming and IL-10 production ( 52 – 54 ). Although enhanced IL-10 secretion was not observed in our THP-1 model, likely reflecting the limited IL-10 competence of this cell line under IFNγ-driven polarization, the coordinated upregulation of these pathways supports a shift toward a reinforced immunomodulatory program. Enhanced PD-L1 expression further indicates strengthened contact-dependent inhibition of activated T cells ( 55 , 56 ). These changes suggest that, in wild-type cells, inflammasome activation may divert metabolic and signaling resources toward a self-amplifying pro-inflammatory program, whereas inflammasome-deficient hABSCs redirect these pathways toward a predominantly regulatory phenotype. CONCLUSIONS Our findings demonstrate that the inflammatory microenvironment not only challenges hABSCs function but actively modifies their immunoregulatory programming through inflammasome-dependent mechanisms. Targeted disruption of AIM2, and particularly NLRP3, preserves hABSCs fitness, enhances their anti-inflammatory secretome, and improves their capacity to modulate both adaptive and innate immune responses under conditions modeling periodontitis and peri-implantitis. These results underscore the importance of considering intrinsic inflammatory signaling pathways when designing MSC-based therapies and position NLRP3 as a promising target to optimize cell-based interventions for chronic inflammatory diseases, especially in metal-associated pathologies. Abbreviations AIM2 Absent in melanoma 2 Cas9 Crispr associated protein 9 CFSE Carboxyfluorescein succinimidyl ester CM Conditioned medium/media COX-2 Cyclooxygenase-2 CRISPR Clustered Regularly Interspaced Short Palindromic Repeats CTRL Control DAMPs Danger associated molecular pattern ELISA Enzyme-Linked Immunosorbent Assay gRNA Guide-RNA hABSCs Human alveolar bone derived MSCs IDO Indoleamine 2,3-dioxygenase IL-1β Interleukin-1β IL-10 Interleukin-10 IL-18 Interleukin-18 IFNγ Interferon gamma KO Knockout LPS Lipopolysaccharide MSCs Mesenchymal stromal cells NLRP3 NLR family pyrin domain containing 3 NT Non-treated PAMPs Pathogen associated molecular pattern PBMCs Peripheral blood mononuclear cells PCR Polymerase chain reaction PD-L1 Programmed death-ligand 1 PGE2 Prostaglandin E2 PHA Phytohemagglutinin PMA Phorbol 12-myristate-13-acetate ROS Reactive oxygen species RT-qPCR Reverse transcription quantitative-PCR Ti Titanium ions WT Wild type Declarations Ethics approval and consent to participate All procedures performed in this study involving human participants were conducted in accordance with the ethical standards of the institutional and national research committee and with the 1964 Declaration of Helsinki and its later amendments. Blood samples for PBMC and T cell isolation, as well as human alveolar bone–derived mesenchymal stromal cells (hABSCs), were obtained after approval by the Ethics Committee for Human Research of the University of Granada, Spain (protocol numbers 3670/CEIH/2023 and 3672/CEIH/2023). Written informed consent was obtained from all participants prior to sample collection. Clinical trial registration Not applicable Consent for publication Not applicable Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests Funding Financial support for this research was provided by MICIU/AEI/10.13039/501100011033 under grant PID2022-137950NB-I00, with additional co-funding from the European Regional Development Fund (ERDF/EU). The authors also acknowledge the Cathedra University of Granada-Ziacom and the scientific contributions funded by Research Groups #CTS-138, #CTS-1028, and #B-CTS-504-UGR18 (Universidad de Granada – Junta de Andalucía, Spain). JA. G-V was supported by a FPU predoctoral contract from the Spanish Ministry of Science, Innovation and Universities grant number FPU24/00315. Authors' contributions ABCG: Conception and design of the work, acquisition, analysis and interpretation of data, manuscript writing and final approval of manuscript. JAGV: Acquisition, analysis and interpretation of data, manuscript writing and final approval of manuscript. MPM: Conception and design of the work, analysis and interpretation of data, financial support and final approval of manuscript. DAG: Acquisition and analysis of data and final approval of manuscript. AO: Acquisition and analysis of data and final approval of manuscript. NMM: Acquisition and analysis of data and final approval of manuscript. FO: Analysis and interpretation of data and final approval of manuscript. PGM: Conception and design of the work, financial support, interpretation of data, manuscript writing and final approval of manuscript. FZ: Conception and design of the work, financial support, interpretation of data, manuscript writing and final approval of manuscript. Acknowledgements Not applicable References Yacine A, Zain Ali M, Alharbi AB, Qubayl Alanaz H, Saud Alrahili A, Alkhdairi AA. Chronic Inflammation: A Multidisciplinary Analysis of Shared Pathways in Autoimmune, Infectious, and Degenerative Diseases. Cureus. 2025; Apr 19;17(4):e82579. Kinane DF, Stathopoulou PG, Papapanou PN. Periodontal diseases. Nat Rev Dis Prim [Internet]. 2017;3(1):17038. Berglundh T, Armitage G, Araujo MG, Avila-Ortiz G, Blanco J, Camargo PM, et al. Peri-implant diseases and conditions: Consensus report of workgroup 4 of the 2017 World Workshop on the Classification of Periodontal and Peri-Implant Diseases and Conditions. J Clin Periodontol. 2018;45(Suppl 20):S286–91. Derks J, Schaller D, Håkansson J, Wennström JL, Tomasi C, Berglundh T. Peri-implantitis - onset and pattern of progression. J Clin Periodontol. 2016;43(4):383–8. Albrektsson T, Albrektsson T. Are Oral Implants the Same As Teeth? J Clin Med 2019, 8. 2019;8(9). Carcuac O, Berglundh T. Composition of human peri-implantitis and periodontitis lesions. J Dent Res. 2014;93(11):1083–8. del Suárez-López F, Rudek I, Wagner V, Martins M, O’Valle F, Galindo-Moreno P, et al. Titanium Activates the DNA Damage Response Pathway in Oral Epithelial Cells: A Pilot Study. Int J Oral Maxillofac Implants. 2017;32(6):1413–20. Bressan E, Ferroni L, Gardin C, Bellin G, Sbricoli L, Sivolella S et al. Metal Nanoparticles Released from Dental Implant Surfaces: Potential Contribution to Chronic Inflammation and Peri-Implant Bone Loss. Mater (Basel Switzerland). 2019;12(12). Furlanetto M, Castro R, Silva F, Pereira J, Macedo J, Soares S. Titanium Particle Impact on Immune Cells, Cytokines, and Inflammasomes: Helping to Profile Peri-Implantitis—A. Syst Rev Oral 2025. 2025;5(4):80. Marchesan JT, Girnary MS, Moss K, Monaghan ET, Egnatz GJ, Jiao Y, et al. Role of inflammasomes in the pathogenesis of periodontal disease and therapeutics. Periodontol 2000. 2020;82(1):93–114. Yao J, Sterling K, Wang Z, Zhang Y, Song W. The role of inflammasomes in human diseases and their potential as therapeutic targets. Signal Transduct Target Ther 2023 91. 2024;9(1):10-. Swanson KV, Deng M, Ting JPY. The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nat Rev Immunol. 2019;19(8):477–89. Fernandes-Alnemri T, Yu JW, Datta P, Wu J, Alnemri ES. AIM2 activates the inflammasome and cell death in response to cytoplasmic DNA. Nat 2009 4587237. 2009;458(7237):509–13. Carrillo-Gálvez AB, Guerra-Valverde JA, Padial-Molina M, Martínez-Cuevas A, Abril-García D, Olaechea A et al. Cross-talk between NLRP3 and AIM2 inflammasomes in macrophage activation by LPS and titanium ions. Mol Med. 2025;31(1). Kaufmann B, Leszczynska A, Reca A, Booshehri LM, Onyuru J, Tan Z, et al. NLRP3 activation in neutrophils induces lethal autoinflammation, liver inflammation, and fibrosis. EMBO Rep. 2022;23(11):EMBR202154446. Robinson KS, Boucher D. Inflammasomes in epithelial innate immunity: front line warriors. FEBS Lett. 2024;598(11):1335–53. Wang L, Chen K, Wan X, Wang F, Guo Z, Mo Z. NLRP3 inflammasome activation in mesenchymal stem cells inhibits osteogenic differentiation and enhances adipogenic differentiation. Biochem Biophys Res Commun. 2017;484(4):871–7. García-Góamez I, Elvira G, Zapata AG, Lamana ML, Ramíarez M, García Castro J, et al. Mesenchymal stem cells: biological properties and clinical applications. Expert Opin Biol Ther. 2010;10(10):1453–68. Dos Santos NCC, Cotrim KC, Achôa GL, Kalil EC, Kantarci A, Bueno DF. The Use of Mesenchymal Stromal/Stem Cells (MSC) for Periodontal and Peri-implant Regeneration: Scoping Review. Braz Dent J. 2024;35. Amato M, Santonocito S, Viglianisi G, Tatullo M, Isola G. Impact of Oral Mesenchymal Stem Cells Applications as a Promising Therapeutic Target in the Therapy of Periodontal Disease. Int J Mol Sci 2022, 23. 2022;23(21). Carrillo-Gálvez AB, Zurita F, Guerra-Valverde JA, Aguilar-González A, Abril-García D, Padial-Molina M, et al. NLRP3 and AIM2 inflammasomes expression is modified by LPS and titanium ions increasing the release of active IL-1β in alveolar bone-derived MSCs. Stem Cells Transl Med. 2024;13(8):826–41. Padial-Molina M, De Buitrago JG, Sainz-Urruela R, Abril-Garcia D, Anderson P, O’Valle F et al. Expression of Musashi-1 During Osteogenic Differentiation of Oral MSC: An In Vitro Study. Int J Mol Sci. 2019;20(9). Carrillo-Gálvez AB, Gálvez-Peisl S, González-Correa JE, de Haro-Carrillo M, Ayllón V, Carmona-Sáez P, et al. GARP is a key molecule for mesenchymal stromal cell responses to TGF-β and fundamental to control mitochondrial ROS levels. Stem Cells Transl Med. 2020;9(5):636–50. Luz-Crawford P, Jorgensen C, Djouad F. Mesenchymal Stem Cells Direct the Immunological Fate of Macrophages. Results Probl Cell Differ. 2017;62:61–72. Luque-Campos N, Bustamante-Barrientos FA, Pradenas C, García C, Araya MJ, Bohaud C, et al. The Macrophage Response Is Driven by Mesenchymal Stem Cell-Mediated Metabolic Reprogramming. Front Immunol. 2021;12:624746. Denu RA, Hematti P. Effects of Oxidative Stress on Mesenchymal Stem Cell Biology. Oxid Med Cell Longev. 2016;2016:2989076. Mancini OK, Lora M, Cuillerier A, Shum-Tim D, Hamdy R, Burelle Y, et al. Mitochondrial oxidative stress reduces the immunopotency of mesenchymal stromal cells in adults with coronary artery disease. Circ Res. 2018;122(2):255–66. Ryu D, Bin, Lim JY, Lee SE, Park G, Min CK. Induction of Indoleamine 2,3-dioxygenase by Pre-treatment with Poly(I:C) May Enhance the Efficacy of MSC Treatment in DSS-induced Colitis. Immune Netw. 2016;16(6):358. Seo Y, Kang MJ, Kim HS. Strategies to Potentiate Paracrine Therapeutic Efficacy of Mesenchymal Stem Cells in Inflammatory Diseases. Int J Mol Sci. 2021;22(7):3397. Sanz M, Herrera D, Kebschull M, Chapple I, Jepsen S, Beglundh T, et al. Treatment of stage I-III periodontitis-The EFP S3 level clinical practice guideline. J Clin Periodontol. 2020;47(Suppl 22):4–60. Li C, Zhang W, Jiang X, Mao N. Human-placenta-derived mesenchymal stem cells inhibit proliferation and function of allogeneic immune cells. Cell Tissue Res. 2007;330(3):437–46. Sun L, Liang J, Li H, Hou Y. Polarization of T Lymphocytes Is Regulated by Mesenchymal Stem Cells in NZBWF1 and BALB/c Mice. Int J Mol Sci. 2007;8:455–69. Lourdes Mora-García M, García-Rocha R, Morales-Ramírez O, Montesinos JJ, Weiss-Steider B, Hernández-Montes J et al. Mesenchymal stromal cells derived from cervical cancer produce high amounts of adenosine to suppress cytotoxic T lymphocyte functions. J Transl Med. 2016;14(1). Xu G, Zhang L, Ren G, Yuan Z, Zhang Y, Zhao RC, et al. Immunosuppressive properties of cloned bone marrow mesenchymal stem cells. Cell Res. 2007;17(3):240–8. Zheng T, Li S, Zhang T, Fu W, Liu S, He Y et al. Exosome-shuttled miR-150–5p from LPS-preconditioned mesenchymal stem cells down-regulate PI3K/Akt/mTOR pathway via Irs1 to enhance M2 macrophage polarization and confer protection against sepsis. Front Immunol. 2024;15. Areny-Balagueró A, Camprubí-Rimblas M, Campaña-Duel E, Solé-Porta A, Ceccato A, Roig A et al. Priming Mesenchymal Stem Cells with Lipopolysaccharide Boosts the Immunomodulatory and Regenerative Activity of Secreted Extracellular Vesicles. Pharmaceutics. 2024;16(10). Su Y, Xu C, Cheng W, Zhao Y, Sui L, Zhao Y. Pretreated Mesenchymal Stem Cells and Their Secretome: Enhanced Immunotherapeutic Strategies. Int J Mol Sci. 2023;24(2). Liotta F, Angeli R, Cosmi L, Filì L, Manuelli C, Frosali F, et al. Toll-like receptors 3 and 4 are expressed by human bone marrow-derived mesenchymal stem cells and can inhibit their T-cell modulatory activity by impairing Notch signaling. Stem Cells. 2008;26(1):279–89. Mellado S, Morillo-Bargues MJ, Perpiñá-Clérigues C, García-García F, Moreno-Manzano V, Guerri C, et al. The emerging role of mesenchymal stem cell-derived extracellular vesicles to ameliorate hippocampal NLRP3 inflammation induced by binge-like ethanol treatment in adolescence. Neural Regen Res. 2025;20(4):1153–63. Kharazinejad E, Hassanzadeh G, Sahebkar A, Yousefi B, Reza Sameni H, Majidpoor J, et al. The Comparative Effects of Schwann Cells and Wharton’s Jelly Mesenchymal Stem Cells on the AIM2 Inflammasome Activity in an Experimental Model of Spinal Cord Injury. Neuroscience. 2023;535:1–12. Chen Y, Yang L, Li X. Advances in Mesenchymal stem cells regulating macrophage polarization and treatment of sepsis-induced liver injury. Front Immunol. 2023;14. Nie Z, Fan Q, Jiang W, Wei S, Luo R, Hu H et al. Placental mesenchymal stem cells suppress inflammation and promote M2-like macrophage polarization through the IL-10/STAT3/NLRP3 axis in acute lung injury. Front Immunol. 2024;15. Yan L, Zheng D, Xu RH. Critical Role of Tumor Necrosis Factor Signaling in Mesenchymal Stem Cell-Based Therapy for Autoimmune and Inflammatory Diseases. Front Immunol. 2018;9(JUL):1658. Saraiva M, O’Garra A. The regulation of IL-10 production by immune cells. Nat Rev Immunol. 2010;10(3):170–81. Schildberger A, Rossmanith E, Eichhorn T, Strassl K, Weber V. Monocytes, peripheral blood mononuclear cells, and THP-1 cells exhibit different cytokine expression patterns following stimulation with lipopolysaccharide. Mediators Inflamm. 