{"paper_id":"10afccca-3930-40fc-a059-405b6f66e7cb","body_text":"Positive effects of gamma aminobutyric acid on growth and lipopolysaccharide induced intestinal mucosal barrier damage in snakehead (Channa argus) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Positive effects of gamma aminobutyric acid on growth and lipopolysaccharide induced intestinal mucosal barrier damage in snakehead (Channa argus) Xue-qin Wu, Xu-nan Li, Feng-kun Cai, Yun-jie Lin, Xiao-tian Niu, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6777536/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 10 You are reading this latest preprint version Abstract Lipopolysaccharides (LPS) impairs intestinal barrier function by disrupting intestinal permeability. Reasonably supplementing gamma aminobutyric (GABA) or regulating its levels has a positive effect on promoting fish growth and improving intestinal health. Therefore, it is valuable to investigate the effects of GABA on snakehead growth and LPS-induced intestinal mucosal barrier damage. In this study, a model for intestinal mucosal barrier damage was created by administering 1.0 mg/mL LPS injection into anus over a period of 96 h in snakehead. Prior to LPS challenge, fish [(5.19 ± 0.12) g] were fed with different levels of GABA (0, 30, 60, 90 and 120 mg/kg) for 56 d. Results showed that LPS induced obvious intestinal damage, while GABA effectively alleviated this phenomenon. In addition, intestinal permeability-related parameters (DAO and LPS) were dramatically increased in LPS group, while these parameters dramatically decreased in remission groups. Correspondingly, LPS altered species composition, α-diversity and β-diversity in biological barrier; digestive enzymes (AMY, LIP and TRY) and gastrointestinal hormones (CCK and GHRL) in chemical barrier; tight junction structures and tight junction-related genes ( claudin-1 , claudin-5 , occludin and zo-1 ) in physical barrier and inflammatory factors (IL-1β and TNF-α) and immune-related genes ( igm , igt , mhc-Ⅰ and pigr ) in immune barrier. Nevertheless, the addition of GABA to feed effectively improved LPS-induced intestinal mucosal barrier damage. Therefore, GABA positively impacted growth and LPS-induced intestinal damage in snakehead, which provided a favorable foundation for the nutritional regulation of their intestinal mucosal barrier. Gamma aminobutyric acid Growth Intestinal mucosal barrier Northern snakehead lipopolysaccharide Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Introduction Intestine, as a special functional organ, is crucial in nutrient absorption, immune defense and the elimination of harmful substances (Flint et al. 2012 ). Its health is directly related to animal's growth performance and disease resistance (Tian et al. 2020 , Dong et al. 2024 , Wu et al. 2024b ). However, the functions of intestine mainly rely on its complex structure and multi-layered barrier mechanisms. On one hand, intestine supports body's growth by absorbing nutrients. Complex macromolecules in food are broken down into absorbable small molecules, which enter body through transport proteins and diffusion mechanisms on epithelial cells (Kiela & Ghishan 2016 ). Additionally, the villi and microvilli of intestine significantly increase absorptive surface area, thereby enhancing nutrient absorption efficiency (Munoz et al. 2023 , Galafat et al. 2024 ). On the other hand, intestine acts as a crucial barrier against external pathogen invasion (Yu & Li 2014 ). Specifically, the physical barrier of intestine is formed by tight junctions between intestinal epithelial cells. In addition, chemical and biological barriers, such as mucus layer and beneficial microbiota, further inhibit the growth and colonization of pathogens. Lymphoid tissues and immune components in intestine actively recognize and neutralize potential threats, collectively maintaining body's health and homeostasis (Wu et al. 2024a ). Nevertheless, intestine still faces threats from various factors, especially intestinal diseases caused by bacterial infections (Wang et al. 2022 , Yang et al. 2023 , Xia et al. 2024a ). Bacterial infections often lead to the disruption of intestinal mucosal barrier, subsequently causing a series of physiological disorders and disease manifestations. Lipopolysaccharide (LPS) is a typical representative of bacterial pathogens, capable of immunostimulating intestinal mucosa and inducing inflammatory responses, ultimately damaging intestinal health (Duan et al. 2018 , Li et al. 2023 ). Gamma-aminobutyric acid (GABA) is a significant non-protein amino acid functioning primarily as an inhibitory neurotransmitter in central nervous system (Łątka et al. 2020 ). It has various biological functions, including promoting appetite (Chan et al. 2013 ), improving intestinal function (Chen et al. 2022 ), enhancing immune function and increasing antioxidant capacity (Cheng et al. 2016 ). In aquatic animals, GABA promotes growth and improves feed utilization by regulating feeding-related genes expression (Xie et al. 2017 , Farris et al. 2022 , Zhang et al. 2022a , Ma et al. 2024 ). Moreover, GABA can mediate somatostatin in gastrointestinal tract, promoting the release of immunoglobulin and gastrin, thereby enhancing body's immunity (Li et al. 2020 , Chen et al. 2021 , Yan et al. 2024 ). Overall, GABA is a potential nutrient that helps maintain and improve intestinal health. Northern snakehead is an important freshwater aquaculture fish with a long history and significant economic value in Asia (Du et al. 2022 , Ma et al. 2023 ). Nonetheless, due to the expansion of intensive aquaculture, the risk of disease in northern snakehead has an obvious increase (Zhou et al. 2023 ). Particularly during juvenile stage, intestinal infections become a major cause of high mortality rates and stunted growth. Optimizing the intestinal health of northern snakehead is critical for improving aquaculture efficiency and ensuring the sustainable growth of aquaculture industry. Based on this, this study aims to investigate the role of GABA in promoting growth and alleviating LPS-induced intestinal mucosal barrier damage, which supplying a theoretical and practical basis for the scientific application of GABA and the scientific aquaculture of northern snakehead. Materials and methods Feed preparation GABA (purity≥99%) was brought from Zaozhuang Jienuo Enzyme Co., Ltd, Shandong, China. The inclusion level of GABA (0, 30, 60, 90, 120 mg/kg) in feed was determined based on previous research. The preparation of feed was shown in Table 1. Fish meal and corn protein powder were the main sources of protein. Corn oil was the main source of fat. Feed preparation process was as follows: raw materials were ground and sieved (60-mesh) sieve, followed by weighing and uniform mixing. The above mixture was added an appropriate amount of water. A pellet machine (FW135, Tianjin Taisite Instrument Co., Ltd., China) was used to form feed pellets (1.50 mm). Feed pellets were dried in an oven (60°C) (101, Hebei Shuangxin Testing Instrument Manufacturing Co., Ltd., China), and then stored in sealed, cool and dry conditions. This resulted in five types of feeds, including 0 mg/kg GABA group, 30 mg/kg GABA group, 60 mg/kg GABA group, 90 mg/kg GABA group and 120 mg/kg GABA group. Experimental animals and design Northern snakehead [(5.19±0.12) g] were purchased from a farm in Linyi, Shandong, China. Fish were temporarily reared for 15 days in circulating water system at the aquaculture room of Jilin Agricultural University. Water quality parameters were as detailed below: water temperature: 23-25°C, dissolved oxygen: 6.0 mg/L, ammonia nitrogen: <0.2 mg/L, pH: 7.1±0.1.In formal trial, 450 healthy and similarly sized fish were randomly allocated into five groups (each group has three repetitions, each repetition has 30 fish) and distributed to 15 pre-disinfected tanks. Five groups of fish were fed aforementioned five types of feeds with different levels of GABA. Fish were fed twice daily (8:20 and 17:20). Half of water was replaced every day. Water quality conditions were consistent with those during temporary rearing. During growth trial, the feeding amounts of fish were recorded. After eight weeks, fish were weighed and measured to calculate growth parameters. After the completion of growth trial, 15 fish were randomly selected from each replicate (45 fish per group), and then injected with 1.0 mg/mL LPS [ Escherichia coli 055: B5, Sigma-Aldrich (Shanghai) Trading Co.,Ltd, China] at anus. Specifically, 0 mg/kg GABA group was split: one half was injected with phosphate buffer saline (PBS) (PB180327, Wuhan Pricella Biotechnology Co., Ltd., China) and the other half with LPS. Thus, six groups were generated: CTL group (PBS), MOD group (1.0 mg/mL LPS), R1 group (1.0 mg/mL LPS+30 mg/kg GABA), R2 group (1.0 mg/mL LPS+60 mg/kg GABA), R3 group (1.0 mg/mL LPS+90 mg/kg GABA) and R4 group (1.0 mg/mL LPS+120 mg/kg GABA). During challenge trial, fish were kept in a fasted state. After 48 hours, fish were anesthetized for caudal vein blood collection. Blood was centrifuged at 3000 rpm/min for 10 minutes using a centrifuge (Allegra X-30, Beckman Coulter, Inc, US), and supernatant was stored in a -80°C freezer (DW-86L, Haier Smart Home Co., Ltd, China). Intestinal tissues dissected at room temperature were fixed in 4% paraformaldehyde fix solution (G1101-500ML, Wuhan Servicebio Technology Co., Ltd, China) and electron microscopy fixative (G1102-100ML, Wuhan Servicebio Technology Co., Ltd, China), and stored in a refrigerator in a 4°C freezer (BCD-216SDN, Haier Smart Home Co., Ltd, China). Intestinal tissues dissected on ice were rapidly frozen using liquid nitrogen, and kept in a -80°C freezer. Growth parameters Formulas were showed as follows: Weight gain rate (WGR) = [(W F - W I )/ W I ] × 100%. Specific growth rate (SGR) = [In W F - In W I /t] × 100%. Feed efficiency rate (FER) = [(W F - W I )/ I] × 100%. Protein efficiency ratio (PER) = [(W F - W I )/ (I×C)] W F : final body weight; W I :initial body weight; t: days of rearing; I: feed intake; C: protein intake. Microscope imaging Intestinal tissue observation Intestinal tissues were extracted from 4% paraformaldehyde fixative solution, and then subjected to dehydration, clearing and paraffin embedding sequentially. Subsequently, paraffin blocks were sectioned into 5 μm thick slices with a microtome [RM2016, Leica Microsystems (Shanghai) Tradingco.，Ltd, China], and slices were mounted on slides. Sections underwent dewaxing and hydration, followed by hematoxylin and eosinstaining, dehydration and sealing sequentially. The images of intestinal tissue sections were obtained using an optical microscope [Nikon DS-U3, Nikon Corporation, China]. Tight junction structure observation Intestinal tissues were removed from electron microscopy fixative, then fixed in osmium tetroxide solution. Subsequent steps were performed sequentially: gradient ethanol dehydration, epoxy resin embedding, ultrathin sectioning (70 nm) and uranyl acetate and lead citrate staining. The images of tight junction structures were obtained using a transmission electron microscope (Hitachi HT7800, Hitachi, Japan) 16S rRNA sequencing Intestinal tissues were ground with lysis buffer at 60 Hz for sample preprocessing. DNA was isolated using OMEGA Soil DNA Kit (D5635-02, Omega Bio-Tek, Inc, USA). Amplification was performed using PCR with bacterial 16S rRNA V3-V4 region-specific primers. Primer sequence was 338F (5-barcOde+ACTCCTACGGGAGGCAGCA-3’, 806R (5'-GGACTACHVGGGTWTCTAAT-3'). Target fragment was purified using UltraPure™ Agarose (75510-019, American Invitrogen Life Technologies Co., Ltd., USA). PCR products were measured using Quant-iT PicoGreen dsDNA Assay Kit (P7589, American Invitrogen Life Technologies Co., Ltd., USA). Sequencing work was conducted by Shanghai Personalbio Technology Co.,Ltd on Illumina MiSeq platform. Microbial diversity data analysis was conducted using GenesCloud (https://www.genescloud.cn). Test kits determination Intestinal tissues with normal saline were homogenized at A weight-to-volume ratio of 1 g per 9 mL. Homogenate was centrifuged at 4000 rpm/min for 10 minutes, and then supernatant was gathered for analysis. α-amylase (AMY) (C016-1-2), lipase (LIP) (A054-2-1) and trypsin (TRY) (A080-2-2) activities in intestine were assessed using kits from Nanjing Jiancheng Bioengineering Institute, China. The contents of cholecystokinin (CCK) (ml063878) and ghrelin (GHRL) (YJ821016) in serum and intestine were determined using kits from Shanghai Enzyme-linked Biotechnology Co., Ltd, China. The contents of interleukin-1β (IL-1β) (YX-091203F), tumor necrosis factor-α (TNF-α) (YX-201407F), diamine oxidase (DAO) (YX-040115F) and LPS (YX-121619F) in serum and intestine were determined using kits from Shanghai Youxuan Biotechnology Co., Ltd, China. Genes expression determination Intestinal tissues were crushed in liquid nitrogen to prepare samples. RNA was taken out from samples according to SparkZol Reagent (AC0101, Shandong Sparkjade Biotechnology Co., Ltd., China). RNA samples were reverse transcribed into cDNA samples using SPARKscript Ⅱ All-in-one RT SuperMix for qPCR (With gDNA Eraser) (AG0305, Shandong Sparkjade Biotechnology Co., Ltd., China). qPCR was performed using 2×SYBR Green qPCR Mix (With ROX) (AH0104, Shandong Sparkjade Biotechnology Co., Ltd., China). Gene expression was quantified using 2 -ΔΔCT method (Livak & Schmittgen 2001). Gene primer information was shown in Table 2. Data statistics and analysis Data was statistically assessed using SPSS 23.0. If data followed a normal distribution and variances were homogeneous, one-way ANOVA and Duncan's multiple range tests were executed. Significance test P-value was set at 0.05. Results were presented as mean ± standard error. Results Growth performance With the increase of GABA levels in feed, the FBW, WGR, SGR, FER and PER of fish showed a gradually increasing trend. Relative to control group, all groups with added GABA showed a significant increase in the FBW, WGR and SGR of fish ( P< 0.05). The inclusion of 120 mg/kg GABA in feed resulted a significant increase in fish's FER and PER ( P< 0.05) (Table 3). Through establishing a quadratic regression model between GABA levels and WGR, it was found that optimum GABA requirement in feed is approximately 107.77 mg/kg (Fig. 1). Intestinal histopathology Compared to CTL group, intestinal villi in MOD group were shortened and thickened with significant rupture, the main manifestations were extensive damage to the striated border and infiltration of inflammatory cells in lamina propria. Compared with MOD group, all remission groups showed improvement in intestinal damage, particularly in R3 and R4 groups (Fig. 2). Intestinal permeability In comparison to CTL group, MOD group had significantly higher contents of DAO and LPS in intestine and serum ( P< 0.05). Compared with MOD group, the intestinal contents of DAO were markedly reduced in R2, R3 and R4 groups ( P< 0.05). In all remission groups, DAO contents in serum and LPS contents in intestinal and serum were significantly decreased ( P< 0.05) (Fig. 3). Biological barrier Species composition The results of species differences were shown in Fig. 4. The numbers of unique OTUs in CTL group, MOD group, R1 group, R2 group, R3 group and R4 group were 95, 489, 69, 72, 50 and 63, respectively. The number of shared OTUs among these six groups was six. The results of species composition were shown in Fig. 5. At phylum level, Proteobacteria , Actinobacteria and Firmicutes ranked as the top three. Specifically, compared to CTL group, MOD group showed a significant decrease in the proportion of Proteobacteria and Firmicutes , while the proportion of Actinobacteria significantly increases. Relative to MOD group, as GABA levels increase, the proportion of Proteobacteria and Firmicutes gradually rose, while the proportion of Actinobacteria gradually decreased [Fig. 5 (A)]. At genus level, Pseudomonas , Aurantimicrobium and Staphylococcus ranked as the top three. Similarly, trends in Pseudomonas align with those of its corresponding phylum [Fig. 5 (B)]. Alpha diversity MOD group showed a decreasing trend in Chao1, Shannon, and Simpson indices. Relative to MOD group, these indices exhibited a gradually increasing trend. The differences in Chao1, Shannon and Simpson indices among groups were not significant ( P> 0.05). (Fig. 6). Beta diversity In PCoA and NMDS analysis, MOD group showed a distinct separation from the other groups, while CTL group overlapped with R1 and R2 groups, respectively. There were varying degrees of overlap among all remission groups (Fig. 7). Chemical barrier Digestive enzymes results were shown in Fig. 8. The activities of AMY, LIP and TRY in intestine were significantly lower than those in CTL group ( P< 0.05). Compared to MOD group, AMY and TRY activities in intestine were markedly increased in R2, R3 and R4 groups ( P< 0.05). There was a significant increase in LIP activity in all remission groups ( P< 0.05). Observations gastrointestinal hormone were shown in Fig. 9. Relative to CTL group, the contents of CCK in intestine and serum were dramatically increased in MOD group ( P< 0.05), while GHRL contents were dramatically decreased ( P< 0.05). Compared to MOD group, intestinal CCK contents were markedly reduced in all remission groups ( P< 0.05). However, the contents of CCK in serum and GHRL in intestine and serum did not show significant changes ( P> 0.05). Physical barrier The results of tight junction structure were illustrated in Fig. 10. Compared to CTL group, intestinal tight junction structure in MOD group displayed noticeable fracture, and intercellular gap width was obvious increased. Compared to MOD group, all remission groups exhibited marked improvement in tight junction structures, and R3 and R4 groups showed apparent decreases in intercellular gap width. The results for genes related to tight junctions were presented in Fig. 11. The expression levels of claudin-1 , claudin-5, occludin and zo-1 in intestine of MOD group were significantly lower than those in CTL group ( P< 0.05). Compared to MOD group, the intestinal expression levels of claudin-1 were significantly increased in R2, R3 and R4 groups ( P< 0.05). The expression levels of claudin-5 in intestine were markedly higher in all remission groups ( P< 0.05). In R3 and R4 groups, the expression levels of occludin in intestine were significantly risen ( P< 0.05). Nonetheless, there were no significant changes in zo-1 expression ( P> 0.05). Immunological barrier The results of inflammatory factors could be seen in Fig. 12. Compared to CTL group, the contents of IL-1β and TNF-α in intestine and serum were dramatically increased in MOD group ( P< 0.05). Compared to MOD group, IL-1β content in intestine and TNF-α content in serum were significantly decreased in all remission groups ( P< 0.05). Serum IL-1β contents were markedly reduced in R2, R3 and R4 groups ( P< 0.05). Intestinal TNF-α contents were dramatically decreased in R3 and R4 groups ( P< 0.05). The results of immunity-related genes were showed in Fig. 13. In comparison to CTL group, the expression levels of igm , igt , mhc-1 , and pigr in intestine were dramatically increased in MOD group ( P< 0.05). Compared to MOD group, igm expression level in intestine was dramatically decreased in R4 group ( P< 0.05). The expression levels of igt in intestine was dramatically decreased in R3 and R4 groups ( P< 0.05). Additionally, the intestinal expression levels of mhc-1 and pigr were dramatically reduced in R2, R3 and R4 groups ( P< 0.05). Discussion In the process of promoting animal growth, GABA, as an inhibitory neurotransmitter, enhances appetite by mediating central nervous responses (Chan et al. 2013 , Boonstra et al. 2015 ). In one study on Nile tilapia ( Orechromis niloticus ), the addition of 200–500 mg/kg GABA in feed had positive effects on WGR, SGR, average day gain (ADG), FCR and FER (Ruenkoed et al. 2023 ). In another study, the optimal GABA level for Nile tilapia was 158 mg/kg determined based on WGR, which could effectively improve growth parameters (Temu et al. 2019 ). Similarly, the inclusion of 80–320 mg/kg GABA in feed dramatically improved the WGR and SGR of Chinese mitten crab ( Eriocheir sinensis ). Based on WGR and SGR, the optimal GABA levels were determined to be 89 mg/kg and 84 mg/kg, respectively (Zhang et al. 2022a ). 