{"paper_id":"107c9b29-86bb-4e36-885c-c0ce79570de4","body_text":"The role of FBXO32 in regulating the growth of esophageal cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The role of FBXO32 in regulating the growth of esophageal cancer Xian-qiang Song, Bin-bin Chen, Yong-mei Jin, Chang-yong Wang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3240325/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Purpose Esophageal cancer (EC) is a common and serious form of cancer. F-box protein 32 (FBXO32) is a member of the F-box protein family and its role in EC is still unclear. Methods FBXO32 expression was examined in EC cells using GSE163735 dataset and RT-qPCR and its effects on cell proliferation, migration, and invasion and epithelial mesenchymal transition (EMT) was investigated. The xenograft model established by injecting EC cells transfected with FBX032 was used to evaluate tumor cells growth, apoptosis, proliferation, and metastasis. ChIP assay was employed to study the interaction between FBXO32 with and DNA methyltransferase-1 (DNMT1). Finally, HitPredict, Co-IP, and GST pulldown assay was utilized to analyze the interaction between FBXO32 and CDK9. Results High FBXO32 expression was associated with better overall survival in patients. It is negatively regulated by DNMT1 in EC cells. DNMT1 bound to the FBXO32 promoter to promote its methylationand downregulation in EC cells. Knockdown of DNMT1 in these cells increased FBXO32 expression and suppressed malignant phenotypes. Mechanistically, FBXO32 ubiquitinated and degraded CDK9 (Cyclin Dependent Kinase 9) in EC cells which was prevented in FBXO32-silenced cells. Finally, EC cells overexpressed with FBXO32 inhibited tumor growth and metastasis in xenografts demonstrating its tumor suppressor role. Conclusion FBXO32 is a tumor suppressor that ubiquitinates and degrades CDK9 that results in inhibition of EC. esophageal cancer FBXO32 DNMT1 CDK9 DNA methylation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Esophageal cancer (EC) is a prevalent form of cancer that poses a significant health burden. Despite extensive research, the underlying causes and pathogenesis of EC remain incompletely understood (Uhlenhopp, Then et al. 2020, Wang, Han et al. 2021). Certain lifestyle habits, such as excessive tobacco and alcohol consumption and exposure to mold, in addition to genetic predisposition, may increase the susceptibility of EC (Huang and Yu 2018 ). Despite some improvement in available treatments, the survival rate for EC patients remains low, at approximately 20%, primarily due to the cancer's asymptomatic nature, which often leads to late-stage diagnosis with poor prognosis (Watanabe, Otake et al. 2020). The pronounced heterogeneity of EC is another factor that contributes to the persistently poor survival rate, as different patients and even distinct regions within the same tumor exhibit diverse genomic aberrations (Dulak, Stojanov et al. 2013, Junker and van Oudenaarden 2014 , Kaz, Grady et al. 2015, Li, Francies et al. 2018, Pectasides, Stachler et al. 2018). Recently, various factors, including genomic abnormalities, cytokine secretion, and epithelial-to-mesenchymal transition (EMT), have been implicated in EC metastasis (Zhang and Weinberg 2018 ). Despite some success with existing therapies, our current understanding of EC biology remains limited, presenting a major obstacle to the development of effective treatment plans (Wang, DeFina et al. 2021). Therefore, it is crucial to elucidate the regulatory mechanisms involved in EC progression. Studies have shown that tumorigenesis is associated with epigenetic modifications, with DNA methylation being the most common mechanism in cancer epigenetics, regulating processes such as stem cell differentiation, genome imprinting, and tumorigenesis (Moore, Le et al. 2013, Meng, Cao et al. 2015, Sun, Zhang et al. 2022 ). DNA methyltransferase-1 (DNMT1) is a crucial enzyme for maintaining DNA methylation, and oncogenic DNMT1-mediated DNA methylation has been observed in various cancers, including EC (Singh, Sharma et al. 2013). Depletion of DNMT1 has been shown to suppress tumorigenesis by inhibiting the self-renewal of EC stem cells (Teng, Yu et al. 2018). Additionally, DNMT1-mediated miR-124-3p silencing has been implicated in the acceleration of EC cell invasion via regulation of BCAT1 (Zeng, Zhang et al. 2019) and the DNMT1-miR-126 epigenetic pathway has been found to facilitate EC cell growth (Liu, Gu et al. 2015). However, the regulatory mechanism of DNMT1-mediated DNA methylation in EC requires further exploration. F-box protein 32 (FBXO32) is a member of the F-box protein family and is one of the four subunits of the ubiquitin E3 protein ligase complex (Habel, El-Hachem et al. 2021). Initially, it was identified for its role in muscle atrophy (Bodine, Latres et al. 2001) but recent studies have revealed its involvement in regulating cell survival and progression in various cancers. For instance, FBXO32 has been shown to participate in apoptosis induced by 3-Deazaneplanocin A (DZNep) in breast cancer cells, indicating its potential role in regulating cellular viability (Tan, Yang et al. 2007). Stitt et al. reported that the AKT (protein kinase B) signaling pathway, associated with the v-akt murine thymoma virus oncogene, suppresses FBXO32 (Stitt, Drujan et al. 2004). FBXO32 suppresses breast cancer development by degrading KLF4 (Zhou, Liu et al. 2017) and selectively targets oncogenic c-Myc for proteasomal degradation, inhibiting its activity (Mei, Zhang et al. 2015). There are also evidences that FBXO32 is usually lowly expressed in ovarian and gastric cancer due to methylation, suggesting a potential role as a tumor suppressor (Chou, Su et al. 2010, Guo, Zhang et al. 2015). However, the specific role and mechanism of FBXO32 in EC requires further investigation. The objective of this study is to explore the biological role of FBXO32 in EC and determine if its involvement in the regulation of EC is mediated by DNMT1. 2. Materials and methods 2.1 Cell culture Four EC cell lines, namely ECa-109, TE-1, TE-10, and TE-11, as well as a human esophageal epithelial cell line HET-1A, were utilized in this study. The ECa-109 cells were purchased from CCTCC (Wuhan, China), while TE-1, TE-10, and TE-11 cells were obtained from the Center for Excellence in Molecular Cell Science (Shanghai, China). HET-1A cells were purchased from ATCC (Manassas, VA, USA). All cells were cultured in RPMI-1640 supplemented with 10% FBS and incubated at 37°C with 5% CO2. 2.2 RT-qPCR To extract total RNA from the EC cells, the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used. The extracted RNA was then reverse transcribed into cDNA using the Transcriptor First Strand cDNA Synthesis kit (Takara, Japan). For quantitative PCR, the SYBR Green II (Takara) was utilized with an ABI PRISM 7900 Sequence Detector system (Applied Biosystems, USA). GAPDH was used as the endogenous control to normalize the gene expression, which was calculated using the 2 − ΔΔCt method. The primers sequences are as follow. GAPDH, Forward: TCG ACA GTC AGC CGC ATC TTC TTT. Reverse: ACC AAA TCG GTT GAC TCC GAC CTT. E-Cadherin, Forward: AAG AAG CTG GCT GAC ATG TAC GGA. Reverse: CCA CCA GCA ACG TGA TTT CTG CAT. Vimentin, Forward: AGA ACC TGC AGG AGG CAG AAG AAT. Reverse: TTC CAT TTC ACG CAT CTG GCG TT. N-Cadherin, Forward: TGT GGG AAT CCG ACG AAT GGA TGA. Reverse: TGG AGC CAC TGC CTT CAT AGT CAA. Snail, Forward: TTT CTG GTT CTG TGT CCT CTG CCT. Reverse: TGA GTC TGT CAG CCT TTG TCC TGT. 2.3 Western blot To prepare the cell lysates, RIPA buffer (Thermo Fisher Scientific, USA) with protease inhibitors was used. The proteins were separated by 10% SDS-PAGE and transferred to PVDF membranes. To block the membranes, 5% skim milk was applied, and they were then incubated with primary antibodies overnight at 4°C. After washing with TBST, the membranes were incubated with the secondary antibody for an additional 2 hours. The protein bands were detected using the ECL substrate (Advansta, Menlo Park, CA, USA) and analyzed using ImageJ (NIH). The primary antibodies used in this study are (GAPDH Santa Cruz, sc-365062, 1:100), E-Cadherin ( Santa Cruz #674A, 1 :50), N-Cadherin (Cell signaling technology Catalogue #4061, 1:1000), Snail (Cell signaling technology#3879 1:500), FBXO32 (#PA5-91959 1:20) and CDK9 (Cell Signaling technology #2316). Secondary antibodies were from cell signaling technology Anti mouse, #33416 and anti-rabbit, #5127) 2.4 Cell transfection To elucidate the functional significance of DNMT1 and FBXO32 in EC cells, we employed transfection techniques to manipulate their expression levels. For knockdown experiments, we utilized specific shRNA molecules designed to target DNMT1 (sh-DNMT1; Genechem, Shanghai, China) or FBXO32 (Santa Cruz, sc-96506), along with corresponding negative control shRNA (sh-NC). The transfections were carried out using Lipofectamine 3000 (Invitrogen), a widely adopted transfection reagent known for its high efficiency in delivering nucleic acids into cells. Target sequences of DNMT1 shRNA was shDNMT1 : 5′GGAAATACTCCGACTACATCA3′; FBXO32 was 5′GATCCGGAGCAGGAATCTTACATTTTCAAGAGAAATGTAAGATTCCCTGCTCTTTTTTGGAAA3′ and shRNA was 5′UUCUCCGAACGUGUCACGUAA3′. 2.5 CCK-8 assay A 96-well plate was used to seed cells at a density of 2 × 103 cells per well. Subsequently, 10 µl of CCK-8 solution (Dojindo, Japan) was added at 0, 24, 48, and 72 hours. After incubating for 2 hours, the optical density (OD) value at 450 nm was measured using a microplate reader (Molecular Devices, USA). 2.6 Colony formation assay Cells were cultured in a 6-well plate for 14 days. Following this, the cells were washed with PBS and fixed with 4% formaldehyde before staining with crystal violet. The number of colonies was then determined. 2.7 Transwell assay For the Transwell assay, 24-well Transwell plates with 8.0-µm-pores (Corning Costar, USA) were used. EC cells suspended in serum-free medium were added to the upper chamber, which was coated with Matrigel (BD Biosciences) for the invasion assay. The lower chamber was filled with culture medium containing 10% FBS. After 24 hours, the cells in the lower chamber were stained with 0.1% crystal violet and observed using a microscope (Olympus, Japan). 2.8 Animal experiments BALB/c nude mice (6–8 weeks old, weighing 22–25 g) were procured from the Qinhuai Medical District at the General Hospital of Eastern Theater Command. The experimental procedures were approved by the Ethics Committee of the hospital (#GH-5567HDE). ECa-109 cells stably expressing pcDNA3.1-FBXO32 or pcDNA3.1-NC were subcutaneously injected into the left dorsal flanks of the mice. Tumor volume was monitored starting from the fifth day and every five days until the 25th day. On the 25th day, the mice were sacrificed, and the tumors were extracted. To assess lung metastasis, BALB/c-nude mice were injected with 100 µL of EC109 cells (5 × 10 6 /mL) via the tail vein. After 45 days, the mice were euthanized, and their lung tissues were collected. The Xenogen imaging system (Perkin Elmer, USA) was used for analysis. 2.9 H& E staining The fixed tissues were processed by embedding them in paraffin and sectioning them into 4 µm-thick slices. These sections were passed through a series of xylene, alcohol and subsequently stained with Hematoxylin and Eosin. Finally, the slides were dehydrated using alcohol, cleared, and sealed with mounting media. The sections were observed using an Olympus microscope. 2.10 Immunohistochemistry (IHC) The tissue sections were deparaffinized with xylene and a graded ethanol series. Subsequently, the sections were incubated with antibodies against Ki67 or PCNA (Abcam, USA) overnight at 4°C, followed by incubation with IgG secondary antibodies (Abcam) for 2 h. After washing with PBS, sections were treated with streptavidin-peroxidase for 30 minutes and then incubated with DAB substrate. The sections were counterstained with hematoxylin, dehydrated, cleared, and mounted with neutral gum. Finally, the microscope was used for observation. 