2013;2013. Hoppenbrouwers T, Bastiaan-Net S, Garssen J, Pellegrini N, Willemsen LEM, Wichers HJ. Functional differences between primary monocyte-derived and THP-1 macrophages and their response to LCPUFAs. PharmaNutrition. 2022;22(OCT):100322. Chomarat P, Rissoan MC, Banchereau J, Miossec P. Interferon gamma inhibits interleukin 10 production by monocytes. J Exp Med. 1993;177(2):523–7. Denu RA, Hematti P. Effects of Oxidative Stress on Mesenchymal Stem Cell Biology. Oxid Med Cell Longev. 2016;2016:2989076. Liu YY, Chiang CH, Hung SC, Chian CF, Tsai CL, Chen WC, et al. Hypoxia-preconditioned mesenchymal stem cells ameliorate ischemia/reperfusion-induced lung injury. PLoS ONE. 2017;12(11):e0187637. Hui Y, Jiao X, Yang L, Lu D, Han Y, Yang W, et al. Indoleamine-2,3-dioxygenase: An important controller in maintaining mesenchymal stem cell-mediated immunomodulatory homeostasis. Acta Pharm Sin B. 2025;15(7):3404–18. Munn DH, Zhou M, Attwood JT, Bondarev I, Conway SJ, Marshall B, et al. Prevention of allogeneic fetal rejection by tryptophan catabolism. Science. 1998;281(5380):1191–3. Németh K, Leelahavanichkul A, Yuen PST, Mayer B, Parmelee A, Doi K, et al. Bone marrow stromal cells attenuate sepsis via prostaglandin E(2)-dependent reprogramming of host macrophages to increase their interleukin-10 production. Nat Med. 2009;15(1):42–9. Kulesza A, Paczek L, Burdzinska A. The Role of COX-2 and PGE2 in the Regulation of Immunomodulation and Other Functions of Mesenchymal Stromal Cells. Biomedicines. 2023;11(2):445. MacKenzie KF, Clark K, Naqvi S, McGuire VA, Nöehren G, Kristariyanto Y, et al. PGE2 Induces Macrophage IL-10 Production and a Regulatory-like Phenotype via a Protein Kinase A–SIK–CRTC3 Pathway. J Immunol Author Choice. 2013;190(2):565. Latchman YE, Liang SC, Wu Y, Chernova T, Sobel RA, Klemm M, et al. PD-L1-deficient mice show that PD-L1 on T cells, antigen-presenting cells, and host tissues negatively regulates T cells. Proc Natl Acad Sci U S A. 2004;101(29):10691–6. Wei F, Zhong S, Ma Z, Kong H, Medvec A, Ahmed R, et al. Strength of PD-1 signaling differentially affects T-cell effector functions. Proc Natl Acad Sci U S A. 2013;110(27):E2480–9. Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterialsubmission.docx image1.png GRAPHICAL ABSTRACT Graphical abstract: CRISPR/Cas9-edited hABSCs overcome inflammasome-mediated impairment under inflammatory stress. Exposure to LPS and titanium (Ti) ions activates NLRP3 and AIM2 inflammasomes in hABSCs, reducing their immunomodulatory capacity toward T cells and macrophages. CRISPR/Cas9-mediated knockout (KO) of NLRP3 or AIM2 enables precise genomic silencing and decreases pro-inflammatory signaling within hABSCs. Functionally, edited cells display enhanced resilience under inflammatory conditions. While AIM2-KO hABSCs show improved immunomodulation under LPS stimulation, NLRP3-KO hABSCs maintain superior regulatory function under combined LPS and titanium stress, preserving high T cell suppression and macrophage modulation. These findings support inflammasome-targeted genome editing as a strategy to optimize MSC-based therapies for chronic inflammatory oral diseases. Figure created with NotebookLM (Google, 2026). Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 12 May, 2026 Reviews received at journal 10 May, 2026 Reviewers agreed at journal 08 May, 2026 Reviewers agreed at journal 07 May, 2026 Reviewers agreed at journal 22 Apr, 2026 Reviewers invited by journal 20 Apr, 2026 Editor assigned by journal 12 Apr, 2026 Submission checks completed at journal 10 Apr, 2026 First submitted to journal 01 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-9293324\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":629515179,\"identity\":\"d51669a2-ed0b-4b9c-afb5-f44d44723e6f\",\"order_by\":0,\"name\":\"Ana Belén Carrillo-Gálvez\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIiWNgGAWjYBADHj52BsYHpGlhY2ZgNiDNGqAWNgmiVPLPbn744eeeezJszMzHqnl+3WPg5z+AX4vEnWPGkj3PioEOY0u7zdtXzCA5I4GANTcSzBh4DiQAtfCY3ebtSWAwuEFAh/yN9G+Mf6BaikFa7M8TcJjBjRwzZpgtzDw/gLYwEHCY4Y2cYmkZsBa2ZMm5DQk8EjcIaJG7kb7x45sDCfb87M0HP7z5kyDH30/AYaiAsY2BhxT1IPCHVA2jYBSMglEwEgAA5cM5INsbddUAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"University of Granada\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Ana\",\"middleName\":\"Belén\",\"lastName\":\"Carrillo-Gálvez\",\"suffix\":\"\"},{\"id\":629515184,\"identity\":\"05164af1-2939-4ede-8f4e-c417321fb086\",\"order_by\":1,\"name\":\"José Antonio Guerra-Valverde\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Granada\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"José\",\"middleName\":\"Antonio\",\"lastName\":\"Guerra-Valverde\",\"suffix\":\"\"},{\"id\":629515187,\"identity\":\"69deb534-83a6-42c6-ac55-bcd8a574d1ba\",\"order_by\":2,\"name\":\"Miguel Padial-Molina\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Granada\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Miguel\",\"middleName\":\"\",\"lastName\":\"Padial-Molina\",\"suffix\":\"\"},{\"id\":629515200,\"identity\":\"543aa5f7-fe9b-4de5-862f-15acedaa2133\",\"order_by\":3,\"name\":\"Darío Abril-García\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Granada\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Darío\",\"middleName\":\"\",\"lastName\":\"Abril-García\",\"suffix\":\"\"},{\"id\":629515204,\"identity\":\"a3a0b6fc-4026-4c40-bb61-705e61724a3e\",\"order_by\":4,\"name\":\"Allinson Olaechea\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Granada\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Allinson\",\"middleName\":\"\",\"lastName\":\"Olaechea\",\"suffix\":\"\"},{\"id\":629515206,\"identity\":\"f87bbfeb-af4f-4c1f-ab43-3ce2e30e2546\",\"order_by\":5,\"name\":\"Natividad Martín-Morales\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Instituto de Investigación Biosanitaria (ibs) de Granada\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Natividad\",\"middleName\":\"\",\"lastName\":\"Martín-Morales\",\"suffix\":\"\"},{\"id\":629515209,\"identity\":\"fb144260-e846-492a-82ae-6ef04dfab8bd\",\"order_by\":6,\"name\":\"Francisco O'Valle\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Granada\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Francisco\",\"middleName\":\"\",\"lastName\":\"O'Valle\",\"suffix\":\"\"},{\"id\":629515212,\"identity\":\"d85a17a7-c726-45b7-93ca-2cc128053ab5\",\"order_by\":7,\"name\":\"Pablo Galindo-Moreno\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Granada\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Pablo\",\"middleName\":\"\",\"lastName\":\"Galindo-Moreno\",\"suffix\":\"\"},{\"id\":629515216,\"identity\":\"06872bd6-af48-4f0c-af32-bc2ea41a7aeb\",\"order_by\":8,\"name\":\"Federico Zurita\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Granada\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Federico\",\"middleName\":\"\",\"lastName\":\"Zurita\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2026-04-01 14:39:15\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-9293324/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-9293324/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":108007795,\"identity\":\"521583c7-d887-4a88-b54a-431dbc1005c2\",\"added_by\":\"auto\",\"created_at\":\"2026-04-28 13:02:12\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":5330061,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eExperimental design of hABSCs immunomodulation assays.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Schematic representation of T cell immunomodulation assay. CTRL, NLRP3-KO and AIM2-KO hABSCs were left untreated (NT) or preconditioned with LPS or LPS/Ti. After stimulation, hABSCs were co-cultured with human PBMCs activated with PHA for 5 days. T cell proliferation was assessed by CFSE dilution using flow cytometry, and supernatants were collected for cytokine analysis. (B) Schematic representation of macrophage polarization assay. CTRL, NLRP3-KO and AIM2-KO hABSCs were NT or pretreated with LPS or LPS/Ti, and conditioned medium (CM) was collected. THP-1 monocytes were differentiated into macrophages using PMA and subsequently exposed to CM for 48 hours. Cells were then polarized toward an M1 phenotype with IFNγ for 24 hours. Gene expression and cytokine production were analyzed. Figure created with NotebookLM (Google, 2026).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9293324/v1/9557ba98b60cf0779fe08650.png\"},{\"id\":108007056,\"identity\":\"ba326382-1f8b-4ec6-973c-1f7984e845d1\",\"added_by\":\"auto\",\"created_at\":\"2026-04-28 12:58:20\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":3807458,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eCRISPR/Cas9-mediated knockout of NLRP3 and AIM2 in hABSCs.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Generation and validation of NLRP3 knockout in hABSCs. Top left: Indel percentage and knockout (KO) score obtained after CRISPR/Cas9 editing. Top right: Representative chromatogram showing edited and CTRL sequences of the NLRP3 gene in the region surrounding the Cas9 cleavage site. The horizontal black underlined sequence indicates the gRNA target region, and the vertical black dotted line marks the predicted cutting site. DNA repair following Cas9 cleavage resulted in the insertion of a thymine immediately downstream of the cut site, followed by mixed sequencing peaks consistent with frameshift editing. Bottom left: Representative immunofluorescence images of NLRP3 expression in non-transduced (WT), CTRL, and NLRP3-KO hABSCs. Nuclei were counterstained with Hoechst. Bottom right: Quantification of NLRP3 fluorescence intensity in WT, CTRL, and NLRP3-KO cells. Fluorescence intensity was measured in at least 50 individual cells per condition in each experiment. (B) Generation and validation of AIM2 knockout in hABSCs. Top left: Indel percentage and KO score following CRISPR/Cas9 editing. Top right: Representative chromatogram showing edited and CTRL sequences of the AIM2 gene around the Cas9 cutting site. DNA repair resulted in the insertion of a thymine immediately after the cut site, followed by mixed sequencing peaks indicative of frameshift mutation. Bottom left: Representative immunofluorescence images of AIM2 expression in WT, CTRL, and AIM2-KO hABSCs, with Hoechst staining for nuclei. Bottom right: Quantification of AIM2 fluorescence intensity measured in at least 50 individual cells per condition. Data are shown as mean (SD) of three independent experiments. ***, p \\u0026lt; .001 versus WT.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9293324/v1/aa4d1d2a6c3fe0cd94b225e0.png\"},{\"id\":108007491,\"identity\":\"5325c7fa-833e-4801-b107-2fe76519e7b7\",\"added_by\":\"auto\",\"created_at\":\"2026-04-28 13:00:13\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1145404,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eInflammasome deficiency improves hABSCs-mediated suppression of T-cell proliferation.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Representative CFSE dilution histograms showing T-cell proliferation after 5 days of PBMCs stimulation with PHA in co-culture with hABSCs under different conditions. Red peaks correspond to CTRL hABSCs (non-treated, NT; LPS-pretreated; LPS/Ti-pretreated), purple peaks to NLRP3-KO hABSCs, and green peaks to AIM2-KO hABSCs. The percentage displayed in each histogram represents the proportion of divided T cells within the total population. Histograms illustrate the global proliferative profile for each experimental condition. (B) Quantification of T-cell proliferation expressed as division index, representing the average number of cell divisions undergone by responding T cells during the 5-day culture period. Data are shown as mean (SD) of three independent experiments. †††, p \\u0026lt; .001 versus PBMCs-; *, p \\u0026lt; .05; **, p \\u0026lt; .01; ***, p \\u0026lt; .001 versus C+. +, p \\u0026lt; .05; ++, p \\u0026lt; .01 CTRL versus KO among the treatments indicated by the square bracket.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9293324/v1/7199e90b986779ae7cedbd1c.png\"},{\"id\":108002945,\"identity\":\"43df0e4a-d417-40f4-b78a-86df73f442e1\",\"added_by\":\"auto\",\"created_at\":\"2026-04-28 12:20:42\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1283094,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eInflammasome-deficient hABSCs modulate macrophage polarization under inflammatory conditions.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Relative mRNA expression of M1-associated genes CD80 (left), CXCL10 (middle), and IL6 (right) in THP-1–derived macrophages treated with conditioned medium (CM) from hABSCs. hABSCs were either non-treated (NT) or preconditioned with LPS or LPS/Ti prior to CM collection. Gene expression levels were determined by RT-qPCR and normalized to housekeeping genes. (B) Relative mRNA expression of M2-associated genes CD206 (left), CCL17 (middle), and ALOX15 (right) in THP-1–derived macrophages cultured under the same CM conditions described in (A). (C) M1/M2 polarization ratio calculated as the mean expression of M1 genes relative to the mean expression of M2 genes for each condition. THP-1 cells differentiated with PMA alone were included as baseline controls, whereas PMA + IFNγ-treated cells were used as positive controls for M1 polarization. Data are presented as mean ± SD of six independent experiments. †††, p \\u0026lt; .001 versus PMA; *, p \\u0026lt; .05; **, p \\u0026lt; .01; ***, p \\u0026lt; .001 versus C+. +, p \\u0026lt; .05 CTRL versus KO among the treatments indicated by the square bracket.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9293324/v1/3fcbd1c754445e5194b1abec.png\"},{\"id\":108007784,\"identity\":\"8404f09d-c3d8-4fa8-b02b-f5513da7a84e\",\"added_by\":\"auto\",\"created_at\":\"2026-04-28 13:01:57\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":993448,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eInflammasome deficiency enhances hABSCs-mediated regulation of inflammatory cytokine secretion.