{"paper_id":"0fea05c5-e4f5-4c16-a7af-d4b204e3a19d","body_text":"Sustainable Biodegradation of Methylene Blue Dye by Enterobacter cloacae Strain BHPGT2024 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Sustainable Biodegradation of Methylene Blue Dye by Enterobacter cloacae Strain BHPGT2024 Gnanasekaran Ramakrishnan, Koteswara Reddy Gujjula, Sai Sree Thanay Allam, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5259849/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The discharge of dye complexes from industrial effluents, especially from textile industries, remains a significant environmental concern. Synthetic dyes such as Methylene Blue contribute notably to pollution due to their persistence and potential toxicity, which disrupt ecosystems and pose health risks via bioaccumulation. Traditional dye removal methods are often expensive and environmentally harmful. This research focuses on isolating bacterial strains from the agricultural fields of KL University, screening them for their decolourization efficiency of Methylene Blue, and optimizing culture parameters for effective decolourization. The study investigates Enterobacter cloacae strain BHPGT2024, which shows a remarkable capability to degrade Methylene Blue at a concentration of 150 ppm, with reduced efficiency at higher concentrations. The strain achieved an 82.1% dye degradation capacity within 2 days at 37°C and 120 rpm. The degradation process was analysed using UV, FT-IR, and HPLC analyses, confirming the bacterium's ability to metabolize the dye into harmless byproducts under aerobic conditions. This strain offers an eco-friendly solution to dye pollution, aligning with green chemistry principles and circular economy goals. The findings highlight the potential of microbial biodiversity in ecological preservation and pave the way for innovative bioremediation strategies, representing a promising advancement towards mitigating industrial dye pollution and fostering a sustainable future. Methylene Blue Decolourization Enterobacter Cloacae UV-Spectrophotometer FT-IR HPLC Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction The relentless pace of industrial advancement has brought significant environmental challenges, with pollution from synthetic dyes being particularly prominent. Methylene Blue, a dye extensively used in textiles, pharmaceuticals, and other industries, epitomizes this issue due to its persistence and potential toxicity (Hashmi et al., 2021). Despite its widespread application, Methylene Blue poses severe environmental risks as it infiltrates water bodies and soils, causing long-term ecological harm and health risks through bioaccumulation in the food chain (Dutta et al., 2024). This cationic dye's high solubility in water contributes to its pervasive presence in aquatic ecosystems, where its chemical stability and resistance to biodegradation under natural conditions cause it to persist (Bhardwaj and Bharadvaja, 2021). Once introduced into the environment, Methylene Blue can significantly reduce light penetration in water bodies, disrupting photosynthetic processes in aquatic plants and phytoplankton, and exerting toxic effects on aquatic organisms, impairing growth, reproduction, and survival rates (Sharma et al., 2021). However, despite its beneficial uses, methylene blue poses significant health risks if misused or overexposed (Karri et al., 2021, Reddy and Yarrakula, 2018). Its toxic effects can result from mechanisms including oxidative stress, disruption of cellular respiration. Acute exposure may cause symptoms like nausea, vomiting, hemolytic anemia, cyanosis, and neurotoxic effects such as confusion and agitation (Vutskits et al., 2008, Dinakarkumar et al., 2024). Chronic exposure can lead to peripheral neuropathy, cognitive impairment, mood disturbances, and potential reproductive toxicity. This chemical compound has been reported to be teratogenic and embryotoxic. These toxic effects were confirmed in exposure studies involving angelfish and rats (International Agency for Research on Cancer. 1997, Gnanasekaran et al., 2024). Manufacturing industries, including textiles, paints, pharmaceuticals, and cosmetics, which use dyes such as methylene blue (MB) in their production processes, may release significant amounts of these substances into the environment as waste (Oladoye et al., 2022, Reddy and Kiran, 2019). Health risks associated with exposure to MB include gastrointestinal complications, respiratory disorders, central nervous system and cardiovascular issues, genitourinary complications, and dermatological effects (Ramsay et al., 2007, Konduri et al., 2011). To manage and prevent methylene blue toxicity, it is crucial to ensure proper dosing, regular monitoring, protective measures in occupational settings, and increased awareness of its risks. Thus, while methylene blue is valuable in various applications, careful handling and adherence to safety protocols are essential to minimize health hazards. Traditional methods for removing synthetic dyes, such as chemical treatments and physical processes, are often marred by high costs, substantial energy consumption, and the production of hazardous byproducts (Kathing and Saini, 2022, Reddy and Yarrakula, 2019). Physical methods like adsorption and membrane filtration, while effective in removing dyes from water, generate concentrated dye sludge that requires further disposal or treatment (Piaskowski et al., 2018). Chemical methods, including oxidation and coagulation, can lead to the formation of secondary pollutants and necessitate careful management of chemical reagents (Sivakumar and Lee, 2022). These drawbacks highlight the urgent need for sustainable and efficient alternatives to manage dye pollution. Bioremediation, the use of microorganisms to degrade environmental contaminants, offers a promising solution to this pressing issue (Bharathi et al., 2022). Enterobacter cloacae Strain BHPGT2024, a bacterium identified through comprehensive environmental sampling and rigorous screening, presents a particularly compelling case. This strain has demonstrated a remarkable ability to degrade Methylene Blue under aerobic conditions, utilizing its metabolic pathways to break down the dye into harmless byproducts. This study examines the potential of Enterobacter cloacae Strain BHPGT2024 for Methylene Blue bioremediation, focusing on the mechanisms underlying the dye-degrading properties of the bacterium and the environmental advantages of its use. By investigating the bacterium's capacity to transform Methylene Blue into non-toxic substances, the study aims to present a viable alternative to conventional dye removal techniques, aligning with the principles of green chemistry and the circular economy. Moreover, this research underscores the broader significance of microbial biodiversity in maintaining ecosystem health and resilience. The discovery and utilization of such microbial strains highlight the importance of preserving natural habitats and the diverse microbial life they harbour. The innovative use of Enterobacter cloacae Strain BHPGT2024 not only addresses the specific issue of Methylene Blue pollution but also exemplifies the potential of harnessing microbial solutions for sustainable environmental management. As we face increasing environmental challenges, the findings presented in this paper offer a beacon of hope, demonstrating that sustainable solutions are attainable through diligent scientific inquiry and environmental stewardship. The application of such bioremediation strategies could revolutionize the approach to managing industrial pollutants, leading to a cleaner, greener future. 2. Materials and Methods 2.1 Chemicals and sample collection High-purity analytical-grade chemical reagents and solvents were exclusively utilized in this study. Methylene Blue (C 16 H 18 ClN 3 S·3H 2 O) dye was acquired from Sigma-Aldrich in the United States, while microbial culture media (LB Agar) were procured from authorized suppliers. Soil samples were aseptically collected from agricultural fields of KL University, Vaddeswaram, Andhra Pradesh, India, using sterile, air-tight plastic bags. These samples were promptly transported to the laboratory and stored at 4°C. A bacterial colony was subsequently isolated from these samples for further investigation. 2.2 Screening and identification The isolated microbial culture underwent thorough examination with a series of tests, including simple staining and the essential Gram staining procedure. The results conclusively identified the microorganism as Gram-negative, representing a significant milestone in the initial screening process (Bartholomew and Mittwer, 1952). 