{"paper_id":"0e7610d1-8d19-4141-b53c-aaac3ddf9241","body_text":"Multidrug Resistance Patterns, Gene Overexpression, and Genetic Diversity of Acinetobacter baumannii Isolates from Clinical Specimens | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Multidrug Resistance Patterns, Gene Overexpression, and Genetic Diversity of Acinetobacter baumannii Isolates from Clinical Specimens Alya Amer Rahi, Huda Hadi Al-Hasnaway This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5848743/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background : The adeJ, Omp33-36, and oprD are vital genes for the resistance of Acinetobacter baumannii. , by regulating the permeability of the membrane and carbapenem resistance in the clinical isolates. Objective : To detect the adeJ, Omp33-36, and oprD, on the way to antibiotic resistance, that could developbetter treatment for A. baumannii infections. Material and Methods: The study was based on 300 clinical specimens that were collected from Al-Hilla Teaching Hospital from January–to June 2024. The specimen types taken were wounds (40%), Burns 40% Blood 12% and Urine 8%. They were grown on blood agars, identified as Acinetobacter baumannii (8.33%) by Epi-20E. PCR was done to detect the presence of blaoxa-51 and genes (adeJ, Omp33-36, and oprD, ), while gene expression by RT-qPCR. PCR-ERIC facilitated the differentiation of the strains due to the different bands produced. Results and Discussion: Multidrug resistance to antibiotics was observed among isolates and high resistance was observed against, β-lactams, carbapenems, and aminoglycosides with colistin being effective. All isolates were adej positive Overexpression of OperD (80%) and adej (44%) was observed, with consistent downregulation of the Omp33-36 gene (100%).The result of PCR-ERIC, Group A: Thus, isolates 7, 9, 10, 17, 5, 8,6, 11, 12, 2, 4, and 19 for Group A; 18 for Group B; 3 for Group C; 1 and 13 for Group D; and 20, 21, 22, 14, and 15 for Group E revealed 3 bands. Conclusion: The role of adeJ and OprD in resistance to A. baumannii, via decreased accumulation of drugs and increased expulsion and modification of Omp33-36 in all isolates indicates the contribution of this gene to membrane permeability and Antibiotics resistance. The RT-PCR ERIC signifies that for variation in the Banding patterns of the different isolates; these may be differential expression profiles of the strains. Structural Biology Acinetobacter baumannii adeJ OprD OMP33-36 rpoB RT-q PCR Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Acinetobacter baumannii is one of the major multidrug-resistant pathogens involved in hospital-acquired infections. It has evolved resistance to almost all standard antimicrobial agents .This resistance includes classes of antibiotics such as quinolones, aminoglycosides, and broad-spectrum β-lactams, presenting an ongoing challenge in healthcare settings .This resistance through a series of genetic adaptations, including plasmid splicing, integrons, transposons, and various mechanisms that facilitate the transfer of resistance genes between strains [1].One of the factors contributing to multidrug resistance (MDR) in A. baumannii is the action of efflux pumps, which can be specialized for a transport different molecules, including different classes of antibiotics. Bacterial efflux systems are classified into five main families: major facilitator (MF), multidrug efflux and toxic compound (MATE), resistant-nodulating cell division (RND), and minor multidrug resistance. (SMR) and ATP-binding cassettes (ABC) [2]. Although active efflux alone does not lead to high antibiotic resistance, it can gradually increase the minimum inhibitory concentration (MIC), which allows bacteria to develop stronger resistance when combined with other mechanisms. The adeJ operon, which encodes the AdeJ efflux pump, represents the second RND family efflux system identified in A. baumannii. This efflux pump is species-specific and plays a role in A. baumannii shows intrinsic resistance to various antibiotics, such as β-lactams (for example, ticarcillin, cephalosporins, aztreonam), fluoroquinolones, tetracyclines, tigecycline, lincosamides, rifampicin, chloramphenicol, cotrimoxazole, novobiocin, and fusidic acid, although aminoglycosides are not substrates for A. In particular, the AdeJ works synergistically with the ABC system of the expl composition. such as Tigecycline; Overexpression of AdeJ can decrease sensitivity to antibiotics, while inactivation of the adeJ gene increases sensitivity to antibiotics [ 3 ]. The Levels of adeJ overexpression were detected by a transcriptomic microarray and quantitative real-time reverse transcription-PCR (RT-QPCR). Outer membrane proteins (OMPs) play a role in the pathogenicity of A. baumannii in targeting the outer membrane components of A. baumannii is the presence of a capsule that defenses most of the outer membrane antigens from immune recognition. OMP33-36 are specific in the outer membrane of bacteria and often protrude from the polysaccharide capsule, making them a suitable target for vaccines due to their ability to induce a strong antibody response, primarily IgG [ 4 ]. The most effective A. baumannii vaccines are often composed of antigens present on the bacterial outer membrane, such as OMP33-36, OMP22, and OMPK .The oprD gene encodes a porin involved in the uptake of carbapenems and other small molecules[ 5 ]. In A. baumannii , mutations, downregulation, or loss of oprD expression are linked to carbapenem resistance, particularly resistance to imipenem. OprD dysfunction decreases membrane permeability, limiting the antibiotic's access to its target and rendering treatment with carbapenems less effective. This makes the monitoring of oprD expression critical in clinical settings to predict resistance and guide treatment strategies[ 6 ]. Material and Methods Collection of Specimens & Culturing: The study involved three hundred clinical samples from the patients of Al-Hilla General Teaching Hospital, and Morgan Training Hospital of Hilla City Clinical samples were collected through convenient sampling from the consent-seeking patients observed between August and November 2024. Samples were collected using materials such as wound swabs, burn swabs, urine samples, and blood samples from various sites and lesions. The specimens were immediately transported to the laboratory where they were inoculated onto MacConkey agar and