2.11 Methylation specific PCR (MSP) The primers used to assess methylation of the CpG islands were designed to amplify bisulfite-converted DNA from the FBXO32 promoter region. A quantity of 2 µg of bisulfite-treated DNA from cells was subjected to qPCR to determine the methylation status. The sequencing analysis was carried out at GeneTech (Shanghai) co., Ltd. To induce demethylation, cells were treated with 3 µM of 5-aza-2-deoxycytidine for 72 hours. 2.12 Coimmunoprecipitation (Co-IP) Cells were lysed using Co-IP buffer mixed with protease inhibitor from Roche, Switzerland. The lysates were incubated overnight at 4°C with gentle rotation, with either anti-FBXO32 or anti-CDK9 antibody obtained from Abcam. The antigen-antibody complexes were retrieved using protein A beads from Cell Signaling Technology, USA, and then washed with PBS. The complexes were eluted with Laemmli buffer and analyzed by western blotting. 2.13 GST-pulldown assay The purified recombinant proteins were mixed with glutathione sepharose 4B and incubated in pulldown buffer (20 mM Tris-Cl, 5 mM MgCl2, 100 mM NaCl, 1 mM DTT, 1 mM EDTA, 0.5% NP-40, and 10 µg/ml BSA pH 7.5). The beads were then washed with pulldown buffer and denatured in SDS-PAGE loading buffer. The protein complexes were analyzed by western blotting. 2.14 Ubiquitination and cycloheximide (CHX) assay The cells were transfected with ubiquitin and relevant plasmids for 48 hours. After being treated with RIPA buffer, the lysates were subjected to immunoprecipitation using antibodies (Abcam) on protein A/G beads at 4°C overnight, followed by boiling in SDS buffer. The proteins were then analyzed using western blotting. To measure CHX-chase, cells were treated with 10 µg/mL CHX and incubated for 0, 2, 4, 6, or 8 hours. The lysates were then analyzed by western blotting with anti-CDK9 (Abcam). 2.15 ChIP assay The cells were treated with 1% formaldehyde to cross-link the chromatin. Subsequently, lysis buffer was added to the cells and sonication was performed to fragment the chromatin into DNA fragments ranging from 150 to 900 bp. Anti-DNMT1 or anti-IgG (Abcam) was then added to the sonicated mixtures. The precipitated complexes were washed, and the cross-linking was reversed. The DNA was purified and extracted, followed by qPCR amplification. 2.16 Statistical analysis The data presented are the means ± standard deviation (SD) of three independent experiments. Statistical analysis was performed using GraphPad Prism 8 software, and the data were analyzed by either Student's t-test or one-way ANOVA as appropriate. A p-value of less than 0.05 was considered statistically significant. 3. Results 3.1 FBXO32 expression is regulated by DNMT1 in EC Based on our analysis of the GSE163735 dataset (adj.P.Val=0.0000378, logFC༝-5.43), we observed a significant decrease in FBXO32 expression in esophageal epithelial cells with high DNMT1 expression (Fig. 1A). To further investigate this correlation, we transfected EC cells with sh-DNMT1 plasmids, resulting in a significant decrease in DNMT1 expression (Fig. 1B). Following this, we observed a significant increase in FBXO32 expression in EC cells under sh-DNMT1 transfection, indicating a negative correlation between DNMT1 and FBXO32 (Fig. 1C). Additionally, we observed a significant downregulation of FBXO32 in ECa-109, TE-1, TE-10, and TE-11 cells compared to the normal cell line HET-1A (Fig. 1D). Finally, our analysis of GEPIA data indicated that high expression of FBXO32 is positively correlated with overall survival of patients. Overall, our findings confirm that FBXO32 expression is low in EC cells and negatively regulated by DNMT1. 3.2 FBXO32 overexpression suppresses malignant phenotype in EC cells We investigated the effect of FBXO32 function on EC cell behaviors. We transfected pcDNA3.1-FBXO32 vectors to elevate FBXO32 expression in the cells, as confirmed by Fig. 2 A. To assess the impact on cell proliferation, we conducted colony formation and CCK-8 assays, which showed a significant decrease in the number of colonies and OD value upon FBXO32 upregulation (Fig. 2 B, 2 C), indicating suppressed cell proliferation. We also performed Transwell assays to evaluate cell migration and invasion and found that FBXO32 overexpression reduced these capabilities in EC cells (Fig. 2 D, 2 E). Furthermore, we investigated the effect of FBXO32 on EMT-related genes using RT-qPCR and western blotting. The results demonstrated that FBXO32 upregulation led to elevated E-cadherin levels, and reduced levels of Vimentin, N-cadherin, and Snail in EC cells, indicating repression of the oncogenic EMT process (Fig. 2 F, 2 G). Taken together, our findings indicate that FBXO32 overexpression suppresses the malignant phenotype in EC cells. 3.3. FBXO32 overexpression inhibits tumor growth and metastasis For further validating the impact of FBXO32 overexpression in vivo , Eca-109-pcDNA3.1-FBXO32 and Eca-109-pcDNA3.1-NC cells were subcutaneously injected into mice. The volume and weight of tumors formed via Eca-109-pcDNA3.1-FBXO32 cells were markedly lower than those formed via Eca-109-pcDNA3.1-NC cells (Fig. 3 A-B). Tunnel assay indicated more apoptosis in esophagus tissues of xenografts established by injecting Eca-109 cells overexpressed with FBXO32 cells (Fig. 3 C). Additionally, the results of IHC indicated that Ki67 and PCNA levels were notably reduced by FBXO32 overexpression (Fig. 3 D). Next, the Eca-109-pcDNA3.1-FBXO32 and Eca-109-pcDNA3.1-NC cells were injected into the tail vein of mice for monitoring lung metastasis Compared with control group, FBXO32 overexpression reduced lung metastatic inflammatory infiltration (Fig. 3 E). Thus, we confirmed that FBXO32 overexpression inhibited tumor growth and metastasis of EC. Thus, we confirmed that FBXO32 overexpression inhibited tumor growth and metastasis in these mice. 3.4 DNMT1 regulates malignant phenotypes of EC cells by inhibiting FBXO32 We investigated the regulatory relationship between DNMT1 and FBXO32 in EC cells and assessed the impact on cell behavior. To achieve this, we initiated our experiment by silencing FBXO32 expression in EC cells through the transfection of sh-FBXO32 plasmids (as shown in Fig. 4 A). We then proceeded to silence DNMT1 expression in these cells, in order to observe any potential changes in the expression of FBX032 (also shown in Fig. 4 A). Our results indicate that silencing DNMT1 actually increased the expression of FBX032, suggesting that there may be some sort of interaction between these two factors. Clonogenic assays revealed that depletion of DNMT1 inhibited cell proliferation, whereas FBXO32 silencing restored the proliferative capacity of the cells, as illustrated in Fig. 4 B. We also observed a significant decrease in cell migration and invasion upon DNMT1 depletion, which was reversed by FBXO32 silencing, as depicted in Fig. 4 C and 4 D. Furthermore, we investigated the impact of DNMT1 and FBXO32 silencing on the expression of EMT-related genes at both mRNA and protein level. The results indicated that DNMT1 knockdown increased the levels of E-cadherin and decreased the levels of Vimentin, N-cadherin, and Snail. However, these effects were reversed by FBXO32 silencing, as shown in Fig. 4 E-F. Overall, our findings indicate that DNMT1 regulates EC cell proliferation, invasion, migration, and EMT process by inhibiting FBXO32. 3.5 DNMT1 targets the FBXO32 promoter and induces FBXO32 promoter methylation We next investigated the specific regulatory interaction between FBXO32 and DNMT1. Gene methylation plays a crucial role in the reduction of gene expression (Ehrlich and Lacey 2013 ). Therefore, we evaluated FBXO32 promoter methylation in EC cells. Two CpG islands (161 bp & 252bp) in the FBXO32 promoter region were identified to be methylated using the MethPrimer database ( http://www.urogene.org/methprimer/ ), (Fig. 5 A). Next, we overexpressed DNMT1 in cells by transfecting pcDNA3.1-DNMT1 (Fig. 5 B) and measured the methylation status of FBXO32 promoter in EC cell lines using methylation-specific PCR (Fig. 5 C). Results showed that both EC cell lines expressed methylation of FBXO32 genes in controls. However, no FBXO32 methylation was found in cells treated with the demethylating agent, 5-Aza‐dC, (Fig. 5 C). Furthermore, FBXO32 methylation was inhibited by the knockdown of DNMT1 and promoted by pcDNA3.1-DNMT1, suggesting that DNMT1 regulates the methylation status of FBXO32 gene (Fig. 5 C). Additionally, we observed that FBXO32 mRNA and protein levels were decreased by DNMT1 upregulation, while significantly increased by 5‐Aza‐dC treatment (Fig. 5 D-E). Finally, ChIP assay demonstrated that FBXO32 was enriched with DNMT1 but not with IgG (Fig. 5 F). Thus, the downregulation of FBXO32 in EC cells was caused by methylation modification, and DNMT1 bound to the FBXO32 promoter to promote its methylation. 3.6 FBXO32 degrades CDK9 through ubiquitination To investigate FBXO32 interacting proteins and molecular pathways, we used the HitPredict database ( http://www.hitpredict.org/ ) to predict potential interaction partners. The results identified two proteins, CDK9 (Cyclin Dependent Kinase 9) and FBXO32 (Fig. 6A). Given that CDK9 is a promising target for cancer drug development and is highly expressed in EC cells (Veeranki, Tong et al. 2019) we focused on CDK9. Western blot analysis revealed that silencing FBXO32 increased CDK9 protein levels (Fig. 6B), and co-immunoprecipitation (co-IP) assays confirmed the endogenous interaction between FBXO32 and CDK9 in both EC cell lines (Fig. 6C). In addition, a GST pulldown assay demonstrated direct interaction between FBXO32 and CDK9 (Fig. 6D). Furthermore, we conducted a ubiquitination assay and found that FBXO32 promoted the ubiquitination of CDK9 in EC cells, whereas ubiquitination was prevented in the presence of vector (Fig. 6E-F). Finally, we treated cells with cycloheximide (CHX) to measure the half-life of ubiquitinated protein. Western blot analysis revealed that in the presence of CHX, the half-life of CDK9 protein in FBXO32-silenced cells was longer than that in the control, indicating that FBXO32 knockdown alleviated the degradation of CDK9 in Eca-109 cells (Fig. 6G). Overall, our findings confirm that FBXO32 ubiquitinates CDK9 and promotes its degradation by ubiquitination. 