{"paper_id":"0f4c1947-e4b6-4b8a-aa7c-2e557c3d78fa","body_text":"1 \nEvolution of Origin Sequence and Recognition for Licensing of 1 \nEukaryotic DNA Replication 2 \n 3 \n 4 \nJack Bauer1,2*, Narges Zali 1,3*, Om Prakash Chouhan 1, Osama El Demerdash1, Kaiser Loell1, 5 \nJustin B. Kinney1, Leemor Joshua-Tor1,4 and Bruce Stillman1 6 \n 7 \n1. Cold Spring Harbor Laboratory, 1 Bungtown Road, Cold Spring Harbor, NY 11724 8 \n2. Graduate Program in Molecular and Cellular Pharmacology, Stony Brook University, Stony 9 \nBrook, NY 11794 10 \n3. Graduate Program in Genetics, Stony Brook University, Stony Brook, NY 11794 11 \n4. Howard Hughes Medical Institute 12 \n 13 \n*Co-first authors 14 \nCorrespondence: BS: stillman@cshl.edu; LJ: leemor@cshl.edu 15 \n 16 \nAbstract 17 \nThe large size of eukaryotic chromosomes necessitates that the initiation of DNA replication 18 \noccurs at numerous origins of DNA replication. In S. cerevisiae, origins are highly DNA sequence-19 \nspecific and are recognized by the Origin Recognition Complex (ORC) . In contrast, most 20 \neukaryotes have lost features in ORC  subunits that contribute to  DNA sequence -specific 21 \nrecognition, raising the question of how origins are identified. An analysis of origins in the genome 22 \nof the distantly related budding yeast Yarrowia lipolytica identified considerable variability in origin 23 \nsequence and structure . High-resolution structures demonstrate that Y. lipolytica  origins are 24 \nrecognized by a combination of  ORC and Cdc6 in a manner different from S. cerevisiae. The 25 \nstructure of Yarrowia ORC-Cdc6 bound to different origins shows considerable plasticity in 26 \nprotein-DNA interactions. We compare these yeast structures to the structure of human ORC -27 \nCDC6 bound to DNA. These studies reveal information on the evolution of origin s and origin 28 \nrecognition.  29 \n 30 \nNomenclature note: There is a different nomenclature for proteins in yeast and human cells. For 31 \nexample, Cdc6 in yeasts is CDC6 in human cells. 32 \nIntroduction 33 \nThe genome in eukaryotic cells is distributed over multiple large chromosomes that each contain 34 \nnumerous origins of DNA replication to ensure that all of the DNA is duplicated precisely once per 35 \ncell division cycle 1–4.  The location of origins in the genome is marked by the assembly of pre-36 \nReplicative Complexes (pre-RCs) prior to the initiation of actual DNA synthesis from each origin. 37 \nPre-RCs are assembled on all potential origins, usually following exit from the previous mitosis or 38 \nduring G1 -phase 5–11.  The best characterized system for understanding the biochemistry of 39 \ncomplete DNA replication, including pre-RC assembly, derives from studies of the budding yeast 40 \nS. cerevisiae 5,7,12–17. 41 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 2 \nIn S. cerevisiae, pre-RCs are assembled by the binding of the Origin Recognition Complex (ORC) 42 \nto specific DNA sequences called Autonomously Replicating Sequences (ARSs) that determine 43 \nthe location of ~500 origins in the 13Mb genome 7,18,19. ORC, a six-subunit ATPase, binds to and 44 \nbends the origin DNA and then recruits the Cdc6 ATPase. Together, these proteins load two 45 \ncopies of the Mcm2-7 hexamer that are chaperoned by the Cdt1 protein to form the MCM double 46 \nhexamer ( DH) 5,6,16,17,20.  The MCM DH is destined to separate into two divergent replicative 47 \nhelicases called the CMG  (Cdc45-Mcm2-7-GINS), which encompasses Cdc45, the Mcm-2-7 48 \nhexamer, and the four-subunit GINS complex 21. The assembly of the helicase and subsequent 49 \nreplication of DNA occurs following activation of the pre -RC by the S -phase Cyclin-Dependent 50 \nKinases (CDKs) and the Cdc7-Dbf4 kinase (DDK) 16.  51 \nThe origins of DNA replication in S. cerevisiae consist of multiple essential or important DNA 52 \nelements. The A and B1 DNA elements are recognized by ORC, whereas the B2 element is a 53 \nweak ORC binding site that is in an inverted orientation  and of variable distance from the A and 54 \nB1 elements 12,22–26.  Depending on this distance, two modes of assembly of pre-RCs can occur, 55 \none requiring only a single ORC and the other involving two separate ORCs  12,17,26,27.  Since the 56 \ngenome of S. cerevisiae is relatively compact with little repeat sequences and has very short 57 \nintergenic DNA regions, origins of DNA replication have most likely evolved to be highly DNA 58 \nsequence-specific and located in non-transcribed regions of the genome so that the initiation of 59 \nDNA replication does not conflict with gene transcription 28.  As a consequence, most S. cerevisiae 60 \norigins are located within the short intergenic DNA sequences.  18,29  Origin specificity in S. 61 \ncerevisiae occurs in part by the interaction of an a-helix in the Orc4 subunit that inserts into a 62 \nmajor groove in the origin DNA, a loop in the Orc2 subunit that inserts into a minor groove in the 63 \norigin DNA, and a lysine-rich region in the intrinsically disordered domain of Orc1 that also binds 64 \na DNA minor groove 28,30–32.  65 \nA small clade of budding yeasts that are evolutionarily related to S. cerevisiae , including 66 \nKluyveromyces lactis and Lachancea kluyveri have ARSs and origins that are related in sequence 67 \nto the S. cerevisiae origins 33,34.  The Orc2 loop and Orc4 a-helix in these species are conserved 68 \n35. In contrast, all other eukaryotes, including other budding yeasts and fungi, and all animals and 69 \nplants have either lost completely or truncated these origins recognition elements 1,35. In some 70 \nbudding yeasts such as Candida albicans  and Pichia pastoris , ARS sequences have been 71 \ncharacterized and are very different from the S. cerevisiae clade of ARS sequences, 36,37  but the 72 \nmanner in which the proteins interact with them has not been addressed. Other yeasts, such as 73 \nthe fission yeast S. pombe, have gained an unusual A/T-rich hook domain in Orc4 that binds to 74 \nthe A.T-rich origins of DNA replication, but this mode of origin recognition is not common. Similar 75 \nto pre -RC assembly using purified  S. cerevisiae proteins, 38,39  pre-RC assembly has been 76 \nreconstituted with purified human proteins, demonstrating  both a one -ORC and a two-ORC 77 \nmechanism of MCM DH loading onto non-specific DNA 17,40–42.  While this may suggest that ORC 78 \ncan determine the location of origins of DNA replication in human cells, a meta-analysis of multiple 79 \nstudies that mapped ORC and MCM binding sites in the human genome showed a very poor 80 \ncorrelation with the location of origins of DNA replication 43.  This may be due to technical reasons, 81 \nbut there remains the matter of  how origin recognition, and hence the specification of origin  82 \nlocation in most eukaryotes occurs. 83 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 3 \nIn animal cells, such as C. elegans, Drosophila and mammalian cells , including human cell s, 84 \norigins of DNA replication have been mapped and they cor relate with genomic features such as 85 \nhistone modifications, higher-order chromosome structure, and in many cases transcription start 86 \nsites 1–3,44,45. For example, in C. elegans, the efficiency of origins of DNA replication is associated 87 \nwith histone H3-lysine-4-dimetylation (H3K4me2) and histone H3-lysine27-acetylation (H3K27Ac) 88 \n46. In Drosophila and human cells, DNA topology and certain chromatin features mark replication 89 \norigins, and they are commonly associated with regions that contain nearby predicted G4-quartet 90 \nDNA structures 47–51. In human cells, origins of DNA replication are located both at specific loci 91 \nsuch as open chromatin regions, but initiation of DNA replication can  also occur in a distributed 92 \nfashion, where stochastic origin firing takes place in chromosome replication initiation domains 93 \n44,45,52–57. How these specific and distributed origins are specified is not known, but speculation 94 \nabout epigenetic marking of the initiation of DNA replication is common 4,44,58,59.  95 \nIn a study of the mechanism of origin specificity in S. cerevisiae, we noticed that the Orc4 a-helix 96 \nand Orc2 loop that provided DNA sequence-specific interactions with origins were only conserved 97 \nin the small clade of S. cerevisiae-related budding yeasts, whereas many other budding yeasts 98 \nand all other eukaryotes , including plants and animals,  including human ORC, lacked these 99 \nconserved features 28. In this report, we  first determined the structure of human ORC -CDC6 100 \nbound to a G/C rich DNA. Though we observed DNA bending seen in all ODC complexes to date 101 \nas well as a surprising minor groove contact, we reasoned that a stronger evolutionary 102 \nperspective would aid in understanding origin specification. We therefore began studies on 103 \nYarrowia lipolytica, which lacked the origin-recognition features seen in S. cerevisiae. Y. lipolytica 104 \nis a non-conventional, oleaginous yeast that is widely used in biotechnology whose last common 105 \nancestor with S. cerevisiae existed ~300 million years ago 60. Unlike S. cerevisiae, Yarrowia is 106 \nheterothallic, having two separate mating types, MatA and MatB. Previous studies identified a few 107 \norigins that are located near centromeres , probably because , unlike S. cerevisiae  ARSs, 108 \npropagation of extra-chromosomal plasmids in Yarrowia requires both a centromere and an origin 109 \nsequence on the plasmid 61–64. To study DNA replication in Yarrowia more thoroughly, we mapped 110 \nthe location of origins in all six chromosomes, demonstrating a genome organization of replication 111 \ntiming domains reminiscent of those in the genomes of animal cells , including human cells. 112 \nGenetic analysis of two of these origins, one a centromere -associated origin and the other an 113 \norigin on a chromosome arm , uncovered a short ~30 bp essential region , and massive parallel 114 \nmutational analysis revealed that Y. lipolytica  origins of DNA replication are heterogeneous. 115 \nStructural studies of ORC and Cdc6 bound to the two different origin DNA sequences 116 \ndemonstrated that, unlike S. cerevisiae, Y. lipolytica origin recognition required both ORC and 117 \nCdc6 for base -specific interactions and hence origin recognition, with some protein -DNA 118 \ninteractions varied between the two origins.  The results show a surprising plasticity in origin 119 \nsequences, structure, and recognition in different eukaryotes. We discuss the evolution of origin 120 \nrecognition and specificity. 121 \n 122 \nResults 123 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 4 \nCryo-EM structure of the human ORC–DNA–CDC6 complex 124 \n 125 \nThe human ORC and CDC6 bound to DNA (HsODC) was reconstituted by combining HsORC1–126 \n5, HsCDC6, and DNA in vitro. Since the sequence specificity of HsORC remains unknown, a 127 \ndefined DNA 60 base -pair fragment with 70% G /C content was selected for complex assembly 128 \nafter confirming ORC binding through biochemical assays. The 2.6 Å -resolution cryoEM map 129 \n(Figures 1A, S1A and S1B ) enabled the unambiguous placement of all five ORC subunits, 130 \nHsCDC6, and the bound DNA. The N-terminal regions of HsORC1 (amino acids 1-465), HsORC2 131 \n(aa 1-165), and HsCDC6 (aa 1 -151) proteins, which consist of intrinsically disordered regions 132 \n(IDRs) are disordered and therefore not visible. Of the 60 -bp DNA used , 29-bp were built with 133 \nconfidence, and density corresponding to four ATP analogs was clearly resolved at the conserved 134 \nnucleotide-binding sites within ORC. Local resolution analysis demonstrated that the AAA+ 135 \n(ATPases Associated with diverse Activities) core of the complex, comprising RecA-like domains 136 \nfrom each ORC subunit and HsCDC6, was better resolved than the central DNA, which exhibited 137 \nflexibility and correspondingly lower resolution.  138 \n 139 \nOverall architecture .  HsODC adopts a closed -ring conformation, in which all six protein 140 \ncomponents encircle a centrally located DNA duplex. The complex has a two -tiered layered 141 \nappearance, with the AAA+ domains forming one layer and the winged -helix domains (WHD) 142 \nforming a second layer. Each WHD from one subunit sits atop the AAA+ domain of a neighboring 143 \nsubunit (Figure 1B, Suppl. Video 1). The HsODC structure is very similar to HsORC1 -5 bound 144 \nto DNA that copurified from the expression host cells (PDB ID: 7JPS) 65, with HsCDC6 closing the 145 \nring around the DNA. The overall RMSD between the two structures is 4.0 Å  over backbone 146 \natoms, without the DNA and HsCDC6, though the RMSD between individual subunits is 147 \nconsiderably lower (between 0.6 and 1.5 Å). The HsCDC6 AAA+ domain is nestled between the 148 \nAAA+ domains of HsORC1 and HsORC2, and its WHD sits on top of the AAA+ domain of 149 \nHsORC1. The higher resolution of this structure , compared to ORC -DNA alone 65,66, brings 150 \nadditional features into view. The HsORC2 WHD was not visible in the HsORC structure but there 151 \nis clear density for this domain in the HsODC structure, which is situated above the RecA domain 152 \nof HsCDC6. There is a slight widening of ~4.2Å at the interface between HsORC1 and HsORC2, 153 \ncreating sufficient space to accommodate HsCDC6. This local broadening allows the RecA 154 \ndomain of HsCDC6 to insert into the gap, where it establishes contacts with both HsORC1 and 155 \nHsORC2. An additional ATP -binding site is formed between HsCDC6 and HsORC1, as is the 156 \ncase for ScODC and DmODC 67–69 .  157 \n 158 \nDNA bending.  Previous studies in S. cerevisiae have shown that DNA bending mediated by 159 \nORC is important for origin licensing and subsequent MCM loading  17,25,31,70 . In S. cerevisiae, 160 \nreplication origins contain an A/T -rich ARS consensus sequence (ACS) and ORC bends DNA 161 \ndownstream of the ACS site by 40–55° relative to the axis of ORC’s central DNA-binding channel. 162 \nThis bending is primarily driven by a basic amino acid patch within the Orc5 subunit (ORC5-BP), 163 \nwhich contains a long loop (AA 350 - 370) enriched with glycine and alanine residues, which 164 \nconfer flexibility, along with basic amino acids that extend into the DNA minor groove. In our 165 \nHsODC structure, we observe clear density for only two HsORC5 arginine residues that make 166 \nlimited contacts with the DNA backbone and are at the very beginning of this highly flexible loop 167 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 5 \n(Figure 1C ). The rest of the loop is disordered ( Figure S1C). These interactions might be 168 \ninsufficient to achieve the degree of bending seen in S. cerevisiae ODC, resulting in a more 169 \nmodest bend of ~20° relative to the axis of the central DNA -binding channel. This difference 170 \nsuggests that the mechanism of DNA engagement and bending by human ODC may either be 171 \ninherently less pronounced than in yeast, potentially reflecting species -specific adaptations in 172 \norigin recognition, or that reduced bending may reflect the fact that the DNA used is not a bona 173 \nfide origin.  174 \n 175 \nORC-CDC6 engages DNA through backbone interactions with all protein subunits.  Detailed 176 \nexamination of the cryo-EM structure revealed that the five subunits of human ORC ( HsORC1–177 \n5) and HsCDC6 engage directly with the DNA duplex (Figure 1C and S1D). The majority of these 178 \ninteractions are mediated through the RecA-like domains of the ORC subunits. Notably, only the 179 \nWHDs of HsORC3 and HsORC5 make direct contacts with the DNA, rather than all of them in the 180 \ncase of ScODC, suggesting a specialized role for these WHDs in stabilizing DNA binding within 181 \nthe closed -ring architecture during the assembly of the pre -Replicative Complex. The high -182 \nresolution of the cryo-EM map enabled detailed mapping of the protein–DNA interface within the 183 \nODC. HsORC1 engages the DNA through residues T593 and H596, positioned to interact with 184 \nthe phosphate backbone near the DNA entry point of the complex. HsORC2 contacts DNA via 185 \nT365 and R367. HsORC3 contributes a cluster of residues—R641, K697, and Q698 that interact 186 \nwith the DNA backbone. Like all other ORC subunits, HsORC4 also exhibits a DNA-binding 187 \ninterface, with residues K127, F129, S131, and T391 forming a broad contact surface that likely 188 \nplays a role in anchoring the DNA and stabilizing the complex (Figure 1C).  