2.2.1 Identification through 16s rRNA sequencing Monolayer cells were lysed, and one to three colonies were suspended aseptically in 500 µl of lysis buffer in a 2 ml vial. The cells were lysed by repeated pipetting. Next, 500 µl of neutralizing buffer and 4 µl of RNase were added, the contents were vortexed, and the vials were placed in a 65°C water bath for 30 minutes. The vials with mixed DNA solutions were inverted to reduce molecular shearing, then centrifuged for 10 minutes at 10,000 rpm. The supernatant was gently transferred into a 2 ml vial without disturbing the pellet. After this, 600 µl of chloroform isoamyl alcohol was added, mixed vigorously by hand, and centrifuged again for 10 minutes at 10,000 rpm. In the next step, 600 µl of binding buffer was thoroughly mixed by pipetting and incubated for 5 minutes at room temperature. Following this, 600 µl of the mixture was transferred to a spin column placed in a 2 ml vial, centrifuged at 10,000 rpm for 2 minutes, and the flow-through was discarded. This step was repeated with the remaining 600 µl of lysate. Washing was done by adding 500 µl of washing buffer to the spin column, centrifuging for 2 minutes at 10,000 rpm, and discarding the flow-through. This process was repeated with 500 µl of washing buffer II, followed by a dry spin for 5 minutes at 10,000 rpm. The spin column was then transferred to a sterile 1.5 ml vial. During the elution step, 100 µl of elution buffer was added to the centre of the spin column, avoiding contact with the filtrate, incubated for 2 minutes at room temperature, and centrifuged for 2 minutes at 10,000 rpm. The resulting buffer in the microcentrifuge tube contained the DNA, whose concentrations were measured using a Qubit fluorometer 3.0 or by 1% agarose gel electrophoresis (Purchase et al., 2021). 2.2.2 Polymerase Chain Reaction The gene sequence was amplified utilizing carefully selected primers 27F (5' AGAGTTTGATCTGGCTCAG 3') and 1492R (5' TACGGTACCTTGTTACGACTT 3'), enabling comprehensive identification of the microbial species. After identification, the sequence was submitted to NCBI, assigned the accession number PP499653, and designated as the BHPGT2024 strain (Purchase et al., 2021). 2.3 Decolorization Assay The BHPGT2024 strain was cultured under optimal conditions for microbial growth post-identification, using precisely measured 100 ml of LB media. The culture was meticulously adjusted to enhance microbial metabolism over a 24-hour period, with incubation conditions strictly maintained at 37°C and 120 rpm agitation. Subsequently, four carefully prepared flasks, each containing 100 ml of LB medium, were inoculated to commence investigations into Methylene Blue dye degradation. To stimulate robust microbial growth and activity, a carefully calibrated 5% inoculum was added to each flask. Concurrently, various concentrations of Methylene Blue dye ranging from 50 ppm to 200 ppm were meticulously introduced into each flask after undergoing rigorous filter sterilization to ensure sterility and accuracy. The securely sealed flasks, now poised for microbial action, underwent an identical incubation regimen maintaining a constant temperature of 35°C and agitation rate of 120 rpm. This systematic approach laid the groundwork for a thorough understanding of the biodegradation process, methodically monitoring microbial activity and Methylene Blue dye breakdown over a precisely defined two-day period (Kishor et al., 2021). $$\\:\\text{D}\\text{e}\\text{c}\\text{o}\\text{l}\\text{o}\\text{r}\\text{i}\\text{z}\\text{a}\\text{t}\\text{i}\\text{o}\\text{n}\\:\\left(\\text{%}\\right)=\\left(\\frac{{R}_{0}-{R}_{t}}{{R}_{0}}\\right)X100$$ Where, R 0 is the initial absorbance, R t is the final absorbance 2.4 UV- Visible Spectroscopy Analysis The decolorization of Methylene Blue dye was confirmed using a UV–vis spectrophotometer (Eppendorf, 6135). During the decolorization study, a 3.0-milliliter sample was taken from the flasks and centrifuged at 10,000 rpm for 9 minutes at room temperature. The degree of decolorization was then assessed at a wavelength of 668 nm (Luo et al., 2020). 2.5. FT-IR Analysis FT-IR spectrometer by Perkin Elmer was used for the analysis. The bacterial broth was transferred to a vial and centrifuged at 10,000 rpm for 9 minutes. The supernatant was then collected, and 100 µL of this supernatant was added to the FT-IR cassette (Banu and Balasubramanian, 2015). The sample was subsequently run, with readings taken both before and after incubation of bacteria with the dye. 2.6. HPLC To safeguard the chromatographic column, the samples were filtered through Millipore discs with a pore size of 0.45 µm. High-performance liquid chromatography (HPLC) was monitored using a UV absorbance detector (UV-2070 plus) set to 668 nm, in conjunction with a C18 Hs column from Kyta Tech (Ullah et al., 2017). 3. Results and Discussion 3.1. Isolation of Bacteria Soil samples were collected from agricultural fields of KL University, Vaddeswaram, Andhra Pradesh, India (Figure. 1). These samples underwent a stringent serial dilution process, handled with utmost aseptic precautions to prevent external contamination. Luria-Bertani (LB) agar, renowned for its nutritional properties, was deliberately selected as the optimal medium to foster the growth of isolated microbial strains. Following quadrant streaking of the culture plates (Figure. 2), they were carefully placed in a precisely maintained 37°C incubator for a duration of 24hours. After the incubation period, the microbial colonies that developed were examined and documented. Each distinct colony morphology was recorded, and a selection of colonies was chosen for further examination. 3.2. Screening and Identification The isolated microbial culture underwent a comprehensive series of assays, including basic staining and the traditional Gram staining technique. These experiments were pivotal in establishing a foundational understanding of the microorganism's characteristics. The results definitively categorized the bacterium as Gram-negative, marking a critical milestone in the initial screening process. Simple staining involved the use of a single dye, which facilitated visualization of microbial cell shape, size, and arrangement. This initial observation formed the basis for hypothesizing the type of microbe present. Subsequently, the more informative Gram staining technique was employed. This method divides bacteria into Gram-positive and Gram-negative categories based on structural differences in their cell walls. The Gram-negative outcome indicated the presence of an outer membrane containing lipopolysaccharides and a thinner peptidoglycan layer, characteristic features of Gram-negative bacteria. 16S rRNA sequencing played a crucial role in enhancing microbial identification. This modern molecular method accurately decoded the genetic profile of the isolated microbe. The 16S rRNA gene was amplified with carefully chosen primers 27F (5' AGAGTTTGATCTGGCTCAG 3') and 1492R (5' TACGGTACCTTGTTACGACTT 3'), allowing for detailed identification of the microbial species. The 16S rRNA gene's high conservation across bacterial and archaeal species makes it an ideal candidate for phylogenetic analysis and identification. The primers 27F and 1492R were chosen for their ability to amplify nearly the entire 16S rRNA gene, owing to conserved regions at its beginning and end, respectively, ensuring comprehensive coverage and facilitating the recognition of a wide range of microbial species. Phylogenetic analysis and sequence alignment provided extensive insights into the microorganism's taxonomy and evolutionary relationships (Figure. 3). This rigorous approach confirmed the microbial species' identity, elucidated its closest relatives, and shed light on its potential environmental niche. Accurate identification is essential for understanding the microorganism's role within its ecosystem, potential pathogenicity, and possible applications. 3.3. UV- Visible Spectrophotometer Analysis The decolorization of methylene blue dye was observed using UV-vis spectroscopy, indicating a possible biodegradation mechanism. Decolorization was identified when the blue color of methylene blue dye disappeared after incubation with BHPGT2024 (Fig. 4 ). UV–vis spectra analysis at 668 nm showed that the sample at 0 hours of incubation had a higher absorbance value compared to the sample at 48 hours, indicating dye degradation and discoloration. The percentage of dye decolorization was highest at 150 ppm, whereas at 200 ppm, the percentage was very low due to the bacteria's reduced ability to degrade the dye. Table 1 presents the statistics of dye decolorization efficiency. A graphical representation of the UV–vis spectroscopy analysis is shown in Fig. 5 . Table 1 Statistics of Percentage of Methylene blue decolorization efficiency. Concentration (PPM) Absorbance at 668 nm at 0 hrs. of Incubation Standard Deviation (SD) Absorbance at 668 nm at 48 hrs. of Incubation Standard Deviation (SD) Dye Decolourization Efficiency (%) 1 2 3 Average 1 2 3 Average 50 0.315 0.32 0.39 0.34 0.042 0.075 0.071 0.069 0.07 0.0031 81.6 100 0.41 0.418 0.426 0.42 0.008 0.08 0.087 0.085 0.08 0.0036 80.3 150 0.531 0.54 0.59 0.55 0.032 0.095 0.089 0.092 0.09 0.003 84.4 200 0.62 0.68 0.7 0.67 0.042 0.346 0.29 0.324 0.32 0.0282 54.3 3.4 FT-IR Analysis Figure. 