4. Discussion EC is a type of cancer with a high incidence and mortality rate that significantly affects people's health and quality of life. Dysregulated genes have been linked to cancer development, including DNMT1, which functions as an oncogene in various tumors, including EC (Teng, Yu et al. 2018, Colebatch, Dobrovic et al. 2019). Through analysis of the GEO dataset, we found that FBXO32 expression was aberrantly low in esophageal epithelial cells with high DNMT1 expression, prompting our interest in investigating the regulatory role of FBXO32 in EC. FBXO32 belongs to the F-box protein family and has been suggested to function as a cancer suppressor in human cancers (Chou, Su et al. 2010). FBX032 has been shown to repress cell migratory and invasive capabilities in ovarian cancer (Shu, Zhang et al. 2020) and its depletion can promote breast cancer growth (Zhou, Liu et al. 2017). Consistent with this, we observed a significant downregulation of FBXO32 in EC cells and found that its overexpression notably inhibited cell proliferation, migration, and invasion. Our animal experiment results demonstrated that FBXO32 overexpression attenuated tumor growth rate and lung metastasis in EC mice, confirming its anti-tumor effect in EC. Numerous studies have confirmed the carcinogenic effects of DNMT1 in various types of cancer. DNMT1 plays a critical role in maintaining mammary and cancer stem cells, as well as promoting tumorigenesis (Pathania, Ramachandran et al. 2015). DNMT1 expression was observed to be higher in triple negative breast cancer samples and promotes its progression by facilitating cell proliferation and the EMT process (Shin, Lee et al. 2016 , Fu, Zhang et al. 2022 ). In addition, DNMT1 has been shown to promote tumor growth and cell proliferation in prostate cancer (Lee, Wang et al. 2016, Li, Li et al. 2022 ) and lung cancer by methylating the hMLH1 and hMSH2 promoter (Wu, Chen et al. 2020). DNMT1-miRNA-126 epigenetic pathway has been found to facilitate EC development via AKT signaling (Liu, Gu et al. 2015). Furthermore, DNMT1 has been shown to inhibit tumor suppressor genes and promote the development of cervical cancer (Zhang, Chen et al. 2011) highlighting its crucial role in the progression of cancer through various mechanisms. In this study, we observed a negative regulatory relationship between DNMT1 and FBXO32 in EC cells. DNA methylation is a common epigenetic mechanism in cancer development (Kulis and Esteller 2010 ). DNMTs are enzymes responsible for DNA methylation by transferring methyl groups to cytosine bases in CpG dinucleotides (Weisenberger, Lakshminarasimhan et al. 2022). Among the DNMTs, DNMT1 is the most active and can recognize hemimethylated DNA to maintain methylation patterns (Lyko 2018 ). Knockdown of DNMT1 suppressed the malignant phenotypes of EC cells and significantly increased FBXO32 expression, indicating that DNMT1 mediates the EC process by regulating FBXO32. We also identified two CpG islands in the FBXO32 promoter region that were hypermethylated in EC cells, and DNMT1 knockdown reduced FBXO32 methylation while DNMT1 overexpression increased it. These findings suggest that DNMT1 targets the FBXO32 promoter region and mediates its methylation. Previous studies have reported that DNMT1-mediated methylation of the promoter regions of BEX1 and PTEN modulated stemness and tumor growth in liver cancer and breast cancer, respectively (Liu, Wang et al. 2021 , Wang, Liang et al. 2021). These studies further support our discovery that DNMT1 can mediate FBXO32 methylation and promote the progression of EC. Protein ubiquitination is a complex modification involved in various cellular processes, and its dysregulation can lead to abnormal changes in signaling pathways in human cancers (Faktor, Pjechová et al. 2019). FBXO32, an E3 ubiquitin ligase, has been shown to target cancer-related proteins for ubiquitination (Bodine and Baehr 2014 , Mei, Zhang et al. 2015). For example, FBXO32 promotes polyubiquitination of IκBα, leading to its proteasomal degradation (Meshram, Paul et al. 2017). In addition, FBXO32 targets PHPT1 for ubiquitination to modulate lung cancer development (Zhang, Liao et al. 2022). In our study, we found that the HitPredict database identified CDK9 as an interacting protein of FBXO32 in EC cells. Cyclin Dependent Kinases (CDKs) are a family of serine/threonine kinases that play a crucial role in regulating cell cycle and transcription (Malumbres 2014 ). CDK9 is a vital transcription regulatory member of the CDK family and is considered a potential target for cancer treatment (Chou, Quigley et al. 2020). Previous research has shown that CDK9 can function as an oncogene in various malignant tumors, including endometrial cancer (Yang, Liu et al. 2021 ), glioma (Qiu, Zhao et al. 2022), pancreatic cancer (Kretz, Schaum et al. 2017), and EC (Zeng, Yang et al. 2021 ). Evidence suggests that CDK9 expression can be regulated by ubiquitination (Cojocaru, Bouchard et al. 2011, Nekhai, Petukhov et al. 2014). For instance, ubiquitin protein ligase E3 component n-recognin 5 can induce CDK9 ubiquitination (Cojocaru, Bouchard et al. 2011). Similarly, in our study, we found that depletion of FBXO32 increased CDK9 protein levels, and FBXO32 can promote CDK9 degradation by ubiquitination. In conclusion, the results of this study provide evidence that DNMT1-mediated FBXO32 promoter methylation leads to the downregulation of FBXO32 in EC. Moreover, FBXO32 was found to inhibit the malignant phenotypes and tumor growth of EC cells by ubiquitinating CDK9. These findings may contribute to the identification of potential therapeutic targets for the treatment of EC. Declarations Ethics approval The experimental procedures were approved by the Ethics Committee of the hospital (#GH-5567HDE). Funding None Authorship XQS and BBC planned and executed the experiments, analyzed the data and performed statistical analysis. YMJ and CYW are the corresponding author and designed the idea of research as well as experiments. Conflicts of interest The authors declare that they have no conflicts of interest. Data availability The datasets generated during this study are available on request. References Bodine, S. C. and L. M. Baehr (2014). \"Skeletal muscle atrophy and the E3 ubiquitin ligases MuRF1 and MAFbx/atrogin-1.\" Am J Physiol Endocrinol Metab 307 (6): E469-484. Bodine, S. C., et al. (2001). \"Identification of ubiquitin ligases required for skeletal muscle atrophy.\" Science 294 (5547): 1704-1708. Chou, J., et al. (2020). \"Transcription-Associated Cyclin-Dependent Kinases as Targets and Biomarkers for Cancer Therapy.\" Cancer Discov 10 (3): 351-370. Chou, J. L., et al. (2010). \"Promoter hypermethylation of FBXO32, a novel TGF-beta/SMAD4 target gene and tumor suppressor, is associated with poor prognosis in human ovarian cancer.\" Lab Invest 90 (3): 414-425. Cojocaru, M., et al. (2011). \"Transcription factor IIS cooperates with the E3 ligase UBR5 to ubiquitinate the CDK9 subunit of the positive transcription elongation factor B.\" J Biol Chem 286 (7): 5012-5022. Colebatch, A. J., et al. (2019). \"TERT gene: its function and dysregulation in cancer.\" J Clin Pathol 72 (4): 281-284. Dulak, A. M., et al. (2013). \"Exome and whole-genome sequencing of esophageal adenocarcinoma identifies recurrent driver events and mutational complexity.\" Nat Genet 45 (5): 478-486. Ehrlich, M. and M. Lacey (2013). \"DNA methylation and differentiation: silencing, upregulation and modulation of gene expression.\" Epigenomics 5 (5): 553-568. Faktor, J., et al. (2019). \"Protein Ubiquitination Research in Oncology.\" Klin Onkol 32 (Supplementum 3): 56-64. Fu, Y., et al. (2022). \"The DNMT1-PAS1-PH20 axis drives breast cancer growth and metastasis.\" Signal Transduct Target Ther 7 (1): 81. Guo, W., et al. (2015). \"FBXO32, a new TGF-β/Smad signaling pathway target gene, is epigenetically inactivated in gastric cardia adenocarcinoma.\" Neoplasma 62 (4): 646-657. Habel, N., et al. (2021). \"FBXO32 links ubiquitination to epigenetic reprograming of melanoma cells.\" Cell Death Differ 28 (6): 1837-1848. Huang, F. L. and S. J. Yu (2018). \"Esophageal cancer: Risk factors, genetic association, and treatment.\" Asian J Surg 41 (3): 210-215. Junker, J. P. and A. van Oudenaarden (2014). \"Every cell is special: genome-wide studies add a new dimension to single-cell biology.\" Cell 157 (1): 8-11. Kaz, A. M., et al. (2015). \"Genetic and Epigenetic Alterations in Barrett's Esophagus and Esophageal Adenocarcinoma.\" Gastroenterol Clin North Am 44 (2): 473-489. Kretz, A. L., et al. (2017). \"CDK9 is a prognostic marker and therapeutic target in pancreatic cancer.\" Tumour Biol 39 (2): 1010428317694304. Kulis, M. and M. Esteller (2010). \"DNA methylation and cancer.\" Adv Genet 70 : 27-56. Lee, E., et al. (2016). \"DNMT1 Regulates Epithelial-Mesenchymal Transition and Cancer Stem Cells, Which Promotes Prostate Cancer Metastasis.\" Neoplasia 18 (9): 553-566. Li, X., et al. (2018). \"Organoid cultures recapitulate esophageal adenocarcinoma heterogeneity providing a model for clonality studies and precision therapeutics.\" Nat Commun 9 (1): 2983. Li, Z., et al. (2022). \"DNMT1-mediated epigenetic silencing of TRAF6 promotes prostate cancer tumorigenesis and metastasis by enhancing EZH2 stability.\" Oncogene 41 (33): 3991-4002. Liu, R., et al. (2015). \"DNMT1-microRNA126 epigenetic circuit contributes to esophageal squamous cell carcinoma growth via ADAM9-EGFR-AKT signaling.\" Clin Cancer Res 21 (4): 854-863. Liu, T., et al. (2021). \"Piwi-interacting RNA-651 promotes cell proliferation and migration and inhibits apoptosis in breast cancer by facilitating DNMT1-mediated PTEN promoter methylation.\" Cell Cycle 20 (16): 1603-1616. Lyko, F. (2018). \"The DNA methyltransferase family: a versatile toolkit for epigenetic regulation.\" Nat Rev Genet 19 (2): 81-92. Malumbres, M. (2014). \"Cyclin-dependent kinases.\" Genome Biol 15 (6): 122. Mei, Z., et al. (2015). \"FBXO32 Targets c-Myc for Proteasomal Degradation and Inhibits c-Myc Activity.\" J Biol Chem 290 (26): 16202-16214. Meng, H., et al. (2015). \"DNA methylation, its mediators and genome integrity.\" Int J Biol Sci 11 (5): 604-617. Meshram, S. N., et al. (2017). \"FBXO32 activates NF-κB through IκBα degradation in inflammatory and genotoxic stress.\" Int J Biochem Cell Biol 92 : 134-140. Moore, L. D., et al. (2013). \"DNA methylation and its basic function.\" Neuropsychopharmacology 38 (1): 23-38. Nekhai, S., et al. (2014). \"Regulation of CDK9 activity by phosphorylation and dephosphorylation.\" Biomed Res Int 2014 : 964964. Pathania, R., et al. (2015). \"DNMT1 is essential for mammary and cancer stem cell maintenance and tumorigenesis.\" Nat Commun 6 : 6910. Pectasides, E., et al. (2018). \"Genomic Heterogeneity as a Barrier to Precision Medicine in Gastroesophageal Adenocarcinoma.\" Cancer Discov 8 (1): 37-48. Qiu, Z., et al. (2022). \"Transcription Elongation Machinery Is a Druggable Dependency and Potentiates Immunotherapy in Glioblastoma Stem Cells.\" Cancer Discov 12 (2): 502-521. Shin, E., et al. (2016). \"Differential expression of the epigenetic methylation-related protein DNMT1 by breast cancer molecular subtype and stromal histology.\" J Transl Med 14 : 87. Shu, Y., et al. (2020). \"LINC00494 Promotes Ovarian Cancer Development and Progression by Modulating NFκB1 and FBXO32.\" Front Oncol 10 : 541410. Singh, V., et al. (2013). \"DNA methyltransferase-1 inhibitors as epigenetic therapy for cancer.\" Curr Cancer Drug Targets 13 (4): 379-399. Stitt, T. N., et al. (2004). \"The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors.\" Mol Cell 14 (3): 395-403. Sun, L., et al. (2022). \"Metabolic reprogramming and epigenetic modifications on the path to cancer.\" Protein Cell 13 (12): 877-919. Tan, J., et al. (2007). \"Pharmacologic disruption of Polycomb-repressive complex 2-mediated gene repression selectively induces apoptosis in cancer cells.\" Genes Dev 21 (9): 1050-1063. Teng, Y., et al. (2018). \"DNMT1 ablation suppresses tumorigenesis by inhibiting the self-renewal of esophageal cancer stem cells.\" Oncotarget 9 (27): 18896-18907. Uhlenhopp, D. J., et al. (2020). \"Epidemiology of esophageal cancer: update in global trends, etiology and risk factors.\" Clin J Gastroenterol 13 (6): 1010-1021. Veeranki, O. L., et al. (2019). \"Targeting cyclin-dependent kinase 9 by a novel inhibitor enhances radiosensitization and identifies Axl as a novel downstream target in esophageal adenocarcinoma.\" Oncotarget 10 (45): 4703-4718. Wang, H., et al. (2021). \"DNA methylation markers in esophageal cancer: an emerging tool for cancer surveillance and treatment.\" Am J Cancer Res 11 (11): 5644-5658. Wang, L., et al. (2021). \"Targeting the Microenvironment in Esophageal Cancer.\" Front Cell Dev Biol 9 : 684966. Wang, Q., et al. (2021). \"DNMT1-mediated methylation of BEX1 regulates stemness and tumorigenicity in liver cancer.\" J Hepatol 75 (5): 1142-1153. Watanabe, M., et al. (2020). \"Recent progress in multidisciplinary treatment for patients with esophageal cancer.\" Surg Today 50 (1): 12-20. Weisenberger, D. J., et al. (2022). \"The Role of DNA Methylation and DNA Methyltransferases in Cancer.\" Adv Exp Med Biol 1389 : 317-348. Wu, X. Y., et al. (2020). \"DNMT1 promotes cell proliferation via methylating hMLH1 and hMSH2 promoters in EGFR-mutated non-small cell lung cancer.