189 \n 190 \nA particularly notable feature is the DNA -binding mode of HsORC5, which utilizes its WHD to 191 \nengage the DNA through a cluster of basic residues —R322, R326, and Y432. These residues 192 \nform a distinct basic patch that establishes strong electrostatic interactions with the phosphate 193 \nbackbone of the DNA. This interaction likely contributes to the bending of the DNA toward the 194 \nprotein surface. Such localized bending may play a critical role in the structural remodeling of the 195 \norigin DNA, enabling the recruitment and loading of downstream replication factors, such as the 196 \nMCM2–7 helicase, as shown for ScODC  70. HsCDC6 also participates in DNA binding, 197 \ncontributing contacts via residues T236, T238, and Q240 to the phosphate backbone of the DNA. 198 \nThese protein -DNA interactions across all six subunits establish a high -affinity DNA -binding 199 \nsurface that facilitates origin recognition and pre-Replicative Complex assembly.  200 \n 201 \nA direct interaction with a DNA base.  Since sequence-specific origins have yet to be identified 202 \nin metazoans, we initially expected to observe only non -specific interactions with the DNA 203 \nbackbone. However, residue R367 from HsORC2 appears to extend into the minor groove of the 204 \nDNA and interact with a nitrogen base edge (Figure 1D and S1E). Although the cryo-EM density 205 \nfor the full guanidinium group of the arginine side chain is incomplete, the visible portion is 206 \nsufficient to model its orientation and infer that it is positioned to form hydrogen bonds with the 207 \nadenine and adjacent thymine base (Figure S1E). This type of contact is noteworthy, as minor 208 \ngroove base interactions can contribute to sequence-preferential recognition, even in proteins or 209 \nDNA that are not strictly sequence -specific. The neighboring residue, T365, binds the DNA 210 \nphosphate backbone and likely stabilizes the orientation of R367, effectively “locking” it into 211 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 6 \nposition.  Although the DNA used in this study is not derived from a bona fide origin sequence, 212 \nthe structural arrangement of T365 and R367 suggests a potential mechanism by which HsORC2 213 \ncould engage in limited DNA sequence-dependent recognition.  214 \n 215 \nNucleotide binding sites . The HsODC complex was assembled in the presence of the non -216 \nhydrolyzable ATP analog AMPPNP. As in most AAA+ ATPases, including ORC, nucleotide 217 \nbinding occurs at the interface between adjacent subunits, where conserved motifs from 218 \nneighboring proteins contribute to the formation of the nucleotide-binding pocket 71 . Upon addition 219 \nof CDC6 to the human ORC complex, we observed additional density corresponding to a 220 \nnucleotide at the interface between CDC6 and ORC1, with HsORC1 R670 serving as the arginine 221 \nfinger, and HsCDC6 residues R388 and K208 coordinate the β- and γ-phosphates of ATP. The 222 \ncryo-EM densities for all four -nucleotide binding regions were sufficiently well -resolved to allow 223 \nmodeling of a magnesium ion coordinated near the ATP analog (Figure S1F). 224 \nGenome-wide identification of origins of DNA replication in Yarrowia lipolytica  225 \nTo investigate the evolution of origin recognition , we identified origins of DNA replication in 226 \nYarrowia lipolytica (Figure 2A). A strain of Y. lipolytica was constructed that expressed the Herpes 227 \nSimplex Virus thymidine kinase (HSVTK) and the human Equilibrative Nucleoside Transporter 1 228 \n(ENT1) proteins to enable incorporation of the thymidine analog 5-ethynyl-2′-deoxyuridine (EdU). 229 \nThe temporal dynamics of DNA replication in  Y. lipolytica  was investigated by EdU -labeling 230 \nfollowing synchronization of cells by nutrient starvation and release into the cell division cycle by 231 \nre-feeding. EdU -positive cells were visualized using fluorescence microscopy and quantified 232 \nalongside budding index as an indicator of S-phase entry (Figure S2A and S2B). The peak of S 233 \nphase under these conditions was 60-75 minutes post release, however, when the DNA synthesis 234 \ninhibitor hydroxyurea (HU) was added, replication progression was slower, but more synchronous 235 \n(Figures 2A and S2C).   236 \nThe whole genome landscape of DNA replication in  Y. lipolytica was determined by continuous 237 \nlabeling of DNA replication with EdU in the presence and absence of HU and harvesting the cells 238 \nat different times post release. Compared to S. cerevisiae , where 200mM HU inhibits DNA 239 \nreplication and cell viability, Y. lipolytica is very sensitive to HU . While in the presence of 5mM 240 \nHU, cells can still progress through the cell cycle, higher levels of HU inhibit cell proliferation and 241 \ncell viability. Labeled DNA was detected by sequencing and mapped to a  high-quality genome 242 \nassembly 72 . A total of 634 replication origin peaks were identified with much sharper peaks when 243 \nHU was added  due to checkpoint inhibition of replication fork progression , allowing better 244 \ndefinition of the temporal activation of origins during S phase (Figure 2A). Importantly, HU did 245 \nnot alter origin location. Early replicating origins were first detected at 30 minutes post release 246 \nand the latest active origins appeared at 120 minutes. Of the 634 replication origins identified 247 \ngenome-wide, 289 were classified as early -firing under HU treatment.  Most origins were in 248 \nintergeneic regions of the genome, with some at transcription start sites (Figure 2B). 249 \nImportantly, the spatial distribution of timing of activation of replication origins across the 250 \nchromosomes was not distributed uniformly, but instead formed discrete 150–300 kb clusters of 251 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 7 \norigins that were activated at the same time (Figure 2C), closely resembling the replication timing 252 \ndomains described in the chromosomes of higher eukaryotes 73,74.  253 \nGenetic analysis of two Yarrowia origins of DNA replication  254 \nThe 634 origins were annotated by referring to the chromosome (A through F) and counting each 255 \norigin from the left telomer e to the right telomere. For example, OriA-006 is a newly discovered 256 \norigin that is the sixth from the left telomere o n chromosome A. To genetically characterize the 257 \nDNA sequences under the EdU -seq peaks, we tested two origins using ARS assays: the 258 \npreviously characterized, centromere-associated OriC-061 (previously called ARS18 or Ori3018) 259 \n61,62 and OriA-006. Unlike ARSs in S. cerevisiae in which an origin can support  high frequency 260 \ntransformation (HFT) and plasmid stability, Y. lipolytica requires both a centromere and an origin 261 \nof DNA replication be present on the mini-chromosome (Figure S3A) 61. Both OriA-006 and OriC-262 \n061 supported robust  plasmid replication when cloned into an Ori⁻/CEN⁺ plasmid backbone , 263 \nincluding equivalent ARS activity (both HFT and plasmid stability) when placed in either 264 \norientation or at variable distances from the centromere (Figure S3B). In contrast, two 600 bp 265 \nfragments not associated with EdU-seq peaks, one derived from a coding region on Chromosome 266 \nD and the other from a non -coding intergenic region on Chromosome E, could not support ARS 267 \nactivity (Figure S3C). These findings demonstrate that not all genomic sequences can function 268 \nas replication origins, highlighting the requirement for specific DNA elements. Furthermore, they 269 \nreinforce the reliability of EdU-seq in identifying biologically active replication origins and provide 270 \na foundation for dissecting the sequence and structural features critical for origin function in  Y. 271 \nlipolytica. 272 \nLinker scan mutagenesis 75 overcomes concerns that deletion mutations can alter the spacing of 273 \nessential DNA sequences and was previously employed to dissect the structure of S. cerevisiae 274 \norigins 22–24.  We therefore used linker scanning to analyze  the sequence requirements of Y. 275 \nlipolytica origins within the 600 bp OriC-061 and OriA-006 fragments (Figure 3A and 3B). Each 276 \nmutant was screened for high-frequency transformation (HFT) and plasmid stability. In OriC-061, 277 \n45 linker mutants were tested  and substitutions at positions 2 –6 severely reduced or abolished 278 \nHFT and plasmid stability, identifying this region as critical for replication initiation (Figure 3A). 279 \nMutations outside this core retained wild -type–like stability (~41%), suggesting they are 280 \ndispensable for origin function. For OriA-006, linker insertions between positions 25–29 reduced 281 \nor eliminated both transformation efficiency and plasmid maintenance  (Figure 3B). Together, 282 \nthese results demonstrated that replication origin activity in Y. lipolytica is dependent on a short 283 \n~30 bp sequence of DNA. These sequences are sufficient for origin activity since for each origin, 284 \na 50 bp fragment supported ARS activity in the presence of a CEN (Figure S3D). 285 \nStructures of Yarrowia ORC-Cdc6 Bound to Different Origin DNAs  286 \nOrigin DNA sequences are required for Cdc6 DNA binding.  A Cdc6 DNA-binding assay using 287 \nsize exclusion chromatography (SEC) was developed to test whether specific DNA sequences 288 \nwere required for Cdc6 to co -elute with ORC. A 54 bp fragment of OriC-061 or a scrambled 289 \nversion of the DNA with the same G/C content was used. Wild-type OriC-061 DNA and some 290 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 8 \nCdc6 co-eluted with ORC (Figure 4A top, fractions 3 and 4 ), however, when the scrambled 291 \nDNA was used, ORC binding to DNA was greatly reduced and Cdc6 no longer co -eluted with 292 \nORC (Figure 4A, bottom). This was validated by mass photometry (Figure S4A). 293 \n 294 \nStructure of YlORC-DNAOriC-061-YlCdc6 suggests sequence-specific binding. Cryo-electron 295 \nmicroscopy (cryo-EM) was used to gain insight into the mechanism of YlORC origin binding. Using 296 \nthe 54bp DNA fragment of OriC-061 in complex with YlORC and YlCdc6, a 2.7 Å resolution 297 \nstructure of the YlORC-DNA54bpOriC-061-YlCdc6 (ODC) complex was obtained (Figure 4B, Suppl. 298 \nVideo 2 and Video 3 , Figure S4B ). The winged-helix (WHD) and AAA+( -like) domains of all 299 \nYlOrc1-5 and YlCdc6 proteins were visible in addition to the second TFIIB domain and C-terminal 300 \nα-helix of YlOrc6 (Figure S4C). A somewhat weaker and less defined density for Orc2 -WHD 301 \nindicates flexibility of the domain while bound to DNA and Cdc6. In addition, neither the Orc1 302 \nbromo-adjacent homology (BAH) domain nor the N-terminal TFIIB domain of Orc6 were visible. 303 \n 304 \nAkin to many AAA+ protein complexes and all ORC -Cdc6 structures determined to date  67–69, 305 \nOrc1-5 and Cdc6 form a two -tiered hexameric ring with ATP -binding sites between the AAA+ 306 \ndomains of Cdc6/Orc1, Orc1/Orc4, Orc4/Orc5, and Orc3/Orc5, along with the contacts between 307 \nthe AAA+ domains of the other subunits forming the first tier (Figure S4D). ATP and Mg2+ were 308 \nobserved in the ATPase binding sites between Orc1/Orc4 and Cdc6/Orc1, while the Orc3/Orc5 309 \nand Orc4/5 sites contained ADP in the YlORC -DNA54bpOriC-061-YlCdc6 maps generated from gel 310 \nfiltration-derived samples (Figure S4D). The winged-helix domain of each subunit sits atop the 311 \nadjacent subunit’s AAA+ domain, forming a domain -swapped second tier. Similar to the S. 312 \ncerevisiae ODC (ScODC) structures 67,69, the C-terminal TFIIB domain (TFIIB-B) and C-terminal 313 \nα-helix of Orc6 are visible. Like ScOrc6, YlOrc6 makes limited contacts with DNA and binds to 314 \nthe complex in multiple places: the TFIIB -B domain contacts part of the Orc2 N -terminal coil 315 \n(residues 106-165), the WH domain of Orc3, and a small portion of the Orc5 basic patch (Orc5 -316 \nBP, residues 348-364), and to the Orc3 protrusion with Orc6’s C-terminal α-helix.  Differing from 317 \nprevious ODC structures , two small segments of the Cdc6 N -terminal IDR are bound to Orc1: 318 \nCdc6[1-13] binds to the exterior surface of the complex between Orc1-AAA and Orc4-AAA, while 319 \nCdc6[13-20] binds near the interface of Orc1 -AAA and Cdc6 -WHD (Figure S4E). Due to the 320 \npartial occupancy of both segments within the density map, we suggest that this region can bind 321 \nto Orc1 in either of the two conformations. 322 \n 323 \nThe sharpness of the DNA in the cryo -EM map was immediately evident, with purine and 324 \npyrimidine densities at each respective position easily discernible, and base identities apparent 325 \nat most positions, indicating that the DNA is positioned in a discrete manner relative to the protein, 326 \nimplying that YlORC -Cdc6 binds to Ori sequences in a DNA sequence-dependent manner 327 \n(Figure S4 F). The pattern of identifiable bases was u sed to define its register. The DNA is 328 \nsignificantly bent, similar to the DNA in ScODC structures 67,69, with a 40° bend occurring near the 329 \ninterface between the WHD and AAA+ domains of the complex. 330 \n 331 \nYlORC/YlCdc6 binds Ori DNA specifically . From the structural analysis, the interactions 332 \nbetween ORC/Cdc6 and DNA can be grouped into three sequence elements: A central region 333 \nwith major/minor groove and phosphate backbone contacts comprised predominantly of Orc4 and 334 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 9 \nCdc6 side chains we coined the Orc4/Cdc6 -interacting element, the AT element consisting of 335 \nminor groove and backbone interactions involving multiple subunits and a water -mediated 336 \nhydrogen bonding network at one end of the origin, and the Orc5 basic patch (Orc5-BP) element 337 \non the opposite side of the origin, with minor groove, backbone, and water -mediated hydrogen 338 \nbonding interactions carried out by Orc2 and Orc5 (Figure 4C).  339 \n 340 \nThe Orc4/Cdc6 -interacting element is proximal to the large bend in the DNA and a site of 341 \nsignificant minor groove compression. K465 of YlOrc4 makes sequence-specific contacts with the 342 \ncarbonyls of G31 and G32 in the major groove of the Y strand DNA (Figures 4C and 4D, bottom 343 \nright). This lysine emanates from an a-helix in the insertion loop, similar in location to the α-helix 344 \nof S. cerevisiae Orc4 (ScOrc4) in the ScODC complex that inserts itself into the major groove of 345 \nthe DNA for sequence -specific binding. The YlOrc4 insertion helix is considerably smaller than 346 \nthat of ScOrc4 (Figure S4G). It is angled so that a stretched K465 side chain reaches into the 347 \nDNA major groove , and salt-bridge interactions between K462, R466, and D474 stabilize the 348 \nhelix. YlOrc4 K465 appears to form the only apparent sequence -specific interaction in the Orc4 349 \ninsertion helix. Unlike the ScOrc4 insertion helix, which is highly conserved among fungi that are 350 \npredicted to bind origins in a similar manner to S. cerevisiae, this lysine is not conserved (Figure 351 \nS4G).  352 \n 353 \nNear the YlOrc4 insertion helix resides a unique extended loop region of the Cdc6 WHD (Figure 354 \n4D). Sequence alignments to other eukaryotic Cdc6 proteins show that a large portion of the loop 355 \ncomes from an insertion that is conserved within the family Dipodascales, although a similar 356 \ninsertion may have separately evolved in more distant fungi such as Neurospora crassa (Figure 357 \nS4H). The density of this extended loop region is sharp and shows the loop interacting with  the 358 \nDNA over an entire turn of the double helix, making major/minor groove and backbone contacts 359 \nthroughout. Starting from the N -terminus of the loop, the sidechain of K548 is inserted into the 360 \nminor groove and hydrogen bonds with the O2 carbonyl of Y-T29. R557 reaches into the major 361 \ngroove of the DNA and interacts with Y-G34 (Figure 4D). The DNA-binding loop appears to be 362 \nheld in place by several electrostatic interactions with the DNA extending from the Orc4/Cdc6 -363 \ninteracting element into the AT element. From these interactions, a structure -based preliminary 364 \nbinding motif was constructed centered around the Orc4/Cdc6-interacting element motif, deemed 365 \nto be 5’-CNCCNRH-3’, where N denotes any nucleotide, R denotes purines, and H is not G. 366 \n 367 \nLocated upstream of the Orc4/Cdc6 -binding element, the AT element lacks major groove 368 \ninteractions and is recognized by a network of backbone, minor groove, and water -mediated 369 \nhydrogen bond interactions involving all ODC subunits except Orc6 ( Figure 4 C). The most 370 \nprominent sequence-dependent interaction in this element is between the Orc3 R220 sidechain 371 \nand N3 of A15 via a coordinated water, and is further stabilized by an aspartate (D218) (Figure 372 \nS4I). The positioning of Orc3 R220 likely precludes a C -G base pair at the adjacent position 16 373 \ndue to potential steric clashes between R220 and the minor groove amine of a guanine.  