30–150 mg/kg GABA also could promote the growth of Jian carp ( Cyprinus carpio var. Jian). Based on the analyses of WGR and FER, recommended GABA levels for Jian carp were estimated to be 99.01 mg/kg and 96.75 mg/kg, respectively (Chen et al. 2021 ). In this study, adding 30–120 mg/kg GABA to feed dramatically increased the FBW, WGR and SGR of snakehead. Especially, 120 mg/kg GABA had a significant promoting effect on FER and PER. This was consistent with results described above. This indicated that GABA had a significant improving effect on the growth of snakehead. However, there was no significant effect on the FE of juvenile olive flounder ( Paralichthys olivaceus ) (Farris et al. 2022 ) and the PER of grass carp ( Ctenopharyngodon idellus ) (Wu et al. 2016 ) from adding GABA to feed. This might be due to differences in GABA dosage, fish species and size. A strong correlation existed between animal growth and intestinal health. Intestine is responsible for digestion and absorption of nutrients, immune regulation and microbial balance, all of which directly affect the growth rate and health status of animals (Chiaranunt et al. 2021 , Liu et al. 2024 ). In fish, intestine is one of targets for pathogen infection, and is particularly susceptible to bacterial invasion (Ou et al. 2023 , Gao et al. 2024 ). LPS is part of outer membrane found in cell wall of gram-negative bacteria. Excessive LPS causes intestinal damage by triggering inflammatory responses and compromising intestinal barrier (Li et al. 2023 ). GABA enhances intestinal health by regulating enteric nervous system, and shows potential in promoting intestinal motility, exerting anti-inflammatory effects and strengthening intestinal barrier function (Chen et al. 2014 , Zhang et al. 2022a ). This study first found that LPS obviously disrupted intestinal tissue structure of snakehead. This was consistent with findings from studies on common carp ( Cyprinus carpio ) (Li et al. 2023 ) and Taimen ( Hucho taimen , Pallas) (Ren et al. 2019 ). However, the addition of GABA to feed evidently ameliorated this pathological condition. It indicated that GABA could facilitate the recovery of damaged intestinal health. Intestinal structure is complex and multifunctional, primarily involving the action of intestinal epithelial cells. This is accompanied by the collaboration of microorganisms, mucus layer and immune cells, which together form the intestinal barrier to maintain the stability and health of intestinal environment (Li et al. 2009 ). Nonetheless, when intestinal barrier is compromised, which can lead to the invasion of harmful substances, triggering inflammation and other health issues (Yu & Li 2014 ). DAO and LPS are key parameters reflecting intestinal permeability. Low levels of DAO are unable to effectively degrade histamine in intestine, which can easily lead to an excessive accumulation of histamine, thereby compromising the integrity of intestinal barrier (Fukuda et al. 2019 ). Increased intestinal permeability can lead to the leakage of DAO and LPS from intestinal lumen into bloodstream. In this study, LPS challenge dramatically increased DAO and LPS contents in intestine and serum. Similarly, serum DAO contents in amur ide ( Leuciscus waleckii ) (Wang et al. 2024 ) and common carp (Li et al. 2023 ) were significantly elevated under LPS stimulation. However, the addition of GABA to feed markedly reduced DAO and LPS contents in intestine and serum, indicating that GABA could effectively alleviate intestinal permeability in snakehead. Intestinal biological barrier is composed of a rich microbiota within intestine. It acts in coordination with host to be crucial in protecting intestine from pathogen invasion (Xia et al. 2024b ). In this study, the number of OTUs in snakehead intestine was much higher than that in control group after LPS challenge. Although this trend was similar to results observed in amur ide, differences were not as pronounced (Wang et al. 2024 ). It was speculated that this might be due to intestinal dysregulation caused by LPS, allowing other normally non-dominant microbiota or exogenous opportunistic pathogens to gain space and resources for growth in intestine. After the addition of GABA to feed, the number of OTUs in each remission group was similar to that of CTL group, indicating that GABA was beneficial for improving intestinal microbiota dysregulation in snakehead. Correspondingly, species composition also showed significant changes. In this study, at phylum level, Proteobacteria , Actinobacteria and Firmicutes ranked as top three. Specifically, LPS significantly reduced the proportion of Proteobacteria and Firmicutes , while markedly increasing the proportion of Actinobacteria . Changes in Proteobacteria were consistent with studies on juvenile taimen (Ren et al. 2019 ) and amur ide (Wang et al. 2024 ). Changes in Firmicutes align with studies on turbot ( Scophthalmus maximus L.) (Zhang et al. 2020 ) and amur ide (Wang et al. 2024 ). However, these studies have all found that LPS reduced the proportion of Actinobacteria in intestine, but since the proportion of Actinobacteria was relatively low, this change was not pronounced. After the exogenous supplementation of GABA, the three bacterial phyla exhibited an opposite trend, gradually approaching control group as GABA level increased. This suggested that the balance of these three bacterial phyla was crucial for promoting intestinal health and optimizing nutrient absorption in snakehead. Differences in changes among bacterial phyla typically depend on specific behaviors at genus level. Pseudomonas is generally considered a health risk factor that can cause intestinal infections in fish, particularly when farming environment is poor (Duman et al. 2024 ). The trend of Pseudomonas in this study was consistent with that of its corresponding phylum. This suggested that the addition of GABA to feed could effectively mitigate changes in intestinal microbiota composition caused by LPS. Alpha diversity is typically measured using species richness (Chao1) and diversity indices (Shannon and Simpson indexes). In this study, no significant differences in Chao1, Shannon and Simpson indexes were observed between groups. This was similar to finding in study on amur ide (Wang et al. 2024 ). Nevertheless, these indices showed a decreasing trend during LPS challenge, but exhibited an increasing trend as GABA levels rose. This indicated that the addition of GABA might mitigate negative effects caused by LPS through some mechanism, thereby enhancing the diversity of intestinal microbial system. Beta diversity is used to measure dissimilarity in species composition between communities from different habitats. In this study, intestinal microbiota composition showed clear separation after LPS challenge relative to control group. This was similar to findings in studies on juvenile taimen (Ren et al. 2019 ), amur ide (Wang et al. 2024 ) and turbot (Zhang et al. 2020 ). However, intestinal microbiota composition of groups with GABA showed varying degrees of overlap with control group, indicating that GABA could effectively mitigate changes in intestinal species composition of snakehead induced by LPS. Actually, factors such as growth environment, feed ingredients and fish species could all cause differences in intestinal microbiota (Sullam et al. 2012 ). Long-term and in-depth monitoring was needed to better understand the impact of GABA on intestinal biological barrier. Intestinal chemical barrier is composed of various chemical substances, including gastric acid, digestive enzymes, bile, mucus layer, antimicrobial peptides and immunoglobulins. These components work together to maintain the stability and health of intestinal environment by inhibiting the growth of pathogens and protecting epithelial cells of intestinal wall (Cui et al. 2019 ). In this study, we primarily focused on s digestive enzymes activities and certain hormone levels. Intestinal digestive enzymes are enzymes secreted by intestine and other parts of digestive system. They break down large macronutrients into smaller and more easily absorbable units (Mohammadiazarm et al. 2023 ). AMY is responsible for breaking down complex carbohydrates like starch and glycogen into maltose and dextrin. LIP breaks down fats into fatty acids and glycerol. TRY breaks down proteins into peptides and amino acids. Current research has found that adding GABA to feed could improve intestinal health by enhancing the activity of digestive enzymes. AMY and LIP activities in juvenile olive flounder fed with 150 mg/kg GABA were significantly higher than those in fish fed with other levels of feed (Farris et al. 2022 ). Similarly, in Nile tilapia fed with 200 mg/kg and 500 mg/kg GABA, the digestive enzyme activities of TRY, AMY and LIP were enhanced (Ruenkoed et al. 2023 ). The addition of GABA to feed could dramatically increase the activities of AMY (320 mg/kg), LIP (640 mg/kg) and TRY (80 and 160 mg/kg), which suggested a significant improvement in the digestive abilities of Chinese mitten crab (Zhang et al. 2022a ). In this study, we also found similar results, showing that feeding GABA could effectively alleviate the inhibitory effects of LPS on intestinal digestive enzymes of snakehead. CCK and GHRL are two peptide hormones that play key roles in digestive system and energy metabolism (Schroeter et al. 2015 ). In this study, LPS markedly increased CCK contents in intestine and serum, while significantly decreased GHRL contents in intestine and serum. After the addition of GABA to feed, there was some improvement in these negative effects, primarily in CCK content in intestine. However, effects in other areas were not significant. This aligned with result observed in study on Chinese mitten crab (Zhang et al. 2022a ). However, in study on grass carp, GABA didn’t have a significant impact on CCK and GHRL contents between groups (Wu et al. 2016 ). This might be related to its complex appetite regulation mechanisms, which required further investigation. Intestinal physical barrier, composed of arranged intestinal epithelial cells and tight junction structures, serves as a crucial defense line protecting body from harmful external substances (Martinez et al. 2012 ). In this study, intestinal tight junction structure was visibly disrupted, and the width of intercellular spaces significantly increased after LPS challenge. However, tight junction structure in intestine of snakehead improved effectively after adding GABA to feed, with most noticeable improvement observed at 90 mg/kg and 120 mg/kg levels. This suggested that GABA helped to enhance tight junction structure between epithelial cells in intestine of snakehead, improving the integrity of intestinal barrier. Moreover, within certain concentration ranges (such as 90 mg/mL and 120 mg/mL), the protective effects of GABA were more pronounced. Tight junction proteins are crucial components in the formation of tight junction structures. Occludin is one of the first discovered tight junction proteins and serves a function in maintaining barrier function between cells and the stability of cytoskeleton (Furuse et al. 1993 , Mariappan et al. 2005 ). Claudins are responsible for selectively controlling the passage of ions and small molecules between cells (Lynn et al. 2020 ). Claudin-1 is widely present in epithelial and endothelial cells, while Claudin-5 is primarily found in endothelial cells. Claudin-1 is widely present in epithelial and endothelial cells, while Claudin-5 is primarily found in endothelial cells. Both play a crucial role in the integrity and function of intestinal physical barrier (Zhang et al. 2022b , Zhang et al. 2024 ). ZO-1 protein serves as a bridge connecting membrane proteins and cytoskeleton. They are conducive to maintain the structure and function of tight junctions through interactions with Occludin and Claudins (Suzuki 2013 ). In this study, LPS significantly reduced claudin-1 , claudin-5 , occludin and zo-1 expression levels. This indicated that LPS disrupted the stability and function of tight junctions. Similarly, LPS also significantly inhibited the expression levels of tight junction-related genes in turbot (Zhang et al. 2020 ), common carp (Jiang et al. 2017 , Li et al. 2023 ), amur ide (Wang et al. 2024 ) and yellow catfish ( Pelteobagrus fulvidraco ) (Liu et al. 2021 ). Nevertheless, after the exogenous addition of GABA, the expression levels of genes related to intestinal tight junctions were dramatically restored. This indicated that GABA has a protective role in maintaining intestinal barrier function. Intestinal immune barrier prevents pathogen invasion through multi-layered immune mechanisms, and is an integral part of intestinal defense system (Koboziev et al. 2010 ). TNF-α and IL-1β are two important pro-inflammatory cytokines in immune system. TNF-α is primarily secreted by activated macrophages, T cells and other immune cells. It amplifies the inflammatory response by promoting the production of other inflammatory cytokines, enhancing the activation and recruitment of immune cells (Revina et al. 2023 ). IL-1β is mainly produced by activated monocytes, macrophages and dendritic cells. In immune responses, IL-1β can influence the activation and function of T cells and B cells, thereby enhancing immune reaction (Yadav et al. 2025 ). Research has shown that following LPS stimulation, the contents of TNF-α and IL-1β in macrophages of rainbow trout rose dramatically (Teles et al. 2011 ). Furthermore, LPS significantly increased tnf-α and il-1β expression levels in turbot (Zhang et al. 2020 ), common carp (Jiang et al. 2017 ), yellow catfish (Liu et al. 2021 ) and juvenile taimen (Ren et al. 2019 ). This was consistent with our findings. GABA as an immunomodulatory molecule can reduce the production of inflammatory cytokines. Studies have shown that exogenous supplementation of 200 mg/kg and 500 mg/kg GABA could dramatically inhibit il-1β expression level (Ruenkoed et al. 2023 ). Additionally, adding appropriate levels of GABA to feed significantly reduced tnf-α and il-1β expression levels in Jian carp (Chen et al. 2021 ). The above results suggested that GABA supplementation might have anti-inflammatory properties, which might help reduce inflammation and associated diseases. This study found that adding GABA to feed effectively reversed increase in TNF-α and IL-1β contents in intestine and serum induced by LPS. This suggested that GABA might regulate intestinal immune health in snakehead through immune mechanisms, warranting further investigation. In addition to some pro-inflammatory factors, the expression levels of certain specific immune genes also play a critical role in body's immune system. IgM is the earliest type of antibody produced in body, and generally acts as the first line of defense during the initial immune response (Wu et al. 2024a ). IgT is the main mucosal immune antibody in fish, involved in protecting mucosal surfaces from pathogen infections (Tang et al. 2018 ). pIgR is responsible for transporting polymeric immunoglobulins such as IgT and IgM across epithelial cells to reach mucosal surfaces where they exert their effects (Gurevich et al. 2003 ). MHC-I is primarily responsible for presenting endogenous antigens to T cells (Yang et al. 2016 ). These parameters are sensitive to bacterial stimulation and can quickly recognize and participate in immune response. Research has found that IgM levels in intestines of carp significantly increased after LPS infection (Li et al. 2023 ). This was consistent with our experimental results, where the injection of LPS led to increased igm expression level in intestine. It is indicated that the disruption of immune barrier after LPS injection leaded to an upregulation of immune-related gene expression. However, the addition of GABA to feed significantly reduced the expression levels of igm , igt , mhc-1 and pigr in intestine. This suggested that GABA could ease inflammatory responses by influencing the expression levels of immune-related genes in intestines of snakehead. Conclusion Summary of research content was shown in Fig. 14 . In summary, this study assessed the harmful impact of LPS on the intestine of snakehead and the role of GABA in nutritional regulation. Specifically, exogenous GABA supplementation could significantly promote growth and improve LPS-induced damage to intestinal mucosal barrier in snakehead. Concurrently, there is a dose-dependent effect of GABA on growth and intestinal barrier protection of snakehead, with an optimal supplementation range recommended at 90–120 mg/kg. Declarations Competing interests Authors declare that they have no competing interests. Ethics approval and consent to participate Animal procedures in this study were approved by Ethics Committee of Jilin Agricultural University (approval number: 2023 05 11 001). Funding This research received funding from Jilin Provincial Education Department Science and Technology Research Project (JJKH20220367KJ), China Agriculture Research System Earmarked Fund (CARS-46) and National Natural Science Foundation of China (32002406). Author Contribution Xue-qin Wu: Formal analysis, Methodology, Software, Validation, Visualization and Writing-original draft; Xu-nan Li: Conceptualization, Data curation, Formal analysis, Methodology, Software and Validation; Feng-kun Cai: Methodology; Yun-jie Lin, Xiao-tian Niu and Yan-nan Tong: Methodology and Resources; Xiu-mei Chen: Conceptualization, Data curation, Funding acquisition, Methodology, Project administration, Resources, Supervision and Writing-review and editing; Gui-qin Wang: Funding acquisition, Methodology, Project administration, Resources and Supervision. Data Availability I have shared the link to my data at the attach file step. References Boonstra E, De Kleijn R, Colzato LS, Alkemade A, Forstmann BU, Nieuwenhuis S (2015) Neurotransmitters as food supplements: the effects of GABA on brain and behavior. Frontiers in psychology 6:167121 Chan O, Paranjape SA, Horblitt A, Zhu W, Sherwin RS (2013) Lactate-induced release of GABA in the ventromedial hypothalamus contributes to counterregulatory