\" J Biochem 168 (2): 151-157. Yang, W., et al. (2021). \"Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B.\" Open Life Sci 16 (1): 1341-1346. Zeng, B., et al. (2019). \"The role of DNMT1/hsa-miR-124-3p/BCAT1 pathway in regulating growth and invasion of esophageal squamous cell carcinoma.\" BMC Cancer 19 (1): 609. Zeng, H., et al. (2021). \"Transcriptional inhibition by CDK7/9 inhibitor SNS-032 suppresses tumor growth and metastasis in esophageal squamous cell carcinoma.\" Cell Death Dis 12 (11): 1048. Zhang, N., et al. (2022). \"FBXO32 targets PHPT1 for ubiquitination to regulate the growth of EGFR mutant lung cancer.\" Cell Oncol (Dordr) 45 (2): 293-307. Zhang, Y., et al. (2011). \"Effects of DNMT1 silencing on malignant phenotype and methylated gene expression in cervical cancer cells.\" J Exp Clin Cancer Res 30 (1): 98. Zhang, Y. and R. A. Weinberg (2018). \"Epithelial-to-mesenchymal transition in cancer: complexity and opportunities.\" Front Med 12 (4): 361-373. Zhou, H., et al. (2017). \"FBXO32 suppresses breast cancer tumorigenesis through targeting KLF4 to proteasomal degradation.\" Oncogene 36 (23): 3312-3321. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3240325\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":224498554,\"identity\":\"56c859cc-2fe6-44c5-a0f9-b76aefa54b3f\",\"order_by\":0,\"name\":\"Xian-qiang Song\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"General Hospital of Eastern Theater Command\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xian-qiang\",\"middleName\":\"\",\"lastName\":\"Song\",\"suffix\":\"\"},{\"id\":224498556,\"identity\":\"f789a111-803d-46a0-913f-ba63468dc435\",\"order_by\":1,\"name\":\"Bin-bin Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"General Hospital of Eastern Theater Command\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Bin-bin\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":224498558,\"identity\":\"e9f3b8cc-7477-4ee8-9570-f451fa40db5a\",\"order_by\":2,\"name\":\"Yong-mei Jin\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"General Hospital of Eastern Theater Command\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yong-mei\",\"middleName\":\"\",\"lastName\":\"Jin\",\"suffix\":\"\"},{\"id\":224498559,\"identity\":\"cbec1812-0524-40db-9de8-14822d892832\",\"order_by\":3,\"name\":\"Chang-yong Wang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYBACNv7mAwckDGzk+NmbDz5IqKghrIVP4ljiAYuKNGPJnmPJBg/OHCOsRY4hx/hAxZlDiRtm+JhJPmxhJsJhDMcSDtxsO5C4QYLHrCKxgY2Bv707Ab8W5uYDB2e23THeLt1WdiNxhwyDxJmzGwjacliy7ZnszjmHt91IPMPGYCCRS0hLjsHhv22HGTfcSDArSGxjJk7LAYkzhxU33EgxYyBOiwTQ+xLQQJZIOHOMh6Bf5PubD3+AReXHHxU1cvztvfi1YAAe0pSPglEwCkbBKMAKAADbVSodyhEkAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"General Hospital of Eastern Theater Command\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Chang-yong\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2023-08-07 02:14:16\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3240325/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3240325/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":41375310,\"identity\":\"8df54bff-5649-4ff4-8146-3576e95004df\",\"added_by\":\"auto\",\"created_at\":\"2023-08-10 14:43:02\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":199289,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cem\\u003e\\u003cstrong\\u003eFBXO32 expression is regulated by DNMT1 in EC\\u003c/strong\\u003e\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e(A) FBXO32 expression in esophageal epithelial cells with high DNMT1 expression was predicted by the GSE163735 dataset. (B) RT-qPCR results of the transfection efficiency of sh-DNMT1 plasmids in ECa-109 and TE-1 cells. (C) RT-qPCR results of FBXO32 expression in cells transfected with sh-DNMT1 or sh-NC. (D) RT-qPCR results of FBXO32 expression in EC cell lines (ECa-109, TE-1, TE-10, and TE-11) and normal cell line HET-1A. (E) FBXO32 expression correlates with patients survival. **P\\u0026lt;0.01, ***P\\u0026lt;0.001.\\u003c/em\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3240325/v1/dc2dba4cf62f9632de1fdf48.png\"},{\"id\":41375316,\"identity\":\"496ffcc9-389b-4475-ba86-a3b135e63c77\",\"added_by\":\"auto\",\"created_at\":\"2023-08-10 14:43:02\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":699802,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cem\\u003e\\u003cstrong\\u003eFBXO32 overexpression suppresses malignant phenotype in EC cells\\u003c/strong\\u003e\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e(A) RT-qPCR was performed to determine the transfection efficiency of pcDNA3.1-FBXO32 vectors in ECa-109 and TE-1 cells. (B, C) Cell proliferation was evaluated using colony formation and CCK-8 assays. (D-E) Transwell assays were conducted to assess the migratory and invasive capabilities of cells transfected with either pcDNA3.1-NC or pcDNA3.1-FBXO32. (F-G) RT-qPCR and Western blotting were used to determine the levels of E-cadherin, Vimentin, N-cadherin, and Snail in cells of different groups. The significance of the results was indicated by **P\\u0026lt;0.01 and ***P\\u0026lt;0.001.\\u003c/em\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3240325/v1/9ee5e4091d0d3bba954ff441.png\"},{\"id\":41376217,\"identity\":\"732be889-ac6f-468a-862e-24009c8feddd\",\"added_by\":\"auto\",\"created_at\":\"2023-08-10 14:51:02\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":535847,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eFBXO32 overexpression inhibits tumor growth and metastasis of EC\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e(A-B). The tumor volume and weight of mice were measured to evaluate the effect of FBXO32 overexpression on tumor growth. (C) Tunnel assay was used to investigate the apoptosis in esophagus tissues of xenografts. (D) IHC assay was used to assess Ki67 and PCNA expression in tumor tissues. (E) H\\u0026amp;E staining was performed to detect lung metastasis in nude mice.\\u003c/em\\u003e **P\\u0026lt;0.01, ***P\\u0026lt;0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3240325/v1/8d60f72f8f6d577b07fc05d3.png\"},{\"id\":41375312,\"identity\":\"2a3a4964-b29b-463f-b4c7-d5648518e0dd\",\"added_by\":\"auto\",\"created_at\":\"2023-08-10 14:43:02\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1593511,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cem\\u003e\\u003cstrong\\u003eDNMT1 regulates malignant phenotypes of EC cells by inhibiting FBXO32\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cem\\u003e (A) RT-qPCR results showing the transfection efficiency of sh-FBXO32 in EC cells.\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e(B-D) Clonogenic assay was performed to determine cell proliferative capability in the sh-NC group, the sh-DNMT1 group, and the sh-DNMT1+sh-FBXO32 group. (E-G) RT-qPCR and western blot results showing the levels of E-cadherin, Vimentin, N-cadherin, and Snail in these groups of cells. * P\\u0026lt;0.05, **P\\u0026lt;0.01, ***P\\u0026lt;0.001.\\u003c/em\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3240325/v1/26e3e36eee963fe0c6ddea93.png\"},{\"id\":41375313,\"identity\":\"a5a7d214-1b77-430e-b040-ec4ba44058e9\",\"added_by\":\"auto\",\"created_at\":\"2023-08-10 14:43:02\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":304106,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cem\\u003e\\u003cstrong\\u003eDNMT1 regulates FBXO32 promoter methylation.\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cem\\u003e (A) Prediction of CpG islands in FBXO32 promoter region using MethPrimer database. (B) RT-qPCR results showing the transfection efficiency of pcDNA3.1-DNMT1 in EC cells. (C) Methylation-specific PCR (MSP) analysis to determine the methylation status of FBXO32 promoter in EC cells treated with 5‐Aza‐dC or transfected with sh-NC, sh-DNMT1, pcDNA3.1, or pcDNA3.1-DNMT1. ((D-E) RT-qPCR and western blot results showing the expression levels of FBXO32 in EC cells treated with 5‐Aza‐dC and pcDNA3.1-DNMT1. (F) ChIP assay to detect the interaction of DNMT1 with FBXO32 promoter. ***P\\u0026lt;0.001.\\u003c/em\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3240325/v1/0c17a2b684b7cd1ac8d4c6fb.png\"},{\"id\":41375311,\"identity\":\"3a749bf2-a5cc-47dd-8c23-a6b9c7e7cf50\",\"added_by\":\"auto\",\"created_at\":\"2023-08-10 14:43:02\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":272747,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cem\\u003e\\u003cstrong\\u003eFBXO32 promotes CDK9 degradation through the ubiquitination pathway.\\u003c/strong\\u003e\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e(A) The HitPredict database was used to predict the interacting proteins of FBXO32. (B) Western blot analysis of CDK9 protein levels in cells transfected with either sh-NC or sh-FBXO32. (C-D) Co-immunoprecipitation and GST pulldown assays were performed to confirm the endogenous and direct interactions between FBXO32 and CDK9. (E-F) Immunoprecipitation-western blot assay was used to detect the effects of FBXO32 on the ubiquitination and degradation of CDK9. (G) The protein half-life of CDK9 was determined in cells treated with cycloheximide (CHX).\\u003c/em\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3240325/v1/1b2e3cb7349c3ad927cb3762.png\"},{\"id\":42961559,\"identity\":\"30b3c0df-193c-4246-adb1-38f2fad911bd\",\"added_by\":\"auto\",\"created_at\":\"2023-09-11 20:07:21\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":3041664,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3240325/v1/9fbf1c35-bf42-4a51-8028-3eb3a8446275.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"The role of FBXO32 in regulating the growth of esophageal cancer\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003eEsophageal cancer (EC) is a prevalent form of cancer that poses a significant health burden. Despite extensive research, the underlying causes and pathogenesis of EC remain incompletely understood (Uhlenhopp, Then et al. 2020, Wang, Han et al. 2021). Certain lifestyle habits, such as excessive tobacco and alcohol consumption and exposure to mold, in addition to genetic predisposition, may increase the susceptibility of EC (Huang and Yu \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). Despite some improvement in available treatments, the survival rate for EC patients remains low, at approximately 20%, primarily due to the cancer's asymptomatic nature, which often leads to late-stage diagnosis with poor prognosis (Watanabe, Otake et al. 2020). The pronounced heterogeneity of EC is another factor that contributes to the persistently poor survival rate, as different patients and even distinct regions within the same tumor exhibit diverse genomic aberrations (Dulak, Stojanov et al. 2013, Junker and van Oudenaarden \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e, Kaz, Grady et al. 2015, Li, Francies et al. 2018, Pectasides, Stachler et al. 2018). Recently, various factors, including genomic abnormalities, cytokine secretion, and epithelial-to-mesenchymal transition (EMT), have been implicated in EC metastasis (Zhang and Weinberg \\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). Despite some success with existing therapies, our current understanding of EC biology remains limited, presenting a major obstacle to the development of effective treatment plans (Wang, DeFina et al. 2021). Therefore, it is crucial to elucidate the regulatory mechanisms involved in EC progression.\\u003c/p\\u003e \\u003cp\\u003eStudies have shown that tumorigenesis is associated with epigenetic modifications, with DNA methylation being the most common mechanism in cancer epigenetics, regulating processes such as stem cell differentiation, genome imprinting, and tumorigenesis (Moore, Le et al. 2013, Meng, Cao et al. 2015, Sun, Zhang et al. \\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e). DNA methyltransferase-1 (DNMT1) is a crucial enzyme for maintaining DNA methylation, and oncogenic DNMT1-mediated DNA methylation has been observed in various cancers, including EC (Singh, Sharma et al. 2013). Depletion of DNMT1 has been shown to suppress tumorigenesis by inhibiting the self-renewal of EC stem cells (Teng, Yu et al. 2018). Additionally, DNMT1-mediated miR-124-3p silencing has been implicated in the acceleration of EC cell invasion via regulation of BCAT1 (Zeng, Zhang et al. 2019) and the DNMT1-miR-126 epigenetic pathway has been found to facilitate EC cell growth (Liu, Gu et al. 2015). However, the regulatory mechanism of DNMT1-mediated DNA methylation in EC requires further exploration.