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e(A) TNFα (left) and IL-10 (right) levels measured by ELISA in supernatants from 5-day co-cultures of PBMCs stimulated with PHA and hABSCs. hABSCs were either non-treated (NT) or preconditioned with LPS or LPS/Ti prior to co-culture. PBMCs stimulated with PHA alone were used as baseline control, and PBMCs stimulated with PHA + LPS were included as positive inflammatory control (C+). (B) TNFα (left) and IL-10 (right) secretion by THP-1–derived macrophages exposed for 48 hours to conditioned medium (CM) from hABSCs (NT, LPS, or LPS/Ti), followed by 24-hour M1 polarization with IFNγ. THP-1 cells differentiated with PMA alone were used as baseline control, and PMA + IFNγ-treated cells were included as positive control. (C) IL-1β levels measured by ELISA in supernatants from THP-1–derived macrophages treated under the same conditions described in (B). Data are presented as mean ± SD of 3 independent experiments. †. P \\u0026lt; .05; †††, p \\u0026lt; .001 versus PHA or PMA; *, p \\u0026lt; .05; **, p \\u0026lt; .01; ***, p \\u0026lt; .001 versus C+. +, p \\u0026lt; .05; ++, p \\u0026lt; .01; +++, p \\u0026lt; .001 CTRL versus KO among the treatments indicated by the square bracket.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9293324/v1/0023df974f5d1ca83a6c9e7e.png\"},{\"id\":108007742,\"identity\":\"a9c2f82d-b314-4764-80da-05848176587b\",\"added_by\":\"auto\",\"created_at\":\"2026-04-28 13:01:39\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":737627,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eInflammasome deficiency alters metabolic stress and immunomodulatory gene expression in hABSCs.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Proliferation of CTRL, NLRP3-KO and AIM2-KO hABSCs under basal conditions (NT) or following preconditioning with LPS or LPS/Ti. Cell proliferation was monitored for 5 days using the CellTiter-Blue assay. (B) Intracellular ROS production in edited and non-edited hABSCs following 4-hour stimulation with LPS or LPS/Ti. ROS levels were quantified using a fluorometric assay according to the manufacturer’s instructions. Results are expressed relative to untreated controls. (C) Relative mRNA expression of immunomodulatory genes in CTRL, NLRP3-KO and AIM2-KO hABSCs under NT, LPS, or LPS/Ti conditions. IDO (upper left), COX-2 (upper right), and PD-L1 (bottom) expression levels were determined by RT-qPCR and normalized to housekeeping genes. Data are presented as mean ± SD of 3 independent experiments. *, p \\u0026lt; .05; **, p \\u0026lt; .01; ***, p \\u0026lt; .001 versus untreated CTRL. ^, p \\u0026lt; .05; ^^^, p \\u0026lt; .001 versus untreated NLRP3-KO. #, p \\u0026lt; .05; ##, p \\u0026lt; .01; ###, p \\u0026lt; .001 versus untreated AIM2-KO.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9293324/v1/4f7f2ea15439d73e0263290c.png\"},{\"id\":108009003,\"identity\":\"3a8de304-b5f5-4028-ad5d-cd569ca55303\",\"added_by\":\"auto\",\"created_at\":\"2026-04-28 13:08:56\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":12989720,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9293324/v1/7745b2d0-5483-48ee-bf3f-13881e900b01.pdf\"},{\"id\":108006828,\"identity\":\"72e0c1c6-3044-4c02-a1ad-ad0ef5f7ab24\",\"added_by\":\"auto\",\"created_at\":\"2026-04-28 12:57:33\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":608322,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supplementarymaterialsubmission.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9293324/v1/b1056ae3d563e37e155e2a58.docx\"},{\"id\":108007397,\"identity\":\"09c6cad9-4c8b-453e-8437-37d3c8c78bd0\",\"added_by\":\"auto\",\"created_at\":\"2026-04-28 12:59:50\",\"extension\":\"png\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":4872161,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eGRAPHICAL ABSTRACT\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eGraphical abstract: CRISPR/Cas9-edited hABSCs overcome inflammasome-mediated impairment under inflammatory stress.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eExposure to LPS and titanium (Ti) ions activates NLRP3 and AIM2 inflammasomes in hABSCs, reducing their immunomodulatory capacity toward T cells and macrophages. CRISPR/Cas9-mediated knockout (KO) of NLRP3 or AIM2 enables precise genomic silencing and decreases pro-inflammatory signaling within hABSCs. Functionally, edited cells display enhanced resilience under inflammatory conditions. While AIM2-KO hABSCs show improved immunomodulation under LPS stimulation, NLRP3-KO hABSCs maintain superior regulatory function under combined LPS and titanium stress, preserving high T cell suppression and macrophage modulation. These findings support inflammasome-targeted genome editing as a strategy to optimize MSC-based therapies for chronic inflammatory oral diseases. Figure created with NotebookLM (Google, 2026).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9293324/v1/2a0234857fe743480732c3a5.png\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Inflammasome Modulation Enhances the Immunoregulatory Function of Mesenchymal Stromal Cells under Bacterial and Titanium-induced Inflammation\",\"fulltext\":[{\"header\":\"BACKGROUND\",\"content\":\"\\u003cp\\u003eChronic inflammation is a central pathological process underlying a wide range of human diseases, including autoimmune disorders, metabolic and cardiovascular diseases, neurodegeneration, and tissue-destructive conditions. Sustained inflammatory responses disrupt tissue homeostasis, drive structural damage, and impair regeneration, ultimately contributing to organ dysfunction (\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e). Within this broad context, periodontal and peri-implant diseases represent highly prevalent examples of chronic inflammatory disorders involving oral tissues. Affecting approximately 60% of the global adult population, periodontitis is a multifactorial disease primarily initiated by dysbiotic bacterial biofilms that trigger an exacerbated immune response, leading to connective tissue degradation and alveolar bone loss (\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e). Peri-implantitis, the analogous pathology occurring around dental implants, is characterized by inflammation of peri-implant tissues accompanied by progressive bone resorption (\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e). Although both diseases share major microbiological and clinical features, increasing evidence indicates that they also present significant biological differences; notably, peri-implant lesions often exhibit a denser immune infiltrate and a faster rate of bone loss than periodontitis, suggesting that additional inflammatory drivers may contribute to disease progression (\\u003cspan additionalcitationids=\\\"CR5\\\" citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e). Among the factors that may account for these differences is the release of metallic particles and ions from the implant surface. Titanium is widely used in oral implantology due to its excellent biocompatibility and mechanical properties, however, under inflammatory conditions, titanium particles and ions can act as danger-associated molecular patterns (DAMPs), amplifying local immune responses (\\u003cspan additionalcitationids=\\\"CR8\\\" citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eInflammation can be triggered by multiple stimuli, including the activation of inflammasome pathways (\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e). Inflammasomes are multiprotein complexes belonging to the innate immune system that promote the proteolytic maturation of pro-inflammatory cytokines interleukin-1β (IL-1β) and interleukin-18 (IL-18), as well as Gasdermin-D\\u0026ndash;mediated pyroptotic cell death (\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e). Among them, the NLRP3 (NLR family pyrin domain containing 3) inflammasome is one of the most widely studied due to its ability to sense a large variety of PAMPs (pathogen-associated molecular patterns) and DAMPs, including microbial components, ATP, and crystalline or metallic particles (\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e). In contrast, AIM2 (absent in melanoma 2) inflammasome is specifically activated by cytosolic double-stranded DNA (\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e). Inflammasomes are classically associated with cells of the innate immune system, particularly macrophages and neutrophils (\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e); however, they are also expressed in other cell types, such as epithelial and mesenchymal stromal cells (MSCs) (\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e). MSCs are multipotent stromal cells present in multiple tissues and are of particular interest because of their immunoregulatory, anti-inflammatory, and regenerative properties (\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e). These characteristics have positioned MSC-based approaches as attractive therapeutic strategies for the treatment of chronic inflammatory disorders, including periodontal and peri-implant diseases (\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e). Despite this potential, the molecular mechanisms linking inflammasome signaling to the immunomodulatory function of MSCs remain poorly defined.\\u003c/p\\u003e \\u003cp\\u003eIn a previous study from our group, we showed that human alveolar bone\\u0026ndash;derived MSCs (hABSCs) exposed to bacterial components (LPS) and titanium ions (Ti) upregulate the expression of NLRP3 and AIM2, accompanied by increased IL-1β release. Moreover, genetic disruption of NLRP3 or AIM2 markedly reduced IL-1β secretion and modified MSC survival and proliferative behavior under inflammatory conditions. Interestingly, although NLRP3-KO and AIM2-KO MSCs showed slightly reduced basal proliferation, they were less affected by LPS or LPS/Ti-induced growth inhibition than control MSCs, suggesting that attenuated inflammasome activation may enhance MSC resilience in inflammatory environments (\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eIn the present work, we investigated the immunomodulatory properties of wild-type (WT) and inflammasome-deficient MSCs under inflammatory stimulation with LPS and LPS/Ti. We evaluated their effects on T-cell proliferation and cytokine secretion, as well as on macrophage inflammatory responses \\u003cem\\u003ein vitro\\u003c/em\\u003e. By elucidating how inflammasome signaling modulates MSC activity, our findings may help optimize the efficacy of MSC-based therapies for periodontal and peri-implant diseases, with potential applicability to other inflammatory conditions.\\u003c/p\\u003e\"},{\"header\":\"MATERIALS AND METHODS\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell culture and maintenance\\u003c/h2\\u003e \\u003cp\\u003eBone specimens were obtained from multiple donors at the University of Granada School of Dentistry during dental implant surgery. Human MSCs derived from alveolar bone (hABSCs) were isolated from these samples following previously established protocols (\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e). Cells were expanded in low-glucose DMEM (Gibco) supplemented with 10% of fetal bovine serum (FBS, Sigma-Aldrich), non-essential amino acids (1:100, Gibco), basic fibroblast growth factor (bFGF) (0.01 \\u0026micro;g/mL, PeproTech), penicillin/streptomycin (100 U/mL), and amphotericin B (0.25 \\u0026micro;g/mL). Cell cultures were incubated at 37\\u0026deg;C under standard culture conditions (5% CO₂, 21% O₂). All hABSCs used in this study were positive for CD90, CD73, and CD105 and negative for CD14, CD34, CD45, and CD31, and retained their ability to differentiate into adipogenic, osteogenic, and chondrogenic lineages (data not shown).\\u003c/p\\u003e \\u003cp\\u003e The human monocytic cell line THP-1 was obtained from the \\u0026ldquo;Centro de Instrumentaci\\u0026oacute;n Cient\\u0026iacute;fica (CIC)\\u0026rdquo; (University of Granada) and cultured in RPMI 1640 (Biowest) supplemented with 10% of heat inactivated FBS, 50 \\u0026micro;M of 2-Mercaptoethanol and 100 U/mL of penicillin/streptomycin. THP-1 cells were incubated and maintained at 21% O\\u003csub\\u003e2\\u003c/sub\\u003e, 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e at 37\\u0026deg;C.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eGenome editing of hABSCs\\u003c/h3\\u003e\\n\\u003cp\\u003eNLRP3 and AIM2-knockout (KO)-hABSCs were generated using a CRISPR/Cas9-based lentiviral approach. Lentiviral vectors encoding Cas9 and a gene-specific guide RNA (gRNA) targeting either NLRP3 or AIM2 were used. A non-targeting gRNA served as a control. The efficiency and specificity of the gRNAs employed in this study had been previously validated in hABSCs by our group (\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e). Lentiviral particles were obtained from VectorBuilder Inc. and exhibited titers higher than 1 \\u0026times; 10⁹ infectious units/mL. The sequences of the gRNAs used were as follows:\\u003c/p\\u003e \\u003cp\\u003e \\u003cul\\u003e \\u003cli\\u003e \\u003cp\\u003eNLRP3 gRNA: CGGTCCTATGTGCTCGTCAA\\u003c/p\\u003e \\u003c/li\\u003e \\u003cli\\u003e \\u003cp\\u003eAIM2 gRNA: TCTTGGGTCTCAAACGTGAA\\u003c/p\\u003e \\u003c/li\\u003e \\u003cli\\u003e \\u003cp\\u003eControl gRNA: GTGTAGTTCGACCATTCGTG\\u003c/p\\u003e \\u003c/li\\u003e \\u003c/ul\\u003e \\u003c/p\\u003e\\n\\u003ch3\\u003eTransduction of hABSCs\\u003c/h3\\u003e\\n\\u003cp\\u003eLentiviral transduction of hABSCs was carried out following a previously described protocol with minor modifications (\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e). Briefly, 1 \\u0026times; 10⁶ hABSCs were incubated with concentrated lentiviral particles at a multiplicity of infection (MOI) of 50, were maintained at room temperature for 10 minutes and subsequently seeded in six-well culture plates, followed by incubation at 37\\u0026deg;C under 21% O₂ and 5% CO₂. After 5 hours of incubation, the viral containing medium was replaced with fresh culture medium. On the following day, cells were detached and subjected to a second round of transduction using the same viral conditions. After an additional 5-hour incubation period, cells were washed to remove residual viral particles and transferred to T75 flasks for expansion under standard culture conditions for 3\\u0026ndash;4 days. To select successfully transduced cells, cultures were treated with puromycin (0.5 \\u0026micro;g/mL; Sigma-Aldrich) for 7 days. Only puromycin-resistant cells were used for subsequent experiments.