failure in recurrent hypoglycemia and diabetes. Diabetes 62:4239-4246 Chen Q, Hu D, Wu X, Feng Y, Ni Y (2022) Dietary γ-aminobutyric acid supplementation Inhibits high-fat diet-Induced hepatic steatosis via modulating gut microbiota in broilers. Microorganisms 10:1281 Chen X, Gao C, Du X, Xu H, Wang G, Zhang D (2021) Effects of dietary γ‐aminobutyric acid levels on the growth, serum biochemical indexes, immune‐related signalling molecules of Jian carp. Aquaculture Research 52:1096-1105 Chen Z, Xie J, Wang B, Tang J (2014) Effect of γ-aminobutyric acid on digestive enzymes, absorption function, and immune function of intestinal mucosa in heat-stressed chicken. Poultry Science 93:2490-2500 Cheng J, Zheng N, Sun X, Li S, Wang J, Zhang Y (2016) Feeding rumen-protected gamma-aminobutyric acid enhances the immune response and antioxidant status of heat-stressed lactating dairy cows. Journal of Thermal Biology 60:103-108 Chiaranunt P, Tai SL, Ngai L, Mortha A (2021) Beyond immunity: underappreciated functions of intestinal macrophages. Frontiers in immunology 12:749708 Cui Y, Wang Q, Chang R, Zhou X, Xu C (2019) Intestinal barrier function–non-alcoholic fatty liver disease interactions and possible role of gut microbiota. Journal of agricultural and food chemistry 67:2754-2762 Dong W, Ran X, He G, Hu W, Chen Y, He Y, Lin S (2024) The effect of dietary full-fat Hermetia illucens larvae meal on growth performance and intestine physiology in largemouth bass ( Micropterus salmoides ). Animal Feed Science and Technology 317:116089 Du JH, Xu MY, Wang Y, Lei Z, Yu Z, Li MY (2022) Evaluation of Taraxacum mongolicum flavonoids in diets for Channa argus based on growth performance, immune responses, apoptosis and antioxidant defense system under lipopolysaccharide stress. Fish & Shellfish Immunology 131:1224-1233 Duan Y, Wang Y, Zhang J, Liu Q, Ding X (2018) Morphologic, digestive enzymes and immunological responses of intestine from Litopenaeus vannamei after lipopolysaccharide injection. Journal of invertebrate pathology 153:186-194 Duman M, Lalucat J, Burcin Saticioglu I, Mulet M, Gomila M, Altun S, Ajmi N, García-Valdés E (2024) Description of three new Pseudomonas species isolated from aquarium fish: Pseudomonas auratipiscis sp. nov., Pseudomonas carassii sp. nov. and Pseudomonas ulcerans sp. nov. Systematic and Applied Microbiology 47:126552 Farris NW, Hamidoghli A, Bae J, Won S, Choi W, Biró J, Lee S, Bai SC (2022) Dietary supplementation with γ-aminobutyric acid improves growth, digestive enzyme activity, non-specific immunity and disease resistance against Streptococcus iniae in juvenile olive flounder, Paralichthys olivaceus. Animals 12:248 Flint HJ, Scott KP, Louis P, Duncan SH (2012) The role of the gut microbiota in nutrition and health. Nature reviews Gastroenterology & hepatology 9:577-589 Fukuda T, Tsukano K, Nakatsuji H, Suzuki K (2019) Plasma diamine oxidase activity decline with diarrhea severity in calves indicating systemic dysfunction related to intestinal mucosal damage. Research in veterinary science 126:127-130 Furuse M, Hirase T, Itoh M, Nagafuchi A, Yonemura S, Tsukita S, Tsukita S (1993) Occludin: a novel integral membrane protein localizing at tight junctions. The Journal of cell biology 123:1777-1788 Galafat A, Sáez M, Rodríguez C, de Rojas AH, Vizcaíno A, Martínez T, Alarcón-López F (2024) In vitro evaluation of algae and their effect as dietary ingredient on growth, chemical composition and intestinal functionality in juvenile turbot ( Scophthalmus maximus ). Aquaculture:741208 Gao JH, Zhao JL, Guo NX, Tola T, Xue WB, Cai KN, Yao XL, Hu M (2024) Hepcidin defense patterns in intestine of mandarin fish ( Siniperca chuatsi ) against Aeromonas hydrophila infection. Fish & Shellfish Immunology 155:110003 Gurevich P, Zusman I, Moldavsky M, Szvalb S, Elhayany A, Halperin R, Gurevich E, Ben-Hur H (2003) Secretory immune system in human intrauterine development: immunopathomorphological analysis of the role of secretory component (pIgR/SC) in immunoglobulin transport. International journal of molecular medicine 12:289-297 Jiang J, Yin L, Li JY, Li Q, Shi D, Feng L, Liu Y, Jiang WD, Wu P, Zhao Y (2017) Glutamate attenuates lipopolysaccharide-induced oxidative damage and mRNA expression changes of tight junction and defensin proteins, inflammatory and apoptosis response signaling molecules in the intestine of fish. Fish & Shellfish Immunology 70:473-484 Kiela PR, Ghishan FK (2016) Physiology of intestinal absorption and secretion. Best practice & research Clinical gastroenterology 30:145-159 Koboziev I, Karlsson F, Grisham MB (2010) Gut‐associated lymphoid tissue, T cell trafficking, and chronic intestinal inflammation. Annals of the New York Academy of Sciences 1207: E86-E93 Łątka K, Jończyk J, Bajda M (2020) γ-Aminobutyric acid transporters as relevant biological target: Their function, structure, inhibitors and role in the therapy of different diseases. International journal of biological macromolecules 158:750-772 Li J, Jiang M, Han Q, Peng R, Jiang X (2020) Effects of γ‐aminobutyric acid supplementation on the growth performance, serum biochemical indices and antioxidant status of pharaoh cuttlefish, Sepia pharaonis . Aquaculture Nutrition 26:1026-1034 Li L, Wei XF, Yang ZY, Zhu R, Li DL, Shang GJ, Wang HT, Meng ST, Wang YT, Liu SY (2023) Alleviative effect of poly-β-hydroxybutyrate on lipopolysaccharide-induced oxidative stress, inflammation and cell apoptosis in Cyprinus carpio. International Journal of Biological Macromolecules 253:126784 Li P, Mai K, Trushenski J, Wu G (2009) New developments in fish amino acid nutrition: towards functional and environmentally oriented aquafeeds. Amino acids 37:43-53 Liu Y, Meng F, Wang S, Xia S, Wang R (2021) Vitamin D3 mitigates lipopolysaccharide-induced oxidative stress, tight junction damage and intestinal inflammatory response in yellow catfish, Pelteobagrus fulvidraco . Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology 243:108982 Liu Y, Wang J, Ding J, Zhang Y, Hou C, Shen W, Wu X, Zhu J (2024) Effects of hypoxia stress on oxidative stress, apoptosis and microorganisms in the intestine of large yellow croaker ( Larimichthys crocea ). Aquaculture 581:740444 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2 −ΔΔCT method. methods 25:402-408 Lynn KS, Peterson RJ, Koval M (2020) Ruffles and spikes: Control of tight junction morphology and permeability by claudins. Biochimica et Biophysica Acta (BBA)-Biomembranes 1862:183339 Ma H, Du H, Wang D, Cao Y, Liu J, Liu T, Liu T, Wang G, Wang E (2023) A subunit vaccine encoding glycoprotein holds potential to protect snakehead (Channa argus) from snakehead vesiculovirus infection. Aquaculture 577:739947 Ma JM, Yang YB, Ding H, Tan Q-Y, Song YJ, Shen HC, Ai QH, Zhao CY, Dewangan NK, Xu C (2024) γ-aminobutyric acid improves the growth performance, food intake and glucose homeostasis of Micropterus salmoides fed high-carbohydrate diets. Aquaculture Reports 38:102350 Mariappan MM, Senthil D, Natarajan KS, Choudhury GG, Kasinath BS (2005) Phospholipase Cγ-Erk axis in vascular endothelial growth factor-induced eukaryotic initiation factor 4E phosphorylation and protein synthesis in renal epithelial cells. Journal of Biological Chemistry 280:28402-28411 Martinez C, González-Castro A, Vicario M, Santos J (2012) Cellular and molecular basis of intestinal barrier dysfunction in the irritable bowel syndrome. Gut and liver 6:305 Mohammadiazarm H, Zehirikia Y, Kalantarzadeh S, Etehadi K, Salati AP, Mousavi SM, Maniat M (2023) Growth, body composition, digestive enzyme activity, blood biochemical parameters, and immune antioxidant indices of red tilapia fish ( Oreochromis mossambicus × Oreochromis niloticus ) reared in mixed cell and rectangular raceways. Aquaculture Reports 33:101803 Munoz LR, Bailey MA, Krehling JT, Bourassa DV, Hauck R, Pacheco WJ, Chaves-Cordoba B, Chasteen KS, Talorico AA, Escobar C (2023) Effects of dietary yeast cell wall supplementation on growth performance, intestinal Campylobacter jejuni colonization, innate immune response, villus height, crypt depth, and slaughter characteristics of broiler chickens inoculated with Campylobacter jejuni at d 21. Poultry Science 102:102609 Ou J, Luo WS, Zhong ZR, Xie Q, Wang F, Xiong NX, Luo SW (2023) Manganese-superoxide dismutase (MnSOD) rescues redox balance and mucosal barrier function in midgut of hybrid fish ( Carassius cuvieri ♀ × Carassius auratus red var ♂ ) infected with Aeromonas hydrophila and Edwardsiella tarda . Reproduction and Breeding 3:108-117 Ren G, Xu L, Lu T, Zhang Y, Wang Y, Yin J (2019) Protective effects of lentinan on lipopolysaccharide induced inflammatory response in intestine of juvenile taimen ( Hucho taimen , Pallas). International journal of biological macromolecules 121:317-325 Revina O, Revins V, Cīrule D, Valdovska A (2023) TNF-Α, IL-6, HSP-70, fish growth hormone, and growth performance of sea trout, Salmo trutta (Actinopterygii: Salmoniformes: Salmonidae) after long-term dietary administration of β-glucan and BGN-2. ACTA ICHTHYOLOGICA ET PISCATORIA 53:253-261 Ruenkoed S, Nontasan S, Phudkliang J, Phudinsai P, Pongtanalert P, Panprommin D, Mongkolwit K, Wangkahart E (2023) Effect of dietary gamma aminobutyric acid (GABA) modulated the growth performance, immune and antioxidant capacity, digestive enzymes, intestinal histology and gene expression of Nile tilapia ( Oreochromis niloticus ). Fish & Shellfish Immunology 141:109056 Schroeter JC, Fenn CM, Small BC (2015) Elucidating the roles of gut neuropeptides on channel catfish feed intake, glycemia, and hypothalamic NPY and POMC expression. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 188:168-174 Sullam KE, Essinger SD, Lozupone CA, O’CONNOR MP, Rosen GL, Knight R, Kilham SS, Russell JA (2012) Environmental and ecological factors that shape the gut bacterial communities of fish: a meta‐analysis. Molecular ecology 21:3363-3378 Suzuki T (2013) Regulation of intestinal epithelial permeability by tight junctions. Cellular and molecular life sciences 70:631-659 Tang X, Du Y, Sheng X, Xing J, Zhan W (2018) Molecular cloning and expression analyses of immunoglobulin tau heavy chain (IgT) in turbot, Scophthalmus maximus. Veterinary immunology and immunopathology 203:1-12 Teles M, MacKenzie S, Boltana S, Callol A, Tort L (2011) Gene expression and TNF-alpha secretion profile in rainbow trout macrophages following exposures to copper and bacterial lipopolysaccharide. Fish & shellfish immunology 30:340-346 Temu V, Kim H, Hamidoghli A, Park M, Won S, Oh M, Han JK, Bai SC (2019) Effects of dietary gamma-aminobutyric acid in juvenile Nile tilapia, Orechromis niloticus. Aquaculture 507:475-480 Tian Z, Cui Y, Lu H, Ma X (2020) Effects of long-term feeding diets supplemented with Lactobacillus reuteri 1 on growth performance, digestive and absorptive function of the small intestine in pigs. Journal of Functional Foods 71:104010 Wang W, Wang Y, Lu Y, Zhu J, Tian X, Wu B, Du J, Cai W, Xiao Y (2022) Reg4 protects against Salmonella infection-associated intestinal inflammation via adopting a calcium-dependent lectin-like domain. International Immunopharmacology 113:109310 Wang Y, Meng S, Li D, Liu S, Liang L, Wu L (2024) Dietary chlorogenic acid supplementation protects against lipopolysaccharide-induced oxidative stress, inflammation and apoptosis in intestine of amur ide (Leuciscus waleckii). Aquatic Toxicology:107223 Wu F, Liu M, Chen C, Chen J, Tan Q (2016) Effects of dietary gamma aminobutyric acid on growth performance, antioxidant status, and feeding‐related gene expression of juvenile grass carp, Ctenopharyngodon idellus . Journal of the World Aquaculture Society 47:820-829 Wu XQ, Chen XM, Pan YY, Sun C, Tian JX, Qian AD, Niu XT, Li M, Wang GQ (2024a) Changes of intestinal barrier in the process of intestinal inflammation induced by Aeromonas hydrophila in snakehead ( Channa argus ). Fish & Shellfish Immunology 152:109775 Wu XQ, Chen XM, Wan JW, Yang ZN, Tian JX, Qian AD, Wang GQ (2024b) A northern snakehead ( Channa argus ) model of intestinal inflammation induced by Aeromonas hydrophila : Construction and transcriptome analysis. Aquaculture 580:740323 Xia H, Liu L, Zhou W, Ding C, Liu H, Lei T, Chen F, Liu S, Yu J, Yang P (2024a) Immune response to Aeromonas hydrophila and molecular characterization of polymeric immunoglobulin receptor in juvenile Megalobrama amblycephala . Fish & Shellfish Immunology 153:109821 Xia X, Ma X, Liang N, Qin L, Huo W, Li Y (2024b) Damage of polyethylene microplastics on the intestine multilayer barrier, blood cell immune function and the repair effect of Leuconostoc mesenteroides DH in the large-scale loach ( Paramisgurnus dabryanus ). Fish & Shellfish Immunology 147:109460 Xie SW, Li YT, Zhou WW, Tian LX, Li YM, Zeng SL, Liu YJ (2017) Effect of γ‐aminobutyric acid supplementation on growth performance, endocrine hormone and stress tolerance of juvenile Pacific white shrimp, Litopenaeus vannamei , fed low fishmeal diet. Aquaculture Nutrition 23:54-62 Yadav S, Prasannan A, Venkatachalam K, Binesh A (2025) Exploring the mechanism and crosstalk between IL-6 and IL-1β on M2 macrophages under metabolic stress conditions. Cytokine 186:156852 Yan Z, Liu B, Liu J, Guo Z, Kou Y, Lu W, Sun J, Li Y (2024) Enhancing resilience to chronic ammonia stress in crucian carp ( Carassius carassius ) through dietary gamma-aminobutyric acid (GABA) supplementation: Effects on growth performance, immune function, hepatotoxicity, and apoptosis. Aquaculture Reports 37:102259 Yang M, Wei J, Li P, Wei S, Huang Y, Qin Q (2016) MHC polymorphism and disease resistance to Singapore grouper iridovirus (SGIV) in the orange-spotted grouper, Epinephelus coioides . Science Bulletin 61:693-699 Yang W, Sun H, Yan J, Kang C, Wu J, Yang B (2023) Enterohemorrhagic Escherichia coli senses microbiota-derived nicotinamide to increase its virulence and colonization in the large intestine. Cell Reports 42 Yu YB, Li YQ (2014) Enteric glial cells and their role in the intestinal epithelial barrier. World journal of gastroenterology: WJG 20:11273 Zhang B, Li C, Wang X, Liu C, Zhou H, Mai K, He G (2020) Administration of commensal Shewanella sp. MR-7 ameliorates lipopolysaccharide-induced intestine dysfunction in turbot ( Scophthalmus maximus L.). Fish & shellfish immunology 102:460-468 Zhang C, Wang X, Su R, He J, Liu S, Huang Q, Qin C, Zhang M, Qin J, Chen L (2022a) Dietary gamma-aminobutyric acid (GABA) supplementation increases food intake, influences the expression of feeding-related genes and improves digestion and growth of Chinese mitten crab ( Eriocheir sinensis ). Aquaculture 546:737332 Zhang W, Zhao G, Lin X, Li C, Zhu H, Bi R, Fang B, Xiong W, Yuan M, Wang D, Li Y (2024) Maternal supplementation with edible birds' nest during gestation and lactation enhances intestinal barrier function by upregulating Claudin-1 in rat offspring. Journal of Functional Foods 116:106177 Zhang Y, Garrett S, Carroll RE, Xia Y, Sun J (2022b) Vitamin D receptor upregulates tight junction protein claudin-5 against colitis-associated tumorigenesis. Mucosal Immunology 15:683-697 Zhou H, Zhang M, Shan Q, Huang H, Zhang M, Liu S, Lin J, Ma L, Zheng G, Li L (2023) Pharmacokinetics and residue elimination of metalaxyl enantiomers in snakehead ( Channa argus ). Aquaculture 567:739219 Tables Table 1 Basic feed composition and nutrient components Ingredients and nutritional composition Group 0 30 60 90 120 Feed ingredient（mg/kg） Fish Meal 410 410 410 410 410 Corn Protein Powder 260 260 260 260 260 Wheat Flour 140 140 140 140 140 Wheat Bran 50 50 50 50 50 Corn Oil 40 40 40 40 40 Dextrin 60 60 60 60 60 GABA 0 30 60 90 120 1 Vitamin Premix 10 10 10 10 10 2 Mineral Premix 10 10 10 10 10 Calcium Phosphate 15 15 15 15 15 Choline Chloride 5 5 5 5 5 Nutrition Level (%) Crude Protein 41.92 42.56 43.02 42.39 43.74 Crude Lipid 7.96 7.51 7.43 7.96 8.08 Crude Ash 10.67 9.79 10.15 10.79 10.77 1 Vitamin premix (mg/kg diet): retinyl acetate 7.2, cholecalciferol 10, thiamin nitrate 5, riboflavin 10, DL-α-tocopherol acetate 150, menadione 10, pyridoxine hydrochloride 20, cyanocobalamin 10, ascorbic acid 300, Inositol 500, folic acid 20, D-biotin 10, niacin acid 30, Ca pantothenate 30. 2 Mineral premix (mg/kg diet): MgSO 4 · H 2 O 4000, KI 1.3, FeSO 4 · H 2 O 500, CuSO 4 ·5H 2 O 19.2, MnSO 4 · H 2 O 53.2, ZnSO 4 · H 2 O 165, Na 2 SeO 3 25, CoCl 2 · 6H 2 O 50. 3 Nutritional level is measured value. Table 2 Primer sequence information. Genes Sequence (5′-3′) β-actin F: GCCCTCTTCCAGCCTTCCTT R: AGTGTTGGCATACAGGTCTTTACGG zo-1 F: TGGTTGTTCAGAGGGACGATAGAG R: TCAGAGGCGTTGGCGGAAG occudin F: CAAACCGCAGCACTTCTACAAATGG R: TCGCCACGCACAGCACAATC claudin-1 F: GCTCATCGGGTTCCTCCTCTCTC R: AGGTTGTTCTCTCATTGCCACTGC claudin-5 F: TGTGTTGTGCTGCTCCTGTCC R: TCTGCGTGGCTCTCTTTGTCTG mhc-1 F: AGTGGCTGAAGAAGTATGTG R: AGAAACCTGTAGCGTGGC pigr F: CTTTGCTGGTGTGTGCTTCG R: CTTGTCTTAACGCAGTATTCTCCTTG igm F: AGATTGATAAGACCGTGCCAGG R: CTTCGTAACAGATGGCTTTAGTGC igt F: CTTTATGCTGCGTCCAGTAGAAC R: GCCAAGACACATAAGCCTCCTG Table 3 The effect of GABA level in feed on growth of snakehead. Items GABA level in feed (mg/kg) 0 30 60 90 120 IBW/g 5.28±0.13 a 5.18±0.17 a 5.13±0.05 a 5.15±0.14 a 5.22±0.08 a FBW/g 29.44±2.25 a 33.79±1.69 b 34.62±1.03 bc 36.70±0.52 c 37.43±1.46 c WGR/% 457.12±29.63 a 551.95±25.23 b 575.37±25.21 bc 613.46±26.26 c 617.27±35.32 c SGR/%/day 3.07±0.10 a 3.35±0.07 b 3.41±0.07 bc 3.51±0.07 c 3.52±0.09 c FER/% 64.14±4.36 a 64.65±2.47 a 65.54±2.28 ab 68.60±1.34 ab 69.70±1.75 b PER/% 1.53±0.10 a 1.54±0.06 a 1.56±0.05 ab 1.63±0.03 ab 1.67±0.04 b Note: Values represent as the means ± SEM (n=3). Different letters indicate significant differences ( P <0.05). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 20 Jun, 2025 Reviews received at journal 19 Jun, 2025 Reviewers agreed at journal 06 Jun, 2025 Reviews received at journal 05 Jun, 2025 Reviewers agreed at journal 04 Jun, 2025 Reviewers agreed at journal 31 May, 2025 Reviewers invited by journal 30 May, 2025 Editor assigned by journal 30 May, 2025 Submission checks completed at journal 29 May, 2025 First submitted to journal 29 May, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6777536\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":464759257,\"identity\":\"3f6b9907-e74b-4ac2-8e60-2c6eb0643142\",\"order_by\":0,\"name\":\"Xue-qin Wu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Jilin Agricultural University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xue-qin\",\"middleName\":\"\",\"lastName\":\"Wu\",\"suffix\":\"\"},{\"id\":464759258,\"identity\":\"b2014c7f-7deb-4798-a1a8-f73c3cdc2d2f\",\"order_by\":1,\"name\":\"Xu-nan Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Jilin Agricultural University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xu-nan\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":464759259,\"identity\":\"90d5a6a9-5f4b-424f-9cbe-4ae287611b1f\",\"order_by\":2,\"name\":\"Feng-kun Cai\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Changbai Mountain Academy of Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Feng-kun\",\"middleName\":\"\",\"lastName\":\"Cai\",\"suffix\":\"\"},{\"id\":464759261,\"identity\":\"1c3c0a05-366f-4248-a9b9-9ed568519cd2\",\"order_by\":3,\"name\":\"Yun-jie Lin\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Jilin Agricultural University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yun-jie\",\"middleName\":\"\",\"lastName\":\"Lin\",\"suffix\":\"\"},{\"id\":464759262,\"identity\":\"9ee33fcc-eaee-4296-90b3-ab564f62f2bf\",\"order_by\":4,\"name\":\"Xiao-tian Niu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Jilin Agricultural University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiao-tian\",\"middleName\":\"\",\"lastName\":\"Niu\",\"suffix\":\"\"},{\"id\":464759263,\"identity\":\"c5bf2dd1-f2e3-43f8-accf-ca1677dffdf5\",\"order_by\":5,\"name\":\"Xiu-mei Chen\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6ElEQVRIiWNgGAWjYDACCRBhAMTM/A8ffqiQkOMnQQsPs7HEGQtjyQaitIABD5sEb1tF4gZCWvhnNx97zFNwOJqfnfeAhOQ8CcYNDMwPH93AZ8mdY+mGMwwO585s5kswKNwmwWzOwGZsnINHi4FEjpnEB6CWDYcZDBIkt0mwWTbwsEnj15L/TSIBqGU/UMsB3jkSPAYHCGrJYYPYwsxj2MDbICFBUIvEjTQzyRkG6bkzDrMlM0sckzCQbCbgF/4Zyc+kef5Y5/b3Hz7+80NNXX0/e/PDx/i0YAHMpCkfBaNgFIyCUYAFAADODEZnnv//tAAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"Jilin Agricultural University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Xiu-mei\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":464759264,\"identity\":\"37b3dced-cc96-47cb-9384-64e1ae56d459\",\"order_by\":6,\"name\":\"Yan-nan N. Tong\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hainan Academy of Ocean and Fisheries Science\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yan-nan\",\"middleName\":\"N.