\\u003c/p\\u003e \\u003cp\\u003eF-box protein 32 (FBXO32) is a member of the F-box protein family and is one of the four subunits of the ubiquitin E3 protein ligase complex (Habel, El-Hachem et al. 2021). Initially, it was identified for its role in muscle atrophy (Bodine, Latres et al. 2001) but recent studies have revealed its involvement in regulating cell survival and progression in various cancers. For instance, FBXO32 has been shown to participate in apoptosis induced by 3-Deazaneplanocin A (DZNep) in breast cancer cells, indicating its potential role in regulating cellular viability (Tan, Yang et al. 2007). Stitt et al. reported that the AKT (protein kinase B) signaling pathway, associated with the v-akt murine thymoma virus oncogene, suppresses FBXO32 (Stitt, Drujan et al. 2004). FBXO32 suppresses breast cancer development by degrading KLF4 (Zhou, Liu et al. 2017) and selectively targets oncogenic c-Myc for proteasomal degradation, inhibiting its activity (Mei, Zhang et al. 2015). There are also evidences that FBXO32 is usually lowly expressed in ovarian and gastric cancer due to methylation, suggesting a potential role as a tumor suppressor (Chou, Su et al. 2010, Guo, Zhang et al. 2015). However, the specific role and mechanism of FBXO32 in EC requires further investigation. The objective of this study is to explore the biological role of FBXO32 in EC and determine if its involvement in the regulation of EC is mediated by DNMT1.\\u003c/p\\u003e\"},{\"header\":\"2. Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1 Cell culture\\u003c/h2\\u003e \\u003cp\\u003eFour EC cell lines, namely ECa-109, TE-1, TE-10, and TE-11, as well as a human esophageal epithelial cell line HET-1A, were utilized in this study. The ECa-109 cells were purchased from CCTCC (Wuhan, China), while TE-1, TE-10, and TE-11 cells were obtained from the Center for Excellence in Molecular Cell Science (Shanghai, China). HET-1A cells were purchased from ATCC (Manassas, VA, USA). All cells were cultured in RPMI-1640 supplemented with 10% FBS and incubated at 37\\u0026deg;C with 5% CO2.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2 RT-qPCR\\u003c/h2\\u003e \\u003cp\\u003eTo extract total RNA from the EC cells, the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used. The extracted RNA was then reverse transcribed into cDNA using the Transcriptor First Strand cDNA Synthesis kit (Takara, Japan). For quantitative PCR, the SYBR Green II (Takara) was utilized with an ABI PRISM 7900 Sequence Detector system (Applied Biosystems, USA). GAPDH was used as the endogenous control to normalize the gene expression, which was calculated using the 2\\u0026thinsp;\\u0026minus;\\u0026thinsp;\\u003csup\\u003eΔΔCt\\u003c/sup\\u003e method. The primers sequences are as follow. GAPDH, Forward: TCG ACA GTC AGC CGC ATC TTC TTT. Reverse: ACC AAA TCG GTT GAC TCC GAC CTT. E-Cadherin, Forward: AAG AAG CTG GCT GAC ATG TAC GGA. Reverse: CCA CCA GCA ACG TGA TTT CTG CAT. Vimentin, Forward: AGA ACC TGC AGG AGG CAG AAG AAT. Reverse: TTC CAT TTC ACG CAT CTG GCG TT. N-Cadherin, Forward: TGT GGG AAT CCG ACG AAT GGA TGA. Reverse: TGG AGC CAC TGC CTT CAT AGT CAA. Snail, Forward: TTT CTG GTT CTG TGT CCT CTG CCT. Reverse: TGA GTC TGT CAG CCT TTG TCC TGT.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3 Western blot\\u003c/h2\\u003e \\u003cp\\u003eTo prepare the cell lysates, RIPA buffer (Thermo Fisher Scientific, USA) with protease inhibitors was used. The proteins were separated by 10% SDS-PAGE and transferred to PVDF membranes. To block the membranes, 5% skim milk was applied, and they were then incubated with primary antibodies overnight at 4\\u0026deg;C. After washing with TBST, the membranes were incubated with the secondary antibody for an additional 2 hours. The protein bands were detected using the ECL substrate (Advansta, Menlo Park, CA, USA) and analyzed using ImageJ (NIH). The primary antibodies used in this study are (GAPDH Santa Cruz, sc-365062, 1:100), E-Cadherin ( Santa Cruz #674A, 1 :50), N-Cadherin (Cell signaling technology Catalogue #4061, 1:1000), Snail (Cell signaling technology#3879 1:500), FBXO32 (#PA5-91959 1:20) and CDK9 (Cell Signaling technology #2316). Secondary antibodies were from cell signaling technology Anti mouse, #33416 and anti-rabbit, #5127)\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4 Cell transfection\\u003c/h2\\u003e \\u003cp\\u003eTo elucidate the functional significance of DNMT1 and FBXO32 in EC cells, we employed transfection techniques to manipulate their expression levels. For knockdown experiments, we utilized specific shRNA molecules designed to target DNMT1 (sh-DNMT1; Genechem, Shanghai, China) or FBXO32 (Santa Cruz, sc-96506), along with corresponding negative control shRNA (sh-NC). The transfections were carried out using Lipofectamine 3000 (Invitrogen), a widely adopted transfection reagent known for its high efficiency in delivering nucleic acids into cells. Target sequences of DNMT1 shRNA was shDNMT1 : 5\\u0026prime;GGAAATACTCCGACTACATCA3\\u0026prime;; FBXO32 was 5\\u0026prime;GATCCGGAGCAGGAATCTTACATTTTCAAGAGAAATGTAAGATTCCCTGCTCTTTTTTGGAAA3\\u0026prime; and shRNA was 5\\u0026prime;UUCUCCGAACGUGUCACGUAA3\\u0026prime;.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5 CCK-8 assay\\u003c/h2\\u003e \\u003cp\\u003eA 96-well plate was used to seed cells at a density of 2 \\u0026times; 103 cells per well. Subsequently, 10 \\u0026micro;l of CCK-8 solution (Dojindo, Japan) was added at 0, 24, 48, and 72 hours. After incubating for 2 hours, the optical density (OD) value at 450 nm was measured using a microplate reader (Molecular Devices, USA).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.6 Colony formation assay\\u003c/h2\\u003e \\u003cp\\u003eCells were cultured in a 6-well plate for 14 days. Following this, the cells were washed with PBS and fixed with 4% formaldehyde before staining with crystal violet. The number of colonies was then determined.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.7 Transwell assay\\u003c/h2\\u003e \\u003cp\\u003eFor the Transwell assay, 24-well Transwell plates with 8.0-\\u0026micro;m-pores (Corning Costar, USA) were used. EC cells suspended in serum-free medium were added to the upper chamber, which was coated with Matrigel (BD Biosciences) for the invasion assay. The lower chamber was filled with culture medium containing 10% FBS. After 24 hours, the cells in the lower chamber were stained with 0.1% crystal violet and observed using a microscope (Olympus, Japan).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.8 Animal experiments\\u003c/h2\\u003e \\u003cp\\u003eBALB/c nude mice (6\\u0026ndash;8 weeks old, weighing 22\\u0026ndash;25 g) were procured from the Qinhuai Medical District at the General Hospital of Eastern Theater Command. The experimental procedures were approved by the Ethics Committee of the hospital (#GH-5567HDE). ECa-109 cells stably expressing pcDNA3.1-FBXO32 or pcDNA3.1-NC were subcutaneously injected into the left dorsal flanks of the mice. Tumor volume was monitored starting from the fifth day and every five days until the 25th day. On the 25th day, the mice were sacrificed, and the tumors were extracted. To assess lung metastasis, BALB/c-nude mice were injected with 100 \\u0026micro;L of EC109 cells (5 \\u0026times; 10\\u003csup\\u003e6\\u003c/sup\\u003e/mL) via the tail vein. After 45 days, the mice were euthanized, and their lung tissues were collected. The Xenogen imaging system (Perkin Elmer, USA) was used for analysis.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.9 H\\u0026amp; E staining\\u003c/h2\\u003e \\u003cp\\u003eThe fixed tissues were processed by embedding them in paraffin and sectioning them into 4 \\u0026micro;m-thick slices. These sections were passed through a series of xylene, alcohol and subsequently stained with Hematoxylin and Eosin. Finally, the slides were dehydrated using alcohol, cleared, and sealed with mounting media. The sections were observed using an Olympus microscope.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.10 Immunohistochemistry (IHC)\\u003c/h2\\u003e \\u003cp\\u003eThe tissue sections were deparaffinized with xylene and a graded ethanol series. Subsequently, the sections were incubated with antibodies against Ki67 or PCNA (Abcam, USA) overnight at 4\\u0026deg;C, followed by incubation with IgG secondary antibodies (Abcam) for 2 h. After washing with PBS, sections were treated with streptavidin-peroxidase for 30 minutes and then incubated with DAB substrate. The sections were counterstained with hematoxylin, dehydrated, cleared, and mounted with neutral gum. Finally, the microscope was used for observation.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.11 Methylation specific PCR (MSP)\\u003c/h2\\u003e \\u003cp\\u003eThe primers used to assess methylation of the CpG islands were designed to amplify bisulfite-converted DNA from the FBXO32 promoter region. A quantity of 2 \\u0026micro;g of bisulfite-treated DNA from cells was subjected to qPCR to determine the methylation status. The sequencing analysis was carried out at GeneTech (Shanghai) co., Ltd. To induce demethylation, cells were treated with 3 \\u0026micro;M of 5-aza-2-deoxycytidine for 72 hours.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.12 Coimmunoprecipitation (Co-IP)\\u003c/h2\\u003e \\u003cp\\u003eCells were lysed using Co-IP buffer mixed with protease inhibitor from Roche, Switzerland. The lysates were incubated overnight at 4\\u0026deg;C with gentle rotation, with either anti-FBXO32 or anti-CDK9 antibody obtained from Abcam. The antigen-antibody complexes were retrieved using protein A beads from Cell Signaling Technology, USA, and then washed with PBS. The complexes were eluted with Laemmli buffer and analyzed by western blotting.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.13 GST-pulldown assay\\u003c/h2\\u003e \\u003cp\\u003eThe purified recombinant proteins were mixed with glutathione sepharose 4B and incubated in pulldown buffer (20 mM Tris-Cl, 5 mM MgCl2, 100 mM NaCl, 1 mM DTT, 1 mM EDTA, 0.5% NP-40, and 10 \\u0026micro;g/ml BSA pH 7.5). The beads were then washed with pulldown buffer and denatured in SDS-PAGE loading buffer. The protein complexes were analyzed by western blotting.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.14 Ubiquitination and cycloheximide (CHX) assay\\u003c/h2\\u003e \\u003cp\\u003eThe cells were transfected with ubiquitin and relevant plasmids for 48 hours. After being treated with RIPA buffer, the lysates were subjected to immunoprecipitation using antibodies (Abcam) on protein A/G beads at 4\\u0026deg;C overnight, followed by boiling in SDS buffer. The proteins were then analyzed using western blotting.\\u003c/p\\u003e \\u003cp\\u003eTo measure CHX-chase, cells were treated with 10 \\u0026micro;g/mL CHX and incubated for 0, 2, 4, 6, or 8 hours. The lysates were then analyzed by western blotting with anti-CDK9 (Abcam).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.15 ChIP assay\\u003c/h2\\u003e \\u003cp\\u003eThe cells were treated with 1% formaldehyde to cross-link the chromatin. Subsequently, lysis buffer was added to the cells and sonication was performed to fragment the chromatin into DNA fragments ranging from 150 to 900 bp. Anti-DNMT1 or anti-IgG (Abcam) was then added to the sonicated mixtures. The precipitated complexes were washed, and the cross-linking was reversed. The DNA was purified and extracted, followed by qPCR amplification.