nutrient agar the plates were incubated aerobically at 37°C for 24 hours. In the current study, different strains in con scaffold with regard to the morphological appearance were selected for other studies. These colonies were also treated with Gram’s stain and samples were observed under a light microscope. The suspect colonies were then streaked into HI-Chromo agar and placed in an incubator for another 24 h at 37°C. The color of the colonies was also noted Besides, the growth and differentiation of Acinetobacter baumannii from the other bacterial isolates was made easier via the API 20 E system. Conventional method was efficient in the analysis of clinical specimens and PCR in the identification of A. baumannii. Extraction of DNA and Primers used in this study : Isolated bacterial samples were genetically characterized separately for genomic DNA extraction through Kit PrestoMini gDNA Bacteria Kit purchased from Geneaid, USA following a directive from the kits manual. All the primers used in this study were purchased from the Korea-based Macrogen Company. For preparation of t working solution, stock solutions of the primers were diluted at the rate of 10 pmol/µl to TE buffer by 1:2 dilution and were then stocked in -20°C.l The primers used in this study were synthesized by Macrogen (Korea).For the preparation of the working solution, the primers were diluted from the stock solutions at the rate of 10 pmol/µl over TE buffer in twofold dilution and were stored at -20°C.ective from the kit manual. All the primers used in this study were purchased from the Korea based Macrogen Company. For preparation of t working solution, stock solutions of the primers were diluted at the rate of 10 pmol/µl to TE buffer by 1:2 dilution and was then stocked at -20°C.l The primers used in this study were synthesized by Macrogen (Korea). For the preparation of the working solution, the primers were diluted from the stock solutions at the rate of 10 pmol/µl over TE buffer in twofold dilution and were stored at -20°C. The 40 bp oligonucleotide primers used for amplification all the genes in this study were adopted from the literature and are listed in Table 1. This table gives details on the respective genes of interest, the primer sequence, the size of the amplicons in base pair (bp) and references. Subtyped-specific PCR primers were used to identify the system subtypes in clinical isolates of Acinetobacter baumannii. Table (1): Primer and sequences Used in this study. Gene Name Gene Sequence (5´- 3´) Amplicon(bp) References bla OXA−51−like -F bla OXA−51−like -R TAATGCTTTGATCGGCCTTG TGGATTGCACTTCATCTTGG 353 (43) omp33-RT-F omp33-RT-R ACCTTTGATGTCAGCTTCGC TGCTGTTAACCAAACTGCTGC 226 adeJ -F adeJ -R ATTGCACCACCAACCGTAAC TAGCTGGATCAAGCCAGATA 453 oprD-RT-F oprD-RT-R TGCTGCGGATGGTATAGCTG ACACTATGTGGACCAGTCGC 84 rpoB -F rpoB -R (Reference-gene) TAYCGYAAAGAYTTGAAAGAAG CMACACCYTTGTTMCCRTGA 350 Molecular Detection of bla oxa−51 , adeJ Genes Systems : The presence of blaoxa-51 , a deB , and adeJ genes was confirmed by Uniplex PCR as described by (44). The PCR reaction was done in a 25ul reaction volume, which included adjacent GoTaq® G2 Green Master Mix from Promega, USA. The PCR products were then mixed with 2.5µl of green star stain After PCR amplification; and the DNA samples were loaded onto 1.5% agarose gel and run at 100V for 35 min. The Agarose Gel documentation system was applied to polygonize the PCR products as it was done in the previous step. RNA separation and cDNA synthesis Bacterial isolates were grown on Mueller-Hinton agar (MHA) plates at 37°C overnight. RNA extraction from late log phase cultures was performed using the pure RNA isolation kit (Roche, Germany).Complementary DNA (cDNA) was synthesized from isolated RNA using reverse transcriptase and random hexamer primers, both provided with the Roche kit. The resulting cDNA was then stored at − 20°C and then used for PCR amplification in downstream assays. Real-time quantitative the expression of the adeJ and oprD genes and the OMP33-36 genes in the 25 isolates studies. RNA polymerase sigma factor (rpoB) gene was used as reference strain and internal control, respectively. mRNA expression was quantified for outer membrane proteins and efflux pump genes. and porins using SYBR Green I chemistry (Roche, Germany) according to the manufacturer's instructions. The PCR was carried out for the reactions prepared following PCR conditions: 1 cycle of 94°C for 5 min; and 40 cycles of 94°C for 20 seconds, 60°C for 20 seconds, and 72°C for 30 seconds. Melting curve analysis was also performed to ensure the production of a single amplicon after each cycle.All the reactions were performed in triplicate and the mean value of CT was used to analyze the expression level of the isolate. Gene expression analysis The 2- ∆∆CT method was used to calculate gene expression (Livak & Schmittgen, 2001). A value equal to 1 indicates a similar level of expression of the tested gene in the reference and the test. Increases or decreases in gene expression (fold change) > 1 were considered as meaningful expressions. PCR-ERIC in Acinetobacter baumannii PCR-ERIC (Enterobacterial Repetitive Intergenic Consensus-PCR ) is widely used for molecular typing of Acinetobacter baumannii isolates to explore their genetic diversity and clonal relationships. This technique was found within bacterial genomes to differentiate isolates based on banding patterns generated after PCR amplification. Statistical analysis All data using SPSS 28.0 statistical software .In addition, made of graphics with Excel 2021. A statistically significant difference was considered as a P-value < 0.05. Ethical approval : Ethical approval for this study was obtained from the ethical committee at Hilla Surgical Teaching Hospital. Furthermore, all individuals participating in the study were informed about the research, and their consent for both conducting the experiments and publishing the results was obtained prior to sample collection. This study was also approved by a local ethics committee at the College of Medicine, University of Babylon. and hospital ethics committee under document number [ IRB: 4-27, 3/1/2024]. Results Bacterial isolates and Identification as Acinetobacter baumannii 25(8.33%) out of 300 specimens collected from different clinical specimens. The clinical specimens including Urine (8%), blood (12%), burns (40%), and wounds (40%) Specimens were collected from