\",\"lastName\":\"Tong\",\"suffix\":\"\"},{\"id\":464759265,\"identity\":\"8f28fb00-7650-4b96-a11d-3bab80095798\",\"order_by\":7,\"name\":\"Gui-qin Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Jilin Agricultural University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Gui-qin\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-05-29 14:38:23\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6777536/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6777536/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":83787114,\"identity\":\"28ae5dd4-059b-4350-86d1-c1ab5e0ddd6e\",\"added_by\":\"auto\",\"created_at\":\"2025-06-02 17:24:40\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":56988,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe quadratic regression analysis between GABA levels and WGR in snakehead (n=3).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6777536/v1/48c07b90490ba1fee5ceab48.png\"},{\"id\":83787116,\"identity\":\"3bb15edf-efbc-4f5a-a1c7-97ab10e2a328\",\"added_by\":\"auto\",\"created_at\":\"2025-06-02 17:24:40\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":747556,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe effect of GABA on intestinal pathology of LPS-induced snakehead (200×).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6777536/v1/bed1a16a2569fceb3e361cc0.png\"},{\"id\":83787123,\"identity\":\"5d0a6382-a1d7-4d02-b68f-d8e109c005e7\",\"added_by\":\"auto\",\"created_at\":\"2025-06-02 17:24:40\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":359594,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe effect of GABA on intestinal permeability parameters of LPS-induced snakehead (n=3; \\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6777536/v1/16ff30cabf731972e38aad24.png\"},{\"id\":83787261,\"identity\":\"10bd49ad-2591-4bd8-b3cf-94075d6c5cbb\",\"added_by\":\"auto\",\"created_at\":\"2025-06-02 17:32:40\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":23700,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe number of share and unique OTUs of intestinal flora in snakehead (Venn).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6777536/v1/8ed90f0733183baf0661d666.png\"},{\"id\":83787118,\"identity\":\"96eb9ebb-8b6a-40c3-b539-92c6580bb5d7\",\"added_by\":\"auto\",\"created_at\":\"2025-06-02 17:24:40\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":77038,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eChanges in species composition of snakehead. (A) Phylum; (B) Genus.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6777536/v1/81d215f9448e3bf37e65c26f.png\"},{\"id\":83787739,\"identity\":\"44744d0f-034c-4df9-a43b-1dd076fc58f8\",\"added_by\":\"auto\",\"created_at\":\"2025-06-02 17:40:40\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":85202,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eChanges in alpha diversity index of intestinal flora in snakehead. (A) Chao1; (B) Shannon; (C) Simpson.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6777536/v1/e2983b731b8972d5e1dd92fc.png\"},{\"id\":83787124,\"identity\":\"66d2f185-4093-4b56-968c-caaca1f2432b\",\"added_by\":\"auto\",\"created_at\":\"2025-06-02 17:24:40\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":104188,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eChanges in beta diversity analysis of intestinal flora in snakehead. (A) PCoA; (B) NMDS.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6777536/v1/6c21cae1731a15d0e0999c1e.png\"},{\"id\":83787125,\"identity\":\"9b6ebd37-31ad-4f3a-b760-5b1db63c0e49\",\"added_by\":\"auto\",\"created_at\":\"2025-06-02 17:24:40\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":165424,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe effect of GABA on intestinal digestive enzymes of LPS-induced snakehead (n=3; \\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6777536/v1/6702dd996265b0cee50fcc44.png\"},{\"id\":83787127,\"identity\":\"9f5c36e6-8127-47dd-8204-32622f962ba2\",\"added_by\":\"auto\",\"created_at\":\"2025-06-02 17:24:40\",\"extension\":\"png\",\"order_by\":9,\"title\":\"Figure 9\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":445959,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe effect of GABA on intestinal gastrointestinal hormones of LPS-induced snakehead (n=3; \\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"9.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6777536/v1/2825dc0ea2ff75489518e6ed.png\"},{\"id\":83787131,\"identity\":\"6b739eb1-b419-44d0-8bd7-d5985fdb1d2b\",\"added_by\":\"auto\",\"created_at\":\"2025-06-02 17:24:40\",\"extension\":\"png\",\"order_by\":10,\"title\":\"Figure 10\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1248965,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe effect of GABA on intestinal tight junction structures of LPS-induced snakehead (80000×).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"10.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6777536/v1/d8e1dfedf063107fcb45719d.png\"},{\"id\":83787129,\"identity\":\"2259dfa0-bcee-4676-b30c-ec71d547f890\",\"added_by\":\"auto\",\"created_at\":\"2025-06-02 17:24:40\",\"extension\":\"png\",\"order_by\":11,\"title\":\"Figure 11\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":325634,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe effect of GABA on intestinal tight junction-related genes of LPS-induced snakehead (n=3; \\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"11.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6777536/v1/4b29cdc8a149a43f00c96c9b.png\"},{\"id\":83787128,\"identity\":\"63bc9cf2-f6e6-4eca-bd9d-982c226da723\",\"added_by\":\"auto\",\"created_at\":\"2025-06-02 17:24:40\",\"extension\":\"png\",\"order_by\":12,\"title\":\"Figure 12\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":421978,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe effect of GABA on intestinal inflammatory factors of LPS-induced snakehead (n=3; \\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"12.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6777536/v1/5f2da61a08d18e1d321f6051.png\"},{\"id\":83787133,\"identity\":\"bd63df85-68e5-42d3-be25-678770c5470b\",\"added_by\":\"auto\",\"created_at\":\"2025-06-02 17:24:40\",\"extension\":\"png\",\"order_by\":13,\"title\":\"Figure 13\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":428114,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe effect of GABA on intestinal immune-related genes of LPS-induced snakehead (n=3; \\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"13.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6777536/v1/113843d3453fddb07e6d65a5.png\"},{\"id\":83787130,\"identity\":\"a9017ed7-41b3-4594-81c2-69e69dc1c677\",\"added_by\":\"auto\",\"created_at\":\"2025-06-02 17:24:40\",\"extension\":\"png\",\"order_by\":14,\"title\":\"Figure 14\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":168074,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSummary of research content.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"14.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6777536/v1/9ef264ccd1b2d1975ff856cd.png\"},{\"id\":83788243,\"identity\":\"d733dc1d-febc-494b-926d-cdc584940983\",\"added_by\":\"auto\",\"created_at\":\"2025-06-02 17:56:43\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":5065756,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6777536/v1/c5722f7a-a62c-42c1-bc0b-3354ce38d8d6.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Positive effects of gamma aminobutyric acid on growth and lipopolysaccharide induced intestinal mucosal barrier damage in snakehead (Channa argus)\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eIntestine, as a special functional organ, is crucial in nutrient absorption, immune defense and the elimination of harmful substances (Flint et al. \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2012\\u003c/span\\u003e). Its health is directly related to animal's growth performance and disease resistance (Tian et al. \\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e, Dong et al. \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e, Wu et al. \\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e2024b\\u003c/span\\u003e). However, the functions of intestine mainly rely on its complex structure and multi-layered barrier mechanisms. On one hand, intestine supports body's growth by absorbing nutrients. Complex macromolecules in food are broken down into absorbable small molecules, which enter body through transport proteins and diffusion mechanisms on epithelial cells (Kiela \\u0026amp; Ghishan \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e). Additionally, the villi and microvilli of intestine significantly increase absorptive surface area, thereby enhancing nutrient absorption efficiency (Munoz et al. \\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e, Galafat et al. \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). On the other hand, intestine acts as a crucial barrier against external pathogen invasion (Yu \\u0026amp; Li \\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). Specifically, the physical barrier of intestine is formed by tight junctions between intestinal epithelial cells. In addition, chemical and biological barriers, such as mucus layer and beneficial microbiota, further inhibit the growth and colonization of pathogens. Lymphoid tissues and immune components in intestine actively recognize and neutralize potential threats, collectively maintaining body's health and homeostasis (Wu et al. \\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e2024a\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eNevertheless, intestine still faces threats from various factors, especially intestinal diseases caused by bacterial infections (Wang et al. \\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e, Yang et al. \\u003cspan citationid=\\\"CR59\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e, Xia et al. \\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e2024a\\u003c/span\\u003e). Bacterial infections often lead to the disruption of intestinal mucosal barrier, subsequently causing a series of physiological disorders and disease manifestations. Lipopolysaccharide (LPS) is a typical representative of bacterial pathogens, capable of immunostimulating intestinal mucosa and inducing inflammatory responses, ultimately damaging intestinal health (Duan et al. \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e, Li et al. \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eGamma-aminobutyric acid (GABA) is a significant non-protein amino acid functioning primarily as an inhibitory neurotransmitter in central nervous system (Łątka et al. \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). It has various biological functions, including promoting appetite (Chan et al. \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e), improving intestinal function (Chen et al. \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e), enhancing immune function and increasing antioxidant capacity (Cheng et al. \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e). In aquatic animals, GABA promotes growth and improves feed utilization by regulating feeding-related genes expression (Xie et al. \\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e, Farris et al. \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e, Zhang et al. \\u003cspan citationid=\\\"CR62\\\" class=\\\"CitationRef\\\"\\u003e2022a\\u003c/span\\u003e, Ma et al. \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). Moreover, GABA can mediate somatostatin in gastrointestinal tract, promoting the release of immunoglobulin and gastrin, thereby enhancing body's immunity (Li et al. \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e, Chen et al. \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e, Yan et al. \\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). Overall, GABA is a potential nutrient that helps maintain and improve intestinal health.\\u003c/p\\u003e \\u003cp\\u003eNorthern snakehead is an important freshwater aquaculture fish with a long history and significant economic value in Asia (Du et al. \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e, Ma et al. \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). Nonetheless, due to the expansion of intensive aquaculture, the risk of disease in northern snakehead has an obvious increase (Zhou et al. \\u003cspan citationid=\\\"CR65\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). Particularly during juvenile stage, intestinal infections become a major cause of high mortality rates and stunted growth. Optimizing the intestinal health of northern snakehead is critical for improving aquaculture efficiency and ensuring the sustainable growth of aquaculture industry. Based on this, this study aims to investigate the role of GABA in promoting growth and alleviating LPS-induced intestinal mucosal barrier damage, which supplying a theoretical and practical basis for the scientific application of GABA and the scientific aquaculture of northern snakehead.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eFeed preparation\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eGABA (purity\\u0026ge;99%) was brought from Zaozhuang Jienuo Enzyme Co., Ltd, Shandong, China. The inclusion level of GABA (0, 30, 60, 90, 120 mg/kg) in feed was determined based on previous research. The preparation of feed was shown in Table 1. Fish meal and corn protein powder were the main sources of protein. Corn oil was the main source of fat. Feed preparation process was as follows: raw materials were ground and sieved (60-mesh) sieve, followed by weighing and uniform mixing. The above mixture was added an appropriate amount of water. A pellet machine (FW135, Tianjin Taisite Instrument Co., Ltd., China) was used to form feed pellets (1.50 mm). Feed pellets were dried in an oven (60\\u0026deg;C) (101, Hebei Shuangxin Testing Instrument Manufacturing Co., Ltd., China), and then stored in sealed, cool and dry conditions. This resulted in five types of feeds, including 0 mg/kg GABA group, 30 mg/kg GABA group, 60 mg/kg GABA group, 90 mg/kg GABA group and 120 mg/kg GABA group.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eExperimental animals and design\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNorthern snakehead [(5.19\\u0026plusmn;0.12) g] were purchased from a farm in Linyi, Shandong, China. Fish were temporarily reared for 15 days in circulating water system at the aquaculture room of Jilin Agricultural University. Water quality parameters were as detailed below: water temperature: 23-25\\u0026deg;C, dissolved oxygen: 6.0 mg/L, ammonia nitrogen:\\u0026nbsp;\\u0026lt;0.2 mg/L, pH: 7.1\\u0026plusmn;0.1.In formal trial, 450 healthy and similarly sized fish were randomly allocated into five groups (each group has three repetitions, each repetition has 30 fish) and distributed to 15 pre-disinfected tanks. Five groups of fish were fed aforementioned five types of feeds with different levels of GABA. Fish were fed twice daily (8:20 and 17:20). Half of water was replaced every day. Water quality conditions were consistent with those during temporary rearing. During growth trial, the feeding amounts of fish were recorded. After eight weeks, fish were weighed and measured to calculate growth parameters.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eAfter the completion of growth trial, 15 fish were randomly selected from each replicate (45 fish per group), and then injected with 1.0 mg/mL LPS [\\u003cem\\u003eEscherichia coli\\u003c/em\\u003e 055: B5, Sigma-Aldrich (Shanghai) Trading Co.,Ltd, China] at anus. Specifically, 0 mg/kg GABA group was split: one half was injected with phosphate buffer saline (PBS) (PB180327, Wuhan Pricella Biotechnology Co., Ltd., China) and the other half with LPS. Thus, six groups were generated: CTL group (PBS), MOD group (1.0 mg/mL LPS), R1 group (1.0 mg/mL LPS+30 mg/kg GABA), R2 group (1.0 mg/mL LPS+60 mg/kg GABA), R3 group (1.0 mg/mL LPS+90 mg/kg GABA) and R4 group (1.0 mg/mL LPS+120 mg/kg GABA). During challenge trial, fish were kept in a fasted state. After 48 hours, fish were anesthetized for caudal vein blood collection. Blood was centrifuged at 3000 rpm/min for 10 minutes using a centrifuge (Allegra X-30, Beckman Coulter, Inc, US), and supernatant was stored in a -80\\u0026deg;C freezer (DW-86L, Haier Smart Home Co., Ltd, China). Intestinal tissues dissected at room temperature were fixed in 4% paraformaldehyde fix solution (G1101-500ML, Wuhan Servicebio Technology Co., Ltd, China) and electron microscopy fixative (G1102-100ML, Wuhan Servicebio Technology Co., Ltd, China), and stored in a refrigerator in a 4\\u0026deg;C freezer (BCD-216SDN, Haier Smart Home Co., Ltd, China). Intestinal tissues dissected on ice were rapidly frozen using liquid nitrogen, and kept in a -80\\u0026deg;C freezer.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eGrowth parameters\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFormulas were showed as follows:\\u003c/p\\u003e\\n\\u003cp\\u003eWeight gain rate (WGR) = [(W\\u003csub\\u003eF\\u003c/sub\\u003e - W\\u003csub\\u003eI\\u003c/sub\\u003e)/ W\\u003csub\\u003eI\\u003c/sub\\u003e] \\u0026times; 100%.\\u003c/p\\u003e\\n\\u003cp\\u003eSpecific growth rate (SGR) = [In W\\u003csub\\u003eF\\u003c/sub\\u003e - In W\\u003csub\\u003eI\\u003c/sub\\u003e /t] \\u0026times; 100%.\\u003c/p\\u003e\\n\\u003cp\\u003eFeed efficiency rate (FER) = [(W\\u003csub\\u003eF\\u003c/sub\\u003e - W\\u003csub\\u003eI\\u003c/sub\\u003e)/\\u0026nbsp;I] \\u0026times; 100%.\\u003c/p\\u003e\\n\\u003cp\\u003eProtein efficiency ratio (PER) = [(W\\u003csub\\u003eF\\u003c/sub\\u003e - W\\u003csub\\u003eI\\u003c/sub\\u003e)/ (I\\u0026times;C)]\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eW\\u003csub\\u003eF\\u003c/sub\\u003e: final body weight; W\\u003csub\\u003eI\\u003c/sub\\u003e:initial body weight; t: days of rearing; I: feed intake; C: protein intake.