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.16 Statistical analysis\\u003c/h2\\u003e \\u003cp\\u003eThe data presented are the means\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation (SD) of three independent experiments. Statistical analysis was performed using GraphPad Prism 8 software, and the data were analyzed by either Student's t-test or one-way ANOVA as appropriate. A p-value of less than 0.05 was considered statistically significant.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e3.1 FBXO32 expression is regulated by DNMT1 in EC\\u003c/h2\\u003e\\n \\u003cp\\u003eBased on our analysis of the GSE163735 dataset (adj.P.Val=0.0000378, logFC༝-5.43), we observed a significant decrease in FBXO32 expression in esophageal epithelial cells with high DNMT1 expression (Fig. 1A). To further investigate this correlation, we transfected EC cells with sh-DNMT1 plasmids, resulting in a significant decrease in DNMT1 expression (Fig. 1B). Following this, we observed a significant increase in FBXO32 expression in EC cells under sh-DNMT1 transfection, indicating a negative correlation between DNMT1 and FBXO32 (Fig. 1C). Additionally, we observed a significant downregulation of FBXO32 in ECa-109, TE-1, TE-10, and TE-11 cells compared to the normal cell line HET-1A (Fig. 1D). Finally, our analysis of GEPIA data indicated that high expression of FBXO32 is positively correlated with overall survival of patients. Overall, our findings confirm that FBXO32 expression is low in EC cells and negatively regulated by DNMT1.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e3.2 FBXO32 overexpression suppresses malignant phenotype in EC cells\\u003c/h2\\u003e\\n \\u003cp\\u003eWe investigated the effect of FBXO32 function on EC cell behaviors. We transfected pcDNA3.1-FBXO32 vectors to elevate FBXO32 expression in the cells, as confirmed by Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA. To assess the impact on cell proliferation, we conducted colony formation and CCK-8 assays, which showed a significant decrease in the number of colonies and OD value upon FBXO32 upregulation (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB, \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC), indicating suppressed cell proliferation. We also performed Transwell assays to evaluate cell migration and invasion and found that FBXO32 overexpression reduced these capabilities in EC cells (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD, \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE).\\u003c/p\\u003e\\n \\u003cp\\u003eFurthermore, we investigated the effect of FBXO32 on EMT-related genes using RT-qPCR and western blotting. The results demonstrated that FBXO32 upregulation led to elevated E-cadherin levels, and reduced levels of Vimentin, N-cadherin, and Snail in EC cells, indicating repression of the oncogenic EMT process (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eF, \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eG). Taken together, our findings indicate that FBXO32 overexpression suppresses the malignant phenotype in EC cells.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec22\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e3.3. FBXO32 overexpression inhibits tumor growth and metastasis\\u003c/h2\\u003e\\n \\u003cp\\u003eFor further validating the impact of FBXO32 overexpression \\u003cem\\u003ein vivo\\u003c/em\\u003e, Eca-109-pcDNA3.1-FBXO32 and Eca-109-pcDNA3.1-NC cells were subcutaneously injected into mice. The volume and weight of tumors formed via Eca-109-pcDNA3.1-FBXO32 cells were markedly lower than those formed via Eca-109-pcDNA3.1-NC cells (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA-B). Tunnel assay indicated more apoptosis in esophagus tissues of xenografts established by injecting Eca-109 cells overexpressed with FBXO32 cells (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC). Additionally, the results of IHC indicated that Ki67 and PCNA levels were notably reduced by FBXO32 overexpression (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). Next, the Eca-109-pcDNA3.1-FBXO32 and Eca-109-pcDNA3.1-NC cells were injected into the tail vein of mice for monitoring lung metastasis Compared with control group, FBXO32 overexpression reduced lung metastatic inflammatory infiltration (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eE). Thus, we confirmed that FBXO32 overexpression inhibited tumor growth and metastasis of EC. Thus, we confirmed that FBXO32 overexpression inhibited tumor growth and metastasis in these mice.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec23\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e3.4 DNMT1 regulates malignant phenotypes of EC cells by inhibiting FBXO32\\u003c/h2\\u003e\\n \\u003cp\\u003eWe investigated the regulatory relationship between DNMT1 and FBXO32 in EC cells and assessed the impact on cell behavior. To achieve this, we initiated our experiment by silencing FBXO32 expression in EC cells through the transfection of sh-FBXO32 plasmids (as shown in Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA). We then proceeded to silence DNMT1 expression in these cells, in order to observe any potential changes in the expression of FBX032 (also shown in Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA). Our results indicate that silencing DNMT1 actually increased the expression of FBX032, suggesting that there may be some sort of interaction between these two factors.\\u003c/p\\u003e\\n \\u003cp\\u003eClonogenic assays revealed that depletion of DNMT1 inhibited cell proliferation, whereas FBXO32 silencing restored the proliferative capacity of the cells, as illustrated in Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB. We also observed a significant decrease in cell migration and invasion upon DNMT1 depletion, which was reversed by FBXO32 silencing, as depicted in Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC and \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eD. Furthermore, we investigated the impact of DNMT1 and FBXO32 silencing on the expression of EMT-related genes at both mRNA and protein level. The results indicated that DNMT1 knockdown increased the levels of E-cadherin and decreased the levels of Vimentin, N-cadherin, and Snail. However, these effects were reversed by FBXO32 silencing, as shown in Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eE-F.\\u003c/p\\u003e\\n \\u003cp\\u003eOverall, our findings indicate that DNMT1 regulates EC cell proliferation, invasion, migration, and EMT process by inhibiting FBXO32.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec24\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e3.5 DNMT1 targets the FBXO32 promoter and induces FBXO32 promoter methylation\\u003c/h2\\u003e\\n \\u003cp\\u003eWe next investigated the specific regulatory interaction between FBXO32 and DNMT1. Gene methylation plays a crucial role in the reduction of gene expression (Ehrlich and Lacey \\u003cspan class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). Therefore, we evaluated FBXO32 promoter methylation in EC cells. Two CpG islands (161 bp \\u0026amp; 252bp) in the FBXO32 promoter region were identified to be methylated using the MethPrimer database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.urogene.org/methprimer/\\u003c/span\\u003e\\u003c/span\\u003e), (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA). Next, we overexpressed DNMT1 in cells by transfecting pcDNA3.1-DNMT1 (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB) and measured the methylation status of FBXO32 promoter in EC cell lines using methylation-specific PCR (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC). Results showed that both EC cell lines expressed methylation of FBXO32 genes in controls. However, no FBXO32 methylation was found in cells treated with the demethylating agent, 5-Aza‐dC, (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC). Furthermore, FBXO32 methylation was inhibited by the knockdown of DNMT1 and promoted by pcDNA3.1-DNMT1, suggesting that DNMT1 regulates the methylation status of FBXO32 gene (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC). Additionally, we observed that FBXO32 mRNA and protein levels were decreased by DNMT1 upregulation, while significantly increased by 5‐Aza‐dC treatment (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eD-E). Finally, ChIP assay demonstrated that FBXO32 was enriched with DNMT1 but not with IgG (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eF). Thus, the downregulation of FBXO32 in EC cells was caused by methylation modification, and DNMT1 bound to the FBXO32 promoter to promote its methylation.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec25\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e3.6 FBXO32 degrades CDK9 through ubiquitination\\u003c/h2\\u003e\\n \\u003cp\\u003eTo investigate FBXO32 interacting proteins and molecular pathways, we used the HitPredict database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.hitpredict.org/\\u003c/span\\u003e\\u003c/span\\u003e) to predict potential interaction partners. The results identified two proteins, CDK9 (Cyclin Dependent Kinase 9) and FBXO32 (Fig. 6A). Given that CDK9 is a promising target for cancer drug development and is highly expressed in EC cells (Veeranki, Tong et al. 2019) we focused on CDK9. Western blot analysis revealed that silencing FBXO32 increased CDK9 protein levels (Fig. 6B), and co-immunoprecipitation (co-IP) assays confirmed the endogenous interaction between FBXO32 and CDK9 in both EC cell lines (Fig. 6C). In addition, a GST pulldown assay demonstrated direct interaction between FBXO32 and CDK9 (Fig. 6D). Furthermore, we conducted a ubiquitination assay and found that FBXO32 promoted the ubiquitination of CDK9 in EC cells, whereas ubiquitination was prevented in the presence of vector (Fig. 6E-F). Finally, we treated cells with cycloheximide (CHX) to measure the half-life of ubiquitinated protein. Western blot analysis revealed that in the presence of CHX, the half-life of CDK9 protein in FBXO32-silenced cells was longer than that in the control, indicating that FBXO32 knockdown alleviated the degradation of CDK9 in Eca-109 cells (Fig. 6G). Overall, our findings confirm that FBXO32 ubiquitinates CDK9 and promotes its degradation by ubiquitination.\\u003c/p\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"4. Discussion\",\"content\":\"\\u003cp\\u003eEC is a type of cancer with a high incidence and mortality rate that significantly affects people's health and quality of life. Dysregulated genes have been linked to cancer development, including DNMT1, which functions as an oncogene in various tumors, including EC (Teng, Yu et al. 2018, Colebatch, Dobrovic et al. 2019). Through analysis of the GEO dataset, we found that FBXO32 expression was aberrantly low in esophageal epithelial cells with high DNMT1 expression, prompting our interest in investigating the regulatory role of FBXO32 in EC. FBXO32 belongs to the F-box protein family and has been suggested to function as a cancer suppressor in human cancers (Chou, Su et al. 2010). FBX032 has been shown to repress cell migratory and invasive capabilities in ovarian cancer (Shu, Zhang et al. 2020) and its depletion can promote breast cancer growth (Zhou, Liu et al. 2017). Consistent with this, we observed a significant downregulation of FBXO32 in EC cells and found that its overexpression notably inhibited cell proliferation, migration, and invasion. Our animal experiment results demonstrated that FBXO32 overexpression attenuated tumor growth rate and lung metastasis in EC mice, confirming its anti-tumor effect in EC.