The 374 \nsidechain of Orc4 K168 enters the minor groove near position 14 and may interact with the N3 375 \nnitrogen of A14, but the sidechain density is weak (Figure S4I). Adjacent to the AT element, the 376 \nOrc1[300-305] basic patch is visible, with a mix of backbone and minor groove interactions. In 377 \naddition, Orc2, Orc5, and Cdc6 all make contact with the phosphate backbone in this region. 378 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 10 \nThese interactions extend th e binding motif in the 5’ direction of OriC-061 to 5’ -379 \nATNNNNCNCCNRH-3’.  380 \n 381 \nOn the opposite side of the Orc4/Cdc6 -binding element are the sites of two clusters of protein -382 \nDNA interactions: one encompassing X-strand positions 27 and 30 to 33 mediated predominantly 383 \nby Orc3, and another mediated by Orc2 and the Orc5 basic patch (Orc5-BP) from positions X-35-384 \n41 (Figure S4J). Apart from backbone interactions, Orc3 R672 forms a minor groove H-bond with 385 \nT25 O2 carbonyl on the Y strand. Orc5 R357 forms a hydrogen bond with the O2 carbonyl of T16, 386 \nwhile R362 forms a hydrogen bond to the carbonyl of T38 (Figure S4J). The other significant 387 \ninteraction in the Orc5-BP element is an H-bond between Orc2 R150 and G35 in the major groove. 388 \nWith the addition of the Orc5-BP element, the inferred binding motif of YlORC and YlCdc6 to OriC-389 \n061 extends in the 3’ direction to 5’-ATNNNNCNCCNRHNNNNNNNGNNYR-3’, where Y denotes 390 \na pyrimidine. 391 \n 392 \nComparison of YlODC with two different origin sequences provide a consensus 393 \nrecognition sequence. To determine whether the interactions between YlORC/YlCdc6 and DNA 394 \nare consistent between different origin sequences, a 2.6 Å cryo-EM structure was determined 395 \nusing a 60-bp fragment from OriA-006, the other origin validated by the linker scan assay (Figure 396 \nS4K, S4L). Many of the critical interactions remained the same (Figure S4M), with a Ca RMSD 397 \nof 0.60 Å between the two structures, however, an excess of ATP was used for this cryo -EM 398 \nsample and ATP is now visible in each ATP binding site. 399 \n 400 \nIn the AT element, the sidechain of Orc4 K168 appears to have stronger density overall compared 401 \nto YlODC54bpOriC-061, but still appears to have multiple conformations. Unlike YlODC54bpOriC-061, the 402 \nlysine sidechain could hydrogen bond to a water between K168 and the T51 O2 carbonyl on the 403 \nY strand, the O2 carbonyl of T11, or a water between the lysine amine and the N3 nitrogen of  404 \nA50. The most significant change in the Orc5-BP element is the loss of Orc2 R150 density in the 405 \nmap with the change of G35 to a cytosine, consistent with the loss of this interaction. 406 \n 407 \nThe overall conformations of the Orc4 insertion helix and Cdc6 DNA-binding loop are very similar 408 \nbetween the two origins. However, the positioning of the Cdc6 R557 sidechain is different: with, 409 \nthe arginine H-bonding with G34 on the Y strand in the major groove in OriC-061, while with OriA-410 \n006, R557 interacts with G44 on the Y strand, the equivalent of one base pair away (Figure S4N). 411 \nThis would then alter the Orc4/Cdc6 element motif from CNCCNRH in OriC-061 to CNNCCNRH 412 \nin OriA-006, pointing towards added flexibility for Orc4/Cdc6 binding requirements. With the 413 \nobserved changes at other elements included, we suggest the structure -based YlORC - and 414 \nYlCdc6-binding sequence 5’-ATNNNXXNCCNRHNNNNNNNNNNYR-3’, where at least one X is 415 \na cytosine. 416 \n 417 \nMutation of origin sequences disrupt ODC assembly  418 \n 419 \nThe importance of the sequence -specific interactions was determined by measuring the effects 420 \nof origin mutations on in vivo genetic assays, including colony formation and plasmid stability 421 \n(Figure 5A) and a biochemical assay for DNA/Cdc6 binding to ORC (Figure 5B). The first series 422 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 11 \nof mutant ori fragments tested were in the Orc4/Cdc6-interacting element of OriA-006, as the site 423 \ninvolves multiple major groove interactions which could confer base specificity . Changing 424 \nindividual cytosines (C17A or C21A) along with the complementary base in the motif does not 425 \naffect the phenotype in vivo, but mutation of two cytosines [C20A, C21A] leads to smaller colonies, 426 \na 50% reduction in plasmid stability , and reduced Cdc6 loading (Figure 5A, 5B and S5A). All 427 \ntriple mutants (CA, CG, or CT at positions 17, 20, and 21) are inviable in vivo (Figure 5A 428 \nand S5A) and mutation of all three cytosines to guanines greatly reduced Cdc6 binding to ORC-429 \nDNA (Figure 5B and S5A).The lack of sensitivity to the X-strand position 17 mutant alone could 430 \nbe caused by the flexible nature of the Cdc6 R557 sidechain coordinating it, as it can potentially 431 \nshift to the adjacent position as seen in OriC-061 while still affecting binding specificity  (Figure 432 \nS4N). Changes to the Ori sequence at position 23, the site of the Cdc6 K548 interaction, led to a 433 \nlarge decrease in the number of colonies, a 90% decrease in plasmid stability once returned to 434 \nnon-selective media (Figure 5A), and a sharp reduction of Cdc6 loading in vitro (Figure 5B), 435 \nindicating the importance of this minor groove interaction for proper origin licensing. Mutations in 436 \nother regions of the Ori sequence had similar effects. Both A12G and T13C mutations to the AT 437 \nelement of OriA-006 (Figure 5B) result in a decrease in in vitro Cdc6 loading (Figure 5B). 438 \n 439 \nTo study the structural effects of Ori sequence mutations on the binding of the ODC, a 2. 6 Å 440 \nresolution cryo-EM structure was determined for the double cytosine to guanine mutant [C20G,  441 \nC21G] of OriA-006 (YlODC60bpOriA-006-CNNGGNR) (Figure S5D,E). The structure is nearly identical to 442 \nYlODC60bpOriA-006-WT, with the largest change occurring at the Orc4  α-helix (Figure 5C ). The 443 \nsecondary structure of this helix unravels  and becomes a structured loop.  Orc4 K465, which 444 \ncontacts consecutive guanines in the WT OriA-006, points away from the DNA, and Orc4 D474 445 \nis unable to form a stabilizing salt bridge, as Orc4 R466 now forms multiple H -bonds with the 446 \nmutant guanine, now located on the opposite strand. The Cdc6 DNA -binding loop appears to 447 \nhave no noticeable changes to its structure, suggesting that Cdc6 loading and specificity might 448 \nbe independent of Orc4 sequence-specific binding. 449 \n 450 \nDNA deformability and bendability are critical for DNA replication 451 \n 452 \nCompared to the strict sequence requirements for origin licensing in S. cerevisiae, Y. lipolytica 453 \nhas fewer essential base-specific contacts in the Orc4/Cdc6-binding element to allow for origin 454 \nlicensing. Are there other factors that could play a role in origin licensing specificity? Noticeable 455 \nin the YlODC structure was a significant compression of the minor groove to allow the DNA to 456 \nbend. If the bendability of the Ori has a significant role in origin licensing specificity, replacing 457 \nsegments of the bent region of the Ori DNA with a rigid dA tract should inhibit origin licensing 76,77. 458 \nThe structural properties of DNA have been suggested previously to play a part in Drosophila 459 \nORC binding preference, and more recent studies have shown that bending of DNA via the Orc5-460 \nBP was critical for DNA replication in S. cerevisiae 25,70,78 . To test this, we examined the effect on 461 \nDNA binding, Cdc6 loading, and the in vivo effects of incorporating a 6  nt-long dA tract around 462 \nthe region of OriA-006 that is bent in the YlODC structure, starting at position 23 (abbreviated as 463 \nA[23-28]) and moving it downstream 1 bp at a time (Figure S5B). 464 \n 465 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 12 \nThere were discrepancies between the Cdc6 loading assay and the in vivo phenotypic effects of 466 \nthe 6A mutants tested (Figure S5B and S5C). At A[24-29] a decrease in Cdc6 loading was seen, 467 \nbut no deleterious effects were observed in vivo. Mutant A[25-30] had >85% of WT OriA-006 468 \nactivity, Cdc6 loading efficiency increased, whereas with A[26-31] and A[27 -32] Cdc6 loading 469 \nassay results had near WT Cdc6 loading efficacy, but either an extreme reduction or a complete 470 \nlack of growth was observed in vivo. Insertions from A[28-33] through A[31-36], showed complete 471 \ninhibition of Cdc6 loading and no growth in vivo, as the 6A tract enters the Orc5 -BP element. 472 \nDecreases in the 260/280 ratio, indicating reduced DNA binding, were seen in the A[28 -33] 473 \nthrough A[31-36] mutants compared to WT. 474 \nLarge-scale mutational analysis of Yarrowia Origins of DNA Replication  475 \nTo identify sequence preferences required for origin function, a Massively Parallel Origin 476 \nSelection (MPOS) assay was performed using mutagenized libraries (~15% mutation density 35) 477 \nspanning 90 bp regions of  OriC-061 and OriA-006. These libraries were cloned into Ori⁻/CEN⁺ 478 \nplasmids and introduced into  Y. lipolytica for growth-based competitive selection.  Deep 479 \nsequencing of plasmids from pre-selection and post-selection time points was performed, and a 480 \nquantitative model was trained using MAVE-NN to predict post-selection enrichment as a function 481 \nof DNA sequence 79. 482 \nIn OriA-006, the most striking changes occurred between positions 10 and 37, where specific 483 \nnucleotides showed strong selection signatures, highlighting this region as a functionally critical 484 \ncore of the origin, which aligns with the linker scan sensitive area (Figure 6A, the numbers refer 485 \nto the numbering of base pairs in Figure S4M ). A similar pattern was observed for  OriC-061, 486 \nthough with slightly lower resolution due to reduced transformation efficiency and higher 487 \nbackground signal (Figure S6A), confirming that both sequence preference and positional 488 \nsensitivity are conserved features in this origin. 489 \nBases critical for ORC–CDC6 binding showed enrichment when unmutated and depletion when 490 \naltered, reflecting their essential role in origin establishment. Conversely, mutations that allowed 491 \ninitial transformation but led to reduced plasmid stability highlighted bases important for 492 \nmaintenance. This dual-phase insight was central to parsing the functional logic of ARS activity 493 \nin Y. lipolytica. 494 \nA conserved sequence motif,  5’-YATRNNNNNNCNAWTTNNNNNNYNYAA-3’, emerged from 495 \nMPOS assay analysis as a central feature of functional origins. Targeted mutagenesis within the 496 \nYAT, YNYA, and flanking regions revealed key nucleotide requirements for Ori function (Figure 497 \n6B). Mutation in a critical position such as A 12-to-C within the YAT region abolished colony 498 \nformation, indicating a loss of Ori activity. Multiple substitutions in the YNYA region , including 499 \nmutations at posit ions 33,  34, 35 and 36 resulted in either reduced plasmid instability  or no 500 \ntransformation, suggesting that these positions are critical for origin activity. These findings align 501 \nwith MPOS results, which showed selection against guanine (G) at T33, reinforcing a preference 502 \nfor thymine (T) or cytosine (C). This preference likely reflects the structural compatibility of 503 \npyrimidines with ORC binding, particularly through minor groove interactions involving ORC3, 504 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 13 \nORC2, and ORC5. For example, the YA motif appears critical for minor groove engagement by 505 \nORC5, and substitutions that disrupt this local DNA shape abolish origin function. 506 \nCross-Species Validation of a Replication Origin Motif Using ROC Analysis . Next we 507 \nevaluated the predictive power of MPOS-identified motifs by evaluating their ability to distinguish 508 \nfunctional origins from genomic background. The motif derived from the Y. lipolytica MPOS assay 509 \nexhibited a remarkable ability to distinguish EDU -seq peaks from randomly sampled DNA from 510 \nthe Y. lipolytica genome, yielding an AUROC of 0.80  (Figure 6C). By comparison, an AUROC of 511 \n0.91 was obtained when an analogous motif was inferred from S. cerevisiae MPOS data of 28 and 512 \nused to distinguish sequences in OriDB 18  from random DNA in the S. cerevisiae genome (Figure 513 \n6C). The predictive power of the Y. lipolytic a motif is considerably less than that of the S. 514 \ncerevisiae motif. This difference may be due to reduced motif accuracy arising from the lower 515 \ntransformation rate of Y. lipolytica relative to S. cerevisiae, or from the reduced number of variant 516 \nsequences used in the MPOS assay (7,000 synthetic sequences in Y. lipolytica versus millions of 517 \nrandomly mutagenized sequences in  S. cerevisiae). Alternatively, Y. lipolytica origins may be 518 \nmore variable than S. cerevisiae origins, so much so that some origins do not contain a match to 519 \nthe motif.  520 \nAn analysis of nucleotide frequencies across 54 Y. lipolytica early origins of replication compared 521 \nto the frequencies across 5351 close matches to the motif in  non-origin sequences showed a 522 \nskew for T/A sequences 5’ to the core consensus sequence and a skew for A/T base pairs 3’ to 523 \nthe core consensus sequence  only in early origins , but not in non -origins (Figure S6B). This 524 \nsuggests that the arrangement facilitates initiation of DNA replication  in the generally G/C rich 525 \ngenome since the average %G /C in 160 bp around motif in early  origins is 44%, whereas the 526 \nYarrowia genome is on average 48.9% G/C 72 . 527 \nDiscussion 528 \nThe Yarrowia lipolytica genome has 634 origins of DNA replication that are distributed into large 529 \nreplication timing domains of early and late replicating regions, much like the A and B replication 530 \ntiming domains of vertebrate chromosome replication 80,81. Interestingly, both centromeres and 531 \ntelomeres replicate early in Y. lipolytica. The early and late re plicating domains in vertebrates, 532 \nincluding in human cells, correspond to topologically associated domains (TADs) and 533 \neuchromatin and heterochromatin, respectively. What determines the structure of the Y. lipolytica 534 \nreplication timing domains remains to be determined, but the global temporal pattern of replication 535 \nin this yeast is very different from the replication timing in S. cerevisiae, which falls into two classes 536 \nbased on temporal control by the S-phase cyclin-dependent protein kinases 82.  537 \nOrigins of DNA replication in S. cerevisiae are specified by ORC recognizing the ARS consensus 538 \nsequence 5’ -WTTTAYRTTTW-3’and bending the DNA 17,31,83. After interacting with ORC, t he 539 \nCdc6 initiator-specific motif (ISM) and WH domains bind to the DNA phosphate backbone (but do 540 \nnot form base-specific interactions), thereby contributing to origin DNA binding 67,69. Thus, in S. 541 \ncerevisiae, the location of origins in the genome is primarily due to ORC. The ScOrc4 and ScOrc2 542 \nbase-specific contacts are major contributors to DNA-sequence-specific interactions, so much so 543 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 14 \nthat it was predicted that the presence of the Orc4 α-helix correlated with DNA sequence-specific 544 \nbinding 28,32. But S. cerevisiae ORC also has minor groove and backbone interactions that 545 \ncontribute to ORC -DNA binding. Clearly, however, analysis of origin recognition in Y. lipolytica 546 \nsuggests that the re are alternative mec hanisms for base-specific origin recognition because in 547 \nthis yeast  both YlORC and YlCdc6 are required . The Y. lipolytica  consensus sequence 5’-548 \nATNNNXXNCCNRHNNNNNNNNNNYR-3’, supported by both structural data and high -549 \nthroughput mutagenesis data, is substantially different from the S. cerevisiae sequence, both in 550 \nlength and flexible base composition. The YlOrc4 α-helix is substantially reduced and only a single 551 \nlysine (K465) contacts adjacent G/C base pairs in the  5’-XXNCCNRH-3’ Orc4/Cdc6-interaction 552 \nmotif. This α-helix is completely missing in the human ORC4 subunit, suggesting evolution of the 553 \nOrc4 protein toward increasing sequence-specific origin recognition in the yeasts  (Figure 7 ). 