\\u003c/p\\u003e\\n\\u003ch3\\u003eVerification of CRISPR gene editing efficiency\\u003c/h3\\u003e\\n\\u003cp\\u003eTo evaluate the efficiency of CRISPR/Cas9-mediated gene disruption, genomic DNA was extracted from bulk-edited hABSCs using the Quick-DNA Miniprep Kit (Zymo Research). Genomic regions flanking the target sites recognized by each guide RNA were amplified by polymerase chain reaction (PCR) using the MyTaq\\u0026trade; Red Mix 2\\u0026times; kit (Bioline). PCR products were purified with the DNA Clean \\u0026amp; Concentrator-5 Kit (Zymo Research) and analyzed by Sanger sequencing (STABvida) using the same primers employed for amplification. Sequencing chromatograms were processed with the Inference of CRISPR Edits (ICE) analysis tool (Synthego), using sequences obtained from non-transduced hABSCs as reference controls. ICE analysis confirmed the presence of gene editing events consistent with non-homologous end joining (NHEJ). Primer sequences are provided in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e\\n\\u003ch3\\u003eImmunofluorescence\\u003c/h3\\u003e\\n\\u003cp\\u003eEdited and non-edited hABSCs were plated in 24-well culture plates (50,000 cells per well) and maintained under standard culture conditions. After allowing cell attachment for 24 hours, cultures were chemically fixed using 4% paraformaldehyde (PFA, Sigma-Aldrich). Cell membranes were then permeabilized with 0.25% Triton X-100 (Sigma-Aldrich), followed by a blocking step with 2% bovine serum albumin (BSA, Sigma-Aldrich) to minimize non-specific antibody binding. Samples were incubated overnight at 4\\u0026deg;C with antibodies recognizing human NLRP3 or AIM2 (Invitrogen and MyBioSource, respectively). After extensive washing, fluorescent labeling was achieved by incubation with an Alexa Fluor 488\\u0026ndash;conjugated goat anti-rabbit secondary antibody (Invitrogen) for 1 hour at room temperature. Nuclear staining was performed using Hoechst dye. Control conditions included samples processed in the absence of either primary or secondary antibodies. Images were acquired using a Nikon Eclipse Ts2 fluorescence microscope. Quantitative analysis of fluorescence intensity was performed with ImageJ software.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAssessment of MSC-mediated immunosuppression of T cells\\u003c/h2\\u003e \\u003cp\\u003eMSC-mediated immunosuppression of T cells was evaluated using a direct co-culture system, as schematically illustrated in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA. hABSCs, including Control (CTRL), NLRP3-knockout (NLRP3-KO), and AIM2-knockout (AIM2-KO) cells, were seeded in 96-well plates at a density of 1,000 cells per well and allowed to adhere overnight. Next day, hABSCs were either left untreated or stimulated with 1\\u0026micro;g/mL Lipopolysaccharide (LPS, \\u003cem\\u003eE.coli\\u003c/em\\u003e O111:B4, Sigma-Aldrich) or LPS in combination with 20\\u0026micro;g/mL Ti (Titanium atomic absorption standard solution, Sigma-Aldrich) (LPS/Ti) for 24 hours. The following day, peripheral blood mononuclear cells (PBMCs) were isolated from healthy donors by density gradient centrifugation using Ficoll-Paque (Sigma-Aldrich). Freshly isolated PBMCs were labeled with carboxyfluorescein succinimidyl ester (CFSE, Invitrogen) according to the manufacturer\\u0026rsquo;s instructions and subsequently activated with 1\\u0026micro;g/mL phytohemagglutinin (PHA, Sigma-Aldrich) to induce T cell proliferation. After hABSCs stimulation, culture media were removed, and CFSE-labeled PBMCs were added to the wells containing hABSCs at a density of 2 \\u0026times; 10⁵ cells per well. Control conditions included PBMCs cultured alone in the presence or absence of PHA, without hABSCs. Co-cultures were maintained for 5 days under standard culture conditions. At the end of the co-culture period, cell-free supernatants were collected and stored at \\u0026minus;\\u0026thinsp;20\\u0026deg;C for subsequent cytokine analysis by ELISA. PBMCs were then harvested and stained with a human anti-CD4 antibody (Invitrogen) to identify T cells. CFSE dilution within the CD4⁺ T cell population was analyzed by flow cytometry using a FACSCanto II flow cytometer (BD Biosciences). T cell proliferation and division indices were quantified using FlowJo software (Tree Star Inc., Ashland, OR).\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eAssessment of MSC-mediated immunomodulation of macrophages cells\\u003c/h3\\u003e\\n\\u003cp\\u003eMSC-mediated immunomodulation of macrophages was evaluated using a conditioned medium\\u0026ndash;based approach, as illustrated in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB. First, 100,000 CTRL, NLRP3-KO and AIM2-KO hABSCs were seeded in 6-well plates and allowed to adhere overnight under standard culture conditions. In parallel, 250,000 THP-1 monocytes were plated in 12-well plates and differentiated into macrophage-like cells by treatment with 100 ng/mL phorbol 12-myristate-13-acetate (PMA; Sigma-Aldrich). The following day, hABSCs were either left untreated or stimulated with LPS or LPS/Ti for 24 hours. After this stimulation period, the culture medium was replaced with fresh medium and hABSCs were maintained for an additional 48 hours to allow the release of conditioned factors. On the other hand, seventy-two hours after PMA treatment, THP-1\\u0026ndash;derived macrophages were washed and incubated in fresh medium for 24 hours. At this time point, conditioned medium from hABSCs cultures (collected 48 hours after medium replacement) was harvested and transferred onto THP-1\\u0026ndash;derived macrophages to induce macrophage conditioning. THP-1 cells were exposed to hABSC-conditioned media for 48 hours. Following the conditioning period, macrophages were washed and stimulated with 20 ng/mL interferon gamma (IFN-γ, Invivogen) for 24 hours to induce M1 polarization. After IFN-γ treatment, cell-free supernatants were collected and stored at \\u0026minus;\\u0026thinsp;20\\u0026deg;C for subsequent cytokine analysis by ELISA. For gene expression analysis, TRIzol\\u0026trade; Reagent (Invitrogen) was directly added to the cells, and samples were stored at \\u0026minus;\\u0026thinsp;80\\u0026deg;C until RNA extraction. Control conditions included THP-1 cells treated with PMA alone (negative control) and THP-1 cells treated with PMA followed by IFN-γ stimulation (positive control for M1 polarization).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e(A) Schematic representation of T cell immunomodulation assay. CTRL, NLRP3-KO and AIM2-KO hABSCs were left untreated (NT) or preconditioned with LPS or LPS/Ti. After stimulation, hABSCs were co-cultured with human PBMCs activated with PHA for 5 days. T cell proliferation was assessed by CFSE dilution using flow cytometry, and supernatants were collected for cytokine analysis. (B) Schematic representation of macrophage polarization assay. CTRL, NLRP3-KO and AIM2-KO hABSCs were NT or pretreated with LPS or LPS/Ti, and conditioned medium (CM) was collected. THP-1 monocytes were differentiated into macrophages using PMA and subsequently exposed to CM for 48 hours. Cells were then polarized toward an M1 phenotype with IFNγ for 24 hours. Gene expression and cytokine production were analyzed. Figure created with NotebookLM (Google, 2026).\\u003c/p\\u003e\\n\\u003ch3\\u003eQuantitative PCR (RT-qPCR)\\u003c/h3\\u003e\\n\\u003cp\\u003eTotal RNA was isolated using TRIzol\\u0026trade; Reagent according to the manufacturer\\u0026rsquo;s instructions. Complementary DNA (cDNA) was synthesized from purified RNA using the PrimeScript\\u0026reg; RT Master Mix (Perfect Real Time; TaKaRa Bio Inc.). Quantitative real-time PCR (RT-qPCR) was subsequently performed using TB Green\\u0026reg; Premix Ex Taq\\u0026trade; (Tli RNase H Plus; TaKaRa Bio Inc.) on a qTOWER\\u0026sup3; Real-Time PCR System. Primer sequences used for gene amplification are provided in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eRatio M1/M2\\u003c/h2\\u003e \\u003cp\\u003eThe inflammatory polarization status of THP-1\\u0026ndash;derived macrophages was assessed by analyzing the expression of established M1 and M2 macrophage-associated genes by RT-qPCR. Following the experimental procedures described above, total RNA was extracted and reverse-transcribed, and relative gene expression levels were determined by quantitative PCR. The pro-inflammatory (M1) phenotype was evaluated using the markers CD80, CXCL10 and IL-6, whereas the anti-inflammatory (M2) phenotype was assessed through the expression of CD206, CCL17 and ALOX15. Relative expression values were calculated for each gene, and an M1/M2 polarization index was generated by computing the ratio between the mean expression levels of M1-associated genes and those of M2-associated genes. An M1/M2 ratio greater than 1 was interpreted as a predominance of the pro-inflammatory M1 phenotype, whereas values below 1 indicated a shift toward an M2-like polarization. Primer sequences used for gene expression analysis are listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eSequence of primers used for PCR and RT-qPCR analyzes.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"3\\\" nameend=\\\"c3\\\" namest=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimers\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGene\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward sequence\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eReverse sequence\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eNLRP3-KO check\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-CAGGAAGATGATGTTGGACT-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-AAGGAAGAAGACGTACACCG-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eAIM2-KO check\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-CTTCCCTTGATTCCACCTAT-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-CTGAGTTTGAAGCGTGTTGA-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCD80\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-CTCTTGGTGCTGGCTGGTCTTT-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-GCCAGTAGATGCGAGTTTGTGC-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCXCL10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-CGCTGTACCTGCATCAGCAT-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-CGTGGACAAAATTGGCTTGC-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIL-6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u0026acute;5\\u0026acute;-AGGAGACTTGCCTGGTGAAA-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-CAGGGGTGGTTATTGCATCT-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCD206\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-AGCCAACACCAGCTCCTCAAGA-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-CAAAACGCTCGCGCATTGTCCA-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCCL17\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-CTTCTCTGCAGCACATCCAC-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-CAGATGTCTGGTACCACGTC-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eALOX15\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-CAGATGTCCATCACTTGGCAG-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-CTCCTCCCTGAACTTCTTCAG-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIDO\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-GCCTGATCTCATAGAGTCTGGC-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-TGCATCCCAGAACTAGACGTGC-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCOX-2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-CGGTGAAACTCTGGCTAGACAG-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-GCAAACCGTAGATGCTCAGGGA-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePD-L1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-TGCCGACTACAAGCGAATTACTG-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-CTGCTTGTCCAGATGACTTCGG-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGAPDH\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-AGCTCATTTCCTGGTATGACAAC-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-TTACTCCTTGGAGGCCATGTG-3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eEnzyme-Linked Immunosorbent Assay (ELISA)\\u003c/h2\\u003e \\u003cp\\u003eCell-free supernatants collected from hABSCs\\u0026ndash;PBMCs co-cultures and from THP-1 cultures treated with hABSCs-conditioned media were clarified by centrifugation at 1,000 \\u0026times; g for 10 minutes at 4\\u0026deg;C. Levels of interleukin-1 beta (IL-1β), tumor necrosis factor alpha (TNF-α), and interleukin-10 (IL-10) were quantified using Human IL-1β, Human TNF-α and Human IL-10 Uncoated ELISA kits (Invitrogen), respectively, according to the manufacturers\\u0026rsquo; instructions. Absorbance was measured at 450 nm using an Infinite M200 Pro microplate reader (Tecan). Cytokine concentrations were calculated by interpolation from standard curves generated with recombinant cytokines provided in each kit.