\\u003c/p\\u003e \\u003cp\\u003eNumerous studies have confirmed the carcinogenic effects of DNMT1 in various types of cancer. DNMT1 plays a critical role in maintaining mammary and cancer stem cells, as well as promoting tumorigenesis (Pathania, Ramachandran et al. 2015). DNMT1 expression was observed to be higher in triple negative breast cancer samples and promotes its progression by facilitating cell proliferation and the EMT process (Shin, Lee et al. \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e, Fu, Zhang et al. \\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e). In addition, DNMT1 has been shown to promote tumor growth and cell proliferation in prostate cancer (Lee, Wang et al. 2016, Li, Li et al. \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e) and lung cancer by methylating the hMLH1 and hMSH2 promoter (Wu, Chen et al. 2020). DNMT1-miRNA-126 epigenetic pathway has been found to facilitate EC development via AKT signaling (Liu, Gu et al. 2015). Furthermore, DNMT1 has been shown to inhibit tumor suppressor genes and promote the development of cervical cancer (Zhang, Chen et al. 2011) highlighting its crucial role in the progression of cancer through various mechanisms.\\u003c/p\\u003e \\u003cp\\u003eIn this study, we observed a negative regulatory relationship between DNMT1 and FBXO32 in EC cells. DNA methylation is a common epigenetic mechanism in cancer development (Kulis and Esteller \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e). DNMTs are enzymes responsible for DNA methylation by transferring methyl groups to cytosine bases in CpG dinucleotides (Weisenberger, Lakshminarasimhan et al. 2022). Among the DNMTs, DNMT1 is the most active and can recognize hemimethylated DNA to maintain methylation patterns (Lyko \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). Knockdown of DNMT1 suppressed the malignant phenotypes of EC cells and significantly increased FBXO32 expression, indicating that DNMT1 mediates the EC process by regulating FBXO32. We also identified two CpG islands in the FBXO32 promoter region that were hypermethylated in EC cells, and DNMT1 knockdown reduced FBXO32 methylation while DNMT1 overexpression increased it. These findings suggest that DNMT1 targets the FBXO32 promoter region and mediates its methylation. Previous studies have reported that DNMT1-mediated methylation of the promoter regions of BEX1 and PTEN modulated stemness and tumor growth in liver cancer and breast cancer, respectively (Liu, Wang et al. \\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e, Wang, Liang et al. 2021). These studies further support our discovery that DNMT1 can mediate FBXO32 methylation and promote the progression of EC.\\u003c/p\\u003e \\u003cp\\u003eProtein ubiquitination is a complex modification involved in various cellular processes, and its dysregulation can lead to abnormal changes in signaling pathways in human cancers (Faktor, Pjechov\\u0026aacute; et al. 2019). FBXO32, an E3 ubiquitin ligase, has been shown to target cancer-related proteins for ubiquitination (Bodine and Baehr \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e, Mei, Zhang et al. 2015). For example, FBXO32 promotes polyubiquitination of IκBα, leading to its proteasomal degradation (Meshram, Paul et al. 2017). In addition, FBXO32 targets PHPT1 for ubiquitination to modulate lung cancer development (Zhang, Liao et al. 2022). In our study, we found that the HitPredict database identified CDK9 as an interacting protein of FBXO32 in EC cells. Cyclin Dependent Kinases (CDKs) are a family of serine/threonine kinases that play a crucial role in regulating cell cycle and transcription (Malumbres \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). CDK9 is a vital transcription regulatory member of the CDK family and is considered a potential target for cancer treatment (Chou, Quigley et al. 2020). Previous research has shown that CDK9 can function as an oncogene in various malignant tumors, including endometrial cancer (Yang, Liu et al. \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e), glioma (Qiu, Zhao et al. 2022), pancreatic cancer (Kretz, Schaum et al. 2017), and EC (Zeng, Yang et al. \\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). Evidence suggests that CDK9 expression can be regulated by ubiquitination (Cojocaru, Bouchard et al. 2011, Nekhai, Petukhov et al. 2014). For instance, ubiquitin protein ligase E3 component n-recognin 5 can induce CDK9 ubiquitination (Cojocaru, Bouchard et al. 2011). Similarly, in our study, we found that depletion of FBXO32 increased CDK9 protein levels, and FBXO32 can promote CDK9 degradation by ubiquitination.\\u003c/p\\u003e \\u003cp\\u003eIn conclusion, the results of this study provide evidence that DNMT1-mediated FBXO32 promoter methylation leads to the downregulation of FBXO32 in EC. Moreover, FBXO32 was found to inhibit the malignant phenotypes and tumor growth of EC cells by ubiquitinating CDK9. These findings may contribute to the identification of potential therapeutic targets for the treatment of EC.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe experimental procedures were approved by the Ethics Committee of the hospital (#GH-5567HDE).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNone\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthorship\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eXQS and BBC\\u0026nbsp;planned and executed the experiments, analyzed the data and performed statistical analysis. YMJ and CYW\\u0026nbsp;are the corresponding author and designed the idea of research as well as experiments.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflicts of interest\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no conflicts of interest.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe datasets generated during this study are available on request.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eBodine, S. C. and L. M. Baehr (2014). \\u0026quot;Skeletal muscle atrophy and the E3 ubiquitin ligases MuRF1 and MAFbx/atrogin-1.\\u0026quot; \\u003cu\\u003eAm J Physiol Endocrinol Metab\\u003c/u\\u003e \\u003cstrong\\u003e307\\u003c/strong\\u003e(6): E469-484.\\u003c/li\\u003e\\n\\u003cli\\u003eBodine, S. C., et al. (2001). \\u0026quot;Identification of ubiquitin ligases required for skeletal muscle atrophy.\\u0026quot; \\u003cu\\u003eScience\\u003c/u\\u003e \\u003cstrong\\u003e294\\u003c/strong\\u003e(5547): 1704-1708.\\u003c/li\\u003e\\n\\u003cli\\u003eChou, J., et al. (2020). \\u0026quot;Transcription-Associated Cyclin-Dependent Kinases as Targets and Biomarkers for Cancer Therapy.\\u0026quot; \\u003cu\\u003eCancer Discov\\u003c/u\\u003e \\u003cstrong\\u003e10\\u003c/strong\\u003e(3): 351-370.\\u003c/li\\u003e\\n\\u003cli\\u003eChou, J. L., et al. (2010). \\u0026quot;Promoter hypermethylation of FBXO32, a novel TGF-beta/SMAD4 target gene and tumor suppressor, is associated with poor prognosis in human ovarian cancer.\\u0026quot; \\u003cu\\u003eLab Invest\\u003c/u\\u003e \\u003cstrong\\u003e90\\u003c/strong\\u003e(3): 414-425.\\u003c/li\\u003e\\n\\u003cli\\u003eCojocaru, M., et al. (2011). \\u0026quot;Transcription factor IIS cooperates with the E3 ligase UBR5 to ubiquitinate the CDK9 subunit of the positive transcription elongation factor B.\\u0026quot; \\u003cu\\u003eJ Biol Chem\\u003c/u\\u003e \\u003cstrong\\u003e286\\u003c/strong\\u003e(7): 5012-5022.\\u003c/li\\u003e\\n\\u003cli\\u003eColebatch, A. J., et al. (2019). \\u0026quot;TERT gene: its function and dysregulation in cancer.\\u0026quot; \\u003cu\\u003eJ Clin Pathol\\u003c/u\\u003e \\u003cstrong\\u003e72\\u003c/strong\\u003e(4): 281-284.\\u003c/li\\u003e\\n\\u003cli\\u003eDulak, A. M., et al. (2013). \\u0026quot;Exome and whole-genome sequencing of esophageal adenocarcinoma identifies recurrent driver events and mutational complexity.\\u0026quot; \\u003cu\\u003eNat Genet\\u003c/u\\u003e \\u003cstrong\\u003e45\\u003c/strong\\u003e(5): 478-486.\\u003c/li\\u003e\\n\\u003cli\\u003eEhrlich, M. and M. Lacey (2013). \\u0026quot;DNA methylation and differentiation: silencing, upregulation and modulation of gene expression.\\u0026quot; \\u003cu\\u003eEpigenomics\\u003c/u\\u003e \\u003cstrong\\u003e5\\u003c/strong\\u003e(5): 553-568.\\u003c/li\\u003e\\n\\u003cli\\u003eFaktor, J., et al. (2019). \\u0026quot;Protein Ubiquitination Research in Oncology.\\u0026quot; \\u003cu\\u003eKlin Onkol\\u003c/u\\u003e \\u003cstrong\\u003e32\\u003c/strong\\u003e(Supplementum 3): 56-64.\\u003c/li\\u003e\\n\\u003cli\\u003eFu, Y., et al. (2022). \\u0026quot;The DNMT1-PAS1-PH20 axis drives breast cancer growth and metastasis.\\u0026quot; \\u003cu\\u003eSignal Transduct Target Ther\\u003c/u\\u003e \\u003cstrong\\u003e7\\u003c/strong\\u003e(1): 81.\\u003c/li\\u003e\\n\\u003cli\\u003eGuo, W., et al. (2015). \\u0026quot;FBXO32, a new TGF-\\u0026beta;/Smad signaling pathway target gene, is epigenetically inactivated in gastric cardia adenocarcinoma.\\u0026quot; \\u003cu\\u003eNeoplasma\\u003c/u\\u003e \\u003cstrong\\u003e62\\u003c/strong\\u003e(4): 646-657.\\u003c/li\\u003e\\n\\u003cli\\u003eHabel, N., et al. (2021). \\u0026quot;FBXO32 links ubiquitination to epigenetic reprograming of melanoma cells.\\u0026quot; \\u003cu\\u003eCell Death Differ\\u003c/u\\u003e \\u003cstrong\\u003e28\\u003c/strong\\u003e(6): 1837-1848.\\u003c/li\\u003e\\n\\u003cli\\u003eHuang, F. L. and S. J. Yu (2018). \\u0026quot;Esophageal cancer: Risk factors, genetic association, and treatment.\\u0026quot; \\u003cu\\u003eAsian J Surg\\u003c/u\\u003e \\u003cstrong\\u003e41\\u003c/strong\\u003e(3): 210-215.\\u003c/li\\u003e\\n\\u003cli\\u003eJunker, J. P. and A. van Oudenaarden (2014). \\u0026quot;Every cell is special: genome-wide studies add a new dimension to single-cell biology.\\u0026quot; \\u003cu\\u003eCell\\u003c/u\\u003e \\u003cstrong\\u003e157\\u003c/strong\\u003e(1): 8-11.\\u003c/li\\u003e\\n\\u003cli\\u003eKaz, A. M., et al. (2015). \\u0026quot;Genetic and Epigenetic Alterations in Barrett\\u0026apos;s Esophagus and Esophageal Adenocarcinoma.\\u0026quot; \\u003cu\\u003eGastroenterol Clin North Am\\u003c/u\\u003e \\u003cstrong\\u003e44\\u003c/strong\\u003e(2): 473-489.\\u003c/li\\u003e\\n\\u003cli\\u003eKretz, A. L., et al. (2017). \\u0026quot;CDK9 is a prognostic marker and therapeutic target in pancreatic cancer.\\u0026quot; \\u003cu\\u003eTumour Biol\\u003c/u\\u003e \\u003cstrong\\u003e39\\u003c/strong\\u003e(2): 1010428317694304.\\u003c/li\\u003e\\n\\u003cli\\u003eKulis, M. and M. Esteller (2010). \\u0026quot;DNA methylation and cancer.\\u0026quot; \\u003cu\\u003eAdv Genet\\u003c/u\\u003e \\u003cstrong\\u003e70\\u003c/strong\\u003e: 27-56.\\u003c/li\\u003e\\n\\u003cli\\u003eLee, E., et al. (2016). \\u0026quot;DNMT1 Regulates Epithelial-Mesenchymal Transition and Cancer Stem Cells, Which Promotes Prostate Cancer Metastasis.\\u0026quot; \\u003cu\\u003eNeoplasia\\u003c/u\\u003e \\u003cstrong\\u003e18\\u003c/strong\\u003e(9): 553-566.\\u003c/li\\u003e\\n\\u003cli\\u003eLi, X., et al. (2018). \\u0026quot;Organoid cultures recapitulate esophageal adenocarcinoma heterogeneity providing a model for clonality studies and precision therapeutics.\\u0026quot; \\u003cu\\u003eNat Commun\\u003c/u\\u003e \\u003cstrong\\u003e9\\u003c/strong\\u003e(1): 2983.\\u003c/li\\u003e\\n\\u003cli\\u003eLi, Z., et al. (2022). \\u0026quot;DNMT1-mediated epigenetic silencing of TRAF6 promotes prostate cancer tumorigenesis and metastasis by enhancing EZH2 stability.\\u0026quot; \\u003cu\\u003eOncogene\\u003c/u\\u003e \\u003cstrong\\u003e41\\u003c/strong\\u003e(33): 3991-4002.\\u003c/li\\u003e\\n\\u003cli\\u003eLiu, R., et al. (2015). \\u0026quot;DNMT1-microRNA126 epigenetic circuit contributes to esophageal squamous cell carcinoma growth via ADAM9-EGFR-AKT signaling.\\u0026quot; \\u003cu\\u003eClin Cancer Res\\u003c/u\\u003e \\u003cstrong\\u003e21\\u003c/strong\\u003e(4): 854-863.\\u003c/li\\u003e\\n\\u003cli\\u003eLiu, T., et al. (2021). \\u0026quot;Piwi-interacting RNA-651 promotes cell proliferation and migration and inhibits apoptosis in breast cancer by facilitating DNMT1-mediated PTEN promoter methylation.