554 \nMutation of single YlOrc4 interacting bases did not affect Y. lipolytica origin activity (Figure 5A), 555 \nin contrast to single base changes in the ScORC binding site significantly compromising origin 556 \nactivity 84. When YlOrc4 two adjacent interacting base pair s are mutated, the Orc4 α-helix 557 \ncollapses and the base-interacting K465 residue, switches with R466, which now makes base-558 \nspecific interactions, albeit with guanines now located on the opposite strand (Figure 5C). Thus, 559 \nthere is considerable plasticity in ORC binding to origins in Y. lipolytica since the different origins 560 \ndisplay alternative protein-DNA interactions. 561 \nUnlike the situation in S. cerevisiae, the YlORC bound weakly to origin DNA and YlCdc6 increased 562 \nthe specificity and affinity for origin DNA by making several contacts, including a base-specific 563 \ninteraction via R557 to the Orc4/Cdc6-interacting element, adjacent to the Orc4 α-helix interaction 564 \nsite (Figure 4D). Interestingly, a single base change in the base in the major grove of either OriA-565 \n006 or OriC-061 that interacts with YlCdc6 R557 does not affect origin function. This may be due 566 \nto the flexibility of the YlCdc6 R557 ability to interact with neighboring  base-pairs in the major 567 \ngroove, depending on the origin (Figure S4N). In contrast, in both origins, mutation in the minor 568 \ngroove base pair that interacts with YlCdc6 K548 severely compromises origin activity, 569 \nunderscoring the importance of YlCdc6 in origin recognition. 570 \nThe extensive DNA interactions in the AT and  Orc5-BP elements in the consensus sequence 571 \ncontribute to origin function, since single-point mutations in both elements eliminate origin activity. 572 \nThese include base pairs that interact with Orc3 in the AT element and Orc 2 and Orc 5 in the 573 \nOrc5-BP element. An Orc1 loop ( residues 300-305) interacts with the minor gro ove non-574 \nspecifically in addition to other residues binding the phosphate backbone. A conserved β-loop in 575 \nthis region binds to a minor gro ove in the Drosophila ORC-CDC6-DNA structure, but does not 576 \nmake nucleotide -specific contacts 68. Indeed, unlike Y. lipolytica  ORC-Cdc6 interaction s with 577 \nDNA, all DNA contacts in the Drosophila ORC-CDC6-DNA structure on a 60 bp AT-rich DNA lack 578 \nbase pair specificity. One common feature in all structures, however, is the interaction between 579 \nOrc5/ORC5 with the DNA to stabilize the DNA bend (Figure 7). As noted previously 25,85–87, it is 580 \npossible that DNA sequences that have the propensity to bend upon ORC or ORC-CDC6 binding 581 \nis an essential feature of all origins of DNA replication. 582 \nIt was surprising that, in the structure of the human ORC-CDC6-DNA, we observed that HsORC2 583 \nresidue R367 appears to interact in a minor grove with the edge of a nucleotide, suggesting for 584 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 15 \nthe first time that human ORC-CDC6 might have direct DNA sequence dependent interactions or 585 \norigin recognition . In an analogous way, the S. cerevisiae  Orc2 W396 residue makes p-586 \ninteractions in a minor gro ove of ARS1 origin DNA, contributing to origin specificity. In contrast, 587 \nin Yarrowia, residues in the non-conserved Orc2 loop interact with the phosphate backbone of 588 \nDNA, likely contributing to affinity but not specificity (Figure 7). The DNA in the human ORC-589 \nCDC6-DNA structure is a G/C rich sequence that is not an origin of DNA replication or a known 590 \nORC-CDC6 binding site in the human genome, so it is possible that ORC-CDC6 interaction with 591 \nan authentic origin or binding site might reveal additional base-specific interactions. 592 \nIt is remarkable that for such a fundamental process as specification of origins of DNA replication 593 \nthat there have been many solutions to defining the location of origin sequences in the eukaryotic 594 \ngenome. This variation may be a result of differences in genome organization and gene density, 595 \nas well as other features such as genome size, G/C content and 3D structure. The Yarrowia and 596 \nhuman ORC -Cdc6-DNA structures presented here, together with previous analyses of S. 597 \ncerevisiae and Drosophila structures have highlighted some key aspects of the evolution of origin 598 \nrecognition and specification. 599 \nLimitations of the study 600 \nWe have only characterized in detail two Y. lipolytica origins and yet there are some sequences 601 \nunder EdU peaks that lack the consensus sequence identified here. Mutagenesis and structural 602 \nstudies with ORC and Cdc6 using these origins may reveal even greater flexibility in origin 603 \nspecification uncovered in this study. Furthermore, continued analysis of the HsODC using 604 \ndifferent DNA sequences, including known ORC-CDC6 DNA binding sites, may reveal additional 605 \nbase-specific origins recognition in human cells. 606 \nAcknowledgements 607 \nThis research was supported by grants from the National Institutes of Health ( GM045436, 608 \nGM133777, HG011787), the Howard Hughes Medical Institute and the Goldring Family 609 \nFoundation. Core DNA sequencing was facilitated by the Cold Spring Harbor Laboratory (CSHL) 610 \nDNA sequencing and analysis shared resource, supported by t he Cancer Center grant 611 \n(CA13106). We thank Dennis Thomas for managing the CSHL Cryogenic Microscopy Core 612 \nshared resource, and members of the Stillman and Joshua-Tor laboratories for suggestions and 613 \nadvice. L.J. is an Investigator of the Howard Hughes Medical Institute. 614 \nAuthor contributions 615 \nB.S. and L. J. conceived the study. B.S., L. J., and J.B.K.  designed the study. J.B, N.Z., O.P.C. 616 \nand K.L. performed the experiments. J.B., N.Z., O.E.D, O.P.C., K.L.,  J.B.K., L.J., and B.S. 617 \nanalyzed the data. N.Z, J.B, O.P .C, J.B.K, L.J. and B.S. wrote the paper with input from all 618 \nauthors. B.S., J.B.K. and L. J. provided funding and oversaw the project. 619 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 16 \nDeclaration of interests 620 \nThe authors declare no conflicts of interest. 621 \n 622 \nFigure Legends 623 \n 624 \nFigure 1 Structure of the HsORC–Cdc6–DNA complex. (A) Cryo-EM 3D map of the HsODC 625 \ncomplex bound to a 60 -bp DNA duplex, with each protein subunit shown in a distinct color. (B) 626 \nCartoon representation of the atomic model fitted into the cryo -EM map, highlighting all protein 627 \nsubunits of HsORC, Cdc6, and the DNA molecule. This view emphasizes the arrangement of the 628 \nproteins around the central DNA-binding channel. (C) Interactions between HsORC subunits and 629 \nDNA, shown at the amino acid level. Interacting residues are colored as above, providing a clear 630 \nvisualization of how each subunit contributes to DNA engagement. (D) Close-up view of residue 631 \nR367 from the HsORC2 subunit, which establishes three distinct contacts with DNA nucleotides, 632 \nspecifically thymine from chain H and guanine and adenine from chain I. 633 \n 634 \nFigure 2: Genome-wide profiling and genomic context of replication origins in  Yarrowia 635 \nlipolytica. (A) Temporal mapping of replication origin activity throughout Yarrowia 636 \nlipolytica genome using EdU-seq. EdU-seq signal tracks across a 2.3 Mb region of Chromosome 637 \nA following release from starvation into S phase in the presence (blue) or absence (red) of 5 mM 638 \nhydroxyurea (HU). Samples were collected at the indicated time points. HU -treated cells show 639 \ntemporally resolved activation of replication origins, while untreated cells exhibit more extensive 640 \nEdU incorporation. (B) Enrichment analysis of EdU -seq peaks relative to genomic annotations. 641 \nIntergenic and promoter/TSS regions are enriched for replication origins, while exonic regions are 642 \ndepleted. Log2(observed/expected) values indicate the degree of enrichment or depletion across 643 \ndifferent genomic features.  (C) Genome-wide origin firing maps across all six  Y. 644 \nlipolytica chromosomes at 30 and 120 minutes post -release in the presence of HU. Each track 645 \nshows EdU-seq signal along individual chromosomes (A–F), with peaks corresponding to active 646 \nreplication origins. Regions highlighted in black boxes represent early -firing origins (30’), while 647 \nred boxes highlight later -firing origins (120’). Centromeres (black  boxes), rDNA clusters (red  648 \nboxes), and telomeric regions (orange diamonds) are annotated for reference. 649 \nFigure 3. Linker -scanning mutagenesis reveals essential regions for origin activity in  Y. 650 \nlipolytica OriC-061 and OriA-006. (A) Mitotic stability assay of OriC-061 mutants carrying XhoI 651 \nlinker substitutions (CTCGAG) at positions 2–45. Images show colony formation following plasmid 652 \ntransformation and selection and percentage (% URA+ retention) for  different linker mutations. 653 \nWild-type (WT) OriC-061 shows ~41% mitotic stability, while substitutions in linkers 2 to 6 654 \ndrastically reduce origin activity to ≤3%. A zoomed-in view highlights the six critical linker mutants 655 \nwith corresponding colonies on the plate after  the initial. transformation, with the percentage 656 \nplasmid stability values  shown. (B) Mitotic stability assay of OriA-006 mutants with linker 657 \nsubstitutions at positions 1–44. WT OriA-006 exhibits ~45% mitotic stability. A cluster of mutations 658 \n(linkers 25 –29) results in complete loss of origin activity (0 –5% stability), identifying a key 659 \nfunctional region. Sequences and representative colony phenotypes for these five mutants are 660 \nshown below the graph. 661 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 17 \nFigure 4. YlORC and YlCdc6 coordinate to bind origins specifically.  (A)  SDS-PAGE and 662 \nagarose gel electrophoresis of gel filtration fractions from samples containing YlOrc1 -6[SST-663 \nYlOrc1], YlCdc6, and a 54 -bp DNA oligonucleotide derived from OriC-061 (top panel) and a 664 \nscrambled sequence thereof (bottom pane l). The ag arose gel in the top panel was spliced 665 \ntogether as shown in the black boxes , but represents DNA from the same experiment. (B) (left) 666 \nThe 2.7 Å resolution unsharpened map of the YlORC-DNA54bpOriC-061-YlCdc6 complex and (right) 667 \nthe ribbon representation of the derived structure. (C) A diagram of the visible protein -DNA 668 \ninteractions seen in the YlORC -DNA54bpOriC-061-YlCdc6 structure. N indicates any nucleotide; W 669 \ndenotes an A or T; XX denotes a C in either of these positions; R indicates a purine; H indicates 670 \nA, C, or T; Y indicates a pyrimidine. (D) A ribbon representation of YlOrc4 ( blue) and YlCdc6 671 \n(pink) near the Orc4/Cdc6 element of OriC-061 in the YlORC -DNA54bpOriC-061-YlCdc6 structure, 672 \nwith insets of the YlOrc4 insertion helix (bottom right) and the YlCdc6 DNA binding loop (top right, 673 \nbottom left). (E) A top-down representation of the complex near the AT element shows all proteins 674 \nexcept YlOrc6 forming electrostatic interactions with OriC-061 in the region. 675 \n 676 \nFigure 5. Effects of mutations on origin recognition and function.  (A) Mutational analysis of 677 \nthe Orc4/Cdc6-interacting element motif in OriA-006 (top) and OriC-061 (bottom) and the effect 678 \non origin activity. Images show colony formation following plasmid transformation and selection 679 \nand percentage (% URA+ retention) for different mutations. Base changes are highlighted in red, 680 \nand their colony formation is shown in the adjacent images. Boxes represent the linker scan 681 \nmutations (see Figure 3).  (B) SDS-PAGE results of the peak fractions from the Cdc6 loading 682 \nassay utilizing mutant OriA-006 sequences, indicating the differences in Cdc6 co -elution 683 \n(numbers refer to the X -strand). (C) Comparison of the structure of the YlOrc4 insertion loop 684 \nbetween YlORC -DNA60bpOriA-006-YlCdc6 ( left) and YlORC -DNA60bpOriA-CNNGGNR-YlCdc6 ( right) 685 \nstructures. The yellow bases represent the bases that were mutated in OriA-006. 686 \n 687 \nFigure 6. Massively parallel origin selection assay and quantitative modeling. (A) 688 \nQuantitative model for Y. lipolytica  origin specificity derived from a massively parallel origin 689 \nselection (MPOS) assay carried out on 90 bp sequences containing OriA-006 mutagenized at 690 \n15% per bp. Logo illustrates an additive model trained using MAVE-NN 79 to distinguish selected 691 \nvariants from input variants. Sequence coordinates match those in Fig. S4M. The endogenous 692 \nOriA-006 sequence is shown above, and linker positions 25-29 from Fig. 3B are boxed. Fig S6A 693 \nprovides a similar analysis for OriC-061. (B) Functional origin assay of single-nucleotide mutants 694 \nwithin the AT and the Orc5 -BP motifs . Images show c olony formation following plasmid 695 \ntransformation and selection and percentage (% URA+ retention) for  different mutations. (C) 696 \nSensitivity and specificity of core motifs in MPOS-derived models. (i) Core motif of the Y. lipolytica 697 \nMPOS model and corresponding z -score distributions for EdU peaks and random Y. lipolytica 698 \ngenomic regions. (ii) Core motif from a model trained on S. cerevisiae MPOS data 28 , together 699 \nwith z-score distributions of this model on  origins from OriDB  18  and on random S. cerevisiae 700 \ngenomic regions. (iii) ROC curves for the two core motifs on their respective positive and negative 701 \ngenomic regions.  702 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 18 \nFigure 7. Origin recognition throughout evolution .  A comparison of analogous structural 703 \nfeatures within the ODC complex of metazoans (Homo sapiens), Saccharomyces cerevisiae, and 704 \nYarrowia lipolytica. 705 \n 706 \nSupplemental Video 1  An animation of the 2.6 Å-resolution unsharpened map of the HsORC-707 \nCDC6 complex rotated along two axes. 708 \n 709 \nSupplemental Video 2  An animation of the 2.7 Å resolution unsharpened map of the YlORC -710 \nDNA54bpOriC-061-YlCdc6 complex rotated along two axes. 711 \n 712 \nSupplemental Video 3  An animation of the refined molecular structure of the YlORC-DNA54bpOriC-713 \n061-YlCdc6 complex rotated along two axes. 714 \nMethods: 715 \nYeast Strain Construction 716 \nYeast strains for EdU -sequencing and ARS assays were derived from  Yarrowia lipolytica PO1f 717 \n(MATA, leu2 -270, ura3 -302, xpr2 -322, axp1 -2). Strains used for genome annotation were 718 \nprovided by Dr. Richard Rachubinski (University of Alberta).  To generate the TK+ strain 719 \n(YlB0002), a BrdU -Inc cassette with a URA3 marker was integrated at the IntE1 locus on 720 \nchromosome 5. The cassette, under TEF and GPD promoters, expressed Herpes Simplex Virus 721 \nthymidine kinase (HSV-TK) and the human Equilibrative Nucleoside Transporter 1  (hENT1) 722 \ngenes. Correct integration was confirmed via selective growth on -URA and FOA plates, colony 723 \nPCR, and vector verification before transformation. 724 \nPlasmid Construction for BrdU-Inc Cassette 725 \nThe BrdU-Inc cassette was cloned into the EasyClone vector pCfB6677 88 obtained from Addgene 726 \nand targeted to the IntE1 locus. The cassette was flanked by loxP sites for URA3 marker removal 727 \nvia Cre recombinase.  HSV-TK and hENT1 were placed under the TEF and GPD promoters, 728 \nrespectively, and amplified from pNC1164 and pCfB8742. USER cloning enabled precise 729 \nassembly using uracil -containing primers and enzymatic treatment to generate overhangs for 730 \ndirectional ligation. The final construct was validated by PCR, restriction mapping, and 731 \nsequencing. 