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ehABSCs proliferation\\u003c/h2\\u003e \\u003cp\\u003eThe proliferative capacity of hABSCs, either gene-edited or control, was evaluated using the CellTiter-Blue\\u0026reg; cell viability assay. Briefly, 1,000 hABSCs per well were plated in 96-well culture plates and allowed to attach overnight. Cells were subsequently left untreated or exposed to LPS or LPS in combination with titanium ions, as described above. Cell proliferation was assessed at day 5 after treatment by incubating cultures with CellTiter-Blue\\u0026reg; reagent for 4 hours. Fluorescence was then recorded at 560 nm using an Infinite M200 Pro microplate reader.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eIntracellular Reactive Oxygen Species (ROS) measurement\\u003c/h2\\u003e \\u003cp\\u003eROS levels were determined in hABSCs, including CTRL, NLRP3-KO and AIM2-KO cells, using a fluorometric intracellular ROS detection assay (Sigma-Aldrich). Cells were seeded under standard culture conditions and subsequently left untreated or stimulated with LPS) or LPS/Ti, during 4 hours. Following stimulation, the ROS Detection Reagent was added directly to the cultures, and cells were incubated for 1 hour at 37\\u0026deg;C according to the manufacturer\\u0026rsquo;s instructions. Fluorescence signals were then recorded using an Infinite M200 Pro microplate reader at λex\\u0026thinsp;=\\u0026thinsp;540 nm / λem\\u0026thinsp;=\\u0026thinsp;570 nm.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eAll statistical analyses were performed using GraphPad Prism software. Results are expressed as mean values with corresponding standard deviations (SD) derived from a minimum of three independent experiments. Data distribution was evaluated for normality using the Shapiro\\u0026ndash;Wilk test. Comparisons among multiple experimental groups were carried out using one-way or two-way analysis of variance (ANOVA), as appropriate, followed by Tukey\\u0026rsquo;s multiple comparisons test. Differences were considered statistically significant when p values were \\u0026le;\\u0026thinsp;0.05.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"RESULTS\",\"content\":\"\\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eGeneration and validation of NLRP3 and AIM2 deficient hABSCs\\u003c/h2\\u003e\\n\\u003cp\\u003eTo generate hABSCs deficient in NLRP3 or AIM2, a CRISPR/Cas9-based genome editing strategy was employed. Cells were transduced with lentiviral \\u0026ldquo;all-in-one\\u0026rdquo; vectors encoding both the Cas9 nuclease and gene-specific guide RNAs. Successfully transduced cells were selected using puromycin, and genomic DNA was subsequently extracted to evaluate editing efficiency.\\u003c/p\\u003e\\n\\u003cp\\u003eFor each target gene, three independent knockout cell populations (N) were generated. In the case of NLRP3, ICE analysis revealed high editing efficiencies, with indel frequencies of 92%, 90%, and 97%, and corresponding KO-scores of 91, 90, and 92, respectively (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA, upper left table). Similarly, AIM2 knockout hABSCs showed indel frequencies of 97% in all three populations, with KO-scores of 97, 93, and 95 (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB, upper left table).\\u003c/p\\u003e\\n\\u003cp\\u003eSequence analysis demonstrated that, for both NLRP3 and AIM2, Cas9-mediated DNA cleavage followed by non-homologous end joining predominantly resulted in the insertion of a single nucleotide at the target site, specifically a thymine (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA, \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB, upper right panels). This single-nucleotide insertion is predicted to disrupt the open reading frame, leading to the generation of truncated or non-functional protein products due to frameshift mutations and/or premature stop codons.\\u003c/p\\u003e\\n\\u003cp\\u003eConsistent with the genomic data, immunofluorescence analysis revealed a marked reduction in NLRP3 and AIM2 protein expression in the corresponding knockout hABSCs compared to control cells (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA, \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB, lower panels), confirming the effective disruption of both genes at the protein level.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eNLRP3 and AIM2 deficiency modulates the T cell immunosuppressive function of hABSCs under inflammatory conditions\\u003c/h2\\u003e\\n\\u003cp\\u003eMSCs are widely recognized for their immunomodulatory and regenerative properties, which support their therapeutic potential (\\u003cspan class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e, \\u003cspan class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e). However, how inflammasome activation influences these functions remains poorly understood. In a previous study, we demonstrated that NLRP3 and AIM2 deficient hABSCs proliferate more efficiently than unedited cells under LPS or LPS/Ti induced inflammatory conditions (\\u003cspan class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e). Based on these observations, we investigated whether an inflammatory microenvironment also modulates the immunosuppressive capacity of inflammasome deficient hABSCs. To address this, we evaluated the ability of control (CTRL), NLRP3-KO, and AIM2-KO hABSCs, either non-treated (NT) or pre-exposed to LPS or LPS/Ti, to suppress T cell proliferation in a CFSE-based assay. Under basal conditions, CTRL, NLRP3-KO, and AIM2-KO hABSCs exhibited a comparable capacity to suppress T cell proliferation, indicating that inflammasome deficiency does not intrinsically alter the immunosuppressive function of hABSCs. However, pre-treatment of CTRL hABSCs with LPS significantly impaired their suppressive capacity, an effect that was further exacerbated in the presence of LPS/Ti. In contrast, NLRP3-KO hABSCs maintained a significantly higher immunosuppressive activity under both LPS and LPS/Ti treatments compared to CTRL cells. AIM2-KO hABSCs also displayed an improved ability to suppress T cell proliferation in the presence of LPS when compared to CTRL hABSCs. Notably, this protective effect was lost upon exposure to LPS/Ti, suggesting that titanium-driven inflammatory conditions preferentially activate NLRP3 pathway, thereby limiting the contribution of AIM2 to the regulation of MSC immunomodulatory function under these conditions (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). Quantitative analysis of T cell proliferation, expressed as proliferation index, supported these observations (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB). While all hABSCs populations significantly reduced T cell proliferation under basal conditions, only NLRP3-KO hABSCs preserved a robust and significative suppressive effect under inflammatory stimulation, particularly in the presence of titanium particles.\\u003c/p\\u003e\\n\\u003cp\\u003eComparable results were obtained when using WT hABSCs instead of CTRL cells, both under basal and inflammatory conditions (\\u003cstrong\\u003eSupplementary Figure \\u003cspan class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e\\u003c/strong\\u003e). As WT and CTRL hABSCs showed indistinguishable immunosuppressive behavior, subsequent experiments were performed using CTRL hABSCs as reference.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eInflammasome activation in hABSCs alters their ability to regulate macrophage polarization\\u003c/h2\\u003e\\n\\u003cp\\u003eMSCs are known to modulate macrophage activation by limiting pro-inflammatory M1 polarization and contributing to the maintenance of immune homeostasis (\\u003cspan class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e, \\u003cspan class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e). To evaluate whether inflammasome activation affects this function, macrophage polarization was analyzed in THP-1\\u0026ndash;derived macrophages exposed to conditioned medium (CM) from CTRL, NLRP3-KO, or AIM2-KO hABSCs, either NT or previously stimulated with LPS or LPS/Ti. As an initial validation of the experimental system, LPS/IFN\\u0026gamma; stimulation robustly induced the expression of M1-associated genes (CXCL10, CD80, and IL6), while CM from WT hABSCs reduced this induction. In parallel, LPS/IFN\\u0026gamma; treatment decreased the expression of M2-associated genes (CD206, CCL17, and ALOX15), which showed a modest recovery upon exposure to hABSCs-derived CM, confirming the suitability of the model to assess MSC-mediated modulation of macrophage polarization (\\u003cstrong\\u003eSupplementary Figure S2\\u003c/strong\\u003e).\\u003c/p\\u003e\\n\\u003cp\\u003eAnalysis of M1-associated gene expression revealed that CM from NT-hABSCs, regardless of inflammasome status, exerted comparable effects on macrophages. In contrast, CM derived from LPS or LPS/Ti-stimulated hABSCs increased the expression of M1 markers in all conditions, with an attenuated induction observed in macrophages exposed to CM from NLRP3-KO hABSCs, and to a lesser extent from AIM2-KO hABSCs (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA). Evaluation of M2-associated genes did not reveal marked differences among conditions, and no consistent trends were observed between CTRL and inflammasome-deficient hABSCs (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB). Given the limited differences observed at the level of individual markers, macrophage polarization was further assessed by analyzing the M1/M2 gene expression ratio. While CM from NT-hABSCs markedly reduced the M1/M2 ratio compared to pro-inflammatory controls (C+), CM from LPS or LPS/Ti-treated CTRL hABSCs showed a partial loss of this modulatory effect. Importantly, CM from both NLRP3-KO and AIM2-KO hABSCs preserved a significantly lower M1/M2 ratio under LPS stimulation compared to CTRL-derived CM. Under LPS/Ti conditions, a reduction in the M1/M2 ratio was still observed in macrophages exposed to CM from NLRP3-KO hABSCs compared to CTRL hABSCs, whereas this reduction was no longer evident in the AIM2-KO condition, consistent with enhanced involvement of the NLRP3 inflammasome in titanium-associated inflammatory environments (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eInflammasome-deficient hABSCs differentially regulate pro and anti-inflammatory cytokine secretion\\u003c/h2\\u003e\\n\\u003cp\\u003eTo further characterize the immunomodulatory effects of inflammasome-deficient hABSCs, we analyzed the secretion of key pro- and anti-inflammatory cytokines as functional readouts of immune activation. Tumor Necrosis Factor (TNF)-\\u0026alpha; and IL-10 were measured in supernatants from PBMC\\u0026ndash;hABSCs cocultures, while TNF\\u0026alpha;, IL-1\\u0026beta;, and IL-10 were quantified in supernatants from THP-1\\u0026ndash;derived macrophages exposed to CM of hABSCs.\\u003c/p\\u003e\\n\\u003cp\\u003eIn PBMCs cocultures, LPS stimulation markedly increased TNF\\u0026alpha; secretion compared to PHA alone, whereas coculture with hABSCs, edited or not, strongly suppressed TNF\\u0026alpha; release (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA, left panel). This suppressive effect was partially impaired when CTRL hABSCs were pre-exposed to LPS and further reduced under LPS/Ti treatments. In contrast, NLRP3-KO hABSCs largely preserved their ability to suppress TNF\\u0026alpha; secretion under inflammatory stimulation, reaching levels comparable to untreated hABSCs under LPS and remaining significantly lower than CTRL-derived cocultures under LPS/Ti. AIM2-KO hABSCs also reduced TNF\\u0026alpha; secretion, however, their effect did not significantly differ from that of CTRL hABSCs under either inflammatory condition. IL-10 secretion in PBMCs cocultures increased upon immune activation and was further enhanced in the presence of hABSCs (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA, right panel). Under LPS stimulation, cocultures with NLRP3-KO and AIM2-KO hABSCs showed significantly higher IL-10 levels than those with CTRL hABSCs, whereas under LPS/Ti conditions this increase was maintained only in the NLRP3-KO condition.\\u003c/p\\u003e\\n\\u003cp\\u003eIn macrophage cultures, IFN\\u0026gamma;-induced TNF\\u0026alpha; secretion was markedly reduced by CM from hABSCs irrespective of inflammasome status (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB, left panel). However, CM from LPS or LPS/Ti-treated CTRL hABSCs showed a reduced suppressive capacity, whereas CM from NLRP3-KO hABSCs consistently maintained lower TNF\\u0026alpha; levels under all inflammatory conditions, an effect that was also observed with AIM2-KO hABSCs but only under LPS stimulation. IL-10 secretion was enhanced by CM from CTRL hABSCs compared to the positive control, while CM from inflammasome-deficient hABSCs maintained IL-10 levels comparable to the control condition (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB, right panel). Unexpectedly, pre-exposure of hABSCs to LPS or LPS/Ti led to a generalized reduction in IL-10 secretion. This decrease was significantly more pronounced in macrophages exposed to CM from NLRP3-KO hABSCs under LPS and from AIM2-KO hABSCs under both LPS and LPS/Ti conditions. Finally, secretion analysis of the hallmark cytokine of inflammasome activation (IL-1\\u0026beta;) in macrophages revealed a pattern closely resembling that observed for TNF\\u0026alpha;, with CM from NLRP3-KO hABSCs limiting IL-1\\u0026beta; release under inflammatory conditions, whereas this effect was attenuated or lost in CTRL and AIM2-KO conditions, particularly in the presence of titanium (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eCell-intrinsic mechanisms associated with enhanced immunomodulation in inflammasome-deficient hABSCs\\u003c/h2\\u003e\\n\\u003cp\\u003eTo explore potential mechanisms underlying the enhanced immunomodulatory effects observed in inflammasome-deficient hABSCs, we evaluated cell proliferation, intracellular ROS production and the expression of key immunomodulatory mediators, including Indoleamine 2,3-dioxygenase (IDO), Cyclooxygenase-2 (COX-2), and Programmed death-ligand 1 (PD-L1), which are known to contribute to MSC-mediated immune regulation (\\u003cspan class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e\\u0026ndash;\\u003cspan class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e).