6. presents the FTIR spectra of methylene blue dye and the degradation products obtained by Enterobacter cloacae strain BHPGT-2024. The FTIR spectrum of the methylene blue control displayed peaks at 3323.2 cm⁻¹ (C-H stretching in alkynes), 3201.8 cm⁻¹ (O-H stretching in alcohols), 3119.6 cm⁻¹ (O-H stretching in alcohols), 2959 cm⁻¹ (O-H stretching in alcohols), 2191 cm⁻¹ (C \\(\\:\\equiv\\:\\) C stretching in alkynes), 1909 cm⁻¹ (C-H bending in aromatic compounds), 1755.4 cm⁻¹ (C-H bending in aromatic compounds), 1516 cm⁻¹ (N-O stretching in nitro compounds), 1398.2 cm⁻¹ (O-H bending in carboxylic acids), 1266 cm⁻¹ (C-N stretching in aromatic amines), 1080.4 cm⁻¹ (C-N stretching in amines), 1037.5 cm⁻¹ (S = O stretching in sulfoxides), 833.93 cm⁻¹ (C = C bending in alkenes), 783.93 cm⁻¹ (C = C bending in trisubstituted alkenes), and 683 cm⁻¹ (C-Br stretching in halo compounds) (Figure. 6A). The FTIR spectrum of the product extracted from methylene blue dye degraded by Enterobacter cloacae strain BHPGT-2024 exhibited peaks at 3684 cm⁻¹ (O-H stretching in alcohols), 3598.4 cm⁻¹ (O-H stretching in alcohols), 3444.6 cm⁻¹ (O-H stretching in alcohols), 3259 cm⁻¹ (O-H stretching in alcohols), 3169.6 cm⁻¹ (O-H stretching in carboxylic acids), 3126.8 cm⁻¹ (O-H stretching in alcohols), 2994.6 cm⁻¹ (C-H stretching in alkanes), 2159 cm⁻¹ (S-C = N stretching in thiocyanates), 1716 cm⁻¹ (C = O stretching in alpha, beta-unsaturated esters), 1541 cm⁻¹ (N-O stretching in nitro compounds), 1119.6 cm⁻¹ (C-N stretching in amines), 1005.4 cm⁻¹ (C-F stretching in fluoro compounds), and 619.64 cm⁻¹ (C-Br stretching in halo compounds) (Figure. 6B). The significant differences in the FTIR spectra between the control dye and its degradation products reveal that Enterobacter cloacae strain BHPGT-2024 biodegrades the dye into various metabolites. The alterations in the peaks of the supernatant after dye decolorization, compared to the original dye, indicate the dye's breakdown into intermediate products. The marked variations in the HPLC peaks, corroborated by FTIR analysis, confirm the biodegradation of methylene blue dye by Enterobacter cloacae strain BHPGT-2024. 3.5 Analysis of HPLC Data The chromatograms from the HPLC analysis of both the untreated dye and the treated solution are shown in Figure. 7. The HPLC analysis of the control methylene blue dye samples displayed a prominent peak at a retention time of 5.03 minutes (Fig. 7 A). Following decolorization by Enterobacter cloacae strain BHPGT-2024, the HPLC elution profile of the treated dyes revealed major peaks at 6.08 and 5.7 minutes, along with smaller peaks at 8.01 and 6.7 minutes, indicating that the parent dye structure was degraded (Fig. 7 B). These changes in peak patterns and absorbance, as observed in the HPLC analysis, confirmed the biodegradation of the dyes, reflecting a decrease in dye concentration. 4. Conclusion In conclusion, the discharge of dye complexes from industrial effluents, particularly from textile industries, poses a substantial environmental threat due to the persistence and potential toxicity of synthetic dyes like Methylene Blue. This study successfully isolated and identified the bacterial strain Enterobacter cloacae BHPGT2024 from the agricultural fields of KL University, demonstrating its remarkable ability to degrade Methylene Blue dye. Under optimized conditions, this strain achieved an 82.1% decolorization efficiency at a concentration of 150 ppm within two days, as confirmed by UV, FT-IR, and HPLC analyses. These findings underscore the potential of Enterobacter cloacae BHPGT2024 as an eco-friendly solution for dye pollution, promoting green chemistry principles and the circular economy. The research highlights the importance of microbial biodiversity in environmental preservation and suggests innovative bioremediation strategies to address industrial dye pollution, contributing to a sustainable future. Declarations Funding: No funding available for this resaerch Author Contribution Gnanasekaran Ramakrishnan= MS preparationKoteswara Reddy Gujjula= AnalysisSai Sree Thanay Allam= Conducted workSesha Bhavana Jagarlapudi=MethodologyPraveen Tummalacharla, Priyanka Hutha Kosuri, Geya Govind= analysis and participated in writting MSBaji Shaik= Methodology and assayMekala Janaki Ramaiah = Over all MS prepatration, analysis Acknowledgement Authors would like to thank KLEF management References Banu, A. N., Balasubramanian, C. (2015). Extracellular synthesis of silver nanoparticles using Bacillus megaterium against malarial and dengue vector (Diptera: Culicidae). Parasitology research , 114 , 4069-4079. Bartholomew, J. W., Mittwer, T. (1952). The gram stain. Bacteriological Reviews, 16(1), 1-29. Bharathi, D., Nandagopal, J. G. T., Ranjithkumar, R., Gupta, P. K., Djearamane, S. (2022). Microbial approaches for sustainable remediation of dye-contaminated wastewater: a review. Archives of Microbiology, 204(3), 169. Bhardwaj, D., Bharadvaja, N., (2021). Phycoremediation of effluents containing dyes and its prospects for value-added products: A review of opportunities. Journal of Water Process Engineering, 41, 102080. Dinakarkumar, Y., Gnanasekaran, R., Reddy, G. K., Vasu, V., Balamurugan, P., Murali, G. (2024). Fungal bioremediation: An overview of the mechanisms, applications and future perspectives. Environmental Chemistry and Ecotoxicology . Dutta, S., Adhikary, S., Bhattacharya, S., Roy, D., Chatterjee, S., Chakraborty, A., Rajak, P. (2024). Contamination of textile dyes in aquatic environment: Adverse impacts on aquatic ecosystem and human health, and its management using bioremediation. Journal of Environmental Management, 353, 120103. Gnanasekaran, R., Yuvaraj, D., Reddy, G. K., Shangar, S. N., Vijayakumar, V., Iyyappan, J. (2024). Zinc oxide nanoparticles from leaf extract of Eclipta prostrata: Biosynthesis and characterization towards potential agent against film forming bacteria in metal working fluids. Environmental Chemistry and Ecotoxicology , 6 , 206-215. Hashmi, S. S., Shah, M., Muhammad, W., Ahmad, A., Ullah, M. A., Nadeem, M., Abbasi, B. H. (2021). Potentials of phyto-fabricated nanoparticles as ecofriendly agents for photocatalytic degradation of toxic dyes and waste water treatment, risk assessment and probable mechanism. Journal of the Indian Chemical Society, 98(4), 100019. International Agency for Research on Cancer. (1997). IARC monographs on the evaluation of carcinogenic risks to humans. Polychlorinated dibenzo-para-dioxins and polychlorinated dibenzofurans. Karri, R. R., Ravindran, G., Dehghani, M. H. (2021). Wastewater sources, toxicity, and their consequences to human health. In Soft computing techniques in solid waste and wastewater management (pp. 3-33). Elsevier. Kathing, C., Saini, G., (2022). A review of various treatment methods for the removal of dyes from textile effluent. Recent Progress in Materials, 4(4), 1-15. Kishor, R., Purchase, D., Saratale, G. D., Ferreira, L. F. R., Bilal, M., Iqbal, H. M., Bharagava, R. N. (2021). Environment friendly degradation and detoxification of Congo red dye and textile industry wastewater by a newly isolated Bacillus cohnni (RKS9). Environmental Technology & Innovation, 22, 101425. Kishor, R., Saratale, G. D., Saratale, R. G., Ferreira, L. F. R., Bilal, M., Iqbal, H. M., Bharagava, R. N. (2021). Efficient degradation and detoxification of methylene blue dye by a newly isolated ligninolytic enzyme producing bacterium Bacillus albus MW407057. Colloids and Surfaces B: Biointerfaces, 206, 111947. Konduri, M. K., Koteswarareddy, G., Rohini Kumar, D. B., Venkata Reddy, B., Lakshmi Narasu, M. (2011). Effect of pro‐oxidants on biodegradation of polyethylene (LDPE) by indigenous fungal isolate, Aspergillus oryzae. Journal of Applied Polymer Science , 120 (6), 3536-3545. Luo, S., Liu, C., Zhou, S., Li, W., Ma, C., Liu, S., He, S. (2020). ZnO nanorod arrays assembled on activated carbon fibers for photocatalytic degradation: Characteristics and synergistic effects. Chemosphere, 261, 127731. Oladoye, P. O., Ajiboye, T. O., Omotola, E. O., Oyewola, O. J. (2022). Methylene blue dye: Toxicity and potential elimination technology from wastewater. Results in Engineering, 16, 100678. Piaskowski, K., Świderska-Dąbrowska, R., Zarzycki, P. K. (2018). Dye removal from water and wastewater using various physical, chemical, and biological processes. Journal of AOAC International, 101(5), 1371-1384. Ramsay, R. R., Dunford, C., Gillman, P. K. (2007). Methylene blue and serotonin toxicity: inhibition of monoamine oxidase A (MAO A) confirms a theoretical prediction. British journal of pharmacology, 152(6), 946-951. Reddy, G. K., Kiran, Y., (2019). A theoretical mechanism in the degradation of polyolefin plastic waste using phytochemical oxidation process. The Journal of Solid Waste Technology and Management , 45 (4), 468-478. Reddy, G. K., Yarrakula, K., (2018). Assessment of contamination levels and ecological risk indices of environmentally hazardous metals for granite mining waste. Indian Journal of Ecology , 45 (1), 227-234. Sharma, J., Sharma, S., Soni, V. (2021). Classification and impact of synthetic textile dyes on Aquatic Flora: A review. Regional Studies in Marine Science, 45, 101802. Sivakumar, R., Lee, N. Y., (2022). Adsorptive removal of organic pollutant methylene blue using polysaccharide-based composite hydrogels. Chemosphere, 286, 131890. Ullah, A. K. M. A., Kibria, A. K. M. F., Akter, M., Khan, M. N. I., Tareq, A. R. M., Firoz, S. H. (2017). Oxidative degradation of methylene blue using Mn3O4 nanoparticles. Water Conserv Sci Eng 1: 249–256. Vutskits, L., Briner, A., Klauser, P., Gascon, E., Dayer, A. G., Kiss, J. Z., Morel, D. R. (2008). Adverse effects of methylene blue on the central nervous system. The Journal of the American Society of Anesthesiologists , 108 (4), 684-692. Reddy, G.K., Yarrakula, K. (2019). Geo-chemical exploration of granite mining waste using XRD, SEM/EDX and AAS analysis. Iranian Journal of Chemistry and Chemical Engineering, 38 (2), 215-228. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-5259849\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":380645380,\"identity\":\"a822c9eb-370d-49fb-8c0b-487dc34bab74\",\"order_by\":0,\"name\":\"Gnanasekaran Ramakrishnan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Koneru Lakshmaiah Education Foundation (Deemed to be University, Vaddeswram Green Fields Andhra Pradesh\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Gnanasekaran\",\"middleName\":\"\",\"lastName\":\"Ramakrishnan\",\"suffix\":\"\"},{\"id\":380645381,\"identity\":\"f98987e7-e5fc-4870-ac49-7bdbd5a3fc72\",\"order_by\":1,\"name\":\"Koteswara Reddy Gujjula\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Koneru Lakshmaiah Education Foundation (Deemed to be University, Vaddeswram Green Fields Andhra Pradesh\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Koteswara\",\"middleName\":\"Reddy\",\"lastName\":\"Gujjula\",\"suffix\":\"\"},{\"id\":380645382,\"identity\":\"bddd0937-63aa-4cbd-a740-9939b3f5f03c\",\"order_by\":2,\"name\":\"Sai Sree Thanay Allam\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Koneru Lakshmaiah Education Foundation (Deemed to be University, Vaddeswram Green Fields Andhra Pradesh\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Sai\",\"middleName\":\"Sree Thanay\",\"lastName\":\"Allam\",\"suffix\":\"\"},{\"id\":380645383,\"identity\":\"0f655479-df72-45c3-8d60-d1b326eb5ab1\",\"order_by\":3,\"name\":\"Sesha Bhavana Jagarlapudi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Koneru Lakshmaiah Education Foundation (Deemed to be University, Vaddeswram Green Fields Andhra Pradesh\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Sesha\",\"middleName\":\"Bhavana\",\"lastName\":\"Jagarlapudi\",\"suffix\":\"\"},{\"id\":380645384,\"identity\":\"2bf7b2fb-4991-4ed8-aaee-6328cf0283d5\",\"order_by\":4,\"name\":\"Praveen Tummalacharla\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Koneru Lakshmaiah Education Foundation (Deemed to be University, Vaddeswram Green Fields Andhra Pradesh\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Praveen\",\"middleName\":\"\",\"lastName\":\"Tummalacharla\",\"suffix\":\"\"},{\"id\":380645385,\"identity\":\"01a7dec4-1004-4ba6-9696-a3682a5d68fd\",\"order_by\":5,\"name\":\"Priyanka Hutha Kosuri\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Koneru Lakshmaiah Education Foundation (Deemed to be University, Vaddeswram Green Fields Andhra Pradesh\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Priyanka\",\"middleName\":\"Hutha\",\"lastName\":\"Kosuri\",\"suffix\":\"\"},{\"id\":380645386,\"identity\":\"168aded9-0867-4063-b3df-fcf357d4687e\",\"order_by\":6,\"name\":\"Geya Govind\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Koneru Lakshmaiah Education Foundation (Deemed to be University, Vaddeswram Green Fields Andhra Pradesh\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Geya\",\"middleName\":\"\",\"lastName\":\"Govind\",\"suffix\":\"\"},{\"id\":380645387,\"identity\":\"077e44ff-31c9-4fe9-afb9-cb0128915325\",\"order_by\":7,\"name\":\"Baji Shaik\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Koneru Lakshmaiah Education Foundation (Deemed to be University, Vaddeswram Green Fields Andhra Pradesh\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Baji\",\"middleName\":\"\",\"lastName\":\"Shaik\",\"suffix\":\"\"},{\"id\":380645388,\"identity\":\"0c20455b-f5ea-4a6e-9d5e-76544faa6cb4\",\"order_by\":8,\"name\":\"Janaki Ramaiah Mekala\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3UlEQVRIiWNgGAWjYBACxgYQNvhfv//+4wNAvoQMsVqYGRsOpCWAtPAQaxNIS44BiENYC3P72YMfZxSwAfWc+fzqRo0FDwP74aMb8NrQk5csucGAB6ind5t1zjGgw3jS0m7gd1SOgeQDAwmgHt5txjlsQC0SPGb4tfS/Mf75wACkh+eZcc4/YrTMyDEDOiwBqIeH+XFuG1Fa3phZzjA4ANTDZsac2weyjYBfDPtzjG/2/AFpYX78OedbnRw/++Fj+LU0INhsEmASn3IQkEdiM38gpHoUjIJRMApGJgAApkNF3xGs70AAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Koneru Lakshmaiah Education Foundation (Deemed to be University, Vaddeswram Green Fields Andhra Pradesh\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Janaki\",\"middleName\":\"Ramaiah\",\"lastName\":\"Mekala\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-10-14 09:23:26\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-5259849/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-5259849/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":70338552,\"identity\":\"f106980c-6b49-488d-b72d-c6fcf81f7ec3\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 09:39:27\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":408514,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCollection of Soil Sample\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5259849/v1/dd986d0576d50ebc1e1849b8.png\"},{\"id\":70339195,\"identity\":\"99825dc9-5a83-42e7-bec6-46ff27fa97ad\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 09:47:32\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":259933,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eIsolation bacteria by quadrant streaking\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5259849/v1/80edab37a0a3ce3b127af846.png\"},{\"id\":70338594,\"identity\":\"b7705767-1efb-472e-b066-fb5d7312bf7c\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 09:39:32\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":48547,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePhylogenetic tree\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5259849/v1/da6e24aa164aaab50eeecdad.png\"},{\"id\":70339194,\"identity\":\"30ddd9f1-5ed4-49ef-8b83-efa3ba372cb8\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 09:47:31\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":357930,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eDye decolorization assay at various concentrations (A) and (B) are of 50 ppm, (C) and (D) are of 100 ppm, 150 ppm and 200 ppm.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5259849/v1/9faf48d5749f8330c8b22403.png\"},{\"id\":70338597,\"identity\":\"2c49a5c3-300c-4942-a0e9-7133bec6456b\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 09:39:33\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":16883,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eGraphical representation of dye degradation assay.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e(Significance of difference between 0 hrs incubation and 48 hrs incubation of 50 ppm *p\\u0026lt;0.05. Significance of difference between 0 hrs incubation and 48 hrs incubation of 100 ppm #p\\u0026lt;0.05. Significance of difference between 0 hrs incubation and 48 hrs incubation of 150 ppm ¥p\\u0026lt;0.05. Significance of difference between 0 hrs incubation and 48 hrs incubation of 200 ppm £p\\u0026lt;0.05. There is no significance of difference for 48 hrs incubation between 50 ppm, 100 ppm and 150 ppm. Concentrations. Values are mean ± SD of triplicate determinations).\\u003c/em\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5259849/v1/faf86b416263fff54d2421bc.png\"},{\"id\":70338645,\"identity\":\"0ad85ec6-41e4-4919-b0f4-50798615c9e7\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 09:39:35\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":65333,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eFT-IT Spectra of before incubation (A) and after 48hrs incubation with MB dye treated (B).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5259849/v1/b3212ffef650efa7cf8f70c1.png\"},{\"id\":70338593,\"identity\":\"71451c3c-875d-43e7-b61f-719b0e227131\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 09:39:31\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":95118,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHPLC analysis of methylene blue dye (A) before incubation and (B) after 48hrs incubation.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5259849/v1/9355537dd4ecd4c87d78cf78.png\"},{\"id\":87555489,\"identity\":\"195a278a-08e4-4d96-b795-11a2fdb810d5\",\"added_by\":\"auto\",\"created_at\":\"2025-07-25 07:02:07\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2180646,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5259849/v1/319b1f44-f1d1-4ee9-86d7-26545be49bdc.