732 \nARS Plasmid Construction 733 \nThe pSCARS1 plasmid 89  was modified to create pYl001 by removing SC-Trp and ORI1068, and 734 \nadding KpnI and BglII sites. GFP remained under TEF promoter control.  To construct pYl002 - 735 \npYl011, replication origins were amplified from PO1f genomic DNA and ligated into pYl001 at KpnI 736 \nor BglII sites. Constructs were verified by PCR and restriction digestion for downstream ARS 737 \nassays and stability tests. 738 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 19 \nYeast Transformation 739 \nPO1f cells (5 × 10⁷) were grown overnight and transformed according to Dahlin et al 2021 88 . For 740 \ngenomic integrations, 500 ng of the linearized vector was used; for ARS assays, 15 µg of the 741 \ncircular plasmid. Cells were heat -shocked at 39°C, recovered in YPD, and plated on -URA. 742 \nIntegration was confirmed using PCR. 743 \nSynchronization of YlB0002 (TK+) 744 \nTo synchronize cells in G0/G1, YlB0002 was grown in YPD for 72 hours when they reached 745 \nstationary phase and then diluted 1:10 into fresh medium to re-enter the cell cycle. EdU (500 µM 746 \nfor sequencing, 100 µM for imaging) (Thermo Fisher, E10187) and HU (5 mM) (Sigma, H8627) 747 \nwere added as needed. Samples were collected at multiple time points for EdU imaging, flow 748 \ncytometry, and sequencing. 749 \nEdU Imaging in YlB0002 750 \nSynchronized or log-phase cells were labeled with 100 µM EdU  (Thermo Fisher, E10187). After 751 \nfixation (3.7% PFA), cells were permeabilized with Triton X -100 and subjected to Click -iT 752 \nchemistry using Alexa Fluor 488 (Thermo Fisher, C10387). DNA was stained with Hoechst 33342, 753 \nand cells were mounted in anti-fade solution for imaging with 63X or 100X oil objectives. 754 \nFlow Cytometry 755 \nTo assess cell cycle progression in Y. lipolytica, cultures were grown at 30°C to mid-log phase or 756 \nharvested at specific time points. Cells were pelleted and washed twice with sterile water, then 757 \nfixed in 70% ethanol and incubated overnight at 4°C. Following fixation, cells were pelleted, 758 \nwashed twice with sterile water, and resuspended in FC buffer (50 mM sodium citrate, pH 7.0, 759 \n0.1% sodium azide). For RNA and protein degradation, samples were sequentially treated with 760 \nRNase A (0.1 mg/ml) and proteinase K (0.2 mg/ml) for 1 hour each at 55°C. Cells were then 761 \nstained with SYTOX Green Nucleic Acid stain (Thermo Fisher S7020). Samples were sonicated 762 \nand diluted before flow cytometry or FACS analysis to assess DNA content and cell cycle 763 \ndistribution. 764 \nEdU-Seq of Synchronous Yarrowia Cells ± HU 765 \nTo track DNA replication dynamics,  Y. lipolytica cells were synchronized in G0/G1 by 72 -hour 766 \nculture in YPD. Cells were then released into fresh YPD containing 500 µM EdU (± 5 mM HU), 767 \nand samples were collected over a 210 -minute time course. Flow cytometry confirmed 768 \nsynchronization. 769 \nFor mapping sites of EdU incorporation , DNA from the time-course samples was fragmented, 770 \nEdU-labeled DNA was captured via biotin -azide Click-iT reaction (Thermo Fisher, C10365) and 771 \nStreptavidin T1 beads (Thermo Fisher 65602). Libraries were prepared using the Illumina TruSeq 772 \nKit (Illumina IP -202-1012). Sequencing identified newly replicated regions, providing high -773 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 20 \nresolution replication timing profiles. Sequencing data revealed replication origin firing across S 774 \nphase 35. 775 \nEdU Incorporation and DNA Preparation 776 \nTo identify early - and late-firing origins, stationary phase cells were transferred into fresh YPD 777 \ncontaining either EdU+HU or EdU alone. A mock (no EdU) control was included. At each time 778 \npoint, replication was halted with sodium azide (0.1%), and cells were collected for flow cytometry 779 \nand DNA extraction. DNA was purified using a Qiagen Genomic-tip after Zymolyase-20T (Sunrise 780 \nScience Products, N0766391) digestion and lysis. Purified genomic DNA was fragmented using 781 \nthe Bioruptor Pico and checked on a Bioanalyzer (100–550 bp fragments). 782 \nClick Labeling and DNA Enrichment 783 \nEdU-labeled DNA was tagged with biotin via Click -iT chemistry and purified using magnetic 784 \nStreptavidin beads. Bound DNA was eluted and further cleaned using MinElute columns (Qiagen). 785 \nLibrary Prep and Sequencing 786 \nBiotinylated DNA was ligated to adapters and PCR -amplified using the Illumina TruSeq kit. The 787 \nresulting libraries were sequenced to profile replication timing at high resolution. 788 \nEdU-seq Pre-processing and genome alignment 789 \nThe paired -end reads were trimmed using Fastp v.0.23.2  90 using the default settings and 790 \nautomatic adapter detection, and quality control was performed using FastQC (v0.12.1; available 791 \nonline at: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). The trimmed reads were 792 \naligned to Yarrowia Lipolytica  strain E122 (MATA) using Bowtie2 v.2.4.4 91  with the default 793 \noptions.  The output SAM alignment files were converted to BAM format, sorted and indexed  794 \nusing SAMtools Samtools v.1.19.2 92  To produce the illustrated genome coverage tracks and for 795 \nvisualization purposes, we used bamCoverage  from Deeptools v.3.5.1 93  was used to generate 796 \nthe coverage tracks with normalization option of bins per million mapped reads (BPM).    797 \nA total of 75 EdU -seq libraries were prepared across 11 time points (15 –210 minutes), with 798 \nbiological and technical replicates ensuring data reproducibility (Supplement Table 1). Fifty high-799 \nquality libraries were selected for downstream analysis. Temporal replication patterns were 800 \nconsistent across replicates, demonstrating the robustness of the protocol. 801 \nSupplemental Table 1 802 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 21 \n 803 \nThe libraries used in the analysis are summarized in the table below. 804 \n 805 \nName of the library Duration of \nEdU label \nTreatment \n9-30min-eh5_S3_trm_matAfinal.sorted.bw 30 min 500 mM EdU + \n5mM HU \nS07_S7_trm_matAfinal.sorted-45minold.bw 45 min 500 mM EdU + \n5mM HU \n72-45-eh-5_S3_trm_matAfinal.sorted.bw 45 min 500 mM EdU + \n5mM HU \nS03_S3_trm_matAfinal.sorted-new45eh.bw 45 min 500 mM EdU + \n5mM HU \nS04_S4_trm_matAfinal.sorted-new60eh.bw 60 min 500 mM EdU + \n5mM HU \nS09_S9_trm_matAfinal.sorted-75min.bw 75 min 500 mM EdU + \n5mM HU \nS08_S8_trm_matAfinal.sorted-new90eh.bw 90 min 500 mM EdU + \n5mM HU \nS07_S7_trm_matAfinal.sorted-90eh.bw 90 min 500 mM EdU + \n5mM HU \nS14_S14_trm_matAfinal.sorted-120min-old.bw 120 min 500 mM EdU + \n5mM HU \nS11_S11_trm_matAfinal.sorted-new180-\n642peakcount.bw \n180 min 500 mM EdU + \n5mM HU \nS12_S12_trm_matAfinal.sorted-new210.bw 210 min 500 mM EdU + \n5mM HU \n30min_S4_trm_matAfinal.sorted.bw 30 min 500 mM EdU \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 22 \n45min_S5_trm_matAfinal.sorted.bw 45 min 500 mM EdU \n45min_S6_trm_matAfinal.sorted.bw 45 min 500 mM EdU \nS04_S4_trm_matAfinal.sorted.bw 60 min 500 mM EdU \nS06_S6_trm_matAfinal.sorted.bw 60 min 500 mM EdU \n 806 \nEdU-seq Peak calling and annotation 807 \nFor peak calling, we employed MACS2 v2.2.6 94  using a p -value filter of 0.01 and a minimum 808 \nlength of 300 base pairs.  These peaks were annotated using annotatePeaks.pl from HOMER 809 \nv.4.11 http://homer.ucsd.edu/homer 95 , which also provides the annotation class (Promoter -810 \nTSS/TTS/Gene/Intergenic) enrichment analysis.   811 \nStability Assays 812 \nFor plasmid stability, transformants were grown in selective media, then diluted into YPD and 813 \nregrown. After 30 hours, cells were plated on selective and non -selective plates. Colony counts 814 \non both plates were used to estimate plasmid loss , expressed as percentage . In GFP-based 815 \nassays, cells harboring plasmids expressing Green Fluorescent Protein (GFP) under the control 816 \nof the TEF promoter with the CYC1 terminator were analyzed via flow cytometry  according to 817 \nLopez et al. 89 . GFP+ percentages were calculated using BD FACSC, with wild -type cells as a 818 \nnegative control. 819 \nXhoI Linker Scanning via In-Fusion Cloning 820 \nXhoI linker scanning mutants of OriA-006 and OriC-061 were generated using In-Fusion cloning 821 \n(TaKaRa 638945). Primers with XhoI sites and 15 -bp overlaps were used in high -fidelity PCR 822 \n(PrimeSTAR Max,TaKaRa R045A). Mutant plasmids were circularized via inverse PCR and In -823 \nFusion assembled, purified, and transformed into Y. lipolytica for downstream analysis. 824 \nMassively parallel origin selection (MPOS) assay 825 \nMPOS assays were carried out as in 28  with minor modifications. Plasmid libraries for OriA-006 826 \nand for OriC-061 were constructed starting with corresponding wild -type plasmids used in the 827 \nlinker scanning experiments . 90 bp regions centered on the essential sites identified by linker 828 \nscanning were then mutagenized  at 15% per bp. Mutagenesis was carried out using 829 \ncomputationally designed oligo pools, each containing 7,000 variants, synthesized by Agilent. To 830 \nincrease the percentage of correctly cloned plasmids, variants were cloned using a ccdB cassette 831 \nreplacement strategy based on that of Kinney et al. (2010) 96 , but with Gibson cloning instead of 832 \nGolden Gate cloning. Each plasmid library was then transformed into Y. lipolytica and subjected 833 \nto selection via growth on SC-URA plates, after which bulk DNA was extracted. Amplicons 834 \ncontaining variant sequences flanked by barcodes and primers for Illumina sequencing were then 835 \nprepared using template DNA (plasmid DNA from the initial libraries or bulk DNA extract ed from 836 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 23 \ncells) amplified by PCR using custom primers. Amplicons were subjected to PE150 sequencing 837 \non an Illumina NextSeq 2000 instrument using a P1 flow cell and XLEAP-SBS chemistry. 838 \nQuantitative modeling of MPOS data 839 \nFor each of the two loci, OriA-006 and OriC-061, MAVE-NN 79  was used to train an additive model 840 \nthat distinguishes MPOS-selected origins from those in the initial library. The OriA-006 model was 841 \ntrained using 2,911,260 pre-selection reads and 2,082,266 post-selection reads. The OriC-061 842 \nmodel was trained using 8,820,054 pre-selection reads and 7,264,362 post-selection reads. 843 \nSequence logos illustrating these models are shown in Figure 6A (OriA-006) and Figure S6A 844 \n(OriC-061). Logos were created using Logomaker 97 . The additive model for origin specificity in 845 \nS. cerevisiae was previously reported by Hu et al. 35  and computed in a similar manner using an 846 \nearly version of MAVE-NN. 847 \nROC analysis of MPOS-derived motifs  848 \nTo carry out the ROC analysis in Figure 6C a 32 bp core motif was extracted from the Y. lipolytica 849 \nOriA-006 additive model. This motif was used to scan 1,000 bp regions of Y. lipolytica genomic 850 \nDNA centered on either the EdU peaks identified above (positive set; 623 regions) or on randomly 851 \nchosen genomic locations (control set; 623 regions). The maximum motif score observed in each 852 \ngenomic region was recorded. The scores for positive and negative regions were then converted 853 \nto z-scores (Figure 6Ci). A similar analysis was performed using a n 18 bp core motif extracted 854 \nfrom the S. cerevisiae ARS1 MPOS model (Figure 6Cii). This motif was used to scan 1 ,000 bp 855 \nregions of S. cerevisiae genomic DNA centered either on origins in OriDB  18  (positive set; 410 856 \nregions) or on randomly chosen genomic DNA (control set ; 410 regions). Figure 6Ciii shows 857 \nROC curves corresponding to these core motifs and their respective positive and negative control 858 \nsets.  859 \nExpression and Purification of Human ORC Subunits (HsORC1–5) 860 \n 861 \nCodon-optimized HsORC1 (NP_004144.2), N-terminally fused with twin Strep and SUMO tags, 862 \nwas cloned into the pFL vector for expression in insect cells. The remaining synthetic human ORC 863 \ngenes—HsORC2 (NP_006181.1), HsORC3 (NP_862820.1), HsORC4 (NP_859525.1), and 864 \nHsORC5 (NP_002544.1)—were cloned into the MultiBac baculovirus expression system  98 . A 865 \ntwin StrepTag followed by a TEV cleavage site was also introduced at the N-terminus of HsORC3 866 \nto facilitate affinity purification. All HsORC proteins are full length.  Recombinant expression of 867 \nHsORC1 and separately of the HsORC2-5 complex were performed in Sf9 insect cells infected 868 \nwith baculovirus and cultured in CCM3 medium (GE Healthcare Life Sciences, Pittsburgh, PA) for 869 \n48 hours. Cell pellets for both HsORC1 and HsORC2-5 were resuspended separately in lysis 870 \nbuffer containing 50 mM HEPES -NaOH (pH 7.5), 300 mM KCl, 30 mM potassium glutamate, 5 871 \nmM magnesium acetate, 5 mM dithiothreitol (DTT), and 2 mM ATP. HsORC1-expressing cells 872 \nwere lysed by sonication, and lysates were clarified by centrifugation at 143,000 × g for 45 873 \nminutes. The supernatant was loaded onto a 5 mL StrepTactin agarose beads onto a gravity flow 874 \ncolumn. After washing, bound HsORC1 protein was eluted with lysis buffer supplemented with 5 875 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 24 \nmM desthiobiotin. The HsORC2-5 complex was purified in parallel using an identical Strep -tag 876 \naffinity protocol. Purified HsORC1 and HsORC2-5 protein fractions were combined, and TEV 877 \nprotease was added for tag cleavage, followed by incubation at 4 °C for 12 hours. The mixture 878 \nwas subsequently diluted to 150 mM KCl and subjected to ion exchange chromatography using 879 \na HiTrap SP column with a linear gradient from 150 to 1000 mM KCl. Protein-containing fractions 880 \nwere analyzed by SDS -PAGE. Fractions containing all five ORC subunits were pooled, 881 \nconcentrated, and further purified by size exclusion chromatography using a Superose 6 Increase 882 \n10/300 GL column (GE Healthcare) equilibrated with minimal buffer (25 mM HEPES -NaOH (pH 883 \n7.5), 100 mM KCl, 2 mM DTT). Final protein purity was assessed by SDS -PAGE, and pure 884 \nfractions were concentrated using an Amicon® Ultra centrifugal filter (50 kDa MWCO). Aliquots 885 \nof ~3–5 μM were snap-frozen in liquid nitrogen and stored at –80 °C. 886 \n 887 \nExpression and Purification of Human CDC6 Protein 888 \n 889 \nThe human CDC6 (HsCDC6) gene was cloned into the pET28a vector to allow for IPTG inducible 890 \nexpression in Escherichia coli. The construct encoded full-length HsCDC6 with an N-terminal His-891 \nSUMO tag. The resulting plasmid was transformed into E. coli Rosetta (DE3) cells and cultured 892 \nin 4 liters of Terrific Broth (TB)  supplemented with kanamycin. Cells were grown at 37°C until 893 \nreaching an optical density (OD ₆₀₀) of 0.8–1.0, at which point expression was induced with 0.5 894 \nmM IPTG. Protein expression was carried out for 16 hours at 16°C, and cells were harvested by 895 \ncentrifugation at 3,500 × g for 15 minutes . Cell pellets were resuspended in lysis buffer (50 mM 896 \nHEPES, pH 7.0, 300 mM NaCl, 10 mM imidazole, 2 mM β -mercaptoethanol) and lysed by 897 \nsonication on ice. The lysate was clarified by centrifugation and loaded onto a gravity-flow column 898 \npacked with Ni-NTA agarose beads and  pre-equilibrated with lysis buffer. The column was 899 \nwashed with 10 column volumes (CV) of lysis buffer , followed by 5 CV of high -salt buffer (lysis 900 \nbuffer with 500 mM NaCl). Bound protein was eluted using lysis buffer containing 400 mM 901 \nimidazole. Eluted protein was incubated with TEV protease overnight at 4°C to cleave the His -902 \nSUMO-TEV tag. The cleaved sample was diluted and applied to a HiTrap SP column  (GE 903 \nHealthcare) equilibrated in buffer (50 mM HEPES-NaOH, pH 7.0, 150 mM NaCl, 1 mM DTT) for 904 \nion exchange chromatography . Protein was eluted with a linear gradient of Buffer B (50 mM 905 \nHEPES-NaOH, pH 7.0, 1 M NaCl, 1 mM DTT). Protein peak fractions were pooled and subjected 906 \nto size exclusion chromatography (SEC)  using a Superdex 200 Increase 10/300 GL column , 907 \nequilibrated with SEC buffer (25 mM HEPES-NaOH, pH 7.5, 100 mM KCl, 2 mM DTT). Protein 908 \npurity was assessed by SDS-PAGE, and pure fractions were concentrated using an Amicon® 909 \nUltra centrifugal filter (30 kDa MWCO). Final protein aliquots at concentrations of approximately 910 \n10–15 μM were snap-frozen in liquid nitrogen and stored at –80°C. 911 \n 912 \nProtein purification and preparation of YlODC 913 \n 914 \nSynthetic, full -length genes of Yarrowia lipolytica ORC1 (YlORC1) (RefSeq: XP_502645.1), 915 \nYlORC2 (XP_503147.3), YlORC3 (XP_505428.1), YlORC4 (XP_504002.3), YlORC5 916 \n(XP_500387.1), and YlORC6 (XP_506105.1) were codon optimized and cloned into either pFL 917 \n(pH promoter YlORC1, p10 promoter YlORC6), pSPL (pH promoter YlORC2, p10 promoter 918 \nYlORC5), or pUCDM (pH promoter YlORC4, p10 promoter YlORC3) plasmids for expression via 919 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 25 \nthe MultiBac baculovirus expression system 98 . To increase protein expression and solubility, in 920 \naddition to providing a tag for affinity chromatography, an N -terminal Twin Strep-SumoStar-TEV 921 \ntag was added to YlORC1. The tagged version of YlOrc1 was utilized for the Cdc6 loading assay 922 \nand EM studies. YlCDC6 (XP_501295.1) was codon optimized and cloned into a pET28b bacterial 923 \nexpression cassette (Novagen) containing an N-terminal 8xHis-TEV tag for affinity purification. 