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMicroscope imaging\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eIntestinal tissue observation\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eIntestinal tissues were extracted from 4% paraformaldehyde fixative solution, and then subjected to dehydration, clearing and paraffin embedding sequentially. Subsequently, paraffin blocks were sectioned into 5 \\u0026mu;m thick slices with a microtome [RM2016, Leica Microsystems (Shanghai) Tradingco.，Ltd, China], and slices were mounted on slides. Sections underwent dewaxing and hydration, followed by hematoxylin and eosinstaining, dehydration and sealing sequentially. The images of intestinal tissue sections were obtained using an optical microscope [Nikon DS-U3, Nikon Corporation, China].\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTight junction structure observation\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eIntestinal tissues were removed from electron microscopy fixative, then fixed in osmium tetroxide solution. Subsequent steps were performed sequentially: gradient ethanol dehydration, epoxy resin embedding, ultrathin sectioning (70 nm) and uranyl acetate and lead citrate staining. The images of tight junction structures were obtained using a transmission electron microscope\\u0026nbsp;(Hitachi HT7800, Hitachi, Japan)\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e16S rRNA sequencing\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eIntestinal tissues were ground with lysis buffer at 60 Hz for sample preprocessing. DNA was isolated using OMEGA Soil DNA Kit (D5635-02, Omega Bio-Tek, Inc, USA). Amplification was performed using PCR with bacterial 16S rRNA V3-V4 region-specific primers. Primer sequence was 338F (5-barcOde+ACTCCTACGGGAGGCAGCA-3\\u0026rsquo;, 806R (5\\u0026apos;-GGACTACHVGGGTWTCTAAT-3\\u0026apos;). Target fragment was purified using UltraPure\\u0026trade; Agarose (75510-019, American Invitrogen Life Technologies Co., Ltd., USA). PCR products were measured using Quant-iT PicoGreen dsDNA Assay Kit (P7589, American Invitrogen Life Technologies Co., Ltd., USA). Sequencing work was conducted by Shanghai Personalbio Technology Co.,Ltd on Illumina MiSeq platform. Microbial diversity data analysis was conducted using GenesCloud (https://www.genescloud.cn).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTest kits determination\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eIntestinal tissues with normal saline were homogenized at A weight-to-volume ratio of 1 g per 9 mL. Homogenate was centrifuged at 4000 rpm/min for 10 minutes, and then supernatant was gathered for analysis. \\u0026alpha;-amylase (AMY) (C016-1-2), lipase (LIP) (A054-2-1) and trypsin (TRY) (A080-2-2) activities in intestine were assessed using kits from Nanjing Jiancheng Bioengineering Institute, China. The contents of cholecystokinin (CCK) (ml063878) and ghrelin (GHRL) (YJ821016) in serum and intestine were determined using kits from Shanghai Enzyme-linked Biotechnology Co., Ltd, China. The contents of interleukin-1\\u0026beta; (IL-1\\u0026beta;) (YX-091203F), tumor necrosis factor-\\u0026alpha; (TNF-\\u0026alpha;) (YX-201407F), diamine oxidase (DAO) (YX-040115F) and LPS (YX-121619F) in serum and intestine were determined using kits from Shanghai Youxuan Biotechnology Co., Ltd, China.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eGenes expression determination\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eIntestinal tissues were crushed in liquid nitrogen to prepare samples. RNA was taken out from samples according to SparkZol Reagent (AC0101, Shandong Sparkjade Biotechnology Co., Ltd., China). RNA samples were reverse transcribed into cDNA samples using SPARKscript Ⅱ All-in-one RT SuperMix for qPCR (With gDNA Eraser) (AG0305, Shandong Sparkjade Biotechnology Co., Ltd., China). qPCR was performed using 2\\u0026times;SYBR Green qPCR Mix (With ROX) (AH0104, Shandong Sparkjade Biotechnology Co., Ltd., China). Gene expression was quantified using 2\\u003csup\\u003e-\\u0026Delta;\\u0026Delta;CT\\u003c/sup\\u003e method (Livak \\u0026amp; Schmittgen 2001). Gene primer information was shown in Table 2.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData statistics and analysis\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eData was statistically assessed using SPSS 23.0. If data followed a normal distribution and variances were homogeneous, one-way ANOVA and Duncan\\u0026apos;s multiple range tests were executed. Significance test P-value was set at 0.05. Results were presented as mean \\u0026plusmn; standard error.\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eGrowth performance\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWith the increase of GABA levels in feed, the FBW, WGR, SGR, FER and PER of fish showed a gradually increasing trend. Relative to control group, all groups with added GABA showed a significant increase in the FBW, WGR and SGR of fish (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05). The inclusion of 120 mg/kg GABA in feed resulted a significant increase in fish's FER and PER (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05) (Table 3). Through establishing a quadratic regression model between GABA levels and WGR, it was found that optimum GABA requirement in feed is approximately 107.77 mg/kg (Fig. 1).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eIntestinal histopathology\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eCompared to CTL group, intestinal villi in MOD group were shortened and thickened with significant rupture, the main manifestations were extensive damage to the striated border and infiltration of inflammatory cells in lamina propria.\\u0026nbsp;Compared with MOD group, all remission groups showed improvement in intestinal damage, particularly in R3 and R4 groups (Fig. 2).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eIntestinal permeability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eIn comparison to CTL group, MOD group had significantly higher contents of DAO and LPS in intestine and serum (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05). Compared with MOD group, the intestinal contents of DAO were markedly reduced in R2, R3 and R4 groups (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05). In all remission groups, DAO contents in serum and LPS contents in intestinal and serum were significantly decreased (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05) (Fig. 3).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eBiological barrier\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eSpecies composition\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe results of species differences were shown in\\u0026nbsp;Fig. 4. The numbers of unique OTUs in CTL group, MOD group, R1 group, R2 group, R3 group and R4 group were 95, 489, 69, 72, 50 and 63, respectively. The number of shared OTUs among these six groups was six. The results of species composition were shown in Fig. 5. At phylum level, \\u003cem\\u003eProteobacteria\\u003c/em\\u003e, \\u003cem\\u003eActinobacteria\\u003c/em\\u003e and \\u003cem\\u003eFirmicutes\\u003c/em\\u003e ranked as the top three. Specifically, compared to CTL group, MOD group showed a significant decrease in the proportion of \\u003cem\\u003eProteobacteria\\u003c/em\\u003e and \\u003cem\\u003eFirmicutes\\u003c/em\\u003e, while the proportion of \\u003cem\\u003eActinobacteria\\u003c/em\\u003e significantly increases. Relative to MOD group, as GABA levels increase, the proportion of \\u003cem\\u003eProteobacteria\\u003c/em\\u003e and \\u003cem\\u003eFirmicutes\\u003c/em\\u003e gradually rose, while the proportion of \\u003cem\\u003eActinobacteria\\u003c/em\\u003e gradually decreased [Fig. 5 (A)]. At genus level, \\u003cem\\u003ePseudomonas\\u003c/em\\u003e, \\u003cem\\u003eAurantimicrobium\\u003c/em\\u003e and \\u003cem\\u003eStaphylococcus\\u003c/em\\u003e ranked as the top three. Similarly, trends in \\u003cem\\u003ePseudomonas\\u003c/em\\u003e align with those of its corresponding phylum [Fig. 5 (B)].\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAlpha diversity\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eMOD group showed a decreasing trend in Chao1, Shannon, and Simpson indices. Relative to MOD group, these indices exhibited a gradually increasing trend. The differences in Chao1, Shannon and Simpson indices among groups were not significant (\\u003cem\\u003eP\\u0026gt;\\u003c/em\\u003e0.05). (Fig. 6).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eBeta diversity\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eIn PCoA and NMDS analysis, MOD group showed a distinct separation from the other groups, while CTL group overlapped with R1 and R2 groups, respectively. There were varying degrees of overlap among all remission groups (Fig. 7).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eChemical barrier\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eDigestive enzymes results were shown in Fig. 8. The activities of AMY, LIP and TRY in intestine were significantly lower than those in CTL group (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05).\\u0026nbsp;Compared to MOD group, AMY and TRY activities in intestine were markedly increased in R2, R3 and R4 groups (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05). There was a significant increase in LIP activity in all remission groups (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eObservations gastrointestinal hormone were shown in Fig. 9. Relative to CTL group, the contents of CCK in intestine and serum were dramatically increased in MOD group (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05), while GHRL contents were dramatically decreased (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05). Compared to MOD group, intestinal CCK contents were markedly reduced in all remission groups (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05). However, the contents of CCK in serum and GHRL in intestine and serum did not show significant changes (\\u003cem\\u003eP\\u0026gt;\\u003c/em\\u003e0.05).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ePhysical barrier\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe results of tight junction structure were illustrated in Fig. 10. \\u0026nbsp;Compared to CTL group, intestinal tight junction structure in MOD group displayed noticeable fracture, and intercellular gap width was obvious increased. Compared to MOD group, all remission groups exhibited marked improvement in tight junction structures, and R3 and R4 groups showed apparent decreases in intercellular gap width.\\u003c/p\\u003e\\n\\u003cp\\u003eThe results for genes related to tight junctions were presented in Fig. 11. The expression levels of \\u003cem\\u003eclaudin-1\\u003c/em\\u003e, \\u003cem\\u003eclaudin-5,\\u003c/em\\u003e \\u003cem\\u003eoccludin\\u003c/em\\u003e and \\u003cem\\u003ezo-1\\u003c/em\\u003e in intestine of MOD group were significantly lower than those in CTL group (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05). Compared to MOD group, the intestinal expression levels of \\u003cem\\u003eclaudin-1\\u003c/em\\u003e were significantly increased in R2, R3 and R4 groups (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05).\\u0026nbsp;The expression levels of \\u003cem\\u003eclaudin-5\\u003c/em\\u003e in intestine were markedly higher in all remission groups (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05). In R3 and R4 groups, the expression levels of \\u003cem\\u003eoccludin\\u003c/em\\u003e in intestine were significantly risen (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05). Nonetheless, there were no significant changes in \\u003cem\\u003ezo-1\\u003c/em\\u003e expression (\\u003cem\\u003eP\\u0026gt;\\u003c/em\\u003e0.05).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eImmunological barrier\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe results of inflammatory factors could be seen in Fig. 12. Compared to CTL group, the contents of IL-1β and TNF-α in intestine and serum were dramatically increased in MOD group (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05). Compared to MOD group, IL-1β content in intestine and TNF-α content in serum were significantly decreased in all remission groups (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05). Serum IL-1β contents were markedly reduced in R2, R3 and R4 groups (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05). Intestinal TNF-α contents were dramatically decreased in R3 and R4 groups (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05).\\u003c/p\\u003e\\n\\u003cp\\u003eThe results of immunity-related genes were showed in Fig. 13. In comparison to CTL group, the expression levels of \\u003cem\\u003eigm\\u003c/em\\u003e, \\u003cem\\u003eigt\\u003c/em\\u003e, \\u003cem\\u003emhc-1\\u003c/em\\u003e, and\\u003cem\\u003e\\u0026nbsp;pigr\\u003c/em\\u003e in intestine were dramatically increased in MOD group (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05). Compared to MOD group, \\u003cem\\u003eigm\\u003c/em\\u003e expression level in intestine was dramatically decreased in R4 group (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05). The expression levels of \\u003cem\\u003eigt\\u003c/em\\u003e in intestine was dramatically decreased in R3 and R4 groups (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05). Additionally, the intestinal expression levels of\\u003cem\\u003e\\u0026nbsp;mhc-1\\u003c/em\\u003e and \\u003cem\\u003epigr\\u0026nbsp;\\u003c/em\\u003ewere dramatically reduced in R2, R3 and R4 groups (\\u003cem\\u003eP\\u0026lt;\\u003c/em\\u003e0.05).\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eIn the process of promoting animal growth, GABA, as an inhibitory neurotransmitter, enhances appetite by mediating central nervous responses (Chan et al. \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e, Boonstra et al. \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e). In one study on Nile tilapia (\\u003cem\\u003eOrechromis niloticus\\u003c/em\\u003e), the addition of 200\\u0026ndash;500 mg/kg GABA in feed had positive effects on WGR, SGR, average day gain (ADG), FCR and FER (Ruenkoed et al. \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). In another study, the optimal GABA level for Nile tilapia was 158 mg/kg determined based on WGR, which could effectively improve growth parameters (Temu et al. \\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). Similarly, the inclusion of 80\\u0026ndash;320 mg/kg GABA in feed dramatically improved the WGR and SGR of Chinese mitten crab (\\u003cem\\u003eEriocheir sinensis\\u003c/em\\u003e). Based on WGR and SGR, the optimal GABA levels were determined to be 89 mg/kg and 84 mg/kg, respectively (Zhang et al. \\u003cspan citationid=\\\"CR62\\\" class=\\\"CitationRef\\\"\\u003e2022a\\u003c/span\\u003e). 30\\u0026ndash;150 mg/kg GABA also could promote the growth of Jian carp (\\u003cem\\u003eCyprinus carpio var.\\u003c/em\\u003e Jian). Based on the analyses of WGR and FER, recommended GABA levels for Jian carp were estimated to be 99.01 mg/kg and 96.75 mg/kg, respectively (Chen et al. \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). In this study, adding 30\\u0026ndash;120 mg/kg GABA to feed dramatically increased the FBW, WGR and SGR of snakehead. Especially, 120 mg/kg GABA had a significant promoting effect on FER and PER. This was consistent with results described above. This indicated that GABA had a significant improving effect on the growth of snakehead. However, there was no significant effect on the FE of juvenile olive flounder (\\u003cem\\u003eParalichthys olivaceus\\u003c/em\\u003e) (Farris et al. \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e) and the PER of grass carp (\\u003cem\\u003eCtenopharyngodon idellus\\u003c/em\\u003e) (Wu et al. \\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e) from adding GABA to feed. This might be due to differences in GABA dosage, fish species and size.\\u003c/p\\u003e \\u003cp\\u003eA strong correlation existed between animal growth and intestinal health. Intestine is responsible for digestion and absorption of nutrients, immune regulation and microbial balance, all of which directly affect the growth rate and health status of animals (Chiaranunt et al. \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e, Liu et al. \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). In fish, intestine is one of targets for pathogen infection, and is particularly susceptible to bacterial invasion (Ou et al. \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e, Gao et al. \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). LPS is part of outer membrane found in cell wall of gram-negative bacteria. Excessive LPS causes intestinal damage by triggering inflammatory responses and compromising intestinal barrier (Li et al. \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). GABA enhances intestinal health by regulating enteric nervous system, and shows potential in promoting intestinal motility, exerting anti-inflammatory effects and strengthening intestinal barrier function (Chen et al. \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e, Zhang et al. \\u003cspan citationid=\\\"CR62\\\" class=\\\"CitationRef\\\"\\u003e2022a\\u003c/span\\u003e). This study first found that LPS obviously disrupted intestinal tissue structure of snakehead. This was consistent with findings from studies on common carp (\\u003cem\\u003eCyprinus carpio\\u003c/em\\u003e) (Li et al. \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e) and Taimen (\\u003cem\\u003eHucho taimen\\u003c/em\\u003e, Pallas) (Ren et al. \\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). However, the addition of GABA to feed evidently ameliorated this pathological condition. It indicated that GABA could facilitate the recovery of damaged intestinal health.\\u003c/p\\u003e \\u003cp\\u003eIntestinal structure is complex and multifunctional, primarily involving the action of intestinal epithelial cells. This is accompanied by the collaboration of microorganisms, mucus layer and immune cells, which together form the intestinal barrier to maintain the stability and health of intestinal environment (Li et al. \\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e2009\\u003c/span\\u003e). Nonetheless, when intestinal barrier is compromised, which can lead to the invasion of harmful substances, triggering inflammation and other health issues (Yu \\u0026amp; Li \\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). DAO and LPS are key parameters reflecting intestinal permeability. Low levels of DAO are unable to effectively degrade histamine in intestine, which can easily lead to an excessive accumulation of histamine, thereby compromising the integrity of intestinal barrier (Fukuda et al. \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). Increased intestinal permeability can lead to the leakage of DAO and LPS from intestinal lumen into bloodstream. In this study, LPS challenge dramatically increased DAO and LPS contents in intestine and serum. Similarly, serum DAO contents in amur ide (\\u003cem\\u003eLeuciscus waleckii\\u003c/em\\u003e) (Wang et al. \\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e) and common carp (Li et al. \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e) were significantly elevated under LPS stimulation. However, the addition of GABA to feed markedly reduced DAO and LPS contents in intestine and serum, indicating that GABA could effectively alleviate intestinal permeability in snakehead.