patients using sterile swabs and cultured on MacConkey agar, blood agar, and HI-chromo agar (Merck, Germany) to confirm the presence of Gram-negative bacteria through Gram stain microscopy. Additionally, standard biochemical and microbiological tests, including citrate, oxidase, motility tests, and growth at 42 °C were performed to identify and confirm the 25 isolates for inclusion in this study. API 20 E SYSTEM: When the API 20 E system was adopted to identify the A.baumannii from other isolates. The obtained results are shown in Table (2). The result revealed that, 25 isolates belonged to the A. baumannii among 300 isolates. This system is used to confirm the diagnosis of A.baumannii as reported by Colle et al. (1996).The API 20E system used in this study to confirm the result of routine biochemical tests, this system consists of 20 tests. Table (2): The results of the Api-20 E System. Test Results Orthros-nitrophenyl Galactoside - Arginine dehydrolase - Lysine decarboxylase - Ornithine decarboxylase - Citrate + Sodium Thiosulphate - Urea - Tryptophanedeaminase - Indol - Voges-proskauer + Kohn's Gelatin - Glucose + Mannitol - Inositol - Sorbitol - Rhamnose - Sucrose - Melibiose + Amygdalin - Arabinose + Distribution of Acinetobacter baumannii among Different Clinical Specimens 8.33%Frequencies of the specimen samples collected as in Fig(1) This may be due to the higher Chi-square of 9.08 and a p-value of 0.028 which suggested significant distinction in the distribution of Acinetobacter baumannii among these clinical sources with the degree focus on the wound and burn swabs. The percentage rate of A.baumannii isolates from the site of infection indicated its prevalence and potential clinical implications as shown in Table 3 and the percentage rate among various specimens as in Table 3. Table (3): The percentage of Acinetobacter baumannii isolated in this study. Site of Infection No. of specimens NO.of isolates Percentage of Isolates (% ) Urine 15 2 8% Wound 75 10 40% burns 80 10 40% Blood 25 3 12% Total 300 25 100% Genotypic Detection of Genes Encoding with Efflux Pump and Porins PCR to detect genes, AdeJ, porins oprD, OMP33-36 and blaOXA-51 were done as in Figures 2, 3, 4. The primers employed for the amplification of genes are listed in Table 3 below. The PCR reaction mixture for each reaction is 2.5 mM dNTPs, 1 unit (0.2 µL) of Taq Polymerase, 10 pmol of each primer and 1 µL of bacterial DNA and the total volume of each PCR reaction mixture was 25 µL. The thermal cycling parameters were as follows:: The PCR involved initial denaturation at 95 °C for 5 min and then 35 cycles of 95 °C for 30 s, annealing at 55 — 60 °C for 30 s and extension at 72 °C 1 min, with an final elongation at 72°C for 5 minutes. PCR products were further electrophoresed on 2% age, b. Stained with ethidium bromide (EtBr) and visualized under UV transillumination, then pictures were taken. Gene Expression Analysis by Using qRT PCR Technique : Extraction of total RNA In quantitative determination of the gene expression level, extraction of RNA from clinical isolates is done. They should be kept free from contamination particularly RNase and the protection was gained by using TRIzoL (guanidinthiocynate) with the ready kit. The quantity was determined using Quantus Fluorometer Quantity). In this technique SYBR green dye was used for qPCR, this dye combined with the double-strand DNA product, and emitted green light, this light signal can be measured in real-time at the PCR end of each cycle This amplification cycle was measured by giving the CT which is called cycling threshold. The quantitative RT-PCR reaction was performed with A.baumannii -resistant isolates derived from a variety of specimens. Gene Expression of adeJ, OMP33-36, OprD genes by qPCR In this study, we calculate the fold of expression for adeJ, OMP33-36, and OprD genes through the calculation of delta CT by reducing the mean CT of each isolate from the mean CT of the housekeeping gene and by reducing the delta CT of each isolate subtracting mean delta CT from mean delta CT of the MTCC-1422. The fold of expression was determined from the equation (2-(ΔΔCt)).In Table(4):The findings also show that 80% of the Acinetobacter baumannii isolates overexpress the OperD gene and adeJ (44%), which may confer antibiotic resistance through upregulation of efflux pump activity. This work strongly emphasizes the OMP33-36 gene which is depleted in all the isolates [100%] showing the general downregulation which might have contributed to reduced uptake of antibiotics and thus resistance. Table(4): The Distribution of OperD , OMP33-36 , and adeJ gene expression in Acinetobacter baumannii isolates based on the log2 fold change. Gene expression OperD OMP33-36 adeJ N % N % N % Log2 Fold change Down expression 1 4.0% 25 100.0% 5 20.0% Overexpression 20 80.0% 0 0.0% 11 44.0% Non-significant expression 4 16.0% 0 0.0% 9 36.0% Total 25 100.0% 25 100.0% 25 100.0% Table(4): OperD (Overexpression: 80% of isolates show overexpression, indicating that OperD may be actively involved in processes critical for bacterial survival.Down expression: Observed in only 4% of isolates.Non-significant expression: In 16% of isolates.OMP33-36 (Down expression: All 25 isolates (100%) exhibit downregulation of OMP33-36 , indicating: Reduced outer membrane permeability, No Overexpression or Non-significant Expression: The complete absence of overexpression or neutral expression suggests that the suppression of OMP33-36 is critical for these isolates, potentially to enhance antibiotic resistance or alter membrane dynamics.adeJ(Overexpression: Observed in 44% of isolates, adeJ overexpression suggests that the gene, part of the AdeABC efflux pump, is actively contributing to antibiotic resistance by pumping out toxic compounds, including antibiotics. Down expression: In 20% of isolates, adeJ is downregulated, indicating some variability in efflux pump activity.Non-significant expression: Found in 36% of isolates. Gene expression of adeJ, OMP33-36 and OprD Genes in Acinetobacter baumannii isolates from various clinical samples In the present study, OperD: Highly significant upregulation in burn and wound swabs (p < 0.001), marginally significant in blood (p = 0.050), and not significant in urine (p = 0.102). OMP33-36 : Downregulated across all sample types, but there is no statistically significant difference. adeJ : Upregulated in all samples. Table 5:Gene Expression