924 \n 925 \nFor YlORC, Sf9 insect cells were incubated with baculovirus for 72 hr in Hyclone CCM3 media 926 \n(GE Healthcare Life Sciences, Pittsburg, PA). For YlCdc6 expression, BL21 (DE3) strain E. coli 927 \nwere transformed and then selected for with a kanamycin -supplemented LB starter culture, 928 \nfollowed by inoculation of kanamycin-supplemented Terrific Broth (TB). Expression was induced 929 \nat OD 1 with the addition of 0.5 mM IPTG and incubated at 17ºC overnight. 930 \n 931 \nUnless otherwise noted, each purification step was carried out at 4ºC. For YlORC purification, 932 \ninsect cell pellets were thawed in a 30ºC water bath, resuspended in lysis buffer (50 mM HEPES-933 \nNaOH (pH 7.5), 150 mM potassium acetate (KOAc) (pH 7.5), 50 mM potassium glutamate (K -934 \nGlu), 50 mM arginine hydrochloride, 10 mM Mg(OAc) 2, 6.5 mM dithiothreitol (DTT), 1.65 mM 935 \nadenosine triphosphate (ATP), 10% glycerol), supplemented with a protease inhibitor cocktail (1 936 \nmM PMSF, 2 µM pepstatin, 2 µM leupeptin, 1 mM benzamidine, 1:1725 dilution of Millipore-Sigma 937 \naprotinin (A6279)) in addition to 1X cOmplete EDTA-free protease inhibitor cocktail (Roche) and 938 \nsonicated. Lysate was then centrifuged at 38,000g for 1 hour, after which the supernatant was 939 \ncollected and 3 mL of either StrepTactin Superflow resin or StrepTactin 4Flow resin was added 940 \nto the supernatant and incubated for 90 minutes. The resin was washed and YlORC was eluted 941 \nusing lysis buffer supplemented with 5 mM desthiobiotin. YlORC-containing fractions were pooled 942 \ntogether, and l-phosphatase was added at a ~2:1 YlORC:phosphatase molar ratio, along with 1 943 \nmM manganese chloride, and incubated at 4ºC for 36 -48 hours. In preparations used for 944 \nbiochemical assays, YlORC was simultaneously treated with TEV protease at an YlORC:TEV 945 \nmass ratio of 15:1. The phosphatase -treated elution then underwent anion exchange 946 \nchromatography (HiTrap Q HP 5 mL, Cytiva) followed by size exclusion chromatography 947 \n(Superose 6 increase 10/300 GL, Cytiva) equilibrated in minimal buffer (25 mM HEPES -NaOH 948 \n(pH 7.5), 100 mM KOAc (pH 7.5), 50 mM K -Glu, 5 mM Mg(OAc) 2, 1 mM DTT, 5% glycerol). 949 \nAliquots were made with YlORC concentrated to »2.4 mg/mL. 950 \n 951 \nFor YlCdc6 purification, cell pellets were thawed in similar conditions except that the lysis buffer 952 \ncontained an additional 10 mM imidazole. For YlCdc6 affinity purification, 5 mL of Ni-NTA agarose 953 \nwas added to clarified lysate, with resin washes done with 25 mM imidazole supplemented lysis 954 \nbuffer, and eluted with 50 mM, 100 mM, 250 mM, and 500 mM imidazole supplemented lysis 955 \nbuffer. TEV protease was added and incubated overnight at 4º. YlCdc6 was further purified using 956 \ncation exchange chromatography (HiTrap SP HP 5 mL, Cytiva) followed by size exclusion 957 \nchromatography (Superdex 200 increase 10/300 GL, Cytiva) into minimal buffer (25 mM HEPES-958 \nNaOH (pH 7.5), 100 mM NaCl, 1 mM DTT). Aliquots were made by supplementation with glycerol 959 \nto 5%, and YlCdc6 was concentrated to 5 mg/mL. 960 \n 961 \nSynthetic ori oligonucleotides for structural analysis 962 \n 963 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 26 \nOligonucleotides were ordered from IDT and were then annealed to their complementary 964 \noligonucleotides by incubating them together at 95ºC for 5 minutes, followed by a temperature 965 \ndecrease of 2ºC/min until 25ºC was reached. The ordered oligonucleotides are displayed in the 966 \ntable below: 967 \n 968 \nOriA-006ori(60bp) 5’-CTCCACCCAATATGCCCCTCCAATCCAGCTCCTACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTAGGAGCTGGATTGGAGGGGCATATTGGGTGGAG -3’ \nOriA-006 CNNGGNR \n(60bp) \n5’-CTCCACCCAATATGCCCCTGGAATCCAGCTCCTACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTAGGAGCTGGATTCCAGGGGCATATTGGGTGGAG -3’ \nOriA-006GNNGGNR \n(60bp) \n5’-CTCCACCCAATATGCCGCTGGAATCCAGCTCCTACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTAGGAGCTGGATTCCAGCGGCATATTGGGTGGAG -3’ \nOriA-006GNNCCNR \n(60bp) \n5’-CTCCACCCAATATGCCGCTCCAATCCAGCTCCTACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTAGGAGCTGGATTGGAGCGGCATATTGGGTGGAG -3’ \nOriA-006GNNCCNT \n(60bp) \n5’-CTCCACCCAATATGCCGCTCCATTCCAGCTCCTACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTAGGAGCTGGAATGGAGCGGCATATTGGGTGGAG -3’ \nOriA-006CNNAANR \n(60bp) \n5’-CTCCACCCAATATGCCCCTAAAATCCAGCTCCTACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTAGGAGCTGGATTTTAGGGGCATATTGGGTGGAG -3’ \nOriA-006ANNAANR \n(60bp) \n5’-CTCCACCCAATATGCCACTAAAATCCAGCTCCTACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTAGGAGCTGGATTTTAGTGGCATATTGGGTGGAG -3’ \nOriA-006CNNCCNT \n(60bp) \n5’-CTCCACCCAATATGCCCCTCCATTCCAGCTCCTACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTAGGAGCTGGAATGGAGGGGCATATTGGGTGGAG -3’ \nOriA-006CNNCCNC \n(60bp) \n5’-CTCCACCCAATATGCCCCTCCA CTCCAGCTCCTACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTAGGAGCTGGA GTGGAGGGGCATATTGGGTGGAG -3’ \noriA-006 R+0 6A 5’-CTCCACCCAATATGCCCCTCCAAAAAAACTCCTACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTAGGAGTTTTTTTGGAGGGGCATATTGGGTGGAG -3’ \noriA-006 R+1 6A 5’-CTCCACCCAATATGCCCCTCCAAAAAAAATCCTACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTAGGATTTTTTTTGGAGGGGCATATTGGGTGGAG -3’ \nOriA-006 R+2 6A 5’-CTCCACCCAATATGCCCCTCCAATAAAAAACCTACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTAGGTTTTTTATTGGAGGGGCATATTGGGTGGAG -3’ \nOriA-006 R+3 6A 5’-CTCCACCCAATATGCCCCTCCAATCAAAAAACTACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTAGTTTTTTGATTGGAGGGGCATATTGGGTGGAG -3’ \nOriA-006 R+4 6A 5’-CTCCACCCAATATGCCCCTCCAATCCAAAAAATACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTATTTTTTGGATTGGAGGGGCATATTGGGTGGAG -3’ \nOriA-006 R+5 6A 5’-CTCCACCCAATATGCCCCTCCAATCCAAAAAAAACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTTTTTTTTGGATTGGAGGGGCATATTGGGTGGAG -3’ \nOriA-006 R+6 6A 5’-CTCCACCCAATATGCCCCTCCAATCCAGAAAAAACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTTTTTTCTGGATTGGAGGGGCATATTGGGTGGAG -3’ \nOriA-006 R+7 6A 5’-CTCCACCCAATATGCCCCTCCAATCCAGCAAAAAAAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTTTTTTTGCTGGATTGGAGGGGCATATTGGGTGGAG -3’ \nOriA-006 R+8 6A 5’-CTCCACCCAATATGCCCCTCCAATCCAGCTAAAAAAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTTTTTTAGCTGGATTGGAGGGGCATATTGGGTGGAG -3’ \nOriA-006 R+5 XhoI 5’-CTCCACCCAATATGCCCCTCCAATCCACTCGAGACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTCTCGAGTGGATTGGAGGGGCATATTGGGTGGAG -3’ \nOriC-061 (45bp) 5’-CCCAATATTACACCCAAGTAGCATGCATAAGCTAAAAGTAACTCG -3’ \n5’-CGAGTTACTTTTAGCTTATGCATGCTACTTGGGTGTAATATTGGG -3’ \nOriC-061 scramble \n(45bp) \n5’-CACAGAAACTAATAAGACAAACACGCATCTGCTTATTGCGCACTA -3’ \n5’-TAGTGCGCAATAAGCAGATGCGTGTTTGTCTTATTAGTTTCTGTG -3’ \nOriC-061 (54bp) 5’-TGGTACCGATCCCAATATTACACCCAAGTAGCATGCATAAGCTAAAAGTAACTC -3’ \n5’-GAGTTACTTTTAGCTTATGCATGCTACTTGGGTGTAATATTGGGATCGGTACCA -3’ \nOriC-061 (60bp) 5’-CGATGGTACCGATCCCAATATTACACCCAAGTAGCATGCATAAGCTAAAAGTAACTCGCA -3’ \n5’-TGCGAGTTACTTTTAGCTTATGCATGCTACTTGGGTGTAATATTGGGATCGGTACCATCG -3’ \nOriA-006 YGTR \n(60bp) \n5’-CTCCACCCAATGTGCCCCTCCAATCCAGCTCCTACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTAGGAGCTGGATTGGAGGGGCACATTGGGTGGAG -3’ \nOriA-006 YACR \n(60bp) \n5’-CTCCACCCAATACGCCCCTCCAATCCAGCTCCTACAAGTCGGGGTTGAGACTGCACCAAA -3’ \n5’-TTTGGTGCAGTCTCAACCCCGACTTGTAGGAGCTGGATTGGAGGGGCGTATTGGGTGGAG -3’ \n    \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 27 \n    \n 969 \nCdc6 loading assay 970 \n 971 \nTo test the dependence of YlORC’s ability to bind DNA and load YlCdc6 on the origin, annealed 972 \noligonucleotides representing ori variants and 5X reaction buffer (750 mM KOAc (pH 7.5), 250 973 \nmM HEPES-NaOH (pH 7.5), 50 mM Mg(OAc)2, 5 mM DTT, 5 mM ATP, 50% glycerol) were added 974 \nto purified YlORC1 -6, with an ORC:DNA molar ratio of 1:1.5, and allowed to incubate at room 975 \ntemperature for 10 minutes. For YlCdc6-containing assays, purified YlCdc6 was added following 976 \nthe ORC -DNA incubation at an ORC:Cdc6 molar ratio of 1:4 and was incubated at room 977 \ntemperature for 10 minutes. Samples were then loaded onto a Superose 6 increase 3.2/300 978 \nmicrokit column (Cytiva) equilibrated in SEC buffer (25 mM HEPES -NaOH (pH 7.5), 100 mM 979 \nNaCl, 1 mM DTT) and fraction samples were run on SDS-PAGE and visualized using ReadyBlue 980 \nProtein Gel Stain (Sigma). For experiments determining the total quantity of DNA in each fraction, 981 \nSDS-PAGE gels were stained with SYBR Gold and imaged prior to ReadyBlue staining. 982 \n260/280nm UV absorbance ratios obtained from chromatograms were also used for qualitative 983 \nanalysis of DNA and Cdc6 binding to ORC. 984 \n 985 \nGel images were quantified using the ImageJ -based software package Fiji  99 . For calculating 986 \nrelative loading efficiency, the intensity ratio of the YlCdc6 band to each ORC subunit band was 987 \nnormalized to the intensity ratios observed while running the assay with a 60bp fragment of the 988 \nWT OriA-006 and averaged.  989 \n 990 \nCryo-EM sample preparation 991 \n 992 \nHsODC: Purified HsORC1–5, HsCDC6, DNA and AMP-PNP were mixed at final concentrations 993 \nof 2.5 μM, 5.0 μM, 7.5 μM and 10 μM, respectively. To reduce preferred particle orientations and 994 \npromote the formation of thin ice layers over grid holes, lauryl maltose neopentyl glycol (LMNG; 995 \nAnatrace, Maumee, OH)  was added to a final concentration of 0.05% (w/v). For cryo-electron 996 \nmicroscopy, 4 μL of the protein –DNA complex was applied to a glow-discharged Quantifoil R 997 \n0.6/1, 300 mesh copper grid. The grid was incubated for 10 seconds at 25°C and 90% humidity, 998 \nblotted for 3.0 seconds, and then rapidly plunge-frozen into liquid ethane using a Leica EM GP2 999 \nautomatic plunge freezer (Leica Microsystems, Buffalo Grove, IL). 1000 \n 1001 \n 1002 \nYlODC60bpOri-A006-WT: a similar protocol was used with key differences. A 60 bp OriA-006 fragment 1003 \nwas used instead of the 45 bp OriC-061 fragment, and the final protein concentration was 1 1004 \nmg/mL. The sample was applied to a glow -discharged lacey carbon grid and blotted for 3.0 1005 \nseconds.  1006 \n 1007 \nYlODC54bpOriC-061: purified YlORC1 -6 was mixed with glycerol -free 5X loading assay reaction 1008 \nbuffer, a 54 bp OriC-061 fragment, and YlCdc6 at an ORC:DNA:Cdc6 molar ratio of 1:1.5:4 in a 1009 \nstepwise fashion, followed by gel filtration using a Superose 6 increase 3.2/300 microkit column 1010 \n(Cytiva), identical to the Cdc6 loading assay. Fractions containing the YlORC-DNA-Cdc6 complex 1011 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 28 \nwere then concentrated with a 0.5 mL Amicon Ultra 50kDa MWCO centrifugal filter to a final 1012 \nprotein concentration of 1 -1.25 mg/mL without additional ATP supplementation. Following 1013 \nconcentration, lauryl maltose neopentyl glycol (LMNG) was added to 0.05% to reduce a preferred 1014 \norientation issue. 4 µL of sample were applied to a non-glow discharged Quantifoil R 1.2/1.3 300 1015 \nmesh copper grid (previously washed with ethyl acetate), incubated for 10 seconds at 25ºC and 1016 \n95% humidity, blotted for 2.9 seconds, and plunged into liquid ethane using a Leica Automatic 1017 \nPlunge Freezer EM GP2.  1018 \n 1019 \nYlODC60bpOri-A006-CNNGGNR: sample preparation followed the protocol for the YlODC45bpOriC-061 1020 \nsample, with key differences. A 60 bp OriA-006 fragment containing the CNNGGNR mutation 1021 \n(see oligo table for sequence) was substituted, and samples had a final protein concentration of 1022 \n1.6 mg/mL. Additionally, a non -glow discharged Quantifoil R 1.2/1.3 300 mesh copper grid 1023 \n(previously washed with ethyl acetate) was used and was blotted for 2.7 seconds. 1024 \n 1025 \nCryo-EM data acquisition 1026 \n 1027 \nHsODC: Cryo-EM data were collected on a Titan Krios transmission electron microscope 1028 \n(ThermoFisher Scientific) operating at 300 keV. Data were acquired using EPU software 1029 \n(v2.10.0.5, ThermoFisher Scientific), and dose-fractionated movies were recorded on a K3 direct 1030 \nelectron detector (Gatan) in electron counting mode. HsODC samples were applied to Quantifoil 1031 \nR 0.6/1 grids, and 30 -frame movies were collected at an exposure rate of 1.44 e ⁻/Ų/frame, 1032 \nyielding a cumulative dose of 43.2 e ⁻/Ų. A total of 7088 micrographs were acquired at 81,000× 1033 \nnominal magnification, with a defocus range of 0.6–2.2 μm. 1034 \n 1035 \nYlODC: Cryo-electron microscopy data were collected using an FEI/ThermoFisher Titan Krios 1036 \nTEM operating at 300 keV. A Gatan K3 direct electron detector equipped with a BioQuantum 1037 \nenergy filter was utilized to semi -automatically collect dose -fractionated movies with 1038 \nThermoFisher EPU data collection software. For the YlODC45bpOriC-061 maps, two collections on 1039 \nconsecutive days accrued 8978 and 9310 exposures, respectively, with movies collected with 30 1040 \nframes at a dose rate of 1.98 e/Å2 per frame, resulting in a cumulative dose of 59.4 e/Å2. For the 1041 \nYlODC54bpOriC-061 data collection, 30-frame movies were collected over three consecutive days, 1042 \nresulting in 9309, 8758, and 2274 exposures taken, respectively, at a dose rate of 1.44 e/Å2 per 1043 \nframe, totaling a cumulative dose of 43.2 e/Å2. For the YlODC60bpOri-A006-WT data collection, a single 1044 \nsession was used to collect 8340 exposures, with movies containing 40 frames at a dose rate of 1045 \n1.97 e/Å2 per frame, totaling 78.8 e/Å2 in cumulative dose. YlODC60bpOri-A006-CNNGGNR data collection 1046 \nincluded 8428 exposures from a single session, with 40 frames per movie, a dose rate of 1.37 1047 \ne/Å2 per frame, and a cumulative dose of 54.8 e/Å2. 1048 \n 1049 \nCryo-EM data processing 1050 \n 1051 \nHsODC: Real -time preprocessing, including motion correction, CTF estimation, and particle 1052 \npicking, was performed in WARP (v1.0.9). Particle picking used the BoxNet pretrained neural 1053 \nnetwork implemented in TensorFlow, with a particle diameter of 180 Å and a threshold score of 1054 \n0.6, resulting in 898,455 coordinates. Subsequent image processing was carried out in 1055 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 29 \ncryoSPARC v3.2. Particles were extracted and subjected to multiple rounds of 2D classification, 1056 \nand well-resolved subsets were selected for ab initio 3D reconstruction. Separation into 3 –5 ab 1057 \ninitio classes proved critical for improving map quality. These models were used for 3D 1058 \nheterogeneous refinement against the full dataset, yielding 443,190 selected particles for HsODC. 1059 \nThis subset was further classified into three classes, and the best class was refined. 1060 \nHomogeneous and non-uniform refinements for the best 3D class (130,819 particles) produced a 1061 \ncryo-EM map at 2.6 Å resolution, as determined by the gold -standard FSC (GSFSC) criterion. 1062 \nThe final sharpened map was used for model building and visualization (Figure S1B). 