\\u0026quot; \\u003cu\\u003eCell Cycle\\u003c/u\\u003e \\u003cstrong\\u003e20\\u003c/strong\\u003e(16): 1603-1616.\\u003c/li\\u003e\\n\\u003cli\\u003eLyko, F. (2018). \\u0026quot;The DNA methyltransferase family: a versatile toolkit for epigenetic regulation.\\u0026quot; \\u003cu\\u003eNat Rev Genet\\u003c/u\\u003e \\u003cstrong\\u003e19\\u003c/strong\\u003e(2): 81-92.\\u003c/li\\u003e\\n\\u003cli\\u003eMalumbres, M. (2014). \\u0026quot;Cyclin-dependent kinases.\\u0026quot; \\u003cu\\u003eGenome Biol\\u003c/u\\u003e \\u003cstrong\\u003e15\\u003c/strong\\u003e(6): 122.\\u003c/li\\u003e\\n\\u003cli\\u003eMei, Z., et al. (2015). \\u0026quot;FBXO32 Targets c-Myc for Proteasomal Degradation and Inhibits c-Myc Activity.\\u0026quot; \\u003cu\\u003eJ Biol Chem\\u003c/u\\u003e \\u003cstrong\\u003e290\\u003c/strong\\u003e(26): 16202-16214.\\u003c/li\\u003e\\n\\u003cli\\u003eMeng, H., et al. (2015). \\u0026quot;DNA methylation, its mediators and genome integrity.\\u0026quot; \\u003cu\\u003eInt J Biol Sci\\u003c/u\\u003e \\u003cstrong\\u003e11\\u003c/strong\\u003e(5): 604-617.\\u003c/li\\u003e\\n\\u003cli\\u003eMeshram, S. N., et al. (2017). \\u0026quot;FBXO32 activates NF-\\u0026kappa;B through I\\u0026kappa;B\\u0026alpha; degradation in inflammatory and genotoxic stress.\\u0026quot; \\u003cu\\u003eInt J Biochem Cell Biol\\u003c/u\\u003e \\u003cstrong\\u003e92\\u003c/strong\\u003e: 134-140.\\u003c/li\\u003e\\n\\u003cli\\u003eMoore, L. D., et al. (2013). \\u0026quot;DNA methylation and its basic function.\\u0026quot; \\u003cu\\u003eNeuropsychopharmacology\\u003c/u\\u003e \\u003cstrong\\u003e38\\u003c/strong\\u003e(1): 23-38.\\u003c/li\\u003e\\n\\u003cli\\u003eNekhai, S., et al. (2014). \\u0026quot;Regulation of CDK9 activity by phosphorylation and dephosphorylation.\\u0026quot; \\u003cu\\u003eBiomed Res Int\\u003c/u\\u003e \\u003cstrong\\u003e2014\\u003c/strong\\u003e: 964964.\\u003c/li\\u003e\\n\\u003cli\\u003ePathania, R., et al. (2015). \\u0026quot;DNMT1 is essential for mammary and cancer stem cell maintenance and tumorigenesis.\\u0026quot; \\u003cu\\u003eNat Commun\\u003c/u\\u003e \\u003cstrong\\u003e6\\u003c/strong\\u003e: 6910.\\u003c/li\\u003e\\n\\u003cli\\u003ePectasides, E., et al. (2018). \\u0026quot;Genomic Heterogeneity as a Barrier to Precision Medicine in Gastroesophageal Adenocarcinoma.\\u0026quot; \\u003cu\\u003eCancer Discov\\u003c/u\\u003e \\u003cstrong\\u003e8\\u003c/strong\\u003e(1): 37-48.\\u003c/li\\u003e\\n\\u003cli\\u003eQiu, Z., et al. (2022). \\u0026quot;Transcription Elongation Machinery Is a Druggable Dependency and Potentiates Immunotherapy in Glioblastoma Stem Cells.\\u0026quot; \\u003cu\\u003eCancer Discov\\u003c/u\\u003e \\u003cstrong\\u003e12\\u003c/strong\\u003e(2): 502-521.\\u003c/li\\u003e\\n\\u003cli\\u003eShin, E., et al. (2016). \\u0026quot;Differential expression of the epigenetic methylation-related protein DNMT1 by breast cancer molecular subtype and stromal histology.\\u0026quot; \\u003cu\\u003eJ Transl Med\\u003c/u\\u003e \\u003cstrong\\u003e14\\u003c/strong\\u003e: 87.\\u003c/li\\u003e\\n\\u003cli\\u003eShu, Y., et al. (2020). \\u0026quot;LINC00494 Promotes Ovarian Cancer Development and Progression by Modulating NF\\u0026kappa;B1 and FBXO32.\\u0026quot; \\u003cu\\u003eFront Oncol\\u003c/u\\u003e \\u003cstrong\\u003e10\\u003c/strong\\u003e: 541410.\\u003c/li\\u003e\\n\\u003cli\\u003eSingh, V., et al. (2013). \\u0026quot;DNA methyltransferase-1 inhibitors as epigenetic therapy for cancer.\\u0026quot; \\u003cu\\u003eCurr Cancer Drug Targets\\u003c/u\\u003e \\u003cstrong\\u003e13\\u003c/strong\\u003e(4): 379-399.\\u003c/li\\u003e\\n\\u003cli\\u003eStitt, T. N., et al. (2004). \\u0026quot;The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors.\\u0026quot; \\u003cu\\u003eMol Cell\\u003c/u\\u003e \\u003cstrong\\u003e14\\u003c/strong\\u003e(3): 395-403.\\u003c/li\\u003e\\n\\u003cli\\u003eSun, L., et al. (2022). \\u0026quot;Metabolic reprogramming and epigenetic modifications on the path to cancer.\\u0026quot; \\u003cu\\u003eProtein Cell\\u003c/u\\u003e \\u003cstrong\\u003e13\\u003c/strong\\u003e(12): 877-919.\\u003c/li\\u003e\\n\\u003cli\\u003eTan, J., et al. (2007). \\u0026quot;Pharmacologic disruption of Polycomb-repressive complex 2-mediated gene repression selectively induces apoptosis in cancer cells.\\u0026quot; \\u003cu\\u003eGenes Dev\\u003c/u\\u003e \\u003cstrong\\u003e21\\u003c/strong\\u003e(9): 1050-1063.\\u003c/li\\u003e\\n\\u003cli\\u003eTeng, Y., et al. (2018). \\u0026quot;DNMT1 ablation suppresses tumorigenesis by inhibiting the self-renewal of esophageal cancer stem cells.\\u0026quot; \\u003cu\\u003eOncotarget\\u003c/u\\u003e \\u003cstrong\\u003e9\\u003c/strong\\u003e(27): 18896-18907.\\u003c/li\\u003e\\n\\u003cli\\u003eUhlenhopp, D. J., et al. (2020). \\u0026quot;Epidemiology of esophageal cancer: update in global trends, etiology and risk factors.\\u0026quot; \\u003cu\\u003eClin J Gastroenterol\\u003c/u\\u003e \\u003cstrong\\u003e13\\u003c/strong\\u003e(6): 1010-1021.\\u003c/li\\u003e\\n\\u003cli\\u003eVeeranki, O. L., et al. (2019). \\u0026quot;Targeting cyclin-dependent kinase 9 by a novel inhibitor enhances radiosensitization and identifies Axl as a novel downstream target in esophageal adenocarcinoma.\\u0026quot; \\u003cu\\u003eOncotarget\\u003c/u\\u003e \\u003cstrong\\u003e10\\u003c/strong\\u003e(45): 4703-4718.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, H., et al. (2021). \\u0026quot;DNA methylation markers in esophageal cancer: an emerging tool for cancer surveillance and treatment.\\u0026quot; \\u003cu\\u003eAm J Cancer Res\\u003c/u\\u003e \\u003cstrong\\u003e11\\u003c/strong\\u003e(11): 5644-5658.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, L., et al. (2021). \\u0026quot;Targeting the Microenvironment in Esophageal Cancer.\\u0026quot; \\u003cu\\u003eFront Cell Dev Biol\\u003c/u\\u003e \\u003cstrong\\u003e9\\u003c/strong\\u003e: 684966.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, Q., et al. (2021). \\u0026quot;DNMT1-mediated methylation of BEX1 regulates stemness and tumorigenicity in liver cancer.\\u0026quot; \\u003cu\\u003eJ Hepatol\\u003c/u\\u003e \\u003cstrong\\u003e75\\u003c/strong\\u003e(5): 1142-1153.\\u003c/li\\u003e\\n\\u003cli\\u003eWatanabe, M., et al. (2020). \\u0026quot;Recent progress in multidisciplinary treatment for patients with esophageal cancer.\\u0026quot; \\u003cu\\u003eSurg Today\\u003c/u\\u003e \\u003cstrong\\u003e50\\u003c/strong\\u003e(1): 12-20.\\u003c/li\\u003e\\n\\u003cli\\u003eWeisenberger, D. J., et al. (2022). \\u0026quot;The Role of DNA Methylation and DNA Methyltransferases in Cancer.\\u0026quot; \\u003cu\\u003eAdv Exp Med Biol\\u003c/u\\u003e \\u003cstrong\\u003e1389\\u003c/strong\\u003e: 317-348.\\u003c/li\\u003e\\n\\u003cli\\u003eWu, X. Y., et al. (2020). \\u0026quot;DNMT1 promotes cell proliferation via methylating hMLH1 and hMSH2 promoters in EGFR-mutated non-small cell lung cancer.\\u0026quot; \\u003cu\\u003eJ Biochem\\u003c/u\\u003e \\u003cstrong\\u003e168\\u003c/strong\\u003e(2): 151-157.\\u003c/li\\u003e\\n\\u003cli\\u003eYang, W., et al. (2021). \\u0026quot;Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B.\\u0026quot; \\u003cu\\u003eOpen Life Sci\\u003c/u\\u003e \\u003cstrong\\u003e16\\u003c/strong\\u003e(1): 1341-1346.\\u003c/li\\u003e\\n\\u003cli\\u003eZeng, B., et al. (2019). \\u0026quot;The role of DNMT1/hsa-miR-124-3p/BCAT1 pathway in regulating growth and invasion of esophageal squamous cell carcinoma.\\u0026quot; \\u003cu\\u003eBMC Cancer\\u003c/u\\u003e \\u003cstrong\\u003e19\\u003c/strong\\u003e(1): 609.\\u003c/li\\u003e\\n\\u003cli\\u003eZeng, H., et al. (2021). \\u0026quot;Transcriptional inhibition by CDK7/9 inhibitor SNS-032 suppresses tumor growth and metastasis in esophageal squamous cell carcinoma.\\u0026quot; \\u003cu\\u003eCell Death Dis\\u003c/u\\u003e \\u003cstrong\\u003e12\\u003c/strong\\u003e(11): 1048.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, N., et al. (2022). \\u0026quot;FBXO32 targets PHPT1 for ubiquitination to regulate the growth of EGFR mutant lung cancer.\\u0026quot; \\u003cu\\u003eCell Oncol (Dordr)\\u003c/u\\u003e \\u003cstrong\\u003e45\\u003c/strong\\u003e(2): 293-307.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, Y., et al. (2011). \\u0026quot;Effects of DNMT1 silencing on malignant phenotype and methylated gene expression in cervical cancer cells.\\u0026quot; \\u003cu\\u003eJ Exp Clin Cancer Res\\u003c/u\\u003e \\u003cstrong\\u003e30\\u003c/strong\\u003e(1): 98.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, Y. and R. A. Weinberg (2018). \\u0026quot;Epithelial-to-mesenchymal transition in cancer: complexity and opportunities.\\u0026quot; \\u003cu\\u003eFront Med\\u003c/u\\u003e \\u003cstrong\\u003e12\\u003c/strong\\u003e(4): 361-373.\\u003c/li\\u003e\\n\\u003cli\\u003eZhou, H., et al. (2017). \\u0026quot;FBXO32 suppresses breast cancer tumorigenesis through targeting KLF4 to proteasomal degradation.\\u0026quot; \\u003cu\\u003eOncogene\\u003c/u\\u003e \\u003cstrong\\u003e36\\u003c/strong\\u003e(23): 3312-3321.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"esophageal cancer, FBXO32, DNMT1, CDK9, DNA methylation\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3240325/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3240325/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cstrong\\u003ePurpose\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eEsophageal cancer (EC) is a common and serious form of cancer. F-box protein 32 (FBXO32) is a member of the F-box protein family and its role in EC is still unclear.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMethods\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFBXO32 expression was examined in EC cells using GSE163735 dataset and RT-qPCR and its effects on cell proliferation, migration, and invasion and epithelial mesenchymal transition (EMT) was investigated. The xenograft model established by injecting EC cells transfected with FBX032 was used to evaluate tumor cells growth, apoptosis, proliferation, and metastasis. ChIP assay was employed to study the interaction between FBXO32 with and DNA methyltransferase-1 (DNMT1). Finally, HitPredict, Co-IP, and GST pulldown assay was utilized to analyze the interaction between FBXO32 and CDK9.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eResults\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eHigh FBXO32 expression was associated with better overall survival in patients. It is negatively regulated by DNMT1 in EC cells. DNMT1 bound to the FBXO32 promoter to promote its methylationand downregulation in EC cells. Knockdown of DNMT1 in these cells increased FBXO32 expression and suppressed malignant phenotypes. Mechanistically, FBXO32 ubiquitinated and degraded CDK9 (Cyclin Dependent Kinase 9) in EC cells which was prevented in FBXO32-silenced cells. Finally, EC cells overexpressed with FBXO32 inhibited tumor growth and metastasis in xenografts demonstrating its tumor suppressor role.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConclusion\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFBXO32 is a tumor suppressor that ubiquitinates and degrades CDK9 that results in inhibition of EC.\\u003c/p\\u003e\",\"manuscriptTitle\":\"The role of FBXO32 in regulating the growth of esophageal cancer\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2023-08-10 14:42:57\",\"doi\":\"10.21203/rs.3.rs-3240325/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"8cc67324-6e8e-40da-a20a-c96467dbb9d8\",\"owner\":[],\"postedDate\":\"August 10th, 2023\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2023-09-11T19:59:12+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2023-08-10 14:42:57\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3240325\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3240325\",\"identity\":\"rs-3240325\",\"version\":[\"v1\"]},\"buildId\":\"rHA-KDH7Qsr4HCuvH75dn\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}