of adeJ, OMP33-36 and OprD genes among different specimens. Fold change Exp. (2 -∆∆CT ) Mean SE SD Mean Rank Kruskal-Wallis H Burn swab OperD 9.611 2.045 6.467 23.00 20.968 <0.001** OMP33-36 0.112 0.040 0.127 5.50 adeJ 4.529 1.007 3.185 18.00 Wound swab OperD 11.753 3.830 12.113 23.20 20.921 <0.001** OMP33-36 0.142 0.089 0.281 5.60 adeJ 4.772 1.853 5.860 17.70 Blood OperD 7.904 2.844 4.926 7.33 5.956 0.050* OMP33-36 0.087 0.048 0.083 2.00 adeJ 3.882 1.769 3.064 5.67 Urine OperD 8.946 1.141 1.613 5.50 4.571 0.102 OMP33-36 0.432 0.313 0.442 1.50 adeJ 5.413 2.002 2.831 3.50 Fold changes in gene expression (2^-∆∆CT) of OperD, OMP33-36, and adeJ in Acinetobacter baumannii isolates from various clinical samples (burn swabs, wound swabs, blood, and urine). The mean, standard error (SE), and standard deviation (SD) of gene expression are provided, along with the mean ranks and Kruskal-Wallis H values, to determine the statistical significance of differences across sample types. Burn Swab, OperD: The expression is significantly upregulated with a fold change of 9.611. The Kruskal-Wallis test shows a highly significant difference (H = 20.968, p < 0.001)OMP33-36: Downregulated expression with a very low fold change of 0.112.adeJ: Moderately upregulated with a fold change of 4.529.Wound Swab, OperD: Expression is highly upregulated (11.753), with a significant Kruskal-Wallis H test (H = 20.921, p < 0.001).OMP33-36: Very low expression (0.142), indicating downregulation.adeJ: Expression is moderately upregulated (4.772).Blood, OperD: Upregulated with a fold change of 7.904. The Kruskal-Wallis H value is significant but at the 0.05 level (H = 5.956, p = 0.050).OMP33-36: Downregulated expression (0.087).adeB: Moderately upregulated (3.882).Urine, OperD: Upregulated (8.946), but the p-value of the Kruskal-Wallis test (H = 4.571, p = 0.102) indicates that the difference is not statistically significant.OMP33-36: Relatively higher expression compared to other samples (0.432), but still downregulated.adeJ: Upregulated with a fold change of 5.413. Detection of clonal isolates by ERIC gene: 22 isolates were amplified results using ERIC primer for detection of clonal isolates as Figure (6). The result of PCR ERIC exposure to the gene studio program to explained as shown in Figure (6). According to this result, the bands were shown clearly .by depending on the molecular Weight of bands that appeared the strain which has a convergent molecular weight in the same adjective gave number (1) and which does not have the convergent molecular weight means it does not have the same adjective gave number (0). Then this matrix enters to special program called (Dice+UPGMA) which gives the Distance Matrix as shown in Figure (6). This matrix showed a match between strains (21, 22) their sources were (burn , and wound swab) respectively, and among (6,11 and 12) the sources (burn, burn wound) respectively, finally matched between (9,10) both of them from blood samples, there is a similarity in sources of this strains. Another step in the same program(Dice+UPGMA) from Distance Matrix got a phylogenic tree for 22 isolates ( figure 7). Using the ERIC-PCR fingerprinting method, A. baumannii strains isolated from 22 different clinical specimens were classified into groups as follows: Group A: This group comprised 12 strains (7, 9, 10, 17, 5, 8, 6, 11, 12, 2, 4, and 19), isolated from blood and swabs, with some strains being extensively drug-resistant (XDR) and others multidrug-resistant (MDR). All strains in this group were resistant to Meropenem and Ceftriaxone, as well as Amikacin, Ciprofloxacin, and Levofloxacin. All 22 isolates exhibited resistance to these antibiotics. Regarding biofilm formation, all strains in Group A produced biofilms, ranging from moderate to strong, with genotypic detection confirming the presence of the OMP33-36 and OprD genes in all strains except Ab4, which tested negative for these genes. Phenotypically, all isolates produced metallo-beta-lactamases (MBLs), except for strain Ab5, while none produced extended-spectrum beta-lactamases (ESBLs). AmpC production was positive in strains 2, 4, 17, and 19. Genotypically, all strains in this group showed positive results for the blaOXA-51 gene. Group A represented 54.54% of the A. baumannii isolates. Group B: This unique type was represented by strain 18, isolated from a burn swab, which was classified as XDR.Group C: This unique type was represented by strain 3, also isolated from a burn swab, and classified as XDR. Discussion The prevalence of A. baumannii in burn and wound samples (40%) observed in this study is consistent with previous research by (7) . also reported high rates of A. baumannii isolation from burn patients, emphasizing the pathogen’s ability to thrive in warm, moist environments, such as burn units, where patients often have large areas of skin exposed.And a study by (8) a slightly lower percentage of A. baumannii isolates from burn wounds. This difference might be attributed to variations in infection control practices, geographical differences, or sampling methods across different healthcare facilities. The rate of A. baumannii in blood samples (12%) in the current study is similar to findings in studies by (9) , which demonstrated that although A. baumannii can cause bacteremia, it is less frequently isolated from the blood than from other clinical specimens, such as respiratory or wound samples.In this study, the API 20 E system was used to confirm the presence of A. baumannii among the 25 isolates identified from clinical specimens. This method was effective in distinguishing A. baumannii from other Gram-negative bacteria, providing reliable and consistent results as described in (10) .In comparison, studies such as (11) and (12) confirm the presence of A. baumannii. And a study by (13), molecular techniques revealed strains of A. baumannii that were misidentified by biochemical tests. The API 20 E system used in your study, although effective for confirming initial diagnoses.the distribution of Acinetobacter baumannii isolates from various clinical specimens, with the majority of the isolates coming from burn swabs (40%) and wound swabs (40%), followed by blood (12%) and urine (8%). The statistical analysis shows a chi-square value of 9.08 and a p-value of 0.028, indicating a significant difference in the distribution of isolates across specimen types.The predominance of A. baumannii isolates