\\u003c/p\\u003e\\n\\u003cp\\u003eAnalysis of hABSCs proliferation over a 5-day period revealed no significant differences between CTRL, NLRP3-KO, or AIM2-KO cells, either under basal conditions or following stimulation with LPS or LPS/Ti, indicating that differences in immunomodulatory capacity are not attributable to altered cell expansion (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA). Inflammatory stimulation with LPS or LPS/Ti significantly increased intracellular ROS levels in all experimental conditions. Notably, this increase was significantly attenuated in NLRP3-KO hABSCs compared to CTRL cells, whereas AIM2-KO hABSCs displayed ROS levels comparable to those of CTRL cells (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eB). Finally, expression of immunomodulatory genes was strongly induced by inflammatory stimulation. IDO expression increased in all conditions upon LPS and LPS/Ti exposure, with a more pronounced upregulation in inflammasome-deficient hABSCs, reaching statistical significance in NLRP3-KO cells under LPS/Ti stimulation compared to CTRL cells (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eC, upper left panel). A similar pattern was observed for COX-2 and PD-L1 expression, both of which were significantly higher in NLRP3-KO hABSCs compared to CTRL cells under LPS and LPS/Ti conditions (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eC, upper right and lower panels). Collectively, these findings indicate that NLRP3 deficiency in hABSCs is associated with reduced oxidative stress and enhanced expression of key immunomodulatory mediators under inflammatory conditions, which may contribute, at least in part, to the improved immunoregulatory effects observed in previous functional assays.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"DISCUSSION\",\"content\":\"\\u003cp\\u003eChronic periodontal and peri-implant diseases remain challenging to treat, as current therapeutic approaches are largely based on mechanical debridement, often combined with antimicrobial strategies that fail to fully control the underlying dysregulated immune response (\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e). In particular, peri-implantitis has emerged as a distinct inflammatory entity, characterized by a more aggressive immune infiltrate and accelerated bone loss compared to periodontitis, likely driven not only by bacterial dysbiosis but also by the release of titanium particles and ions from implant surfaces (\\u003cspan additionalcitationids=\\\"CR5\\\" citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e). In this context, therapies aimed at modulating inflammation are increasingly recognized as essential. MSCs represent a promising immunoregulatory strategy tool (\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e), however, their function is highly dependent on the surrounding inflammatory environment. While inflammasome research has predominantly focused on innate immune cells (\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e), much less attention has been paid to how inflammasome activation within MSCs themselves may influence their regulatory and regenerative capacities. In our previous work, we demonstrated that exposure of hABSCs to LPS and Ti activates NLRP3 and AIM2 inflammasomes and triggers IL-1β release. Importantly, genetic disruption of these pathways enhanced MSC resilience under inflammatory stress, with knockout cells exhibiting improved long-term survival compared to wild-type controls in the presence of inflammatory stimuli (\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e). Based on these observations, the present study was designed to determine whether inflammasome activation also affects the immunomodulatory function of MSCs, specifically MSCs derived from alveolar bone (hABSCs), and whether selective inflammasome targeting can preserve hABSCs-mediated immune regulation in complex inflammatory environments relevant to periodontal and peri-implant diseases.\\u003c/p\\u003e \\u003cp\\u003eTo address this question, we first evaluated whether inflammasome activation influences the capacity of hABSCs to suppress T-cell proliferation, a defining feature of MSC immunomodulation (\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e). This function depends on soluble mediators and cell\\u0026ndash;cell interactions (\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e) and is known to be shaped by inflammatory priming. Indeed, LPS conditioning has been reported to either enhance or impair MSC immunosuppressive activity depending on experimental context (\\u003cspan additionalcitationids=\\\"CR36 CR37\\\" citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e). In our model, LPS reduced the suppressive capacity of hABSCs, an effect that was further aggravated by titanium ions, an observation not previously described and highly relevant to peri-implantitis. Although inflammasome signaling has been implicated in MSC biology (\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e), direct evidence linking specific inflammasomes to T-cell regulation remains limited. Here, we show that NLRP3 deficiency preserved hABSCs-mediated T-cell suppression under both LPS and LPS/Ti conditions, whereas AIM2 deletion conferred benefit only under LPS stimulation. Together, these findings point to NLRP3 as a key regulator limiting hABSCs immunomodulatory function, particularly in titanium-associated inflammatory environments.\\u003c/p\\u003e \\u003cp\\u003eWe next evaluated whether inflammasome activation in hABSCs modulates their ability to regulate macrophage polarization. MSCs are well known to reduce pro-inflammatory M1 phenotypes through paracrine mechanisms that support tissue homeostasis (\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e), although this function is sensitive to inflammatory priming. While LPS-conditioned MSC-derived extracellular vesicles have been reported to enhance pro-resolving macrophage responses (\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e), we observed that direct LPS exposure reduced the capacity of hABSCs to inhibit M1 polarization, an effect further exacerbated by titanium. Under LPS stimulation alone, both NLRP3 and AIM2 deficient hABSCs, more effectively reduced the M1/M2 ratio compared to non-edited cells, indicating enhanced control of M1 polarization in a bacterial inflammatory context. However, under combined LPS/Ti conditions, this superior regulatory effect was preserved only in NLRP3-deficient cells, whereas AIM2 deficiency no longer conferred additional benefit. As observed in T-cell assays, these findings reinforce a predominant role for NLRP3 in maintaining MSC immunoregulatory function in metal-associated inflammatory environments.\\u003c/p\\u003e \\u003cp\\u003eCytokine profiling further supported these functional observations. Consistent with the established immunosuppressive properties of MSCs (\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e), hABSCs markedly reduced TNFα production in activated PBMCs cultures, while simultaneously promoting IL-10 secretion. Notably, inflammasome disruption enhanced this regulatory balance under inflammatory priming, indicating that NLRP3 and AIM2 activation impose intrinsic constraints on hABSCs-mediated control of adaptive immune responses. The induction of IL-10 observed in stimulated PBMCs even in the absence of MSCs likely reflects the endogenous self-regulatory capacity of primary leukocytes to prevent excessive inflammation, as monocytes and T cells within PBMCs populations can produce IL-10 to maintain immune homeostasis (\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e). Thus, inflammasome-deficient hABSCs appear to amplify a physiological anti-inflammatory feedback loop rather than introducing an suppressive signal. In macrophage assays, conditioned media from hABSCs consistently attenuated TNFα and IL-1β secretion, supporting previous evidence that MSCs limit M1-associated inflammatory outputs (\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e). However, unlike in PBMCs, this modulation was not accompanied by increased IL-10 production. Given that THP-1\\u0026ndash;derived macrophages exhibit limited IL-10 secretion compared to primary macrophages (\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e), and that IFNγ-driven polarization may further restrict IL-10 expression (\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e), our data suggest that, in this model, MSCs primarily exert anti-inflammatory effects through suppression of pro-inflammatory cytokines rather than active induction of an M2 cytokine program.\\u003c/p\\u003e \\u003cp\\u003eThe enhanced immunomodulatory performance of inflammasome-deficient hABSCs cannot be attributed to differences in cell number, as no significant proliferation changes were detected during the 5-day experimental window. Although we previously reported improved long-term proliferative capacity of NLRP3 and AIM2-deficient hABSCs under sustained LPS or LPS/Ti exposure, these differences emerged only after prolonged culture (\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e), indicating that the functional advantages observed here are independent of short-term expansion dynamics. Instead, our data point to qualitative changes in cellular fitness and paracrine programming.\\u003c/p\\u003e \\u003cp\\u003eInflammasome-deficient cells displayed reduced ROS accumulation under inflammatory conditions, particularly NLRP3-KO hABSCs, suggesting improved resistance to oxidative stress. Excessive intracellular ROS is known to impair MSC fitness, promote premature senescence, and limit the secretion of key immunoregulatory mediators such as IDO and Prostaglandin E2 (PGE2) (\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e). Given that mitochondrial ROS act as upstream activators of the NLRP3 inflammasome, genetic ablation of NLRP3 likely disrupts a positive feedback loop of inflammasome activation, autocrine inflammatory signaling, and oxidative stress, thereby preserving cellular integrity and functional competence. Consistently, NLRP3 and, to a lesser extent, AIM2-deficient hABSCs exhibited increased expression of IDO, COX-2, and PD-L1 under inflammatory priming. IDO and COX-2 operate synergistically in MSC-mediated immunoregulation: IDO suppresses T-cell responses through tryptophan catabolism (\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e), while COX-2\\u0026ndash;derived PGE2 has been shown to promote macrophage reprogramming and IL-10 production (\\u003cspan additionalcitationids=\\\"CR53\\\" citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e54\\u003c/span\\u003e). Although enhanced IL-10 secretion was not observed in our THP-1 model, likely reflecting the limited IL-10 competence of this cell line under IFNγ-driven polarization, the coordinated upregulation of these pathways supports a shift toward a reinforced immunomodulatory program. Enhanced PD-L1 expression further indicates strengthened contact-dependent inhibition of activated T cells (\\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e55\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e56\\u003c/span\\u003e). These changes suggest that, in wild-type cells, inflammasome activation may divert metabolic and signaling resources toward a self-amplifying pro-inflammatory program, whereas inflammasome-deficient hABSCs redirect these pathways toward a predominantly regulatory phenotype.\\u003c/p\\u003e\"},{\"header\":\"CONCLUSIONS\",\"content\":\"\\u003cp\\u003eOur findings demonstrate that the inflammatory microenvironment not only challenges hABSCs function but actively modifies their immunoregulatory programming through inflammasome-dependent mechanisms. Targeted disruption of AIM2, and particularly NLRP3, preserves hABSCs fitness, enhances their anti-inflammatory secretome, and improves their capacity to modulate both adaptive and innate immune responses under conditions modeling periodontitis and peri-implantitis. These results underscore the importance of considering intrinsic inflammatory signaling pathways when designing MSC-based therapies and position NLRP3 as a promising target to optimize cell-based interventions for chronic inflammatory diseases, especially in metal-associated pathologies.