\\u003c/p\\u003e \\u003cp\\u003eIntestinal biological barrier is composed of a rich microbiota within intestine. It acts in coordination with host to be crucial in protecting intestine from pathogen invasion (Xia et al. \\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e2024b\\u003c/span\\u003e). In this study, the number of OTUs in snakehead intestine was much higher than that in control group after LPS challenge. Although this trend was similar to results observed in amur ide, differences were not as pronounced (Wang et al. \\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). It was speculated that this might be due to intestinal dysregulation caused by LPS, allowing other normally non-dominant microbiota or exogenous opportunistic pathogens to gain space and resources for growth in intestine. After the addition of GABA to feed, the number of OTUs in each remission group was similar to that of CTL group, indicating that GABA was beneficial for improving intestinal microbiota dysregulation in snakehead. Correspondingly, species composition also showed significant changes. In this study, at phylum level, \\u003cem\\u003eProteobacteria\\u003c/em\\u003e, \\u003cem\\u003eActinobacteria\\u003c/em\\u003e and \\u003cem\\u003eFirmicutes\\u003c/em\\u003e ranked as top three. Specifically, LPS significantly reduced the proportion of \\u003cem\\u003eProteobacteria\\u003c/em\\u003e and \\u003cem\\u003eFirmicutes\\u003c/em\\u003e, while markedly increasing the proportion of \\u003cem\\u003eActinobacteria\\u003c/em\\u003e. Changes in \\u003cem\\u003eProteobacteria\\u003c/em\\u003e were consistent with studies on juvenile taimen (Ren et al. \\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e) and amur ide (Wang et al. \\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). Changes in \\u003cem\\u003eFirmicutes\\u003c/em\\u003e align with studies on turbot (\\u003cem\\u003eScophthalmus maximus\\u003c/em\\u003e L.) (Zhang et al. \\u003cspan citationid=\\\"CR61\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e) and amur ide (Wang et al. \\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). However, these studies have all found that LPS reduced the proportion of \\u003cem\\u003eActinobacteria\\u003c/em\\u003e in intestine, but since the proportion of \\u003cem\\u003eActinobacteria\\u003c/em\\u003e was relatively low, this change was not pronounced. After the exogenous supplementation of GABA, the three bacterial phyla exhibited an opposite trend, gradually approaching control group as GABA level increased. This suggested that the balance of these three bacterial phyla was crucial for promoting intestinal health and optimizing nutrient absorption in snakehead. Differences in changes among bacterial phyla typically depend on specific behaviors at genus level. \\u003cem\\u003ePseudomonas\\u003c/em\\u003e is generally considered a health risk factor that can cause intestinal infections in fish, particularly when farming environment is poor (Duman et al. \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). The trend of \\u003cem\\u003ePseudomonas\\u003c/em\\u003e in this study was consistent with that of its corresponding phylum. This suggested that the addition of GABA to feed could effectively mitigate changes in intestinal microbiota composition caused by LPS. Alpha diversity is typically measured using species richness (Chao1) and diversity indices (Shannon and Simpson indexes). In this study, no significant differences in Chao1, Shannon and Simpson indexes were observed between groups. This was similar to finding in study on amur ide (Wang et al. \\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). Nevertheless, these indices showed a decreasing trend during LPS challenge, but exhibited an increasing trend as GABA levels rose. This indicated that the addition of GABA might mitigate negative effects caused by LPS through some mechanism, thereby enhancing the diversity of intestinal microbial system. Beta diversity is used to measure dissimilarity in species composition between communities from different habitats. In this study, intestinal microbiota composition showed clear separation after LPS challenge relative to control group. This was similar to findings in studies on juvenile taimen (Ren et al. \\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e), amur ide (Wang et al. \\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e) and turbot (Zhang et al. \\u003cspan citationid=\\\"CR61\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). However, intestinal microbiota composition of groups with GABA showed varying degrees of overlap with control group, indicating that GABA could effectively mitigate changes in intestinal species composition of snakehead induced by LPS. Actually, factors such as growth environment, feed ingredients and fish species could all cause differences in intestinal microbiota (Sullam et al. \\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e2012\\u003c/span\\u003e). Long-term and in-depth monitoring was needed to better understand the impact of GABA on intestinal biological barrier.\\u003c/p\\u003e \\u003cp\\u003eIntestinal chemical barrier is composed of various chemical substances, including gastric acid, digestive enzymes, bile, mucus layer, antimicrobial peptides and immunoglobulins. These components work together to maintain the stability and health of intestinal environment by inhibiting the growth of pathogens and protecting epithelial cells of intestinal wall (Cui et al. \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). In this study, we primarily focused on s digestive enzymes activities and certain hormone levels. Intestinal digestive enzymes are enzymes secreted by intestine and other parts of digestive system. They break down large macronutrients into smaller and more easily absorbable units (Mohammadiazarm et al. \\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). AMY is responsible for breaking down complex carbohydrates like starch and glycogen into maltose and dextrin. LIP breaks down fats into fatty acids and glycerol. TRY breaks down proteins into peptides and amino acids. Current research has found that adding GABA to feed could improve intestinal health by enhancing the activity of digestive enzymes.\\u003c/p\\u003e \\u003cp\\u003eAMY and LIP activities in juvenile olive flounder fed with 150 mg/kg GABA were significantly higher than those in fish fed with other levels of feed (Farris et al. \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e). Similarly, in Nile tilapia fed with 200 mg/kg and 500 mg/kg GABA, the digestive enzyme activities of TRY, AMY and LIP were enhanced (Ruenkoed et al. \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). The addition of GABA to feed could dramatically increase the activities of AMY (320 mg/kg), LIP (640 mg/kg) and TRY (80 and 160 mg/kg), which suggested a significant improvement in the digestive abilities of Chinese mitten crab (Zhang et al. \\u003cspan citationid=\\\"CR62\\\" class=\\\"CitationRef\\\"\\u003e2022a\\u003c/span\\u003e). In this study, we also found similar results, showing that feeding GABA could effectively alleviate the inhibitory effects of LPS on intestinal digestive enzymes of snakehead. CCK and GHRL are two peptide hormones that play key roles in digestive system and energy metabolism (Schroeter et al. \\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e). In this study, LPS markedly increased CCK contents in intestine and serum, while significantly decreased GHRL contents in intestine and serum. After the addition of GABA to feed, there was some improvement in these negative effects, primarily in CCK content in intestine. However, effects in other areas were not significant. This aligned with result observed in study on Chinese mitten crab (Zhang et al. \\u003cspan citationid=\\\"CR62\\\" class=\\\"CitationRef\\\"\\u003e2022a\\u003c/span\\u003e). However, in study on grass carp, GABA didn\\u0026rsquo;t have a significant impact on CCK and GHRL contents between groups (Wu et al. \\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e). This might be related to its complex appetite regulation mechanisms, which required further investigation.\\u003c/p\\u003e \\u003cp\\u003eIntestinal physical barrier, composed of arranged intestinal epithelial cells and tight junction structures, serves as a crucial defense line protecting body from harmful external substances (Martinez et al. \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e2012\\u003c/span\\u003e). In this study, intestinal tight junction structure was visibly disrupted, and the width of intercellular spaces significantly increased after LPS challenge. However, tight junction structure in intestine of snakehead improved effectively after adding GABA to feed, with most noticeable improvement observed at 90 mg/kg and 120 mg/kg levels. This suggested that GABA helped to enhance tight junction structure between epithelial cells in intestine of snakehead, improving the integrity of intestinal barrier. Moreover, within certain concentration ranges (such as 90 mg/mL and 120 mg/mL), the protective effects of GABA were more pronounced. Tight junction proteins are crucial components in the formation of tight junction structures. Occludin is one of the first discovered tight junction proteins and serves a function in maintaining barrier function between cells and the stability of cytoskeleton (Furuse et al. \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e1993\\u003c/span\\u003e, Mariappan et al. \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e). Claudins are responsible for selectively controlling the passage of ions and small molecules between cells (Lynn et al. \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). Claudin-1 is widely present in epithelial and endothelial cells, while Claudin-5 is primarily found in endothelial cells. Claudin-1 is widely present in epithelial and endothelial cells, while Claudin-5 is primarily found in endothelial cells. Both play a crucial role in the integrity and function of intestinal physical barrier (Zhang et al. \\u003cspan citationid=\\\"CR64\\\" class=\\\"CitationRef\\\"\\u003e2022b\\u003c/span\\u003e, Zhang et al. \\u003cspan citationid=\\\"CR63\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). ZO-1 protein serves as a bridge connecting membrane proteins and cytoskeleton. They are conducive to maintain the structure and function of tight junctions through interactions with Occludin and Claudins (Suzuki \\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). In this study, LPS significantly reduced \\u003cem\\u003eclaudin-1\\u003c/em\\u003e, \\u003cem\\u003eclaudin-5\\u003c/em\\u003e, \\u003cem\\u003eoccludin\\u003c/em\\u003e and \\u003cem\\u003ezo-1\\u003c/em\\u003e expression levels. This indicated that LPS disrupted the stability and function of tight junctions. Similarly, LPS also significantly inhibited the expression levels of tight junction-related genes in turbot (Zhang et al. \\u003cspan citationid=\\\"CR61\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e), common carp (Jiang et al. \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e, Li et al. \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e), amur ide (Wang et al. \\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e) and yellow catfish (\\u003cem\\u003ePelteobagrus fulvidraco\\u003c/em\\u003e) (Liu et al. \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). Nevertheless, after the exogenous addition of GABA, the expression levels of genes related to intestinal tight junctions were dramatically restored. This indicated that GABA has a protective role in maintaining intestinal barrier function.\\u003c/p\\u003e \\u003cp\\u003eIntestinal immune barrier prevents pathogen invasion through multi-layered immune mechanisms, and is an integral part of intestinal defense system (Koboziev et al. \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e). TNF-α and IL-1β are two important pro-inflammatory cytokines in immune system. TNF-α is primarily secreted by activated macrophages, T cells and other immune cells. It amplifies the inflammatory response by promoting the production of other inflammatory cytokines, enhancing the activation and recruitment of immune cells (Revina et al. \\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). IL-1β is mainly produced by activated monocytes, macrophages and dendritic cells. In immune responses, IL-1β can influence the activation and function of T cells and B cells, thereby enhancing immune reaction (Yadav et al. \\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e2025\\u003c/span\\u003e). Research has shown that following LPS stimulation, the contents of TNF-α and IL-1β in macrophages of rainbow trout rose dramatically (Teles et al. \\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e). Furthermore, LPS significantly increased \\u003cem\\u003etnf-α\\u003c/em\\u003e and \\u003cem\\u003eil-1β\\u003c/em\\u003e expression levels in turbot (Zhang et al. \\u003cspan citationid=\\\"CR61\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e), common carp (Jiang et al. \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e), yellow catfish (Liu et al. \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e) and juvenile taimen (Ren et al. \\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). This was consistent with our findings. GABA as an immunomodulatory molecule can reduce the production of inflammatory cytokines. Studies have shown that exogenous supplementation of 200 mg/kg and 500 mg/kg GABA could dramatically inhibit \\u003cem\\u003eil-1β\\u003c/em\\u003e expression level (Ruenkoed et al. \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). Additionally, adding appropriate levels of GABA to feed significantly reduced \\u003cem\\u003etnf-α\\u003c/em\\u003e and \\u003cem\\u003eil-1β\\u003c/em\\u003e expression levels in Jian carp (Chen et al. \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). The above results suggested that GABA supplementation might have anti-inflammatory properties, which might help reduce inflammation and associated diseases. This study found that adding GABA to feed effectively reversed increase in TNF-α and IL-1β contents in intestine and serum induced by LPS. This suggested that GABA might regulate intestinal immune health in snakehead through immune mechanisms, warranting further investigation. In addition to some pro-inflammatory factors, the expression levels of certain specific immune genes also play a critical role in body's immune system. IgM is the earliest type of antibody produced in body, and generally acts as the first line of defense during the initial immune response (Wu et al. \\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e2024a\\u003c/span\\u003e). IgT is the main mucosal immune antibody in fish, involved in protecting mucosal surfaces from pathogen infections (Tang et al. \\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). pIgR is responsible for transporting polymeric immunoglobulins such as IgT and IgM across epithelial cells to reach mucosal surfaces where they exert their effects (Gurevich et al. \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2003\\u003c/span\\u003e). MHC-I is primarily responsible for presenting endogenous antigens to T cells (Yang et al. \\u003cspan citationid=\\\"CR58\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e). These parameters are sensitive to bacterial stimulation and can quickly recognize and participate in immune response. Research has found that IgM levels in intestines of carp significantly increased after LPS infection (Li et al. \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). This was consistent with our experimental results, where the injection of LPS led to increased \\u003cem\\u003eigm\\u003c/em\\u003e expression level in intestine. It is indicated that the disruption of immune barrier after LPS injection leaded to an upregulation of immune-related gene expression. However, the addition of GABA to feed significantly reduced the expression levels of \\u003cem\\u003eigm\\u003c/em\\u003e, \\u003cem\\u003eigt\\u003c/em\\u003e, \\u003cem\\u003emhc-1\\u003c/em\\u003e and \\u003cem\\u003epigr\\u003c/em\\u003e in intestine. This suggested that GABA could ease inflammatory responses by influencing the expression levels of immune-related genes in intestines of snakehead.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eSummary of research content was shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig14\\\" class=\\\"InternalRef\\\"\\u003e14\\u003c/span\\u003e. In summary, this study assessed the harmful impact of LPS on the intestine of snakehead and the role of GABA in nutritional regulation. Specifically, exogenous GABA supplementation could significantly promote growth and improve LPS-induced damage to intestinal mucosal barrier in snakehead. Concurrently, there is a dose-dependent effect of GABA on growth and intestinal barrier protection of snakehead, with an optimal supplementation range recommended at 90\\u0026ndash;120 mg/kg.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e \\u003ch2\\u003eCompeting interests\\u003c/h2\\u003e \\u003cp\\u003eAuthors declare that they have no competing interests.\\u003c/p\\u003e \\u003c/p\\u003e\\u003cp\\u003e \\u003ch2\\u003eEthics approval and consent to participate\\u003c/h2\\u003e \\u003cp\\u003e Animal procedures in this study were approved by Ethics Committee of Jilin Agricultural University (approval number: 2023 05 11 001).\\u003c/p\\u003e \\u003c/p\\u003e\\u003ch2\\u003eFunding\\u003c/h2\\u003e \\u003cp\\u003eThis research received funding from Jilin Provincial Education Department Science and Technology Research Project (JJKH20220367KJ), China Agriculture Research System Earmarked Fund (CARS-46) and National Natural Science Foundation of China (32002406).\\u003c/p\\u003e\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\u003cp\\u003eXue-qin Wu: Formal analysis, Methodology, Software, Validation, Visualization and Writing-original draft; Xu-nan Li: Conceptualization, Data curation, Formal analysis, Methodology, Software and Validation; Feng-kun Cai: Methodology; Yun-jie Lin, Xiao-tian Niu and Yan-nan Tong: Methodology and Resources; Xiu-mei Chen: Conceptualization, Data curation, Funding acquisition, Methodology, Project administration, Resources, Supervision and Writing-review and editing; Gui-qin Wang: Funding acquisition, Methodology, Project administration, Resources and Supervision.\\u003c/p\\u003e\\u003ch2\\u003eData Availability\\u003c/h2\\u003e\\u003cp\\u003eI have shared the link to my data at the attach file step.