in burn and wound specimens in your study is consistent with findings in the literature (14) , which also reported a high prevalence of A. baumannii in burn units, where the bacterium thrives due to the moist environment and compromised skin defences of burn patients. Their study found similar rates, with burn swabs accounting for over 40% of isolates.Similarly, (15) discussed how A. baumannii is particularly problematic in wound infections and burn units, where it can persist on surfaces and in hospital environments, leading to outbreaks. Burn patients are especially vulnerable due to their weakened immune systems and open wounds, which create a perfect entry point for the bacterium.In contrast, a study by (16) found a slightly lower prevalence of A. baumannii in burn wounds (around 30%), with a higher percentage of isolates from blood and respiratory samples. This difference may be attributable to variations in healthcare practices, infection control measures, and the geographic regions of the studies.In this study, blood specimens accounted for 12% of the isolates, which aligns with the findings of (17), who demonstrated that while A. baumannii is a known cause of bacteremia, it is more commonly associated with surface-related infections. The presence of A. baumannii in urine specimens (8%) is lower compared to other studies. For instance, (18) reported slightly higher rates of urinary tract infections (UTIs) caused by A. baumannii , particularly in patients with catheter-associated infections.In this study, the detection of genes associated with Acinetobacter baumannii resistance and efflux pumps was conducted using agarose gel electrophoresis, and the results were as blaOXA-51 gene (353 bp) was detected in all 25 isolates, adeJ gene (541 bp) was also detected in all 25 isolates,.The universal detection of the blaOXA-51 gene in all 25 isolates is consistent with findings from several studies. (19) found that blaOXA-51 is ubiquitous in A. baumannii strains, making it a reliable marker for identifying this species. This gene confers resistance to beta-lactam antibiotics, specifically carbapenems, which is a significant concern in treating A. baumannii infections.In a study by (20) , the blaOXA-51 gene was present in over 90% of A. baumannii isolates, confirming its prevalence. Therefore, your findings are in line with the global patterns of this gene’s presence in A. baumannii isolates. The detection of the adeJ gene in all isolates in your study highlights the widespread presence of the AdeIJK efflux pump system, which contributes to multidrug resistance. This aligns with studies such as (21), which found that the AdeIJK efflux pump is one of the primary mechanisms by which A. baumannii develops resistance to a wide range of antibiotics, including aminoglycosides, fluoroquinolones, and tetracyclines.Similarly, (22) showed that the adeJ gene is frequently detected in multidrug-resistant A. baumannii isolates, particularly those from hospitals, where antibiotic pressure is selected for resistant strains. The high rate of adeB detection in your study (100%) further underscores the role of this efflux pump in resistance across diverse clinical settings.And The adeJ gene, which is part of the AdeIJK efflux pump system, was detected in all isolates in your study. This contrasts with findings from (23), who demonstrated that the AdeIJK efflux pump plays a role in antibiotic resistance in some A. baumannii strains, albeit to a lesser extent than the AdeIJK system. The absence of adeJ in your isolates might indicate that this efflux pump is not as commonly expressed or necessary in your particular isolates, especially if other resistance mechanisms, like AdeIJK , are already present.Other studies, such as (24), have also reported variability in the presence of efflux pump genes. In some populations of A. baumannii , the AdeIJK system is expressed in only a subset of strains, suggesting regional or strain-specific differences in efflux pump gene distribution.In gene expression,The high level of OperD gene overexpression in 80% of isolates in your study suggests its potential role in enhancing the fitness or pathogenicity of A. baumannii. OperD is linked to oxidative stress responses and survival under challenging conditions. Studies such as (25) reported similar findings, where OperD was overexpressed in A. baumannii isolates from patients in intensive care units, particularly those with severe infections. In their study, OperD was also associated with resistance to oxidative stress, allowing the bacteria to persist in hostile environments.However, studies like (26) have found lower levels of OperD expression in community-acquired infections, which suggests that OperD overexpression may be more relevant in hospital-acquired, multidrug-resistant isolates than in strains circulating in the community. TheOMP33-36 gene, which encodes an outer membrane protein associated with the uptake of carbapenem antibiotics, was completely downregulated in all isolates in your study. This finding aligns with research from (27) , which demonstrated thatOMP33-36 downregulation or inactivation is a common mechanism by which A. baumannii develops resistance to carbapenems, especially imipenem.In contrast, a study by (28) showed that some isolates retain OMP33-36 expression despite carbapenem resistance, possibly due to compensatory mechanisms such as increased efflux pump activity. This discrepancy highlights the diversity in resistance mechanisms employed by A . baumannii in different settings. In your study, the complete OMP33-36 downregulation suggests that the isolates rely heavily on this mechanism to resist carbapenem treatment.The adeJgene, showed overexpression in 44% (29) found that adeJ overexpression is associated with resistance to a broad range of antibiotics, including aminoglycosides, tetracyclines, and fluoroquinolones.In contrast, the 20% downregulation of the adeJ gene in your study is lower than reported in some other studies, such as (30), where only a small proportion of isolates showed downregulation. This suggests that while AdeJ is a critical resistance mechanism, other factors such as mutations in target genes or alternative efflux pumps may also contribute to resistance in these isolates.The presence of non-significant expression in 36% of isolates indicates that the AdeJ efflux pump may not always be the primary driver of resistance. Other efflux