\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cdiv class=\\\"DefinitionList\\\"\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eAIM2\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eAbsent in melanoma 2\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eCas9\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eCrispr associated protein 9\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eCFSE\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eCarboxyfluorescein succinimidyl ester\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eCM\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eConditioned medium/media\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eCOX-2\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eCyclooxygenase-2\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eCRISPR\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eClustered Regularly Interspaced Short Palindromic Repeats\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eCTRL\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eControl\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eDAMPs\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eDanger associated molecular pattern\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eELISA\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eEnzyme-Linked Immunosorbent Assay\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003egRNA\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eGuide-RNA\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003ehABSCs\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eHuman alveolar bone derived MSCs\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eIDO\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eIndoleamine 2,3-dioxygenase\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eIL-1β\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eInterleukin-1β\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eIL-10\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eInterleukin-10\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eIL-18\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eInterleukin-18\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eIFNγ\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eInterferon gamma\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eKO\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eKnockout\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eLPS\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eLipopolysaccharide\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eMSCs\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eMesenchymal stromal cells\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eNLRP3\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eNLR family pyrin domain containing 3\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eNT\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eNon-treated\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003ePAMPs\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003ePathogen associated molecular pattern\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003ePBMCs\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003ePeripheral blood mononuclear cells\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003ePCR\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003ePolymerase chain reaction\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003ePD-L1\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eProgrammed death-ligand 1\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003ePGE2\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eProstaglandin E2\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003ePHA\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003ePhytohemagglutinin\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003ePMA\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003ePhorbol 12-myristate-13-acetate\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eROS\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eReactive oxygen species\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eRT-qPCR\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eReverse transcription quantitative-PCR\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eTi\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eTitanium ions\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003eWT\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eWild type\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cu\\u003eEthics approval and consent to participate\\u003c/u\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll procedures performed in this study involving human participants were conducted in accordance with the ethical standards of the institutional and national research committee and with the 1964 Declaration of Helsinki and its later amendments. Blood samples for PBMC and T cell isolation, as well as human alveolar bone–derived mesenchymal stromal cells (hABSCs), were obtained after approval by the Ethics Committee for Human Research of the University of Granada, Spain (protocol numbers 3670/CEIH/2023 and 3672/CEIH/2023). Written informed consent was obtained from all participants prior to sample collection.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eClinical trial registration\\u003c/u\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eConsent for publication\\u003c/u\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eAvailability of data and materials\\u003c/u\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eCompeting interests\\u003c/u\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no competing interests\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eFunding\\u003c/u\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFinancial support for this research was provided by MICIU/AEI/10.13039/501100011033 under grant PID2022-137950NB-I00, with additional co-funding from the European Regional Development Fund (ERDF/EU). The authors also acknowledge the Cathedra University of Granada-Ziacom and the scientific contributions funded by Research Groups #CTS-138, #CTS-1028, and #B-CTS-504-UGR18 (Universidad de Granada – Junta de Andalucía, Spain). JA. G-V was supported by a FPU predoctoral contract from the Spanish Ministry of Science, Innovation and Universities grant number FPU24/00315.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eAuthors' contributions\\u003c/u\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eABCG: Conception and design of the work, acquisition, analysis and interpretation of data, manuscript writing and final approval of manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003eJAGV: Acquisition, analysis and interpretation of data, manuscript writing and final approval of manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003eMPM: Conception and design of the work, analysis and interpretation of data, financial support and final approval of manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003eDAG: Acquisition and analysis of data and final approval of manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003eAO: Acquisition and analysis of data and final approval of manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003eNMM: Acquisition and analysis of data and final approval of manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003eFO: Analysis and interpretation of data and final approval of manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003ePGM: Conception and design of the work, financial support, interpretation of data, manuscript writing and final approval of manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003eFZ: Conception and design of the work, financial support, interpretation of data, manuscript writing and final approval of manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cu\\u003eAcknowledgements\\u003c/u\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eYacine A, Zain Ali M, Alharbi AB, Qubayl Alanaz H, Saud Alrahili A, Alkhdairi AA. Chronic Inflammation: A Multidisciplinary Analysis of Shared Pathways in Autoimmune, Infectious, and Degenerative Diseases. Cureus. 2025; Apr 19;17(4):e82579.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKinane DF, Stathopoulou PG, Papapanou PN. Periodontal diseases. Nat Rev Dis Prim [Internet]. 2017;3(1):17038.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBerglundh T, Armitage G, Araujo MG, Avila-Ortiz G, Blanco J, Camargo PM, et al. Peri-implant diseases and conditions: Consensus report of workgroup 4 of the 2017 World Workshop on the Classification of Periodontal and Peri-Implant Diseases and Conditions. J Clin Periodontol. 2018;45(Suppl 20):S286\\u0026ndash;91.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDerks J, Schaller D, H\\u0026aring;kansson J, Wennstr\\u0026ouml;m JL, Tomasi C, Berglundh T. Peri-implantitis - onset and pattern of progression. J Clin Periodontol. 2016;43(4):383\\u0026ndash;8.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAlbrektsson T, Albrektsson T. Are Oral Implants the Same As Teeth? J Clin Med 2019, 8. 2019;8(9).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCarcuac O, Berglundh T. Composition of human peri-implantitis and periodontitis lesions. J Dent Res. 2014;93(11):1083\\u0026ndash;8.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003edel Su\\u0026aacute;rez-L\\u0026oacute;pez F, Rudek I, Wagner V, Martins M, O\\u0026rsquo;Valle F, Galindo-Moreno P, et al. Titanium Activates the DNA Damage Response Pathway in Oral Epithelial Cells: A Pilot Study. Int J Oral Maxillofac Implants. 2017;32(6):1413\\u0026ndash;20.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBressan E, Ferroni L, Gardin C, Bellin G, Sbricoli L, Sivolella S et al. Metal Nanoparticles Released from Dental Implant Surfaces: Potential Contribution to Chronic Inflammation and Peri-Implant Bone Loss. Mater (Basel Switzerland). 2019;12(12).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFurlanetto M, Castro R, Silva F, Pereira J, Macedo J, Soares S. Titanium Particle Impact on Immune Cells, Cytokines, and Inflammasomes: Helping to Profile Peri-Implantitis\\u0026mdash;A. Syst Rev Oral 2025. 2025;5(4):80.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMarchesan JT, Girnary MS, Moss K, Monaghan ET, Egnatz GJ, Jiao Y, et al. Role of inflammasomes in the pathogenesis of periodontal disease and therapeutics. Periodontol 2000. 2020;82(1):93\\u0026ndash;114.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYao J, Sterling K, Wang Z, Zhang Y, Song W. The role of inflammasomes in human diseases and their potential as therapeutic targets. Signal Transduct Target Ther 2023 91. 2024;9(1):10-.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSwanson KV, Deng M, Ting JPY. The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nat Rev Immunol. 2019;19(8):477\\u0026ndash;89.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFernandes-Alnemri T, Yu JW, Datta P, Wu J, Alnemri ES. AIM2 activates the inflammasome and cell death in response to cytoplasmic DNA. Nat 2009 4587237. 2009;458(7237):509\\u0026ndash;13.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCarrillo-G\\u0026aacute;lvez AB, Guerra-Valverde JA, Padial-Molina M, Mart\\u0026iacute;nez-Cuevas A, Abril-Garc\\u0026iacute;a D, Olaechea A et al. Cross-talk between NLRP3 and AIM2 inflammasomes in macrophage activation by LPS and titanium ions. Mol Med. 2025;31(1).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKaufmann B, Leszczynska A, Reca A, Booshehri LM, Onyuru J, Tan Z, et al. NLRP3 activation in neutrophils induces lethal autoinflammation, liver inflammation, and fibrosis. EMBO Rep. 2022;23(11):EMBR202154446.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRobinson KS, Boucher D. Inflammasomes in epithelial innate immunity: front line warriors. FEBS Lett. 2024;598(11):1335\\u0026ndash;53.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang L, Chen K, Wan X, Wang F, Guo Z, Mo Z. NLRP3 inflammasome activation in mesenchymal stem cells inhibits osteogenic differentiation and enhances adipogenic differentiation. Biochem Biophys Res Commun. 2017;484(4):871\\u0026ndash;7.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGarc\\u0026iacute;a-G\\u0026oacute;amez I, Elvira G, Zapata AG, Lamana ML, Ram\\u0026iacute;arez M, Garc\\u0026iacute;a Castro J, et al. Mesenchymal stem cells: biological properties and clinical applications. Expert Opin Biol Ther. 2010;10(10):1453\\u0026ndash;68.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDos Santos NCC, Cotrim KC, Ach\\u0026ocirc;a GL, Kalil EC, Kantarci A, Bueno DF. The Use of Mesenchymal Stromal/Stem Cells (MSC) for Periodontal and Peri-implant Regeneration: Scoping Review. Braz Dent J. 2024;35.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAmato M, Santonocito S, Viglianisi G, Tatullo M, Isola G. Impact of Oral Mesenchymal Stem Cells Applications as a Promising Therapeutic Target in the Therapy of Periodontal Disease. Int J Mol Sci 2022, 23. 2022;23(21).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCarrillo-G\\u0026aacute;lvez AB, Zurita F, Guerra-Valverde JA, Aguilar-Gonz\\u0026aacute;lez A, Abril-Garc\\u0026iacute;a D, Padial-Molina M, et al. NLRP3 and AIM2 inflammasomes expression is modified by LPS and titanium ions increasing the release of active IL-1β in alveolar bone-derived MSCs. Stem Cells Transl Med. 2024;13(8):826\\u0026ndash;41.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePadial-Molina M, De Buitrago JG, Sainz-Urruela R, Abril-Garcia D, Anderson P, O\\u0026rsquo;Valle F et al. Expression of Musashi-1 During Osteogenic Differentiation of Oral MSC: An In Vitro Study. Int J Mol Sci. 2019;20(9).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCarrillo-G\\u0026aacute;lvez AB, G\\u0026aacute;lvez-Peisl S, Gonz\\u0026aacute;lez-Correa JE, de Haro-Carrillo M, Ayll\\u0026oacute;n V, Carmona-S\\u0026aacute;ez P, et al. GARP is a key molecule for mesenchymal stromal cell responses to TGF-β and fundamental to control mitochondrial ROS levels. Stem Cells Transl Med. 2020;9(5):636\\u0026ndash;50.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLuz-Crawford P, Jorgensen C, Djouad F. Mesenchymal Stem Cells Direct the Immunological Fate of Macrophages. Results Probl Cell Differ. 2017;62:61\\u0026ndash;72.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLuque-Campos N, Bustamante-Barrientos FA, Pradenas C, Garc\\u0026iacute;a C, Araya MJ, Bohaud C, et al. The Macrophage Response Is Driven by Mesenchymal Stem Cell-Mediated Metabolic Reprogramming. Front Immunol. 2021;12:624746.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDenu RA, Hematti P. Effects of Oxidative Stress on Mesenchymal Stem Cell Biology. Oxid Med Cell Longev. 2016;2016:2989076.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMancini OK, Lora M, Cuillerier A, Shum-Tim D, Hamdy R, Burelle Y, et al. Mitochondrial oxidative stress reduces the immunopotency of mesenchymal stromal cells in adults with coronary artery disease. Circ Res. 2018;122(2):255\\u0026ndash;66.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRyu D, Bin, Lim JY, Lee SE, Park G, Min CK. Induction of Indoleamine 2,3-dioxygenase by Pre-treatment with Poly(I:C) May Enhance the Efficacy of MSC Treatment in DSS-induced Colitis. Immune Netw. 2016;16(6):358.