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Sustainable Biodegradation of Methylene Blue Dye by Enterobacter cloacae Strain BHPGT2024\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003eThe relentless pace of industrial advancement has brought significant environmental challenges, with pollution from synthetic dyes being particularly prominent. Methylene Blue, a dye extensively used in textiles, pharmaceuticals, and other industries, epitomizes this issue due to its persistence and potential toxicity (Hashmi et al., 2021). Despite its widespread application, Methylene Blue poses severe environmental risks as it infiltrates water bodies and soils, causing long-term ecological harm and health risks through bioaccumulation in the food chain (Dutta et al., 2024). This cationic dye's high solubility in water contributes to its pervasive presence in aquatic ecosystems, where its chemical stability and resistance to biodegradation under natural conditions cause it to persist (Bhardwaj and Bharadvaja, 2021). Once introduced into the environment, Methylene Blue can significantly reduce light penetration in water bodies, disrupting photosynthetic processes in aquatic plants and phytoplankton, and exerting toxic effects on aquatic organisms, impairing growth, reproduction, and survival rates (Sharma et al., 2021). However, despite its beneficial uses, methylene blue poses significant health risks if misused or overexposed (Karri et al., 2021, Reddy and Yarrakula, 2018). Its toxic effects can result from mechanisms including oxidative stress, disruption of cellular respiration. Acute exposure may cause symptoms like nausea, vomiting, hemolytic anemia, cyanosis, and neurotoxic effects such as confusion and agitation (Vutskits et al., 2008, Dinakarkumar et al., 2024). Chronic exposure can lead to peripheral neuropathy, cognitive impairment, mood disturbances, and potential reproductive toxicity. This chemical compound has been reported to be teratogenic and embryotoxic. These toxic effects were confirmed in exposure studies involving angelfish and rats (International Agency for Research on Cancer. 1997, Gnanasekaran et al., 2024). Manufacturing industries, including textiles, paints, pharmaceuticals, and cosmetics, which use dyes such as methylene blue (MB) in their production processes, may release significant amounts of these substances into the environment as waste (Oladoye et al., 2022, Reddy and Kiran, 2019). Health risks associated with exposure to MB include gastrointestinal complications, respiratory disorders, central nervous system and cardiovascular issues, genitourinary complications, and dermatological effects (Ramsay et al., 2007, Konduri et al., 2011). To manage and prevent methylene blue toxicity, it is crucial to ensure proper dosing, regular monitoring, protective measures in occupational settings, and increased awareness of its risks. Thus, while methylene blue is valuable in various applications, careful handling and adherence to safety protocols are essential to minimize health hazards. Traditional methods for removing synthetic dyes, such as chemical treatments and physical processes, are often marred by high costs, substantial energy consumption, and the production of hazardous byproducts (Kathing and Saini, 2022, Reddy and Yarrakula, 2019). Physical methods like adsorption and membrane filtration, while effective in removing dyes from water, generate concentrated dye sludge that requires further disposal or treatment (Piaskowski et al., 2018). Chemical methods, including oxidation and coagulation, can lead to the formation of secondary pollutants and necessitate careful management of chemical reagents (Sivakumar and Lee, 2022). These drawbacks highlight the urgent need for sustainable and efficient alternatives to manage dye pollution. Bioremediation, the use of microorganisms to degrade environmental contaminants, offers a promising solution to this pressing issue (Bharathi et al., 2022). Enterobacter cloacae Strain BHPGT2024, a bacterium identified through comprehensive environmental sampling and rigorous screening, presents a particularly compelling case. This strain has demonstrated a remarkable ability to degrade Methylene Blue under aerobic conditions, utilizing its metabolic pathways to break down the dye into harmless byproducts.\\u003c/p\\u003e \\u003cp\\u003eThis study examines the potential of Enterobacter cloacae Strain BHPGT2024 for Methylene Blue bioremediation, focusing on the mechanisms underlying the dye-degrading properties of the bacterium and the environmental advantages of its use. By investigating the bacterium's capacity to transform Methylene Blue into non-toxic substances, the study aims to present a viable alternative to conventional dye removal techniques, aligning with the principles of green chemistry and the circular economy. Moreover, this research underscores the broader significance of microbial biodiversity in maintaining ecosystem health and resilience. The discovery and utilization of such microbial strains highlight the importance of preserving natural habitats and the diverse microbial life they harbour. The innovative use of Enterobacter cloacae Strain BHPGT2024 not only addresses the specific issue of Methylene Blue pollution but also exemplifies the potential of harnessing microbial solutions for sustainable environmental management. As we face increasing environmental challenges, the findings presented in this paper offer a beacon of hope, demonstrating that sustainable solutions are attainable through diligent scientific inquiry and environmental stewardship. The application of such bioremediation strategies could revolutionize the approach to managing industrial pollutants, leading to a cleaner, greener future.\\u003c/p\\u003e\"},{\"header\":\"2. Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1 Chemicals and sample collection\\u003c/h2\\u003e \\u003cp\\u003eHigh-purity analytical-grade chemical reagents and solvents were exclusively utilized in this study. Methylene Blue (C\\u003csub\\u003e16\\u003c/sub\\u003eH\\u003csub\\u003e18\\u003c/sub\\u003eClN\\u003csub\\u003e3\\u003c/sub\\u003eS\\u0026middot;3H\\u003csub\\u003e2\\u003c/sub\\u003eO) dye was acquired from Sigma-Aldrich in the United States, while microbial culture media (LB Agar) were procured from authorized suppliers. Soil samples were aseptically collected from agricultural fields of KL University, Vaddeswaram, Andhra Pradesh, India, using sterile, air-tight plastic bags. These samples were promptly transported to the laboratory and stored at 4\\u0026deg;C. A bacterial colony was subsequently isolated from these samples for further investigation.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2 Screening and identification\\u003c/h2\\u003e \\u003cp\\u003eThe isolated microbial culture underwent thorough examination with a series of tests, including simple staining and the essential Gram staining procedure. The results conclusively identified the microorganism as Gram-negative, representing a significant milestone in the initial screening process (Bartholomew and Mittwer, 1952).\\u003c/p\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.2.1 Identification through 16s rRNA sequencing\\u003c/h2\\u003e \\u003cp\\u003eMonolayer cells were lysed, and one to three colonies were suspended aseptically in 500 \\u0026micro;l of lysis buffer in a 2 ml vial. The cells were lysed by repeated pipetting. Next, 500 \\u0026micro;l of neutralizing buffer and 4 \\u0026micro;l of RNase were added, the contents were vortexed, and the vials were placed in a 65\\u0026deg;C water bath for 30 minutes. The vials with mixed DNA solutions were inverted to reduce molecular shearing, then centrifuged for 10 minutes at 10,000 rpm. The supernatant was gently transferred into a 2 ml vial without disturbing the pellet. After this, 600 \\u0026micro;l of chloroform isoamyl alcohol was added, mixed vigorously by hand, and centrifuged again for 10 minutes at 10,000 rpm. In the next step, 600 \\u0026micro;l of binding buffer was thoroughly mixed by pipetting and incubated for 5 minutes at room temperature. Following this, 600 \\u0026micro;l of the mixture was transferred to a spin column placed in a 2 ml vial, centrifuged at 10,000 rpm for 2 minutes, and the flow-through was discarded. This step was repeated with the remaining 600 \\u0026micro;l of lysate. Washing was done by adding 500 \\u0026micro;l of washing buffer to the spin column, centrifuging for 2 minutes at 10,000 rpm, and discarding the flow-through. This process was repeated with 500 \\u0026micro;l of washing buffer II, followed by a dry spin for 5 minutes at 10,000 rpm. The spin column was then transferred to a sterile 1.5 ml vial. During the elution step, 100 \\u0026micro;l of elution buffer was added to the centre of the spin column, avoiding contact with the filtrate, incubated for 2 minutes at room temperature, and centrifuged for 2 minutes at 10,000 rpm. The resulting buffer in the microcentrifuge tube contained the DNA, whose concentrations were measured using a Qubit fluorometer 3.0 or by 1% agarose gel electrophoresis (Purchase et al., 2021).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.2.2 Polymerase Chain Reaction\\u003c/h2\\u003e \\u003cp\\u003eThe gene sequence was amplified utilizing carefully selected primers 27F (5' AGAGTTTGATCTGGCTCAG 3') and 1492R (5' TACGGTACCTTGTTACGACTT 3'), enabling comprehensive identification of the microbial species. After identification, the sequence was submitted to NCBI, assigned the accession number PP499653, and designated as the BHPGT2024 strain (Purchase et al., 2021).