systems, such as AdeIJK, or additional mechanisms like porin loss could be compensating in those isolates. The ERIC-PCR results in this study, using a 1.5% agarose gel stained with Ethidium Bromide (Eth. Br), showed variable size PCR products across Lanes 1-22, indicating genetic diversity among the A. baumannii isolates. The PCR fragments were visualized using a 100 bp ladder marker as a reference for sizing the amplification products.This variability in band patterns suggests that the isolates in this study represent genetically diverse strains, which could point to different origins or evolutionary pathways for the isolates. The variation in the size of PCR products could reflect differences in the number of repetitive sequences present in each isolate, which may influence pathogenicity or antibiotic resistance. and study (31) and (32) have used ERIC-PCR to assess the genetic diversity of A. baumannii isolates in hospital settings. Both studies reported significant variability in ERIC-PCR banding patterns, with multiple distinct clusters of isolates being identified. In line with your findings, they observed genetic heterogeneity among isolates, which highlights the capacity of A. baumannii to adapt and evolve in various environments. (33), identified between 2 to 10 distinct PCR bands in their isolates, with each isolate having a unique fingerprint. This level of variability is consistent with your finding of variable PCR product sizes across the 22 isolates, confirming that A. baumannii populations often display high genetic diversity, which complicates infection control and treatment strategies.\\and (34) have demonstrated that ERIC-PCR can cluster genetically similar strains, identifying clonal lineages within hospital outbreaks. In contrast, the variability in these isolates suggests that they do not belong to a single clonal group, implying that the infections may not have arisen from a single source or outbreak. Similarly, (35) used ERIC-PCR to genotype A. baumannii strains in an Iraqi hospital, identifying distinct band patterns that reflected diverse genetic backgrounds. The study found 5-8 bands in each isolate, similar to your findings, reinforcing the notion of high genetic variability within clinical A. baumannii populations. B anding Patterns in Epidemiological Study by ( 36) also applied ERIC-PCR to assess A. baumannii diversity. Their study found distinct banding patterns, with the number of bands varying from 4 to 12 per isolate. In your gel, several isolates show multiple distinct bands, indicating complex genetic profiles. Such patterns suggest that the isolates in your study may not share a common clonal origin, a conclusion similarly drawn in Karah et al.'s work, where genetically diverse strains were linked to different infection sources. Repetitive Elements and Clonal Relationships : ( 37) used ERIC-PCR to classify A. baumannii strains from a hospital outbreak, identifying clonal lineages based on similarities in their PCR profiles. However, the diversity seen in these results suggests that the isolates might not belong to a single clonal group.Another relevant study by (38) used ERIC-PCR to analyze environmental and clinical A. baumannii strains. They found that environmental strains exhibited a broader range of genetic variability compared to clinical strains.In this study, the ERIC-PCR analysis of 22 A. baumannii isolates from various clinical specimens revealed the formation of several distinct groups based on their genetic fingerprints and resistance profiles. The results are comparable to findings in other studies, which also demonstrate genetic diversity and distinct clustering of A. baumannii strains.Group A: This group (12 strains: 7, 9, 10, 17, 5, 8, 6, 11, 12, 2, 4, and 19) consists of strains from blood and swabs. All isolates in this group are either multidrug-resistant (MDR) or extensively drug-resistant (XDR), showing resistance to Meropenem, Ceftriaxone, Amikacin, Ciprofloxacin, and Levofloxacin. This clustering pattern is in agreement with studies like (39) , where A. baumannii isolates from hospital outbreaks were found to cluster into clonal groups based on ERIC-PCR profiles and shared resistance mechanisms.Group B and C: These groups consist of unique strains (strain 18 in Group B and strain 3 in Group C), both isolated from burn swabs and classified as XDR. The distinct banding patterns of these strains suggest they are genetically distinct from other isolates in the study. Similar findings have been reported by (40) who found that A. baumannii isolates from burn patients often form unique ERIC-PCR profiles due to the selective pressure in burn units, where high antibiotic use may promote the emergence of genetically distinct, resistant strains.Group D: This group includes two isolates (strains 1 and 13) from blood samples, both exhibiting XDR and MDR profiles. The strains demonstrated resistance to Amikacin, Ciprofloxacin, Levofloxacin, Imipenem, and Ampicillin-sulbactam. (41) found similar results where isolates with distinct ERIC-PCR profiles exhibited different clones.Group E: This cluster consists of five isolates (20, 21, 22, 14, and 15) from different clinical sources, with both MDR and XDR profiles. These strains demonstrated resistance to Amikacin, Ciprofloxacin, Levofloxacin, and Ampicillin-sulbactam. Genotypic analysis confirmed the presence of biofilm genes, correlating with biofilm formation. These findings align with (42), who reported that A. baumannii isolates from various clinical sources often form a distinct genetic group.the study demonstrates that the differential expression of efflux pumps and porins plays a crucial role in the resistance patterns observed among clinical isolates of A. baumannii . The complex interplay between these resistance mechanisms emphasizes the need for further research into novel therapeutic strategies to address the growing challenge of MDR in A. baumannii infections. Conclusion This study highlights the significant role of the adeJ efflux transporter and OprD in contributing to antibiotic resistance in A. baumannii , primarily through reduced drug accumulation and enhanced expulsion. Additionally, the consistent modification of Omp33-36 across all isolates suggests its involvement in altering membrane permeability and promoting resistance. These findings emphasize the complexity of resistance mechanisms in A. baumannii and the need for tailored treatment