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSeo Y, Kang MJ, Kim HS. Strategies to Potentiate Paracrine Therapeutic Efficacy of Mesenchymal Stem Cells in Inflammatory Diseases. Int J Mol Sci. 2021;22(7):3397.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSanz M, Herrera D, Kebschull M, Chapple I, Jepsen S, Beglundh T, et al. Treatment of stage I-III periodontitis-The EFP S3 level clinical practice guideline. J Clin Periodontol. 2020;47(Suppl 22):4\\u0026ndash;60.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi C, Zhang W, Jiang X, Mao N. Human-placenta-derived mesenchymal stem cells inhibit proliferation and function of allogeneic immune cells. Cell Tissue Res. 2007;330(3):437\\u0026ndash;46.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSun L, Liang J, Li H, Hou Y. Polarization of T Lymphocytes Is Regulated by Mesenchymal Stem Cells in NZBWF1 and BALB/c Mice. Int J Mol Sci. 2007;8:455\\u0026ndash;69.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLourdes Mora-Garc\\u0026iacute;a M, Garc\\u0026iacute;a-Rocha R, Morales-Ram\\u0026iacute;rez O, Montesinos JJ, Weiss-Steider B, Hern\\u0026aacute;ndez-Montes J et al. Mesenchymal stromal cells derived from cervical cancer produce high amounts of adenosine to suppress cytotoxic T lymphocyte functions. J Transl Med. 2016;14(1).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXu G, Zhang L, Ren G, Yuan Z, Zhang Y, Zhao RC, et al. Immunosuppressive properties of cloned bone marrow mesenchymal stem cells. Cell Res. 2007;17(3):240\\u0026ndash;8.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZheng T, Li S, Zhang T, Fu W, Liu S, He Y et al. Exosome-shuttled miR-150\\u0026ndash;5p from LPS-preconditioned mesenchymal stem cells down-regulate PI3K/Akt/mTOR pathway via Irs1 to enhance M2 macrophage polarization and confer protection against sepsis. Front Immunol. 2024;15.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAreny-Balaguer\\u0026oacute; A, Camprub\\u0026iacute;-Rimblas M, Campa\\u0026ntilde;a-Duel E, Sol\\u0026eacute;-Porta A, Ceccato A, Roig A et al. Priming Mesenchymal Stem Cells with Lipopolysaccharide Boosts the Immunomodulatory and Regenerative Activity of Secreted Extracellular Vesicles. Pharmaceutics. 2024;16(10).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSu Y, Xu C, Cheng W, Zhao Y, Sui L, Zhao Y. Pretreated Mesenchymal Stem Cells and Their Secretome: Enhanced Immunotherapeutic Strategies. Int J Mol Sci. 2023;24(2).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiotta F, Angeli R, Cosmi L, Fil\\u0026igrave; L, Manuelli C, Frosali F, et al. Toll-like receptors 3 and 4 are expressed by human bone marrow-derived mesenchymal stem cells and can inhibit their T-cell modulatory activity by impairing Notch signaling. Stem Cells. 2008;26(1):279\\u0026ndash;89.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMellado S, Morillo-Bargues MJ, Perpi\\u0026ntilde;\\u0026aacute;-Cl\\u0026eacute;rigues C, Garc\\u0026iacute;a-Garc\\u0026iacute;a F, Moreno-Manzano V, Guerri C, et al. The emerging role of mesenchymal stem cell-derived extracellular vesicles to ameliorate hippocampal NLRP3 inflammation induced by binge-like ethanol treatment in adolescence. Neural Regen Res. 2025;20(4):1153\\u0026ndash;63.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKharazinejad E, Hassanzadeh G, Sahebkar A, Yousefi B, Reza Sameni H, Majidpoor J, et al. The Comparative Effects of Schwann Cells and Wharton\\u0026rsquo;s Jelly Mesenchymal Stem Cells on the AIM2 Inflammasome Activity in an Experimental Model of Spinal Cord Injury. Neuroscience. 2023;535:1\\u0026ndash;12.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen Y, Yang L, Li X. Advances in Mesenchymal stem cells regulating macrophage polarization and treatment of sepsis-induced liver injury. Front Immunol. 2023;14.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNie Z, Fan Q, Jiang W, Wei S, Luo R, Hu H et al. Placental mesenchymal stem cells suppress inflammation and promote M2-like macrophage polarization through the IL-10/STAT3/NLRP3 axis in acute lung injury. Front Immunol. 2024;15.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYan L, Zheng D, Xu RH. Critical Role of Tumor Necrosis Factor Signaling in Mesenchymal Stem Cell-Based Therapy for Autoimmune and Inflammatory Diseases. Front Immunol. 2018;9(JUL):1658.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSaraiva M, O\\u0026rsquo;Garra A. The regulation of IL-10 production by immune cells. Nat Rev Immunol. 2010;10(3):170\\u0026ndash;81.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSchildberger A, Rossmanith E, Eichhorn T, Strassl K, Weber V. Monocytes, peripheral blood mononuclear cells, and THP-1 cells exhibit different cytokine expression patterns following stimulation with lipopolysaccharide. Mediators Inflamm. 2013;2013.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHoppenbrouwers T, Bastiaan-Net S, Garssen J, Pellegrini N, Willemsen LEM, Wichers HJ. Functional differences between primary monocyte-derived and THP-1 macrophages and their response to LCPUFAs. PharmaNutrition. 2022;22(OCT):100322.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChomarat P, Rissoan MC, Banchereau J, Miossec P. Interferon gamma inhibits interleukin 10 production by monocytes. J Exp Med. 1993;177(2):523\\u0026ndash;7.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDenu RA, Hematti P. Effects of Oxidative Stress on Mesenchymal Stem Cell Biology. Oxid Med Cell Longev. 2016;2016:2989076.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu YY, Chiang CH, Hung SC, Chian CF, Tsai CL, Chen WC, et al. Hypoxia-preconditioned mesenchymal stem cells ameliorate ischemia/reperfusion-induced lung injury. PLoS ONE. 2017;12(11):e0187637.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHui Y, Jiao X, Yang L, Lu D, Han Y, Yang W, et al. Indoleamine-2,3-dioxygenase: An important controller in maintaining mesenchymal stem cell-mediated immunomodulatory homeostasis. Acta Pharm Sin B. 2025;15(7):3404\\u0026ndash;18.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMunn DH, Zhou M, Attwood JT, Bondarev I, Conway SJ, Marshall B, et al. Prevention of allogeneic fetal rejection by tryptophan catabolism. Science. 1998;281(5380):1191\\u0026ndash;3.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eN\\u0026eacute;meth K, Leelahavanichkul A, Yuen PST, Mayer B, Parmelee A, Doi K, et al. Bone marrow stromal cells attenuate sepsis via prostaglandin E(2)-dependent reprogramming of host macrophages to increase their interleukin-10 production. Nat Med. 2009;15(1):42\\u0026ndash;9.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKulesza A, Paczek L, Burdzinska A. The Role of COX-2 and PGE2 in the Regulation of Immunomodulation and Other Functions of Mesenchymal Stromal Cells. Biomedicines. 2023;11(2):445.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMacKenzie KF, Clark K, Naqvi S, McGuire VA, N\\u0026ouml;ehren G, Kristariyanto Y, et al. PGE2 Induces Macrophage IL-10 Production and a Regulatory-like Phenotype via a Protein Kinase A\\u0026ndash;SIK\\u0026ndash;CRTC3 Pathway. J Immunol Author Choice. 2013;190(2):565.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLatchman YE, Liang SC, Wu Y, Chernova T, Sobel RA, Klemm M, et al. PD-L1-deficient mice show that PD-L1 on T cells, antigen-presenting cells, and host tissues negatively regulates T cells. Proc Natl Acad Sci U S A. 2004;101(29):10691\\u0026ndash;6.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWei F, Zhong S, Ma Z, Kong H, Medvec A, Ahmed R, et al. Strength of PD-1 signaling differentially affects T-cell effector functions. Proc Natl Acad Sci U S A. 2013;110(27):E2480\\u0026ndash;9.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":false,\"email\":\"info@researchsquare.com\",\"identity\":\"cellular-and-molecular-biology-letters\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"cmbl\",\"sideBox\":\"Learn more about [Cellular \\u0026 Molecular Biology Letters](http://cmbl.biomedcentral.com)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/CMBL/default.aspx\",\"title\":\"Cellular \\u0026 Molecular Biology Letters\",\"twitterHandle\":\"@OACellBiology\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Inflammation, hABSCs, periodontitis, peri-implantitis, inflammasome, NLRP3, AIM2, titanium, immunomodulation\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-9293324/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-9293324/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cstrong\\u003eBackground\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eChronic inflammatory oral diseases such as periodontitis and peri-implantitis are characterized by persistent bacterial challenge and biomaterial-associated stress, leading to sustained immune dysregulation and progressive tissue destruction. Mesenchymal stromal cells represent a promising therapeutic approach due to their immunomodulatory properties. However, the inflammatory microenvironment, including exposure to bacterial components and titanium particles, impairs their regulatory function. Activation of inflammasome pathways, particularly NLRP3 and AIM2, may contribute to this dysfunction. This study aimed to determine whether CRISPR/Cas9-mediated knockout of NLRP3 or AIM2 enhances the immunomodulatory resilience of alveolar bone-derived mesenchymal stromal cells under inflammatory stress.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMethods\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eHuman alveolar bone-derived mesenchymal stem cells (hABSCs) were edited using CRISPR/Cas9 technology to generate NLRP3 or AIM2-deficient cells. Edited and non-edited cells were exposed to LPS or combined LPS and titanium stimuli and subsequently evaluated for their immunomodulatory capacity. Specifically, T cell proliferation, macrophage polarization and inflammatory cytokine profiling was analyzed.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eResults\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eInflammatory stimulation reduced the immunosuppressive capacity of wild-type hABSCs. Under LPS exposure, NLRP3-deficient cells maintained a stronger suppression of T cell proliferation and more effectively limited pro-inflammatory M1 macrophage polarization compared with unedited cells, while AIM2-deficient cells showed a moderate but consistent improvement. Under combined LPS and titanium stress, NLRP3-deficient cells preserved high immunomodulatory function, whereas unedited cells exhibited marked functional impairment.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConclusions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTargeted disruption of inflammasome components enhances the functional stability of hABSCs in inflammatory environments. In particular, NLRP3 deficiency confers superior resilience while AIM2 deficiency also provides functional improvement. Inflammasome-directed genome editing may represent a promising strategy to optimize mesenchymal stromal cell-based therapies for chronic inflammatory oral diseases.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Inflammasome Modulation Enhances the Immunoregulatory Function of Mesenchymal Stromal Cells under Bacterial and Titanium-induced Inflammation\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-04-28 12:20:35\",\"doi\":\"10.21203/rs.3.rs-9293324/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-05-12T06:36:48+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-05-10T17:01:27+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"252144152872246115912356976271208959891\",\"date\":\"2026-05-08T12:10:00+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"172234726238997617764820554441047752345\",\"date\":\"2026-05-07T10:57:17+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"75084652593237150120049355979361479737\",\"date\":\"2026-04-22T17:35:49+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2026-04-20T09:58:09+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2026-04-12T18:16:53+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2026-04-10T12:19:37+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Cellular \\u0026 Molecular Biology Letters\",\"date\":\"2026-04-01T14:32:04+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":false,\"email\":\"info@researchsquare.com\",\"identity\":\"cellular-and-molecular-biology-letters\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"cmbl\",\"sideBox\":\"Learn more about [Cellular \\u0026 Molecular Biology Letters](http://cmbl.biomedcentral.com)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/CMBL/default.aspx\",\"title\":\"Cellular \\u0026 Molecular Biology Letters\",\"twitterHandle\":\"@OACellBiology\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"5adfc9e6-e4f6-4aca-9fb1-476e5a9aa7fd\",\"owner\":[],\"postedDate\":\"April 28th, 2026\",\"published\":true,\"recentEditorialEvents\":[{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-05-12T06:36:48+00:00\",\"index\":44,\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-05-10T17:01:27+00:00\",\"index\":42,\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"252144152872246115912356976271208959891\",\"date\":\"2026-05-08T12:10:00+00:00\",\"index\":40,\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"172234726238997617764820554441047752345\",\"date\":\"2026-05-07T10:57:17+00:00\",\"index\":37,\"fulltext\":\"\"}],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"under-review\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2026-04-28T12:20:35+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-04-28 12:20:35\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-9293324\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-9293324\",\"identity\":\"rs-9293324\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}