\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3 Decolorization Assay\\u003c/h2\\u003e \\u003cp\\u003eThe BHPGT2024 strain was cultured under optimal conditions for microbial growth post-identification, using precisely measured 100 ml of LB media. The culture was meticulously adjusted to enhance microbial metabolism over a 24-hour period, with incubation conditions strictly maintained at 37\\u0026deg;C and 120 rpm agitation. Subsequently, four carefully prepared flasks, each containing 100 ml of LB medium, were inoculated to commence investigations into Methylene Blue dye degradation. To stimulate robust microbial growth and activity, a carefully calibrated 5% inoculum was added to each flask. Concurrently, various concentrations of Methylene Blue dye ranging from 50 ppm to 200 ppm were meticulously introduced into each flask after undergoing rigorous filter sterilization to ensure sterility and accuracy. The securely sealed flasks, now poised for microbial action, underwent an identical incubation regimen maintaining a constant temperature of 35\\u0026deg;C and agitation rate of 120 rpm. This systematic approach laid the groundwork for a thorough understanding of the biodegradation process, methodically monitoring microbial activity and Methylene Blue dye breakdown over a precisely defined two-day period (Kishor et al., 2021).\\u003cdiv id=\\\"Equa\\\" class=\\\"Equation\\\"\\u003e\\u003cdiv format=\\\"TEX\\\" class=\\\"mathdisplay\\\" id=\\\"FileID_Equa\\\" name=\\\"EquationSource\\\"\\u003e\\n$$\\\\:\\\\text{D}\\\\text{e}\\\\text{c}\\\\text{o}\\\\text{l}\\\\text{o}\\\\text{r}\\\\text{i}\\\\text{z}\\\\text{a}\\\\text{t}\\\\text{i}\\\\text{o}\\\\text{n}\\\\:\\\\left(\\\\text{%}\\\\right)=\\\\left(\\\\frac{{R}_{0}-{R}_{t}}{{R}_{0}}\\\\right)X100$$\\u003c/div\\u003e\\u003c/div\\u003e\\u003c/p\\u003e \\u003cp\\u003eWhere, R\\u003csub\\u003e0\\u003c/sub\\u003e is the initial absorbance, R\\u003csub\\u003et\\u003c/sub\\u003e is the final absorbance\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4 UV- Visible Spectroscopy Analysis\\u003c/h2\\u003e \\u003cp\\u003eThe decolorization of Methylene Blue dye was confirmed using a UV\\u0026ndash;vis spectrophotometer (Eppendorf, 6135). During the decolorization study, a 3.0-milliliter sample was taken from the flasks and centrifuged at 10,000 rpm for 9 minutes at room temperature. The degree of decolorization was then assessed at a wavelength of 668 nm (Luo et al., 2020).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5. FT-IR Analysis\\u003c/h2\\u003e \\u003cp\\u003eFT-IR spectrometer by Perkin Elmer was used for the analysis. The bacterial broth was transferred to a vial and centrifuged at 10,000 rpm for 9 minutes. The supernatant was then collected, and 100 \\u0026micro;L of this supernatant was added to the FT-IR cassette (Banu and Balasubramanian, 2015). The sample was subsequently run, with readings taken both before and after incubation of bacteria with the dye.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.6. HPLC\\u003c/h2\\u003e \\u003cp\\u003eTo safeguard the chromatographic column, the samples were filtered through Millipore discs with a pore size of 0.45 \\u0026micro;m. High-performance liquid chromatography (HPLC) was monitored using a UV absorbance detector (UV-2070 plus) set to 668 nm, in conjunction with a C18 Hs column from Kyta Tech (Ullah et al., 2017).\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. Results and Discussion\",\"content\":\"\\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.1. Isolation of Bacteria\\u003c/h2\\u003e \\u003cp\\u003eSoil samples were collected from agricultural fields of KL University, Vaddeswaram, Andhra Pradesh, India (Figure. 1). These samples underwent a stringent serial dilution process, handled with utmost aseptic precautions to prevent external contamination. Luria-Bertani (LB) agar, renowned for its nutritional properties, was deliberately selected as the optimal medium to foster the growth of isolated microbial strains. Following quadrant streaking of the culture plates (Figure. 2), they were carefully placed in a precisely maintained 37\\u0026deg;C incubator for a duration of 24hours.\\u003c/p\\u003e \\u003cp\\u003eAfter the incubation period, the microbial colonies that developed were examined and documented. Each distinct colony morphology was recorded, and a selection of colonies was chosen for further examination.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.2. Screening and Identification\\u003c/h2\\u003e \\u003cp\\u003eThe isolated microbial culture underwent a comprehensive series of assays, including basic staining and the traditional Gram staining technique. These experiments were pivotal in establishing a foundational understanding of the microorganism's characteristics. The results definitively categorized the bacterium as Gram-negative, marking a critical milestone in the initial screening process. Simple staining involved the use of a single dye, which facilitated visualization of microbial cell shape, size, and arrangement. This initial observation formed the basis for hypothesizing the type of microbe present. Subsequently, the more informative Gram staining technique was employed. This method divides bacteria into Gram-positive and Gram-negative categories based on structural differences in their cell walls. The Gram-negative outcome indicated the presence of an outer membrane containing lipopolysaccharides and a thinner peptidoglycan layer, characteristic features of Gram-negative bacteria.\\u003c/p\\u003e \\u003cp\\u003e16S rRNA sequencing played a crucial role in enhancing microbial identification. This modern molecular method accurately decoded the genetic profile of the isolated microbe. The 16S rRNA gene was amplified with carefully chosen primers 27F (5' AGAGTTTGATCTGGCTCAG 3') and 1492R (5' TACGGTACCTTGTTACGACTT 3'), allowing for detailed identification of the microbial species. The 16S rRNA gene's high conservation across bacterial and archaeal species makes it an ideal candidate for phylogenetic analysis and identification. The primers 27F and 1492R were chosen for their ability to amplify nearly the entire 16S rRNA gene, owing to conserved regions at its beginning and end, respectively, ensuring comprehensive coverage and facilitating the recognition of a wide range of microbial species. Phylogenetic analysis and sequence alignment provided extensive insights into the microorganism's taxonomy and evolutionary relationships (Figure. 3). This rigorous approach confirmed the microbial species' identity, elucidated its closest relatives, and shed light on its potential environmental niche. Accurate identification is essential for understanding the microorganism's role within its ecosystem, potential pathogenicity, and possible applications.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.3. UV- Visible Spectrophotometer Analysis\\u003c/h2\\u003e \\u003cp\\u003eThe decolorization of methylene blue dye was observed using UV-vis spectroscopy, indicating a possible biodegradation mechanism. Decolorization was identified when the blue color of methylene blue dye disappeared after incubation with BHPGT2024 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). UV\\u0026ndash;vis spectra analysis at 668 nm showed that the sample at 0 hours of incubation had a higher absorbance value compared to the sample at 48 hours, indicating dye degradation and discoloration. The percentage of dye decolorization was highest at 150 ppm, whereas at 200 ppm, the percentage was very low due to the bacteria's reduced ability to degrade the dye. Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e presents the statistics of dye decolorization efficiency. A graphical representation of the UV\\u0026ndash;vis spectroscopy analysis is shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eStatistics of Percentage of Methylene blue decolorization efficiency.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"12\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c8\\\" colnum=\\\"8\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c9\\\" colnum=\\\"9\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c10\\\" colnum=\\\"10\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c11\\\" colnum=\\\"11\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c12\\\" colnum=\\\"12\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eConcentration (PPM)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"4\\\" nameend=\\\"c5\\\" namest=\\\"c2\\\"\\u003e \\u003cp\\u003eAbsorbance at 668 nm at 0 hrs. of Incubation\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eStandard Deviation (SD)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"4\\\" nameend=\\\"c10\\\" namest=\\\"c7\\\"\\u003e \\u003cp\\u003eAbsorbance at 668 nm at 48 hrs. of Incubation\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c11\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eStandard Deviation (SD)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c12\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eDye Decolourization Efficiency (%)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e2\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e3\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eAverage\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e2\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e3\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c10\\\"\\u003e \\u003cp\\u003eAverage\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e50\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.315\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.32\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.39\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.34\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.042\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e0.075\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.071\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e0.069\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c10\\\"\\u003e \\u003cp\\u003e0.07\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c11\\\"\\u003e \\u003cp\\u003e0.0031\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c12\\\"\\u003e \\u003cp\\u003e81.6\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.41\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.418\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.426\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.42\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.008\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e0.08\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.087\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e0.085\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c10\\\"\\u003e \\u003cp\\u003e0.08\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c11\\\"\\u003e \\u003cp\\u003e0.0036\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c12\\\"\\u003e \\u003cp\\u003e80.3\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e150\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.531\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.54\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.59\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.55\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.032\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e0.095\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.089\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e0.092\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c10\\\"\\u003e \\u003cp\\u003e0.09\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c11\\\"\\u003e \\u003cp\\u003e0.003\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c12\\\"\\u003e \\u003cp\\u003e84.4\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e200\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.62\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.68\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.7\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.67\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.042\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e0.346\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.29\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e0.324\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c10\\\"\\u003e \\u003cp\\u003e0.32\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c11\\\"\\u003e \\u003cp\\u003e0.0282\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c12\\\"\\u003e \\u003cp\\u003e54.3\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.4 FT-IR Analysis\\u003c/h2\\u003e \\u003cp\\u003eFigure. 6. presents the FTIR spectra of methylene blue dye and the degradation products obtained by Enterobacter cloacae strain BHPGT-2024. The FTIR spectrum of the methylene blue control displayed peaks at 3323.2 cm⁻\\u0026sup1; (C-H stretching in alkynes), 3201.8 cm⁻\\u0026sup1; (O-H stretching in alcohols), 3119.6 cm⁻\\u0026sup1; (O-H stretching in alcohols), 2959 cm⁻\\u0026sup1; (O-H stretching in alcohols), 2191 cm⁻\\u0026sup1; (C\\u003cspan class=\\\"InlineEquation\\\"\\u003e\\u003cspan class=\\\"mathinline\\\"\\u003e\\\\(\\\\:\\\\equiv\\\\:\\\\)\\u003c/span\\u003e\\u003c/span\\u003eC stretching in alkynes), 1909 cm⁻\\u0026sup1; (C-H bending in aromatic compounds), 1755.4 cm⁻\\u0026sup1; (C-H bending in aromatic compounds), 1516 cm⁻\\u0026sup1; (N-O stretching in nitro compounds), 1398.2 cm⁻\\u0026sup1; (O-H bending in carboxylic acids), 1266 cm⁻\\u0026sup1; (C-N stretching in aromatic amines), 1080.4 cm⁻\\u0026sup1; (C-N stretching in amines), 1037.5 cm⁻\\u0026sup1; (S\\u0026thinsp;=\\u0026thinsp;O stretching in sulfoxides), 833.93 cm⁻\\u0026sup1; (C\\u0026thinsp;=\\u0026thinsp;C bending in alkenes), 783.93 cm⁻\\u0026sup1; (C\\u0026thinsp;=\\u0026thinsp;C bending in trisubstituted alkenes), and 683 cm⁻\\u0026sup1; (C-Br stretching in halo compounds) (Figure. 6A).\\u003c/p\\u003e \\u003cp\\u003eThe FTIR spectrum of the product extracted from methylene blue dye degraded by Enterobacter cloacae strain BHPGT-2024 exhibited peaks at 3684 cm⁻\\u0026sup1; (O-H stretching in alcohols), 3598.4 cm⁻\\u0026sup1; (O-H stretching in alcohols), 3444.6 cm⁻\\u0026sup1; (O-H stretching in alcohols), 3259 cm⁻\\u0026sup1; (O-H stretching in alcohols), 3169.6 cm⁻\\u0026sup1; (O-H stretching in carboxylic acids), 3126.8 cm⁻\\u0026sup1; (O-H stretching in alcohols), 2994.6 cm⁻\\u0026sup1; (C-H stretching in alkanes), 2159 cm⁻\\u0026sup1; (S-C\\u0026thinsp;=\\u0026thinsp;N stretching in thiocyanates), 1716 cm⁻\\u0026sup1; (C\\u0026thinsp;=\\u0026thinsp;O stretching in alpha, beta-unsaturated esters), 1541 cm⁻\\u0026sup1; (N-O stretching in nitro compounds), 1119.6 cm⁻\\u0026sup1; (C-N stretching in amines), 1005.4 cm⁻\\u0026sup1; (C-F stretching in fluoro compounds), and 619.64 cm⁻\\u0026sup1; (C-Br stretching in halo compounds) (Figure. 6B).\\u003c/p\\u003e \\u003cp\\u003eThe significant differences in the FTIR spectra between the control dye and its degradation products reveal that Enterobacter cloacae strain BHPGT-2024 biodegrades the dye into various metabolites. The alterations in the peaks of the supernatant after dye decolorization, compared to the original dye, indicate the dye's breakdown into intermediate products. The marked variations in the HPLC peaks, corroborated by FTIR analysis, confirm the biodegradation of methylene blue dye by Enterobacter cloacae strain BHPGT-2024.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.5 Analysis of HPLC Data\\u003c/h2\\u003e \\u003cp\\u003eThe chromatograms from the HPLC analysis of both the untreated dye and the treated solution are shown in Figure. 7. The HPLC analysis of the control methylene blue dye samples displayed a prominent peak at a retention time of 5.03 minutes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eA).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eFollowing decolorization by Enterobacter cloacae strain BHPGT-2024, the HPLC elution profile of the treated dyes revealed major peaks at 6.08 and 5.7 minutes, along with smaller peaks at 8.01 and 6.7 minutes, indicating that the parent dye structure was degraded (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eB). These changes in peak patterns and absorbance, as observed in the HPLC analysis, confirmed the biodegradation of the dyes, reflecting a decrease in dye concentration.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"4. Conclusion\",\"content\":\"\\u003cp\\u003eIn conclusion, the discharge of dye complexes from industrial effluents, particularly from textile industries, poses a substantial environmental threat due to the persistence and potential toxicity of synthetic dyes like Methylene Blue. This study successfully isolated and identified the bacterial strain Enterobacter cloacae BHPGT2024 from the agricultural fields of KL University, demonstrating its remarkable ability to degrade Methylene Blue dye. Under optimized conditions, this strain achieved an 82.1% decolorization efficiency at a concentration of 150 ppm within two days, as confirmed by UV, FT-IR, and HPLC analyses. These findings underscore the potential of Enterobacter cloacae BHPGT2024 as an eco-friendly solution for dye pollution, promoting green chemistry principles and the circular economy. The research highlights the importance of microbial biodiversity in environmental preservation and suggests innovative bioremediation strategies to address industrial dye pollution, contributing to a sustainable future.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003ch2\\u003eFunding:\\u003c/h2\\u003e \\u003cp\\u003eNo funding available for this resaerch\\u003c/p\\u003e\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\u003cp\\u003eGnanasekaran Ramakrishnan= MS preparationKoteswara Reddy Gujjula= AnalysisSai Sree Thanay Allam= Conducted workSesha Bhavana Jagarlapudi=MethodologyPraveen Tummalacharla, Priyanka Hutha Kosuri, Geya Govind= analysis and participated in writting MSBaji Shaik= Methodology and assayMekala Janaki Ramaiah = Over all MS prepatration, analysis\\u003c/p\\u003e\\u003ch2\\u003eAcknowledgement\\u003c/h2\\u003e\\u003cp\\u003eAuthors would like to thank KLEF management\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eBanu, A. N., Balasubramanian, C. (2015). Extracellular synthesis of silver nanoparticles using Bacillus megaterium against malarial and dengue vector (Diptera: Culicidae). \\u003cem\\u003eParasitology research\\u003c/em\\u003e, \\u003cem\\u003e114\\u003c/em\\u003e, 4069-4079.