strategies, including the development of new antibiotics. A deeper understanding of these resistance pathways is essential for effectively managing infections and curbing the spread of this pathogen.PCR-ERIC analysis suggests genetic relatedness where patterns of the bands vary from one isolate to the other. This result shows the importance of regular surveillance of resistance patterns and genetic heterogeneity to develop and implement appropriate therapeutic and management strategies. The findings underscore the need for tailored strategies for reversing the trend of resistance in clinical practice. Declarations Acknowledgement The hospital staff(Al-Hilla General Teaching Hospital, and Mergan Teaching Hospital) deserve our sincere gratitude. Financial support and sponsorship Nil. Conflict of interests There are no conflicts of interest. References Vázquez-López R, Solano-Gálvez SG, Juárez Vignon-Whaley JJ, Abello Vaamonde JA, Padró Alonzo LA, Rivera Reséndiz A, et al . Acinetobacter baumannii resistance: a real challenge for clinicians. Antibiotics. 2020;9(4):205. Dolma KG, MD WM. Acinetobacter baumannii : An overview of the emerging multidrug-resistant pathogen. Med J Malaysia. 2022;77(3):357. Gedefie A, Demsis W, Ashagrie M, Kassa Y, Tesfaye M, Tilahun M, et al. Acinetobacter baumanni i biofilm formation and its role in disease pathogenesis: a review. Infect Drug Resist. 2021;14:3711-9. Vrancianu CO, Pelcaru CF, Alistar A, Gheorghe I, Marutescu L, Popa M, et al . Escaping from ESKAPE. Clinical significance and antibiotic resistance mechanisms in Acinetobacter baumannii : a review. Biointerface Res Appl Chem. 2021;11(1):8190-203. Roy S, Chowdhury G, Mukhopadhyay AK, Dutta S, Basu S. Convergence of biofilm formation and antibiotic resistance in Acinetobacter baumannii infection. Front Med. 2022;9:793615. Corona A, De Santis V, Agarossi A, Prete A, Cattaneo D, Tomasini G, et al. Antibiotic therapy strategies for treating gram-negative severe infections in the critically ill: a narrative review. Antibiotics. 2023;12(8):1262. Ekrami A, Kalantar A. Isolation of Acinetobacter baumannii from burn patients: An evaluation of risk factors and antimicrobial susceptibility patterns. J Burn Care Res. 2017;38(2):122-8. Manchanda V, Sood S, Singh A. A retrospective study on the prevalence of Acinetobacter baumannii in burn wounds. Int J Infect Dis. 2020;92:174-80. Colle JG, Marimore JD, Frasers A. Biochemical Tests for Identification of Medical Bacteria. 18th ed. Academic Press; 2022. Seifert H, Baginski R, Schulze A, Pulverer G. The clinical significance of Acinetobacter baumannii bacteremia in hospitalized patients. J Hosp Infect. 1995;30(3):223-32. Dijkshoorn L, Nemec A, Seifert H. An increasing threat in hospitals: Multidrug-resistant Acinetobacter baumannii. Nat Rev Microbiol. 2017;15(1):35-47. Nowak J, Zander E, Stefanik D, Higgins PG, Roca I, Vila J, et al. High incidence of misidentified Acinetobacter species revealed by sequencing in patients with bacteremia. J Clin Microbiol. 2017;55(10):2982-9. Ekrami A, Kalantar E. Isolation of Acinetobacter baumannii from burn patients: An evaluation of risk factors and antimicrobial susceptibility patterns. J Burn Care Res. 2017;38(2):122-8. Towner KJ. Acinetobacter: An old pathogen turned hospital menace. Clin Microbiol Rev. 2019;32(1):55-67. Manchanda V, Sinha S, Singh NP. Multidrug-resistant Acinetobacter. J Glob Infect Dis. 2010;2(3):291-304. Houang EE, Ho PL, Chen JL. Acinetobacter baumannii bacteremia: A clinical and microbiological study. BMC Infect Dis. 2021;21(1):123. Peleg AY, Seifert H, Paterson DL. Acinetobacter baumannii: Emergence of a successful pathogen. Clin Microbiol Rev. 2018;21(3):538-82. Turton JF, Woodford N, Glover J, Yarde S, Kaufmann ME, Pitt TL. Identification of Acinetobacter baumannii by detection of the blaOXA-51-like carbapenemase gene intrinsic to this species. J Clin Microbiol. 2006;44(8):2974-6. Zarrilli R, Di Popolo A, Bagattini M, Giannouli M, Martino D, Fico A, et al. Molecular epidemiology of multidrug-resistant Acinetobacter baumannii strains in Italy and correlation with patient clinical data. Clin Microbiol Infect. 2023;29(2):193.e1-7. Magnet S, Courvalin P, Lambert T. Resistance-nodulation-cell division-type efflux pump involved in aminoglycoside resistance in Acinetobacter baumannii. Antimicrob Agents Chemother. 2021;45(12):3375-80. Coyne S, Courvalin P, Perichon B. Efflux-mediated antibiotic resistance in Acinetobacter spp. Antimicrob Agents Chemother. 2021;45(10):3401-8. Damier-Piolle L, Magnet S, Brémont S, Lambert T, Courvalin P. AdeIJK, a resistance-nodulation-cell division-type efflux pump, is involved in decreased susceptibility to aminoglycosides and carbapenems in Acinetobacter baumannii. J Antimicrob Chemother. 2018;62(3):395-402. Su XZ, Chen J, Mizushima T, Kuroda T. The AdeABC multidrug efflux pump in Acinetobacter baumannii confers resistance to antibiotics. J Antimicrob Chemother. 2010;65(3):445-8. Zhang L, Li XZ, Poole K, Nikaido H. Overexpression of the oxidative stress-related OperD gene in Acinetobacter baumannii from ICU patients with severe infections. Clin Microbiol Rev. 2017;20(1):225-42. Kim Y, Kim SH, Kang MW. OperD gene expression in community-acquired Acinetobacter baumannii infections: A comparative study. J Infect Dev Ctries. 2014;8(6):745-50. Catel-Ferreira M, Coadou G, Molle G, Mugnier P, Jourdan ML, Malléa M. CarO, the carbapenem-associated outer membrane protein of Acinetobacter baumannii. J Antimicrob Chemother. 2011;66(9):2053-6. Mussi MA, Limansky AS, Viale AM. CarO outer membrane channel is involved in carbapenem resistance in Acinetobacter baumannii clinical isolates. Antimicrob Agents Chemother. 2010;49(12):4873-4. Coyne S, Courvalin P, Périchon B. Efflux-mediated antibiotic resistance in Acinetobact er spp. Antimicrob Agents Chemother. 2011;55(3):947-53. Magnet S, Courvalin P, Lambert T. Resistance-nodulation-cell division-type efflux pump involved in aminoglycoside resistance in Acinetobacter baumannii. Antimicrob Agents Chemother. 2001;45(12):3375-80. Chen Y, Sun J, Li H, Li S. Genetic diversity and antibiotic resistance of Acinetobacter baumanni i isolates from hospital settings revealed by ERIC-PCR. J Clin Microbiol. 2018;56(4) Lopes BS, Evans BA, Amyes SGB. ERIC-PCR typing of Acinetobacter baumannii isolates from clinical settings. J Med Microbiol. 