1063 \n 1064 \nYlODC: WARP was utilized for motion correction, CTF estimation, and particle picking (via 1065 \nBoxNet neural network trained on manually picked micrographs) from the collected micrographs 1066 \nfor all datasets  100 . For particle picking, a particle diameter of either 180 Å or 200 Å and a 1067 \nthresholding score of either 0.3, 0.4, or 0.5 were used, yielding 1,822,720 particles for 1068 \nYlODC45bpOriC-061, 3,805,196 particles for YlODC54bpOriC-061, and 793,509 particles for YlODC60bpOri-1069 \nA006-WT. While WARP pre-processing and picking was carried out for the YlODC60bpOri-A006-CNNGGNR 1070 \nexposures originally, cryoSPARC’s pre-processing and particle picking tools were used instead, 1071 \ndescribed below. All downstream processing was carried out using cryoSPARC v4 101–103. All 2D 1072 \nclassifications underwent an extra final iteration, all heterogeneous refinements listed used 1073 \nparticles binned to 128 pixels, and all non -uniform refinements used “minimize over per -particle 1074 \nscale” and underwent one extra final pass. 1075 \n 1076 \nYlODC45bpOriC-061: 1,822,720 particles were picked and extracted by WARP/BoxNet unbinned with 1077 \na box size of 480 pixels and imported into cryoSPARC for processing. Each day of collection 1078 \nunderwent its own set of 2D classification, resulting in two 2D classification jobs, one with 970,731 1079 \nstarting particles and 194,059 particles selected for further processing, and another with 851,989 1080 \nparticles with 457,613 selected. The 194,059 particles were used for ab-initio model generation 1081 \nof three classes. The generated ab-initio structures were then used in a heterogeneous 1082 \nrefinement that included the entire particle dataset (1,822,720 particles), resulting in 802,503 1083 \nparticles constituting the best class. This class then underwent homogenous refinement followed 1084 \nby non-uniform refinement, resulting in a 2.9 Å resolution map. Particles from this map underwent 1085 \nanother round of 2D classification, selecting for 533,196 particles. Another heterogeneous 1086 \nrefinement was carried out, using the ab-initio models as templates, resulting in a class with 1087 \n302,465 particles. This class was then subjected to non -uniform refinement with simultaneous 1088 \nper-particle scale minimization, per-particle defocus refinement, and CTF refinement of per-group 1089 \nCTF parameters, spherical aberration, and tetrafoil, producing a 2.7 Å map. Finally, 3D 1090 \nclassification was carried out, and the class containing the strongest Orc2 -WHD was selected 1091 \nand underwent a final non-uniform refinement, resulting in a final map with a resolution of 2.7 Å 1092 \nfrom 84,914 particles 1093 \n 1094 \nYlODC54bpOriC-061: 3,805,196 particles were picked and extracted by WARP/BoxNet unbinned with 1095 \na box size of 440 pixels and imported into cryoSPARC for processing. Following a check for 1096 \ncorrupt particles, each day’s full particle set was used in ab-initio model generation to generate 4 1097 \nclasses. The best class of each set was used in non -uniform refinement with per -particle scale 1098 \nminimization, per-particle defocus refinement, and CTF refinement of per-group CTF parameters, 1099 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 30 \nspherical aberration, and tetrafoil to produce 3 maps (1,512,226 particles  538,187 particles, 1100 \n2.6 Å resolution map; 509,844 particles  210,193 particles, 2.6 Å resolution map; 1,377,300 1101 \nparticles  488,199 particles, 2.5 Å resolution map) to validate pixel size and spherical aberration 1102 \nparameters. 2D classification with 250 classes was then carried out on the entire dataset, from 1103 \nwhich most (3,705,630) particles were selected for ab -initio model generation commenced from 1104 \n3,705,630 particles sorted into eight classes, the best of which was then flipped for proper 1105 \nhandedness. Heterogeneous refinement was then carried out, producing a 2.3 Å resolution map 1106 \nfrom 1,453,157 particles that appeared heterogeneous in density. 3D classification was carried 1107 \nout with 10 classes at a filter resolution of 8 Å, which were then used to produce 6 maps via non-1108 \nuniform refinement as the result of combining some 3D classification output classes into one 1109 \nstructure. One of these structures underwent a further 3D classification into 2 classes at a filter 1110 \nresolution of 10 Å, selecting for the class that contained the Orc1 -AAA domain while bound to 1111 \nDNA. Following this, a large -scale heterogeneous refinement of the entire dataset was done 1112 \nagain, this time split into 14 classes: the aforementioned Orc1-AAA containing map, three maps 1113 \nderived from the 3D classification, the YlODC45bpOriC -061 map, and a map of YlORC -DNA 1114 \nproduced from a previous collection. Following this large -scale classification/refinement, a 1115 \nYlODC54bpOriC-061  map at 2.5 Å resolution was produced with weak Cdc6 density from 1116 \n558,557 particles. This class then underwent 3 cycles of 3D classification and non -uniform 1117 \nrefinement with per-particle scale minimization, per-particle defocus refinement, CTF refinement 1118 \nof per -group CTF parameters, spherical aberration, and tetrafoil refinement. Each 3D 1119 \nclassification consisted of only 2 classes and used a filter resolution of 10 Å. After the 3 rounds of 1120 \nrefinement and re-classification, a 2.7 Å map from 70,712 particles was produced. Following this, 1121 \nthe Subset Particles job was used to select particles by per-particle scale, leaving 51,599 particles 1122 \nfor use in another non -uniform refinement, producing a 2.7 Å resolution map to be used as the 1123 \nfinal YlODC54bpOriC-061 map. A schematic summary of data processing is shown in Figure 1124 \nS4B. 1125 \n 1126 \nYlODC60bpOri-A006-WT: 793,509 particles were picked and extracted by WARP/BoxNet unbinned 1127 \nwith a box size of 440 pixels and imported into cryoSPARC for processing. Following a check for 1128 \ncorrupt particles, 2D classification into 200 classes was done, with 416,680 particles selected for 1129 \nab-initio model generation of 6 maps. The YlODC54bpOriC-061 map with weak Cdc6 density was 1130 \nimported into the project and heterogeneous refinement with the six ab-initio maps and the 1131 \nimported YlODC54bpOriC-061 map was carried out on the entire particle dataset. The best 1132 \nheterogeneous refinement volume/particles underwent non -uniform refinement with the same 1133 \nscale, defocus, and CTF refinement corrections done in previously mentioned non -uniform 1134 \nrefinements, and a 2.8 Å map from 255,191 particles was produced. Particles used in this map 1135 \nwere then repicked from motion- and CTF-corrected micrographs (carried out in cryoSPARC) to 1136 \ngenerate a 2.9 Å resolution map, which then underwent Reference -Based Motion Correction to 1137 \nproduce a 2.7 Å resolution map from 246,739 particles. 3D classification at a filter resolution of 1138 \n10 Å into 3 classes were performed, and the best two classes were combined for another round 1139 \nof non-uniform refinement, followed by a Subset Particles job (by per -particle scale) and a final 1140 \nnon-uniform refinement to produce a 2.6 Å resolution map from 125,267 particles, which was then 1141 \nused for model building of YlODC60bpOri-A006-WT. A schematic summary of data processing is shown 1142 \nin Figure S4K. 1143 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 31 \n 1144 \nYlODC60bpOri-A006-CNNGGNR: 8,428 movies were imported into cryoSPARC and underwent patch 1145 \nmotion correction and patch CTF corrections to generate corrected micrographs. Template 1146 \npicking of micrographs commenced using representative 2D class averages of the particles used 1147 \nin the final YlODC60bpOri-A006-WT refinement, resulting in 4,708,382 particles being picked. 1148 \nMicrographs and respective particles were then analyzed using the Micrograph Junk Detector job, 1149 \nand after exposure and particle curation resulted in 2,710,398 particles from 7,330 micrographs. 1150 \nParticles were then extracted with a box size of 432 px and Fourier cropped to 128 px. Initial 2D 1151 \nclassification utilized 200 classes, of which 2,4,69,383 particles from 184 classes were selected 1152 \nfor use in further processing. Ab-initio model generation of 8 maps from 400,000 particles failed 1153 \nto produce a YlODC structure, so the YlODC60bpOri-A006-WT map was imported into the project, and 1154 \nheterogeneous refinement with the eight ab-initio maps along with the imported YlODC60bpOri-A006-1155 \nWT map was performed on the particle dataset. The best heterogeneous refinement volume/class 1156 \n(481,746 particles) underwent non-uniform refinement and further 2D classification to produce a 1157 \ncleaned stack of particles (305,326 particles) for particle re -extraction without Fourier cropping. 1158 \nNon-uniform refinement of the extracted particles produced a 2.9 Å resolution map, which was 1159 \nused as the reference volume for Reference-Based Motion Correction and re-refined to produce 1160 \na 2.6 Å resolution map. Particles were then subset by per-particle scale and re-refined, generating 1161 \na 2.5 Å resolution map of the complex with variable Cdc6 density. 3D classification into three 1162 \nclasses generated a class from 51,222 particles containing the full YlODC complex, which was 1163 \nused for a final non-uniform refinement to produce the final 2.56 Å resolution map of YlODC60bpOri-1164 \nA006-CNNGGNR used for model building. All non-uniform refinements of the unbinned particles utilized 1165 \nper-particle scale minimization, per-particle defocus refinement, and CTF refinement of per-group 1166 \nCTF parameters, spherical aberration, and tetrafoil. A schematic summary of data processing is 1167 \nshown in Figure S5D. 1168 \n 1169 \nModel building and validation 1170 \n 1171 \nHsODC: The atomic model of HsORC (PDB ID: 7JPS) was used as the starting model for HsODC 1172 \nand rigid-body fitted into the cryo -EM density using ChimeraX. Regions of HsORC that were 1173 \nmissing or did not fit well into the density were rebuilt manually in Coot. Iterative model building 1174 \nand refinement were performed in PHENIX (v1.20.1 –4487-000), with secondary -structure 1175 \nrestraints applied throughout.  Model validation was carried out using MolProbity and PHENIX 1176 \nvalidation tools. The final model showed good stereochemistry, with >95% of residues in favored 1177 \nregions of the Ramachandran plot, <0.5% outliers, and all bond length and bond angle deviations 1178 \nwithin acceptable limits. Structural figures were generated using ChimeraX and PyMOL (v2.5.5, 1179 \nSchrödinger, LLC). 1180 \n 1181 \nYlODC: For the YlODC45bpOriC-061  structure, AlphaFold 2 models for each subunit were docked 1182 \ninto the density individually using the “fit to map” functionality in ChimeraX 104 , then refined using 1183 \nthe Coot software package 105 . The density for the DNA was sharp enough to allow us to discern 1184 \npurines and pyrimidines, allowing us to produce a generic DNA -B form model of the respective 1185 \nDNA sequence and manually rebuild it in Coot. This structure was then used as the basis of the 1186 \nother ODC structures. Structures were then further refined in Coot using “Real Space Refinement” 1187 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 32 \nfunction and ligands, ions, and waters were manually built. The Phenix software package was 1188 \nthen used to further refine and finalize the structures, as well as provide validation metrics, via its 1189 \n“Real Space Refine” functionality 106 . Figures using these structures, along with comparisons to 1190 \npreviously published ORC/ODC structures, were generated using ChimeraX.  The preliminary 1191 \nYlODC45bpOriC-061  structure was then used as the basis for the YlODC54bpOriC-061 structure, which 1192 \nitself was used as the starting point for the YlODC60bpOri-A006-WT structure. Additionally, the 1193 \nYlODC60bpOri-A006-WT structure was used as a reference for building the YlODC60bpOri-A006-CNNGGNR 1194 \nstructure. 1195 \n 1196 \n 1197 \nREFERENCES 1198 \n 1199 \n1. Hu, Y. & Stillman, B. Origins of DNA replication in eukaryotes. Mol. Cell 83, 352–372 1200 \n(2023). 1201 \n2. Hyrien, O., Guilbaud, G. & Krude, T. The double life of mammalian DNA replication origins. 1202 \nGenes Dev. 39, 304–324 (2025). 1203 \n3. Ekundayo, B. & Bleichert, F. Origins of DNA replication. PLoS genetics 15, e1008320 1204 \n(2019). 1205 \n4. Lee, C. S. K., Weiβ, M. & Hamperl, S. Where and when to start: Regulating DNA replication 1206 \norigin activity in eukaryotic genomes. Nucleus 14, 2229642 (2023). 1207 \n5. Costa, A. & Diffley, J. F. X. The Initiation of Eukaryotic DNA Replication. Annu. Rev. 1208 \nBiochem. 91, 107–131 (2022). 1209 \n6. Bleichert, F., Botchan, M. R. & Berger, J. M. Mechanisms for initiating cellular DNA 1210 \nreplication. Science 355, eaah6317 (2017). 1211 \n7. Bell, S. P. & Labib, K. Chromosome Duplication in Saccharomyces cerevisiae. Genetics 203, 1212 \n1027–1067 (2016). 1213 \n8. Musiałek, M. W. & Rybaczek, D. Behavior of replication origins in Eukaryota - spatio-1214 \ntemporal dynamics of licensing and firing. Cell cycle (Georgetown, Tex) 0 (2015) 1215 \ndoi:10.1080/15384101.2015.1056421. 1216 \n9. Nishitani, H. & Lygerou, Z. Control of DNA replication licensing in a cell cycle. Genes Cells 1217 \n7, 523–534 (2002). 1218 \n10. Rhind, N. DNA replication timing: Biochemical mechanisms and biological significance. 1219 \nBioessays 2200097 (2022) doi:10.1002/bies.202200097. 1220 \n11. Limas, J. C. & Cook, J. G. Preparation for DNA replication: the key to a successful S phase. 1221 \nFEBS letters 593, 2853–2867 (2019). 1222 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 33 \n12. Speck, C. & Reuter, L. M. Compact Origins and Where to Find Them: ORC’s Guide to 1223 \nGenome‐Wide Licensing. BioEssays e70018 (2025) doi:10.1002/bies.70018. 1224 \n13. Yeeles, J. T. P., Deegan, T. D., Janska, A., Early, A. & Diffley, J. F. X. Regulated eukaryotic 1225 \nDNA replication origin firing with purified proteins. Nature 519, 431–435 (2015). 1226 \n14. Kurat, C. F., Yeeles, J. T. P., Patel, H., Early, A. & Diffley, J. F. X. Chromatin Controls 1227 \nDNA Replication Origin Selection, Lagging-Strand Synthesis, and Replication Fork Rates. Mol. 1228 \nCell 65, 117–130 (2017). 1229 \n15. Devbhandari, S., Jiang, J., Kumar, C., Whitehouse, I. & Remus, D. Chromatin Constrains the 1230 \nInitiation and Elongation of DNA Replication. Mol. Cell 65, 131–141 (2017). 1231 \n16. Zhang, Q., Lam, W. H. & Zhai, Y. Assembly and activation of replicative helicases at origin 1232 \nDNA for replication initiation. Curr. Opin. Struct. Biol. 88, 102876 (2024). 1233 \n17. Stillman, B., Diffley, J. F. X. & Iwasa, J. H. Mechanisms for licensing origins of DNA 1234 \nreplication in eukaryotic cells. Nat. Struct. Mol. Biol. 1–11 (2025) doi:10.1038/s41594-025-1235 \n01587-5. 1236 \n18. Siow, C. C., Nieduszynska, S. R., Müller, C. A. & Nieduszynski, C. A. OriDB, the DNA 1237 \nreplication origin database updated and extended. Nucleic acids research 40, D682-6 (2012). 1238 \n19. Brewer, B. J. & Fangman, W. L. The localization of replication origins on ARS plasmids in 1239 \nS. cerevisiae. Cell 51, 463–471 (1987). 1240 \n20. Attali, I., Botchan, M. R. & Berger, J. M. Structural Mechanisms for Replicating DNA in 1241 \nEukaryotes. Annu. Rev. Biochem. 90, 1–30 (2021). 1242 \n21. Moyer, S. E., Lewis, P. W. & Botchan, M. R. Isolation of the Cdc45/Mcm2-7/GINS (CMG) 1243 \ncomplex, a candidate for the eukaryotic DNA replication fork helicase. Proceedings of the 1244 \nNational Academy of Sciences of the United States of America 103, 10236–10241 (2006). 1245 \n22. Marahrens, Y. & Stillman, B. A Yeast Chromosomal Origin of DNA Replication Defined by 1246 \nMultiple Functional Elements. Science 255, 817–823 (1992). 1247 \n23. Theis, J. F. & Newlon, C. S. Domain B of ARS307 contains two functional elements and 1248 \ncontributes to chromosomal replication origin function. Mol Cell Biol 14, 7652–7659 (1994). 1249 \n24. Rao, H., Marahrens, Y. & Stillman, B. Functional Conservation of Multiple Elements in 1250 \nYeast Chromosomal Replicators. Mol. Cell. Biol. 14, 7643–7651 (1994). 1251 \n25. Reuter, L. M. et al. MCM2-7 loading-dependent ORC release ensures genome-wide origin 1252 \nlicensing. Nat. Commun. 15, 7306 (2024). 