\\u003c/li\\u003e\\n\\u003cli\\u003eBartholomew, J. W., Mittwer, T. (1952). The gram stain. Bacteriological Reviews, 16(1), 1-29.\\u003c/li\\u003e\\n\\u003cli\\u003eBharathi, D., Nandagopal, J. G. T., Ranjithkumar, R., Gupta, P. K., Djearamane, S. (2022). Microbial approaches for sustainable remediation of dye-contaminated wastewater: a review. Archives of Microbiology, 204(3), 169.\\u003c/li\\u003e\\n\\u003cli\\u003eBhardwaj, D., Bharadvaja, N., (2021). Phycoremediation of effluents containing dyes and its prospects for value-added products: A review of opportunities. Journal of Water Process Engineering, 41, 102080.\\u003c/li\\u003e\\n\\u003cli\\u003eDinakarkumar, Y., Gnanasekaran, R., Reddy, G. K., Vasu, V., Balamurugan, P., Murali, G. (2024). Fungal bioremediation: An overview of the mechanisms, applications and future perspectives. \\u003cem\\u003eEnvironmental Chemistry and Ecotoxicology\\u003c/em\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eDutta, S., Adhikary, S., Bhattacharya, S., Roy, D., Chatterjee, S., Chakraborty, A., Rajak, P. (2024). Contamination of textile dyes in aquatic environment: Adverse impacts on aquatic ecosystem and human health, and its management using bioremediation. Journal of Environmental Management, 353, 120103.\\u003c/li\\u003e\\n\\u003cli\\u003eGnanasekaran, R., Yuvaraj, D., Reddy, G. K., Shangar, S. N., Vijayakumar, V., Iyyappan, J. (2024). Zinc oxide nanoparticles from leaf extract of Eclipta prostrata: Biosynthesis and characterization towards potential agent against film forming bacteria in metal working fluids. \\u003cem\\u003eEnvironmental Chemistry and Ecotoxicology\\u003c/em\\u003e, \\u003cem\\u003e6\\u003c/em\\u003e, 206-215.\\u003c/li\\u003e\\n\\u003cli\\u003eHashmi, S. S., Shah, M., Muhammad, W., Ahmad, A., Ullah, M. A., Nadeem, M., Abbasi, B. H. (2021). Potentials of phyto-fabricated nanoparticles as ecofriendly agents for photocatalytic degradation of toxic dyes and waste water treatment, risk assessment and probable mechanism. Journal of the Indian Chemical Society, 98(4), 100019.\\u003c/li\\u003e\\n\\u003cli\\u003eInternational Agency for Research on Cancer. (1997). IARC monographs on the evaluation of carcinogenic risks to humans. Polychlorinated dibenzo-para-dioxins and polychlorinated dibenzofurans.\\u003c/li\\u003e\\n\\u003cli\\u003eKarri, R. R., Ravindran, G., Dehghani, M. H. (2021). Wastewater sources, toxicity, and their consequences to human health. In Soft computing techniques in solid waste and wastewater management (pp. 3-33). Elsevier.\\u003c/li\\u003e\\n\\u003cli\\u003eKathing, C., Saini, G., (2022). A review of various treatment methods for the removal of dyes from textile effluent. Recent Progress in Materials, 4(4), 1-15.\\u003c/li\\u003e\\n\\u003cli\\u003eKishor, R., Purchase, D., Saratale, G. D., Ferreira, L. F. R., Bilal, M., Iqbal, H. M., Bharagava, R. N. (2021). Environment friendly degradation and detoxification of Congo red dye and textile industry wastewater by a newly isolated Bacillus cohnni (RKS9). Environmental Technology \\u0026amp; Innovation, 22, 101425.\\u003c/li\\u003e\\n\\u003cli\\u003eKishor, R., Saratale, G. D., Saratale, R. G., Ferreira, L. F. R., Bilal, M., Iqbal, H. M., Bharagava, R. N. (2021). Efficient degradation and detoxification of methylene blue dye by a newly isolated ligninolytic enzyme producing bacterium Bacillus albus MW407057. Colloids and Surfaces B: Biointerfaces, 206, 111947.\\u003c/li\\u003e\\n\\u003cli\\u003eKonduri, M. K., Koteswarareddy, G., Rohini Kumar, D. B., Venkata Reddy, B., Lakshmi Narasu, M. (2011). Effect of pro‐oxidants on biodegradation of polyethylene (LDPE) by indigenous fungal isolate, Aspergillus oryzae. \\u003cem\\u003eJournal of Applied Polymer Science\\u003c/em\\u003e, \\u003cem\\u003e120\\u003c/em\\u003e(6), 3536-3545.\\u003c/li\\u003e\\n\\u003cli\\u003eLuo, S., Liu, C., Zhou, S., Li, W., Ma, C., Liu, S., He, S. (2020). ZnO nanorod arrays assembled on activated carbon fibers for photocatalytic degradation: Characteristics and synergistic effects. Chemosphere, 261, 127731.\\u003c/li\\u003e\\n\\u003cli\\u003eOladoye, P. O., Ajiboye, T. O., Omotola, E. O., Oyewola, O. J. (2022). Methylene blue dye: Toxicity and potential elimination technology from wastewater. Results in Engineering, 16, 100678.\\u003c/li\\u003e\\n\\u003cli\\u003ePiaskowski, K., Świderska-Dąbrowska, R., Zarzycki, P. K. (2018). Dye removal from water and wastewater using various physical, chemical, and biological processes. Journal of AOAC International, 101(5), 1371-1384.\\u003c/li\\u003e\\n\\u003cli\\u003eRamsay, R. R., Dunford, C., Gillman, P. K. (2007). Methylene blue and serotonin toxicity: inhibition of monoamine oxidase A (MAO A) confirms a theoretical prediction. British journal of pharmacology, 152(6), 946-951.\\u003c/li\\u003e\\n\\u003cli\\u003eReddy, G. K., Kiran, Y., (2019). A theoretical mechanism in the degradation of polyolefin plastic waste using phytochemical oxidation process. \\u003cem\\u003eThe Journal of Solid Waste Technology and Management\\u003c/em\\u003e, \\u003cem\\u003e45\\u003c/em\\u003e(4), 468-478.\\u003c/li\\u003e\\n\\u003cli\\u003eReddy, G. K., Yarrakula, K., (2018). Assessment of contamination levels and ecological risk indices of environmentally hazardous metals for granite mining waste. \\u003cem\\u003eIndian Journal of Ecology\\u003c/em\\u003e, \\u003cem\\u003e45\\u003c/em\\u003e(1), 227-234.\\u003c/li\\u003e\\n\\u003cli\\u003eSharma, J., Sharma, S., Soni, V. (2021). Classification and impact of synthetic textile dyes on Aquatic Flora: A review. Regional Studies in Marine Science, 45, 101802.\\u003c/li\\u003e\\n\\u003cli\\u003eSivakumar, R., Lee, N. Y., (2022). Adsorptive removal of organic pollutant methylene blue using polysaccharide-based composite hydrogels. Chemosphere, 286, 131890.\\u003c/li\\u003e\\n\\u003cli\\u003eUllah, A. K. M. A., Kibria, A. K. M. F., Akter, M., Khan, M. N. I., Tareq, A. R. M., Firoz, S. H. (2017). Oxidative degradation of methylene blue using Mn3O4 nanoparticles. Water Conserv Sci Eng 1: 249\\u0026ndash;256.\\u003c/li\\u003e\\n\\u003cli\\u003eVutskits, L., Briner, A., Klauser, P., Gascon, E., Dayer, A. G., Kiss, J. Z., Morel, D. R. (2008). Adverse effects of methylene blue on the central nervous system. \\u003cem\\u003eThe Journal of the American Society of Anesthesiologists\\u003c/em\\u003e, \\u003cem\\u003e108\\u003c/em\\u003e(4), 684-692.\\u003c/li\\u003e\\n\\u003cli\\u003eReddy, G.K., Yarrakula, K. (2019). Geo-chemical exploration of granite mining waste using XRD, SEM/EDX and AAS analysis. \\u003cem\\u003eIranian Journal of Chemistry and Chemical Engineering, 38\\u003c/em\\u003e(2), 215-228.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Methylene Blue, Decolourization, Enterobacter Cloacae, UV-Spectrophotometer, FT-IR, HPLC\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-5259849/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-5259849/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eThe discharge of dye complexes from industrial effluents, especially from textile industries, remains a significant environmental concern. Synthetic dyes such as Methylene Blue contribute notably to pollution due to their persistence and potential toxicity, which disrupt ecosystems and pose health risks via bioaccumulation. Traditional dye removal methods are often expensive and environmentally harmful. This research focuses on isolating bacterial strains from the agricultural fields of KL University, screening them for their decolourization efficiency of Methylene Blue, and optimizing culture parameters for effective decolourization. The study investigates Enterobacter cloacae strain BHPGT2024, which shows a remarkable capability to degrade Methylene Blue at a concentration of 150 ppm, with reduced efficiency at higher concentrations. The strain achieved an 82.1% dye degradation capacity within 2 days at 37\\u0026deg;C and 120 rpm. The degradation process was analysed using UV, FT-IR, and HPLC analyses, confirming the bacterium's ability to metabolize the dye into harmless byproducts under aerobic conditions. This strain offers an eco-friendly solution to dye pollution, aligning with green chemistry principles and circular economy goals. The findings highlight the potential of microbial biodiversity in ecological preservation and pave the way for innovative bioremediation strategies, representing a promising advancement towards mitigating industrial dye pollution and fostering a sustainable future.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Sustainable Biodegradation of Methylene Blue Dye by Enterobacter cloacae Strain BHPGT2024\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-12-02 09:38:30\",\"doi\":\"10.21203/rs.3.rs-5259849/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"ebc036c9-cfba-4ec6-8888-dc9404240597\",\"owner\":[],\"postedDate\":\"December 2nd, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-07-25T06:53:59+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-12-02 09:38:30\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-5259849\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-5259849\",\"identity\":\"rs-5259849\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}