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eBoonstra E, De Kleijn R, Colzato LS, Alkemade A, Forstmann BU, Nieuwenhuis S (2015) Neurotransmitters as food supplements: the effects of GABA on brain and behavior. Frontiers in psychology 6:167121\\u003c/li\\u003e\\n\\u003cli\\u003eChan O, Paranjape SA, Horblitt A, Zhu W, Sherwin RS (2013) Lactate-induced release of GABA in the ventromedial hypothalamus contributes to counterregulatory failure in recurrent hypoglycemia and diabetes. Diabetes 62:4239-4246\\u003c/li\\u003e\\n\\u003cli\\u003eChen Q, Hu D, Wu X, Feng Y, Ni Y (2022) Dietary \\u0026gamma;-aminobutyric acid supplementation Inhibits high-fat diet-Induced hepatic steatosis via modulating gut microbiota in broilers. Microorganisms 10:1281\\u003c/li\\u003e\\n\\u003cli\\u003eChen X, Gao C, Du X, Xu H, Wang G, Zhang D (2021) Effects of dietary \\u0026gamma;‐aminobutyric acid levels on the growth, serum biochemical indexes, immune‐related signalling molecules of Jian carp. Aquaculture Research 52:1096-1105\\u003c/li\\u003e\\n\\u003cli\\u003eChen Z, Xie J, Wang B, Tang J (2014) Effect of \\u0026gamma;-aminobutyric acid on digestive enzymes, absorption function, and immune function of intestinal mucosa in heat-stressed chicken. Poultry Science 93:2490-2500\\u003c/li\\u003e\\n\\u003cli\\u003eCheng J, Zheng N, Sun X, Li S, Wang J, Zhang Y (2016) Feeding rumen-protected gamma-aminobutyric acid enhances the immune response and antioxidant status of heat-stressed lactating dairy cows. Journal of Thermal Biology 60:103-108\\u003c/li\\u003e\\n\\u003cli\\u003eChiaranunt P, Tai SL, Ngai L, Mortha A (2021) Beyond immunity: underappreciated functions of intestinal macrophages. Frontiers in immunology 12:749708\\u003c/li\\u003e\\n\\u003cli\\u003eCui Y, Wang Q, Chang R, Zhou X, Xu C (2019) Intestinal barrier function\\u0026ndash;non-alcoholic fatty liver disease interactions and possible role of gut microbiota. Journal of agricultural and food chemistry 67:2754-2762\\u003c/li\\u003e\\n\\u003cli\\u003eDong W, Ran X, He G, Hu W, Chen Y, He Y, Lin S (2024) The effect of dietary full-fat \\u003cem\\u003eHermetia illucens \\u003c/em\\u003elarvae meal on growth performance and intestine physiology in largemouth bass (\\u003cem\\u003eMicropterus salmoides\\u003c/em\\u003e). Animal Feed Science and Technology 317:116089\\u003c/li\\u003e\\n\\u003cli\\u003eDu JH, Xu MY, Wang Y, Lei Z, Yu Z, Li MY (2022) Evaluation of \\u003cem\\u003eTaraxacum mongolicum\\u003c/em\\u003e flavonoids in diets for Channa argus based on growth performance, immune responses, apoptosis and antioxidant defense system under lipopolysaccharide stress. Fish \\u0026amp; Shellfish Immunology 131:1224-1233\\u003c/li\\u003e\\n\\u003cli\\u003eDuan Y, Wang Y, Zhang J, Liu Q, Ding X (2018) Morphologic, digestive enzymes and immunological responses of intestine from \\u003cem\\u003eLitopenaeus vannamei\\u003c/em\\u003e after lipopolysaccharide injection. Journal of invertebrate pathology 153:186-194\\u003c/li\\u003e\\n\\u003cli\\u003eDuman M, Lalucat J, Burcin Saticioglu I, Mulet M, Gomila M, Altun S, Ajmi N, Garc\\u0026iacute;a-Vald\\u0026eacute;s E (2024) Description of three new Pseudomonas species isolated from aquarium fish: \\u003cem\\u003ePseudomonas auratipiscis\\u003c/em\\u003e sp. nov., \\u003cem\\u003ePseudomonas carassii\\u003c/em\\u003e sp. nov. and \\u003cem\\u003ePseudomonas ulcerans\\u003c/em\\u003e sp. nov. Systematic and Applied Microbiology 47:126552\\u003c/li\\u003e\\n\\u003cli\\u003eFarris NW, Hamidoghli A, Bae J, Won S, Choi W, Bir\\u0026oacute; J, Lee S, Bai SC (2022) Dietary supplementation with \\u0026gamma;-aminobutyric acid improves growth, digestive enzyme activity, non-specific immunity and disease resistance against \\u003cem\\u003eStreptococcus iniae\\u003c/em\\u003e in juvenile olive flounder, Paralichthys olivaceus. Animals 12:248\\u003c/li\\u003e\\n\\u003cli\\u003eFlint HJ, Scott KP, Louis P, Duncan SH (2012) The role of the gut microbiota in nutrition and health. Nature reviews Gastroenterology \\u0026amp; hepatology 9:577-589\\u003c/li\\u003e\\n\\u003cli\\u003eFukuda T, Tsukano K, Nakatsuji H, Suzuki K (2019) Plasma diamine oxidase activity decline with diarrhea severity in calves indicating systemic dysfunction related to intestinal mucosal damage. Research in veterinary science 126:127-130\\u003c/li\\u003e\\n\\u003cli\\u003eFuruse M, Hirase T, Itoh M, Nagafuchi A, Yonemura S, Tsukita S, Tsukita S (1993) Occludin: a novel integral membrane protein localizing at tight junctions. The Journal of cell biology 123:1777-1788\\u003c/li\\u003e\\n\\u003cli\\u003eGalafat A, S\\u0026aacute;ez M, Rodr\\u0026iacute;guez C, de Rojas AH, Vizca\\u0026iacute;no A, Mart\\u0026iacute;nez T, Alarc\\u0026oacute;n-L\\u0026oacute;pez F (2024) In vitro evaluation of algae and their effect as dietary ingredient on growth, chemical composition and intestinal functionality in juvenile turbot (\\u003cem\\u003eScophthalmus maximus\\u003c/em\\u003e). Aquaculture:741208\\u003c/li\\u003e\\n\\u003cli\\u003eGao JH, Zhao JL, Guo NX, Tola T, Xue WB, Cai KN, Yao XL, Hu M (2024) Hepcidin defense patterns in intestine of mandarin fish (\\u003cem\\u003eSiniperca chuatsi\\u003c/em\\u003e) against \\u003cem\\u003eAeromonas hydrophila\\u003c/em\\u003e infection. Fish \\u0026amp; Shellfish Immunology 155:110003\\u003c/li\\u003e\\n\\u003cli\\u003eGurevich P, Zusman I, Moldavsky M, Szvalb S, Elhayany A, Halperin R, Gurevich E, Ben-Hur H (2003) Secretory immune system in human intrauterine development: immunopathomorphological analysis of the role of secretory component (pIgR/SC) in immunoglobulin transport. International journal of molecular medicine 12:289-297\\u003c/li\\u003e\\n\\u003cli\\u003eJiang J, Yin L, Li JY, Li Q, Shi D, Feng L, Liu Y, Jiang WD, Wu P, Zhao Y (2017) Glutamate attenuates lipopolysaccharide-induced oxidative damage and mRNA expression changes of tight junction and defensin proteins, inflammatory and apoptosis response signaling molecules in the intestine of fish. Fish \\u0026amp; Shellfish Immunology 70:473-484\\u003c/li\\u003e\\n\\u003cli\\u003eKiela PR, Ghishan FK (2016) Physiology of intestinal absorption and secretion. Best practice \\u0026amp; research Clinical gastroenterology 30:145-159\\u003c/li\\u003e\\n\\u003cli\\u003eKoboziev I, Karlsson F, Grisham MB (2010) Gut‐associated lymphoid tissue, T cell trafficking, and chronic intestinal inflammation. Annals of the New York Academy of Sciences 1207: E86-E93\\u003c/li\\u003e\\n\\u003cli\\u003eŁątka K, Jończyk J, Bajda M (2020) \\u0026gamma;-Aminobutyric acid transporters as relevant biological target: Their function, structure, inhibitors and role in the therapy of different diseases. International journal of biological macromolecules 158:750-772\\u003c/li\\u003e\\n\\u003cli\\u003eLi J, Jiang M, Han Q, Peng R, Jiang X (2020) Effects of \\u0026gamma;‐aminobutyric acid supplementation on the growth performance, serum biochemical indices and antioxidant status of pharaoh cuttlefish, \\u003cem\\u003eSepia pharaonis\\u003c/em\\u003e. Aquaculture Nutrition 26:1026-1034\\u003c/li\\u003e\\n\\u003cli\\u003eLi L, Wei XF, Yang ZY, Zhu R, Li DL, Shang GJ, Wang HT, Meng ST, Wang YT, Liu SY (2023) Alleviative effect of poly-\\u0026beta;-hydroxybutyrate on lipopolysaccharide-induced oxidative stress, inflammation and cell apoptosis in Cyprinus carpio. International Journal of Biological Macromolecules 253:126784\\u003c/li\\u003e\\n\\u003cli\\u003eLi P, Mai K, Trushenski J, Wu G (2009) New developments in fish amino acid nutrition: towards functional and environmentally oriented aquafeeds. Amino acids 37:43-53\\u003c/li\\u003e\\n\\u003cli\\u003eLiu Y, Meng F, Wang S, Xia S, Wang R (2021) Vitamin D3 mitigates lipopolysaccharide-induced oxidative stress, tight junction damage and intestinal inflammatory response in yellow catfish, \\u003cem\\u003ePelteobagrus fulvidraco\\u003c/em\\u003e. Comparative Biochemistry and Physiology Part C: Toxicology \\u0026amp; Pharmacology 243:108982\\u003c/li\\u003e\\n\\u003cli\\u003eLiu Y, Wang J, Ding J, Zhang Y, Hou C, Shen W, Wu X, Zhu J (2024) Effects of hypoxia stress on oxidative stress, apoptosis and microorganisms in the intestine of large yellow croaker (\\u003cem\\u003eLarimichthys crocea\\u003c/em\\u003e). Aquaculture 581:740444\\u003c/li\\u003e\\n\\u003cli\\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2\\u003csup\\u003e\\u0026minus;\\u0026Delta;\\u0026Delta;CT\\u003c/sup\\u003e method. methods 25:402-408\\u003c/li\\u003e\\n\\u003cli\\u003eLynn KS, Peterson RJ, Koval M (2020) Ruffles and spikes: Control of tight junction morphology and permeability by claudins. Biochimica et Biophysica Acta (BBA)-Biomembranes 1862:183339\\u003c/li\\u003e\\n\\u003cli\\u003eMa H, Du H, Wang D, Cao Y, Liu J, Liu T, Liu T, Wang G, Wang E (2023) A subunit vaccine encoding glycoprotein holds potential to protect snakehead (Channa argus) from snakehead vesiculovirus infection. Aquaculture 577:739947\\u003c/li\\u003e\\n\\u003cli\\u003eMa JM, Yang YB, Ding H, Tan Q-Y, Song YJ, Shen HC, Ai QH, Zhao CY, Dewangan NK, Xu C (2024) \\u0026gamma;-aminobutyric acid improves the growth performance, food intake and glucose homeostasis of Micropterus salmoides fed high-carbohydrate diets. Aquaculture Reports 38:102350\\u003c/li\\u003e\\n\\u003cli\\u003eMariappan MM, Senthil D, Natarajan KS, Choudhury GG, Kasinath BS (2005) Phospholipase C\\u0026gamma;-Erk axis in vascular endothelial growth factor-induced eukaryotic initiation factor 4E phosphorylation and protein synthesis in renal epithelial cells. Journal of Biological Chemistry 280:28402-28411\\u003c/li\\u003e\\n\\u003cli\\u003eMartinez C, Gonz\\u0026aacute;lez-Castro A, Vicario M, Santos J (2012) Cellular and molecular basis of intestinal barrier dysfunction in the irritable bowel syndrome. Gut and liver 6:305\\u003c/li\\u003e\\n\\u003cli\\u003eMohammadiazarm H, Zehirikia Y, Kalantarzadeh S, Etehadi K, Salati AP, Mousavi SM, Maniat M (2023) Growth, body composition, digestive enzyme activity, blood biochemical parameters, and immune antioxidant indices of red tilapia fish (\\u003cem\\u003eOreochromis mossambicus \\u0026times; Oreochromis niloticus\\u003c/em\\u003e) reared in mixed cell and rectangular raceways. Aquaculture Reports 33:101803\\u003c/li\\u003e\\n\\u003cli\\u003eMunoz LR, Bailey MA, Krehling JT, Bourassa DV, Hauck R, Pacheco WJ, Chaves-Cordoba B, Chasteen KS, Talorico AA, Escobar C (2023) Effects of dietary yeast cell wall supplementation on growth performance, intestinal Campylobacter jejuni colonization, innate immune response, villus height, crypt depth, and slaughter characteristics of broiler chickens inoculated with Campylobacter jejuni at d 21. Poultry Science 102:102609\\u003c/li\\u003e\\n\\u003cli\\u003eOu J, Luo WS, Zhong ZR, Xie Q, Wang F, Xiong NX, Luo SW (2023) Manganese-superoxide dismutase (MnSOD) rescues redox balance and mucosal barrier function in midgut of hybrid fish (\\u003cem\\u003eCarassius cuvieri \\u003c/em\\u003e\\u003cem\\u003e♀\\u003c/em\\u003e\\u003cem\\u003e \\u003c/em\\u003e\\u003cem\\u003e\\u0026times;\\u003c/em\\u003e\\u003cem\\u003e Carassius auratus red var \\u003c/em\\u003e\\u003cem\\u003e♂\\u003c/em\\u003e) infected with \\u003cem\\u003eAeromonas hydrophila\\u003c/em\\u003e and \\u003cem\\u003eEdwardsiella tarda\\u003c/em\\u003e. Reproduction and Breeding 3:108-117\\u003c/li\\u003e\\n\\u003cli\\u003eRen G, Xu L, Lu T, Zhang Y, Wang Y, Yin J (2019) Protective effects of lentinan on lipopolysaccharide induced inflammatory response in intestine of juvenile taimen (\\u003cem\\u003eHucho taimen\\u003c/em\\u003e, Pallas). International journal of biological macromolecules 121:317-325\\u003c/li\\u003e\\n\\u003cli\\u003eRevina O, Revins V, Cīrule D, Valdovska A (2023) TNF-\\u0026Alpha;, IL-6, HSP-70, fish growth hormone, and growth performance of sea trout, Salmo trutta (Actinopterygii: Salmoniformes: Salmonidae) after long-term dietary administration of \\u0026beta;-glucan and BGN-2. ACTA ICHTHYOLOGICA ET PISCATORIA 53:253-261\\u003c/li\\u003e\\n\\u003cli\\u003eRuenkoed S, Nontasan S, Phudkliang J, Phudinsai P, Pongtanalert P, Panprommin D, Mongkolwit K, Wangkahart E (2023) Effect of dietary gamma aminobutyric acid (GABA) modulated the growth performance, immune and antioxidant capacity, digestive enzymes, intestinal histology and gene expression of Nile tilapia (\\u003cem\\u003eOreochromis niloticus\\u003c/em\\u003e). Fish \\u0026amp; Shellfish Immunology 141:109056\\u003c/li\\u003e\\n\\u003cli\\u003eSchroeter JC, Fenn CM, Small BC (2015) Elucidating the roles of gut neuropeptides on channel catfish feed intake, glycemia, and hypothalamic NPY and POMC expression. Comparative Biochemistry and Physiology Part A: Molecular \\u0026amp; Integrative Physiology 188:168-174\\u003c/li\\u003e\\n\\u003cli\\u003eSullam KE, Essinger SD, Lozupone CA, O\\u0026rsquo;CONNOR MP, Rosen GL, Knight R, Kilham SS, Russell JA (2012) Environmental and ecological factors that shape the gut bacterial communities of fish: a meta‐analysis. Molecular ecology 21:3363-3378\\u003c/li\\u003e\\n\\u003cli\\u003eSuzuki T (2013) Regulation of intestinal epithelial permeability by tight junctions. Cellular and molecular life sciences 70:631-659\\u003c/li\\u003e\\n\\u003cli\\u003eTang X, Du Y, Sheng X, Xing J, Zhan W (2018) Molecular cloning and expression analyses of immunoglobulin tau heavy chain (IgT) in turbot, Scophthalmus maximus. Veterinary immunology and immunopathology 203:1-12\\u003c/li\\u003e\\n\\u003cli\\u003eTeles M, MacKenzie S, Boltana S, Callol A, Tort L (2011) Gene expression and TNF-alpha secretion profile in rainbow trout macrophages following exposures to copper and bacterial lipopolysaccharide. Fish \\u0026amp; shellfish immunology 30:340-346\\u003c/li\\u003e\\n\\u003cli\\u003eTemu V, Kim H, Hamidoghli A, Park M, Won S, Oh M, Han JK, Bai SC (2019) Effects of dietary gamma-aminobutyric acid in juvenile Nile tilapia, Orechromis niloticus. Aquaculture 507:475-480\\u003c/li\\u003e\\n\\u003cli\\u003eTian Z, Cui Y, Lu H, Ma X (2020) Effects of long-term feeding diets supplemented with Lactobacillus reuteri 1 on growth performance, digestive and absorptive function of the small intestine in pigs. Journal of Functional Foods 71:104010\\u003c/li\\u003e\\n\\u003cli\\u003eWang W, Wang Y, Lu Y, Zhu J, Tian X, Wu B, Du J, Cai W, Xiao Y (2022) Reg4 protects against Salmonella infection-associated intestinal inflammation via adopting a calcium-dependent lectin-like domain. International Immunopharmacology 113:109310\\u003c/li\\u003e\\n\\u003cli\\u003eWang Y, Meng S, Li D, Liu S, Liang L, Wu L (2024) Dietary chlorogenic acid supplementation protects against lipopolysaccharide-induced oxidative stress, inflammation and apoptosis in intestine of amur ide (Leuciscus waleckii). Aquatic Toxicology:107223\\u003c/li\\u003e\\n\\u003cli\\u003eWu F, Liu M, Chen C, Chen J, Tan Q (2016) Effects of dietary gamma aminobutyric acid on growth performance, antioxidant status, and feeding‐related gene expression of juvenile grass carp, \\u003cem\\u003eCtenopharyngodon idellus\\u003c/em\\u003e. Journal of the World Aquaculture Society 47:820-829\\u003c/li\\u003e\\n\\u003cli\\u003eWu XQ, Chen XM, Pan YY, Sun C, Tian JX, Qian AD, Niu XT, Li M, Wang GQ (2024a) Changes of intestinal barrier in the process of intestinal inflammation induced by \\u003cem\\u003eAeromonas hydrophila\\u003c/em\\u003e in snakehead (\\u003cem\\u003eChanna argus\\u003c/em\\u003e). Fish \\u0026amp; Shellfish Immunology 152:109775\\u003c/li\\u003e\\n\\u003cli\\u003eWu XQ, Chen XM, Wan JW, Yang ZN, Tian JX, Qian AD, Wang GQ (2024b) A northern snakehead (\\u003cem\\u003eChanna argus\\u003c/em\\u003e) model of intestinal inflammation induced by \\u003cem\\u003eAeromonas hydrophila\\u003c/em\\u003e: Construction and transcriptome analysis. Aquaculture 580:740323\\u003c/li\\u003e\\n\\u003cli\\u003eXia H, Liu L, Zhou W, Ding C, Liu H, Lei T, Chen F, Liu S, Yu J, Yang P (2024a) Immune response to \\u003cem\\u003eAeromonas hydrophila\\u003c/em\\u003e and molecular characterization of polymeric immunoglobulin receptor in juvenile \\u003cem\\u003eMegalobrama amblycephala\\u003c/em\\u003e. Fish \\u0026amp; Shellfish Immunology 153:109821\\u003c/li\\u003e\\n\\u003cli\\u003eXia X, Ma X, Liang N, Qin L, Huo W, Li Y (2024b) Damage of polyethylene microplastics on the intestine multilayer barrier, blood cell immune function and the repair effect of \\u003cem\\u003eLeuconostoc mesenteroides\\u003c/em\\u003e DH in the large-scale loach (\\u003cem\\u003eParamisgurnus dabryanus\\u003c/em\\u003e). Fish \\u0026amp; Shellfish Immunology 147:109460\\u003c/li\\u003e\\n\\u003cli\\u003eXie SW, Li YT, Zhou WW, Tian LX, Li YM, Zeng SL, Liu YJ (2017) Effect of \\u0026gamma;‐aminobutyric acid supplementation on growth performance, endocrine hormone and stress tolerance of juvenile Pacific white shrimp, \\u003cem\\u003eLitopenaeus vannamei\\u003c/em\\u003e, fed low fishmeal diet. Aquaculture Nutrition 23:54-62\\u003c/li\\u003e\\n\\u003cli\\u003eYadav S, Prasannan A, Venkatachalam K, Binesh A (2025) Exploring the mechanism and crosstalk between IL-6 and IL-1\\u0026beta; on M2 macrophages under metabolic stress conditions. Cytokine 186:156852\\u003c/li\\u003e\\n\\u003cli\\u003eYan Z, Liu B, Liu J, Guo Z, Kou Y, Lu W, Sun J, Li Y (2024) Enhancing resilience to chronic ammonia stress in crucian carp (\\u003cem\\u003eCarassius carassius\\u003c/em\\u003e) through dietary gamma-aminobutyric acid (GABA) supplementation: Effects on growth performance, immune function, hepatotoxicity, and apoptosis. Aquaculture Reports 37:102259\\u003c/li\\u003e\\n\\u003cli\\u003eYang M, Wei J, Li P, Wei S, Huang Y, Qin Q (2016) MHC polymorphism and disease resistance to Singapore grouper iridovirus (SGIV) in the orange-spotted grouper, \\u003cem\\u003eEpinephelus coioides\\u003c/em\\u003e. Science Bulletin 61:693-699\\u003c/li\\u003e\\n\\u003cli\\u003eYang W, Sun H, Yan J, Kang C, Wu J, Yang B (2023) Enterohemorrhagic Escherichia coli senses microbiota-derived nicotinamide to increase its virulence and colonization in the large intestine. Cell Reports 42\\u003c/li\\u003e\\n\\u003cli\\u003eYu YB, Li YQ (2014) Enteric glial cells and their role in the intestinal epithelial barrier. World journal of gastroenterology: WJG 20:11273\\u003c/li\\u003e\\n\\u003cli\\u003eZhang B, Li C, Wang X, Liu C, Zhou H, Mai K, He G (2020) Administration of commensal Shewanella sp. MR-7 ameliorates lipopolysaccharide-induced intestine dysfunction in turbot (\\u003cem\\u003eScophthalmus maximus\\u003c/em\\u003e L.). Fish \\u0026amp; shellfish immunology 102:460-468\\u003c/li\\u003e\\n\\u003cli\\u003eZhang C, Wang X, Su R, He J, Liu S, Huang Q, Qin C, Zhang M, Qin J, Chen L (2022a) Dietary gamma-aminobutyric acid (GABA) supplementation increases food intake, influences the expression of feeding-related genes and improves digestion and growth of Chinese mitten crab (\\u003cem\\u003eEriocheir sinensis\\u003c/em\\u003e). Aquaculture 546:737332\\u003c/li\\u003e\\n\\u003cli\\u003eZhang W, Zhao G, Lin X, Li C, Zhu H, Bi R, Fang B, Xiong W, Yuan M, Wang D, Li Y (2024) Maternal supplementation with edible birds\\u0026apos; nest during gestation and lactation enhances intestinal barrier function by upregulating Claudin-1 in rat offspring. Journal of Functional Foods 116:106177\\u003c/li\\u003e\\n\\u003cli\\u003eZhang Y, Garrett S, Carroll RE, Xia Y, Sun J (2022b) Vitamin D receptor upregulates tight junction protein claudin-5 against colitis-associated tumorigenesis. Mucosal