1253 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 34 \n26. Coster, G. & Diffley, J. F. X. Bidirectional eukaryotic DNA replication is established by 1254 \nquasi-symmetrical helicase loading. Science 357, 314–318 (2017). 1255 \n27. Gupta, S., Friedman, L. J., Gelles, J. & Bell, S. P. A helicase-tethered ORC flip enables 1256 \nbidirectional helicase loading. Elife 10, e74282 (2021). 1257 \n28. Hu, Y. et al. Evolution of DNA replication origin specification and gene silencing 1258 \nmechanisms. Nat. Commun. 11, 5175 (2020). 1259 \n29. Wang, D. & Gao, F. Comprehensive Analysis of Replication Origins in Saccharomyces 1260 \ncerevisiae Genomes. Frontiers in Microbiology 10, 2122 (2019). 1261 \n30. Yuan, Z. et al. Structural basis of Mcm2–7 replicative helicase loading by ORC–Cdc6 and 1262 \nCdt1. Nat. Struct. Mol. Biol. 24, 316–324 (2017). 1263 \n31. Li, N. et al. Structure of the origin recognition complex bound to DNA replication origin. 1264 \nNature 559, 217–222 (2018). 1265 \n32. Lee, C. S. K. et al. Humanizing the yeast origin recognition complex. Nat. Commun. 12, 33 1266 \n(2021). 1267 \n33. Liachko, I. et al. A comprehensive genome-wide map of autonomously replicating sequences 1268 \nin a naive genome. PLoS genetics 6, e1000946 (2010). 1269 \n34. Liachko, I. et al. Novel features of ARS selection in budding yeast Lachancea kluyveri. BMC 1270 \nGenom. 12, 633 (2011). 1271 \n35. Hu, Y. et al. Evolution of DNA replication origin specification and gene silencing 1272 \nmechanisms. Nat. Commun. 11, 5175 (2020). 1273 \n36. Tsai, H.-J. et al. Origin replication complex binding, nucleosome depletion patterns, and a 1274 \nprimary sequence motif can predict origins of replication in a genome with epigenetic 1275 \ncentromeres. Mbio 5, e01703-14 (2014). 1276 \n37. Liachko, I. et al. GC-rich DNA elements enable replication origin activity in the 1277 \nmethylotrophic yeast Pichia pastoris. PLoS genetics 10, e1004169 (2014). 1278 \n38. Evrin, C. et al. A double-hexameric MCM2-7 complex is loaded onto origin DNA during 1279 \nlicensing of eukaryotic DNA replication. Proc. Natl. Acad. Sci. 106, 20240–20245 (2009). 1280 \n39. Remus, D. et al. Concerted Loading of Mcm2–7 Double Hexamers around DNA during 1281 \nDNA Replication Origin Licensing. Cell 139, 719–730 (2009). 1282 \n40. Weissmann, F. et al. MCM double hexamer loading visualized with human proteins. Nature 1283 \n636, 499–508 (2024). 1284 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 35 \n41. Yang, R., Hunker, O., Wise, M. & Bleichert, F. Multiple mechanisms for licensing human 1285 \nreplication origins. Nature 636, 488–498 (2024). 1286 \n42. Wells, J. N. et al. Reconstitution of human DNA licensing and the structural and functional 1287 \nanalysis of key intermediates. Nat. Commun. 16, 478 (2025). 1288 \n43. Tian, M. et al. Integrative analysis of DNA replication origins and ORC-/MCM-binding sites 1289 \nin human cells reveals a lack of overlap. eLife 12, RP89548 (2024). 1290 \n44. Ganier, O., Prorok, P., Akerman, I. & Méchali, M. Metazoan DNA replication origins. 1291 \nCurrent opinion in cell biology 58, 134–141 (2019). 1292 \n45. Wang, W. et al. Genome-wide mapping of human DNA replication by optical replication 1293 \nmapping supports a stochastic model of eukaryotic replication. Mol Cell (2021) 1294 \ndoi:10.1016/j.molcel.2021.05.024. 1295 \n46. Pourkarimi, E., Bellush, J. M. & Whitehouse, I. Spatiotemporal coupling and decoupling of 1296 \ngene transcription with DNA replication origins during embryogenesis in C. elegans. Elife 5, 1297 \ne21728 (2016). 1298 \n47. Comoglio, F. et al. High-Resolution Profiling of Drosophila Replication Start Sites Reveals a 1299 \nDNA Shape and Chromatin Signature of Metazoan Origins. Cell Reports 11, 821–834 (2015). 1300 \n48. Masai, H. & Tanaka, T. G-quadruplex DNA and RNA: Their roles in regulation of DNA 1301 \nreplication and other biological functions. Biochem. Biophys. Res. Commun. 531, 25–38 (2020). 1302 \n49. Valton, A.-L. & Prioleau, M.-N. G-Quadruplexes in DNA Replication: A Problem or a 1303 \nNecessity? Trends in Genetics 32, 697–706 (2016). 1304 \n50. Valton, A. L. et al. G4 motifs affect origin positioning and efficiency in two vertebrate 1305 \nreplicators. The EMBO journal 33, 732–746 (2014). 1306 \n51. Prorok, P. et al. Involvement of G-quadruplex regions in mammalian replication origin 1307 \nactivity. Nat Commun 10, 3274 (2019). 1308 \n52. Bartlett, D. A., Dileep, V., Baslan, T. & Gilbert, D. M. Mapping Replication Timing in 1309 \nSingle Mammalian Cells. Curr Protoc 2, e334 (2022). 1310 \n53. Carrington, J. T. et al. Most human DNA replication initiation is dispersed throughout the 1311 \ngenome with only a minority within previously identified initiation zones. Genome Biol. 26, 122 1312 \n(2025). 1313 \n54. Akerman, I. et al. A predictable conserved DNA base composition signature defines human 1314 \ncore DNA replication origins. Nat Commun 11, 4826 (2020). 1315 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 36 \n55. Guilbaud, G. et al. Determination of human DNA replication origin position and efficiency 1316 \nreveals principles of initiation zone organisation. Nucleic Acids Res (2022) 1317 \ndoi:10.1093/nar/gkac555. 1318 \n56. Langley, A. R., Gräf, S., Smith, J. C. & Krude, T. Genome-wide identification and 1319 \ncharacterisation of human DNA replication origins by initiation site sequencing (ini-seq). 1320 \nNucleic acids research 44, 10230–10247 (2016). 1321 \n57. Petryk, N. et al. Replication landscape of the human genome. Nature Communications 7, 1322 \n10208 (2016). 1323 \n58. Krude, T., Bi, J., Doran, R., Jones, R. A. & Smith, J. C. Human DNA replication initiation 1324 \nsites are specified epigenetically by oxidation of 5-methyl-deoxycytidine. Nucleic Acids Res. 53, 1325 \ngkaf362 (2025). 1326 \n59. Méchali, M., Yoshida, K., Coulombe, P. & Pasero, P. Genetic and epigenetic determinants of 1327 \nDNA replication origins, position and activation. Curr. Opin. Genet. Dev. 23, 124–131 (2013). 1328 \n60. Srikant, S., Gaudet, R. & Murray, A. W. Extending the reach of homology by using 1329 \nsuccessive computational filters to find yeast pheromone genes. Curr. Biol. (2023) 1330 \ndoi:10.1016/j.cub.2023.08.039. 1331 \n61. Vernis, L. et al. An Origin of Replication and a Centromere Are Both Needed To Establish a 1332 \nReplicative Plasmid in the Yeast Yarrowia lipolytica. Mol. Cell. Biol. 17, 1995–2004 (1997). 1333 \n62. Vernis, L. et al. Short DNA Fragments without Sequence Similarity Are Initiation Sites for 1334 \nReplication in the Chromosome of the Yeast Yarrowia lipolytica. Mol. Biol. Cell 10, 757–769 1335 \n(1999). 1336 \n63. Vernis, L. et al. Only Centromeres Can Supply the Partition System Required for ARS 1337 \nFunction in the Yeast Yarrowia lipolytica. J. Mol. Biol. 305, 203–217 (2001). 1338 \n64. Lopez, C., Cao, M., Yao, Z. & Shao, Z. Investigating the role of noncoding regulatory DNA 1339 \nin plasmid development for Yarrowia lipolytica. doi:10.22541/au.160691063.38058320/v1. 1340 \n65. Jaremko, M. J., On, K. F., Thomas, D. R., Stillman, B. & Joshua-Tor, L. The dynamic nature 1341 \nof the human origin recognition complex revealed through five cryoEM structures. eLife 9, 1342 \ne58622 (2020). 1343 \n66. Tocilj, A. et al. Structure of the active form of human Origin Recognition Complex and its 1344 \nATPase motor module. (2017) doi:10.2210/pdb5ujm/pdb. 1345 \n67. Schmidt, J. M. et al. A mechanism of origin licensing control through autoinhibition of S. 1346 \ncerevisiae ORC·DNA·Cdc6. Nat. Commun. 13, 1059 (2022). 1347 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 37 \n68. Schmidt, J. M. & Bleichert, F. Structural mechanism for replication origin binding and 1348 \nremodeling by a metazoan origin recognition complex and its co-loader Cdc6. Nat Commun 11, 1349 \n4263 (2020). 1350 \n69. Feng, X. et al. The structure of ORC–Cdc6 on an origin DNA reveals the mechanism of 1351 \nORC activation by the replication initiator Cdc6. Nat. Commun. 12, 3883 (2021). 1352 \n70. Lam, W. H. et al. DNA bending mediated by ORC is essential for replication licensing in 1353 \nbudding yeast. Proc. Natl. Acad. Sci. 122, e2502277122 (2025). 1354 \n71. Erzberger, J. P. & Berger, J. M. Evolutionary Relationships and Structural Mechanism of 1355 \nAAA+ Proteins. Annu. Rev. Biophys. Biomol. Struct. 35, 93–114 (2006). 1356 \n72. Zali, N. et al. Genome sequence assembly and annotation of MATA and MATB strains of 1357 \nYarrowia lipolytica. NAR Genom. Bioinform. 7, lqaf175 (2025). 1358 \n73. Fu, H., Baris, A. & Aladjem, M. I. Replication timing and nuclear structure. Curr. Opin. Cell 1359 \nBiol. 52, 43–50 (2018). 1360 \n74. Marchal, C., Sima, J. & Gilbert, D. M. Control of DNA replication timing in the 3D genome. 1361 \nNat. Rev. Mol. Cell Biol. 20, 721–737 (2019). 1362 \n75. McKnight, S. L. & Kingsbury, R. Transcriptional Control Signals of a Eukaryotic Protein-1363 \nCoding Gene. Science 217, 316–324 (1982). 1364 \n76. Nelson, H. C. M., Finch, J. T., Luisi, B. F. & Klug, A. The structure of an 1365 \noligo(dA)·oligo(dT) tract and its biological implications. Nature 330, 221–226 (1987). 1366 \n77. Haran, T. E., Kahn, J. D. & Crothers, D. M. Sequence Elements Responsible for DNA 1367 \nCurvature. J. Mol. Biol. 244, 135–143 (1994). 1368 \n78. Remus, D., Beall, E. L. & Botchan, M. R. DNA topology, not DNA sequence, is a critical 1369 \ndeterminant for Drosophila ORC–DNA binding. EMBO J. 23, 897–907 (2004). 1370 \n79. Tareen, A. et al. MAVE-NN: learning genotype-phenotype maps from multiplex assays of 1371 \nvariant effect. Genome Biol. 23, 98 (2022). 1372 \n80. Oji, A., Choubani, L., Miura, H. & Hiratani, I. Structure and dynamics of nuclear A/B 1373 \ncompartments and subcompartments. Curr. Opin. Cell Biol. 90, 102406 (2024). 1374 \n81. Vouzas, A. E. & Gilbert, D. M. Replication timing and transcriptional control: beyond cause 1375 \nand effect — part IV. Curr Opin Genet Dev 79, 102031 (2023). 1376 \n82. McCune, H. J. et al. The Temporal Program of Chromosome Replication: Genomewide 1377 \nReplication in clb5Δ Saccharomyces cerevisiae. Genetics 180, 1833–1847 (2008). 1378 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 38 \n83. Chang, F. et al. High-resolution analysis of four efficient yeast replication origins reveals 1379 \nnew insights into the ORC and putative MCM binding elements. Nucleic Acids Res. 39, 6523–1380 \n6535 (2011). 1381 \n84. Bell, S. P. & Stillman, B. ATP-dependent recognition of eukaryotic origins of DNA 1382 \nreplication by a multiprotein complex. Nature 357, 128–134 (1992). 1383 \n85. Bleichert, F., Leitner, A., Aebersold, R., Botchan, M. R. & Berger, J. M. Conformational 1384 \ncontrol and DNA-binding mechanism of the metazoan origin recognition complex. Proceedings 1385 \nof the National Academy of Sciences 115, E5906–E5915 (2018). 1386 \n86. Miller, T. C. R., Locke, J., Greiwe, J. F., Diffley, J. F. X. & Costa, A. Mechanism of head-to-1387 \nhead MCM double-hexamer formation revealed by cryo-EM. Nature 575, 704–710 (2019). 1388 \n87. Yuan, Z. et al. Structural mechanism of helicase loading onto replication origin DNA by 1389 \nORC-Cdc6. Proc. Natl. Acad. Sci. 117, 17747–17756 (2020). 1390 \n88. Dahlin, J., Holkenbrink, C. & Borodina, I. Yarrowia lipolytica, Methods and Protocols. in 1391 \nvol. 2307 41–68 (2021). 1392 \n89. Lopez, C., Cao, M., Yao, Z. & Shao, Z. Revisiting the unique structure of autonomously 1393 \nreplicating sequences in Yarrowia lipolytica and its role in pathway engineering. Appl Microbiol 1394 \nBiot 1–14 (2021) doi:10.1007/s00253-021-11399-4. 1395 \n90. Chen, S., Zhou, Y., Chen, Y. & Gu, J. fastp: an ultra-fast all-in-one FASTQ preprocessor. 1396 \nBioinformatics 34, i884–i890 (2018). 1397 \n91. Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 9, 1398 \n357–359 (2012). 1399 \n92. Danecek, P. et al. Twelve years of SAMtools and BCFtools. GigaScience 10, giab008 1400 \n(2021). 1401 \n93. Ramírez, F. et al. deepTools2: a next generation web server for deep-sequencing data 1402 \nanalysis. Nucleic Acids Res. 44, W160–W165 (2016). 1403 \n94. Zhang, Y. et al. Model-based Analysis of ChIP-Seq (MACS). Genome Biol. 9, R137 (2008). 1404 \n95. Heinz, S. et al. Simple Combinations of Lineage-Determining Transcription Factors Prime 1405 \ncis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell 38, 576–589 1406 \n(2010). 1407 \n96. Kinney, J. B., Murugan, A., Callan, C. G. & Cox, E. C. Using deep sequencing to 1408 \ncharacterize the biophysical mechanism of a transcriptional regulatory sequence. Proceedings of 1409 \nthe National Academy of Sciences 107, 9158–9163 (2010). 1410 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n \n 39 \n97. Tareen, A. & Kinney, J. B. Logomaker: beautiful sequence logos in Python. Bioinformatics 1411 \n36, 2272–2274 (2020). 1412 \n98. Bieniossek, C., Richmond, T. J. & Berger, I. MultiBac: Multigene Baculovirus‐Based 1413 \nEukaryotic Protein Complex Production. Curr. Protoc. Protein Sci. 51, 5.20.1-5.20.26 (2008). 1414 \n99. Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat. Methods 1415 \n9, 676–682 (2012). 1416 \n100. Tegunov, D. & Cramer, P. Real-time cryo-electron microscopy data preprocessing with 1417 \nWarp. Nat. Methods 16, 1146–1152 (2019). 1418 \n101. Zivanov, J., Nakane, T. & Scheres, S. H. W. Estimation of high-order aberrations and 1419 \nanisotropic magnification from cryo-EM data sets in RELION-3.1. IUCrJ 7, 253–267 (2020). 1420 \n102. Punjani, A., Rubinstein, J. L., Fleet, D. J. & Brubaker, M. A. cryoSPARC: algorithms for 1421 \nrapid unsupervised cryo-EM structure determination. Nat. Methods 14, 290–296 (2017). 1422 \n103. Punjani, A., Zhang, H. & Fleet, D. J. Non-uniform refinement: adaptive regularization 1423 \nimproves single-particle cryo-EM reconstruction. Nat. Methods 17, 1214–1221 (2020). 1424 \n104. Goddard, T. D. et al. UCSF ChimeraX: Meeting modern challenges in visualization and 1425 \nanalysis. Protein science : a publication of the Protein Society 27, 14–25 (2018). 1426 \n105. Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development of Coot. 1427 \nActa Crystallogr. Sect. D 66, 486–501 (2010). 1428 \n106. Liebschner, D. et al. Macromolecular structure determination using X‐rays, neutrons and 1429 \nelectrons: recent developments in Phenix. Acta Crystallogr. Sect. D 75, 861–877 (2019). 1430 \n  1431 \n 1432 \n  1433 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\nD\nBA\nC\nFigure 1\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\nFigure 2\n30’\n75’\n90’\n180’\n210’\n60’\n45’\n120’\n30’\n45’\n60’\n+HU\n160’\n2.3 Mb Chr. A\n-HU\nLog2 Ratio (obs/exp)Total size (bp)Number of peaksAnnotation\n0.0574597943150TTS\n-0.99620384998Exon\n0.7013196821163Intergenic\n0.1796787639241Promoter/TSS\nF\nE\nD\nC\nB\nCEN\nTelomeric repeats \nrDNA clusters\nA 30’\n120’\nA\nB\nC\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\n0\n10\n20\n30\n40\n50\n60\nWT\nOriC-061\nLinkers 2 to 45\nAATATT ACACCC AAGTAG CATGCA TAAGCT\nCTCGAG CTCGAG CTCGAG –TC-AG CTC-AG \n2 3 4 5 6\n WT\n3% 1.2% 41%0% 2% 0%\nMitotic Stability (%)\nFigure 3\nA\nB\n25              26              27             28               29   \n0\n10\n20\n30\n40\n50\n60\nWT\nLinkers 1 to 44\nBoxed linkers\n25 to 29\nWT    \n5% 45%0% 0% 0% 0%\nOriA-006\nMitotic Stability (%)\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\nA\n B\nC\nD E\nFigure 4\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\nFigure 5\nC\n WT oriA006 (CNNCCNR) oriA006 CNNGGNR mutant\nB\nA\nOriA-006\n10\n29 28 27 26 25\n15 20 25 30 35\n5- ATATGCCCCTCCAATCCAGCTCCTACAAGT -3\nCDC6 ORC4\n5- AATATTACACCCAAGTAGCATGCATAAGCT -3\n3 4 5 6 7\n15 20 25 30 35 40\nOriC-061\nCDC6 ORC4\nC20,21 A\n C17,20,21G\n A 23 C\n4%\nC17 A C21 A\nC21,23,24G\n A 26 C\n4%\nC21 A\n48%\nC23 A\n48%\nC24 A\n48% 0%\n0%\n48%\n 22%\n 47%\nC17,20,21T\n0%\n0%\nC   T\nCDC6\nCDC6\n45%\nWT\n21,23,34\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\nFigure 6\nA\nB\nC\nWild type sequence\nOriA-006\n5- ATATGCCCCTCCAATCCAGCTCCTACAAGT -3OriA-006\nORC3\nCDC6 ORC3 ORC2 & ORC5CDC6\nORC4\nT11 G\nA 12 C\n12\n29 28 27 26 25\n17 22 27 32 37\nT33 G A 34 C\nC 35     G\nA 36 C\nC35           G\nA 36 C\nT34 G\nC 35     A\nT 33 A\nA 34 T\n25% 5%\n0% 0%\n0%\n0%\n0%\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint \n\nS. cerevisiae Y. lipolytica H. sapiens\nORC2 loop\nORC-CDC6-DNA bend\nORC4 α-helix\nFigure 7\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 10, 2026. ; https://doi.org/10.64898/2026.03.10.710760doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}