Immunology 15:683-697\\u003c/li\\u003e\\n\\u003cli\\u003eZhou H, Zhang M, Shan Q, Huang H, Zhang M, Liu S, Lin J, Ma L, Zheng G, Li L (2023) Pharmacokinetics and residue elimination of metalaxyl enantiomers in snakehead (\\u003cem\\u003eChanna argus\\u003c/em\\u003e). Aquaculture 567:739219\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"},{\"header\":\"Tables\",\"content\":\"\\u003cp\\u003eTable 1\\u0026nbsp;Basic feed composition and nutrient components\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"507\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003eIngredients and nutritional composition\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003eGroup\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e0\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e30\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e60\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e90\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e120\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003eFeed ingredient（mg/kg）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003eFish Meal\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e410\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e410\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e410\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e410\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e410\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003eCorn Protein Powder\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e260\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e260\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e260\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e260\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e260\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003eWheat Flour\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e140\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e140\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e140\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e140\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e140\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003eWheat Bran\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e50\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e50\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e50\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e50\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e50\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003eCorn Oil\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e40\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e40\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e40\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e40\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e40\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003eDextrin\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e60\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e60\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e60\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e60\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e60\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003eGABA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e0\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e30\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e60\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e90\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e120\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003e\\u003csup\\u003e1\\u003c/sup\\u003e Vitamin Premix\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e10\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e10\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e10\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e10\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e10\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003e\\u003csup\\u003e2\\u003c/sup\\u003e Mineral Premix\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e10\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e10\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e10\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e10\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e10\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003eCalcium Phosphate\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e15\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e15\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e15\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e15\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e15\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003eCholine Chloride\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003eNutrition Level (%)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003eCrude Protein\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e41.92\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e42.56\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e43.02\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e42.39\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e43.74\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003eCrude Lipid\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e7.96\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e7.51\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e7.43\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e7.96\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e8.08\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 205px;\\\"\\u003e\\n \\u003cp\\u003eCrude Ash\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e10.67\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e9.79\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e10.15\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e10.79\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 60px;\\\"\\u003e\\n \\u003cp\\u003e10.77\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003csup\\u003e1\\u003c/sup\\u003e Vitamin premix (mg/kg diet): retinyl acetate 7.2, cholecalciferol 10, thiamin nitrate 5, riboflavin 10, DL-\\u0026alpha;-tocopherol acetate 150, menadione 10, pyridoxine hydrochloride 20, cyanocobalamin 10, ascorbic acid 300, Inositol 500, folic acid 20, D-biotin 10, niacin acid 30, Ca pantothenate 30.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003csup\\u003e2\\u003c/sup\\u003e Mineral premix (mg/kg diet): MgSO\\u003csub\\u003e4\\u003c/sub\\u003e\\u003cstrong\\u003e\\u0026middot;\\u003c/strong\\u003eH\\u003csub\\u003e2\\u003c/sub\\u003eO 4000, KI 1.3, FeSO\\u003csub\\u003e4\\u0026nbsp;\\u003c/sub\\u003e\\u003cstrong\\u003e\\u0026middot;\\u003c/strong\\u003eH\\u003csub\\u003e2\\u003c/sub\\u003eO 500, CuSO\\u003csub\\u003e4\\u003c/sub\\u003e\\u0026middot;5H\\u003csub\\u003e2\\u003c/sub\\u003eO 19.2, MnSO\\u003csub\\u003e4\\u003c/sub\\u003e\\u003cstrong\\u003e\\u0026middot;\\u003c/strong\\u003eH\\u003csub\\u003e2\\u003c/sub\\u003eO 53.2, ZnSO\\u003csub\\u003e4\\u003c/sub\\u003e\\u003cstrong\\u003e\\u0026middot;\\u003c/strong\\u003eH\\u003csub\\u003e2\\u003c/sub\\u003eO 165, Na\\u003csub\\u003e2\\u003c/sub\\u003eSeO\\u003csub\\u003e3\\u0026nbsp;\\u003c/sub\\u003e25, CoCl\\u003csub\\u003e2\\u003c/sub\\u003e\\u003cstrong\\u003e\\u0026middot;\\u003c/strong\\u003e6H\\u003csub\\u003e2\\u003c/sub\\u003eO 50.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003csup\\u003e3\\u003c/sup\\u003e Nutritional level is measured value.\\u003c/p\\u003e\\n\\u003cp\\u003eTable 2\\u0026nbsp;Primer sequence information.\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 142px;\\\"\\u003e\\n \\u003cp\\u003eGenes\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eSequence (5\\u0026prime;-3\\u0026prime;)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 142px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003e\\u0026beta;-actin\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eF: GCCCTCTTCCAGCCTTCCTT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eR: AGTGTTGGCATACAGGTCTTTACGG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 142px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003ezo-1\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eF: TGGTTGTTCAGAGGGACGATAGAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eR: TCAGAGGCGTTGGCGGAAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 142px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eoccudin\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eF:\\u0026nbsp;CAAACCGCAGCACTTCTACAAATGG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eR: TCGCCACGCACAGCACAATC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 142px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eclaudin-1\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eF:\\u0026nbsp;GCTCATCGGGTTCCTCCTCTCTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eR:\\u0026nbsp;AGGTTGTTCTCTCATTGCCACTGC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 142px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eclaudin-5\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eF:\\u0026nbsp;TGTGTTGTGCTGCTCCTGTCC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eR:\\u0026nbsp;TCTGCGTGGCTCTCTTTGTCTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 142px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003emhc-1\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eF: AGTGGCTGAAGAAGTATGTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eR: AGAAACCTGTAGCGTGGC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 142px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003epigr\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eF: CTTTGCTGGTGTGTGCTTCG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eR: CTTGTCTTAACGCAGTATTCTCCTTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 142px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eigm\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eF: AGATTGATAAGACCGTGCCAGG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eR: CTTCGTAACAGATGGCTTTAGTGC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 142px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eigt\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eF: CTTTATGCTGCGTCCAGTAGAAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 331px;\\\"\\u003e\\n \\u003cp\\u003eR: GCCAAGACACATAAGCCTCCTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003eTable 3\\u0026nbsp;The effect of GABA level in feed on growth of snakehead.\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"605\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 85px;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003eItems\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd colspan=\\\"5\\\" style=\\\"width: 520px;\\\"\\u003e\\n \\u003cp\\u003eGABA\\u0026nbsp;level in feed (mg/kg)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e30\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e60\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e90\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e120\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 85px;\\\"\\u003e\\n \\u003cp\\u003eIBW/g\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e5.28\\u0026plusmn;0.13\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e5.18\\u0026plusmn;0.17\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e5.13\\u0026plusmn;0.05\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e5.15\\u0026plusmn;0.14\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e5.22\\u0026plusmn;0.08\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 85px;\\\"\\u003e\\n \\u003cp\\u003eFBW/g\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e29.44\\u0026plusmn;2.25\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e33.79\\u0026plusmn;1.69\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e34.62\\u0026plusmn;1.03\\u003csup\\u003ebc\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e36.70\\u0026plusmn;0.52\\u003csup\\u003ec\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e37.43\\u0026plusmn;1.46\\u003csup\\u003ec\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 85px;\\\"\\u003e\\n \\u003cp\\u003eWGR/%\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e457.12\\u0026plusmn;29.63\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e551.95\\u0026plusmn;25.23\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e575.37\\u0026plusmn;25.21\\u003csup\\u003ebc\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e613.46\\u0026plusmn;26.26\\u003csup\\u003ec\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e617.27\\u0026plusmn;35.32\\u003csup\\u003ec\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 85px;\\\"\\u003e\\n \\u003cp\\u003eSGR/%/day\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e3.07\\u0026plusmn;0.10\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e3.35\\u0026plusmn;0.07\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e3.41\\u0026plusmn;0.07\\u003csup\\u003ebc\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e3.51\\u0026plusmn;0.07\\u003csup\\u003ec\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e3.52\\u0026plusmn;0.09\\u003csup\\u003ec\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 85px;\\\"\\u003e\\n \\u003cp\\u003eFER/%\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e64.14\\u0026plusmn;4.36\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e64.65\\u0026plusmn;2.47\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e65.54\\u0026plusmn;2.28\\u003csup\\u003eab\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e68.60\\u0026plusmn;1.34\\u003csup\\u003eab\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e69.70\\u0026plusmn;1.75\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 85px;\\\"\\u003e\\n \\u003cp\\u003ePER/%\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e1.53\\u0026plusmn;0.10\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e1.54\\u0026plusmn;0.06\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e1.56\\u0026plusmn;0.05\\u003csup\\u003eab\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e1.63\\u0026plusmn;0.03\\u003csup\\u003eab\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 104px;\\\"\\u003e\\n \\u003cp\\u003e1.67\\u0026plusmn;0.04\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003eNote: Values represent as the means \\u0026plusmn; SEM (n=3). Different letters indicate significant differences (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05).\\u003c/p\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"\",\"identity\":\"aquaculture-international\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"10499\",\"submissionUrl\":\"https://submission.nature.com/new-submission/10499/3\",\"title\":\"Aquaculture International\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"\",\"reportingPortfolio\":\"VoR Journals\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"Gamma aminobutyric acid, Growth, Intestinal mucosal barrier, Northern snakehead, lipopolysaccharide\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6777536/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6777536/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eLipopolysaccharides (LPS) impairs intestinal barrier function by disrupting intestinal permeability. Reasonably supplementing gamma aminobutyric (GABA) or regulating its levels has a positive effect on promoting fish growth and improving intestinal health. Therefore, it is valuable to investigate the effects of GABA on snakehead growth and LPS-induced intestinal mucosal barrier damage. In this study, a model for intestinal mucosal barrier damage was created by administering 1.0 mg/mL LPS injection into anus over a period of 96 h in snakehead. Prior to LPS challenge, fish [(5.19\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.12) g] were fed with different levels of GABA (0, 30, 60, 90 and 120 mg/kg) for 56 d. Results showed that LPS induced obvious intestinal damage, while GABA effectively alleviated this phenomenon. In addition, intestinal permeability-related parameters (DAO and LPS) were dramatically increased in LPS group, while these parameters dramatically decreased in remission groups. Correspondingly, LPS altered species composition, α-diversity and β-diversity in biological barrier; digestive enzymes (AMY, LIP and TRY) and gastrointestinal hormones (CCK and GHRL) in chemical barrier; tight junction structures and tight junction-related genes (\\u003cem\\u003eclaudin-1\\u003c/em\\u003e, \\u003cem\\u003eclaudin-5\\u003c/em\\u003e, \\u003cem\\u003eoccludin\\u003c/em\\u003e and \\u003cem\\u003ezo-1\\u003c/em\\u003e) in physical barrier and inflammatory factors (IL-1β and TNF-α) and immune-related genes (\\u003cem\\u003eigm\\u003c/em\\u003e, \\u003cem\\u003eigt\\u003c/em\\u003e, \\u003cem\\u003emhc-Ⅰ\\u003c/em\\u003e and \\u003cem\\u003epigr\\u003c/em\\u003e) in immune barrier. Nevertheless, the addition of GABA to feed effectively improved LPS-induced intestinal mucosal barrier damage. Therefore, GABA positively impacted growth and LPS-induced intestinal damage in snakehead, which provided a favorable foundation for the nutritional regulation of their intestinal mucosal barrier.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Positive effects of gamma aminobutyric acid on growth and lipopolysaccharide induced intestinal mucosal barrier damage in snakehead (Channa argus)\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-06-02 17:24:35\",\"doi\":\"10.21203/rs.3.rs-6777536/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2025-06-20T06:53:30+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-06-20T03:08:29+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"57646815717090978967128063214174141090\",\"date\":\"2025-06-07T02:40:58+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-06-06T00:56:29+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"32167579573390300430796793180244292037\",\"date\":\"2025-06-04T09:39:49+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"148602216999713843254128928641824302376\",\"date\":\"2025-05-31T09:06:56+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2025-05-30T15:16:15+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2025-05-30T15:14:23+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2025-05-30T01:15:30+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Aquaculture International\",\"date\":\"2025-05-29T14:32:28+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"\",\"identity\":\"aquaculture-international\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"10499\",\"submissionUrl\":\"https://submission.nature.com/new-submission/10499/3\",\"title\":\"Aquaculture International\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"\",\"reportingPortfolio\":\"VoR Journals\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"03a13282-c989-42be-afd7-565308ccf472\",\"owner\":[],\"postedDate\":\"June 2nd, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"under-review\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-07-01T06:53:18+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-06-02 17:24:35\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6777536\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6777536\",\"identity\":\"rs-6777536\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}