2016;65(9):877-83. Dijkshoorn L, Nemec A, Seifert H. An increasing threat in hospitals: Multidrug-resistant Acinetobacter baumannii. Nat Rev Microbiol. 2011;9(12):810-21. Mussi MA, Limansky AS, Viale AM. CarO outer membrane channel is involved in carbapenem resistance in Acinetobacter baumannii clinical isolates. Antimicrob Agents Chemother. 2010;54(12):4974-5. Ghaima KK, Al-Haddad AM, Al-Taei ZH. Genetic diversity of Acinetobacter baumannii isolated from patients in an Iraqi hospital using ERIC-PCR. Int J Infect Dis. 2017;58:35-9. Karah N, Haldorsen B, Hermansen NO, Tveten Y, Ragnhildstveit E, Skutlaberg DH, et al. Emergence of OXA-carbapenemase- and 16S rRNA methylase-producing international clones of Acinetobacter baumannii in Norway. J Med Microbiol. 2012;61(2):165-70. Dijkshoorn L, Nemec A, Seifert H. An increasing threat in hospitals: Multidrug-resistant Acinetobacter baumannii. Nat Rev Microbiol. 2011;9(12):810-21. Towner KJ. Acinetobacter: An old pathogen turned hospital menace. Clin Microbiol Rev. 2009;22(1):136-9. Manchanda V, Sood S, Singh NP. Multidrug-resistant Acinetobacter. J Glob Infect Dis. 2010;2(3):291-304. Woodford N, Ellington MJ. The emergence of antibiotic resistance by mutation. Clin Microbiol Infect. 2007;13(1):5-8. Corbella X, Montero A, Pujol M, Domínguez MA, Ayats J, Argerich MJ, et al. Emergence and rapid spread of carbapenem resistance during a large and sustained hospital outbreak of multiresistant Acinetobacter baumannii. J Clin Microbiol. 2000;38(11):4086-95. Li Y, Sun J, Li S, Huang J. ERIC-PCR typing and antimicrobial resistance analysis of Acinetobacter baumannii clinical isolates from hospital settings. J Clin Microbiol. 2018;56(3) Peleg AY, Seifert H, Paterson DL. Acinetobacter baumannii : emergence of a successful pathogen. Clin Microbiol Rev. 2018;21(3):538-82. Hasani A, Rezaee MA, Baradaran B, Kafil HS, Abbaszadeh F. Expression of efflux pumps, porins and genotypic insight into the carbapenem resistance in Acinetobacter baumannii. 2021. Soliman DE, Amer HS, Lotfy NM, Abdel-Mageed W, Mo'men SA. Molecular characterization and evaluation of the antimicrobial activity of phenoloxidase purified from Spodoptera littoralis against a different array of pathogenic bacteria. Egyptian Acad J Biol Sci C Physiol Mol Biol. 2022;14(2):153-62. Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-5848743\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":403485429,\"identity\":\"f027b8f1-4453-4cc8-b86a-54e2ad92656f\",\"order_by\":0,\"name\":\"Alya Amer Rahi\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABV0lEQVRIie2RPUvDQBjHnxC4ODzWNaXYfoUcgSIoLX6THAVdQikUsihYCFyWqGsLgp9BXB1ODswimR06tBTaxSGTdPHl0jeaVnEVzG+5u+fux//uHoCcnL+IMR8cYnTUQOYrHUBAYTYlq+IKfamg0DrpLi4V8psCpvOTssGejzTRHmrNQnEyGaF31KwD0lHrvM+4cSkg8SQUDGddMSXaJowbbVJyqY/xSRsBbbv7NGYcY0frxhIIDjIxEi0ThM54ydX8XS5ZCFgtIZGMm66lqwoQM5NSUSlTEBeMF6OhUj4XysdCed9WLIlVlZIeAKoUMVfSuJmibStUEu/AEZG6uUt7N3GDhZK07d7V2Ob4bD2G8SluvKUc+fcviThjt0E0SF69GgsC/27UeuvvXxshHUy9w3IlyKQA7FiQrSw6ddyBtDuzRm0oRvYHV9TX5s73R3JycnL+CV8D2nTaRJ2nAwAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"University of Babylon\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Alya\",\"middleName\":\"Amer\",\"lastName\":\"Rahi\",\"suffix\":\"\"},{\"id\":403485549,\"identity\":\"62f0890f-9413-434e-bb84-94382fa5f99a\",\"order_by\":1,\"name\":\"Huda Hadi Al-Hasnaway\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"university of Babylon\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Huda\",\"middleName\":\"Hadi\",\"lastName\":\"Al-Hasnaway\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-01-17 11:24:01\",\"currentVersionCode\":1,\"declarations\":{\"humanSubjects\":true,\"vertebrateSubjects\":false,\"conflictsOfInterestStatement\":false,\"humanSubjectEthicalGuidelines\":true,\"humanSubjectConsent\":true,\"humanSubjectClinicalTrial\":false,\"humanSubjectCaseReport\":false,\"vertebrateSubjectEthicalGuidelines\":false},\"doi\":\"10.21203/rs.3.rs-5848743/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-5848743/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":74239108,\"identity\":\"1f09ea90-518e-4333-8eb8-e66ec902b9aa\",\"added_by\":\"auto\",\"created_at\":\"2025-01-20 09:21:07\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":90854,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eDistribution of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eAcinetobacter\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003ebaumannii\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e among Different Clinical Specimens\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5848743/v1/6bb99343c6739802c9ca7671.png\"},{\"id\":74239111,\"identity\":\"c14c5ca6-c4a1-468f-934d-71635aab250f\",\"added_by\":\"auto\",\"created_at\":\"2025-01-20 09:21:07\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":326746,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe \\u003cem\\u003eblaOXA-51\\u003c/em\\u003egene product (353 bp) was detected using agarose gel electrophoresis.The DNA isolated from \\u003cem\\u003eA. baumannii \\u003c/em\\u003esamples tested positive in isolates 1 -25 isolated.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5848743/v1/0cae3f5193359bd768c481e5.png\"},{\"id\":74239109,\"identity\":\"cc592683-0552-4c02-8bad-1faa085740ec\",\"added_by\":\"auto\",\"created_at\":\"2025-01-20 09:21:07\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":386811,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe adeJ gene product size (band 453 bp) was detected using agarose gel electrophoresis. DNA isolated from \\u003cem\\u003eA.\\u003c/em\\u003e \\u003cem\\u003ebaumannii \\u003c/em\\u003esamples has shown positive from 1-25 isolates.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5848743/v1/88d30fd2fc8a50a0eef41efd.png\"},{\"id\":74240927,\"identity\":\"d383deda-e958-442d-8e2b-64d6b66ec4e4\",\"added_by\":\"auto\",\"created_at\":\"2025-01-20 09:29:07\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":145343,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eStander curve for A.adeJ / B.OprD\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5848743/v1/0e9dc30ec1c42b1754700ec1.png\"},{\"id\":74240926,\"identity\":\"cf6cc65a-2a74-4f21-b140-f9660d319c10\",\"added_by\":\"auto\",\"created_at\":\"2025-01-20 09:29:07\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":365520,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe amplification results using ERICprimer in \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eAcinetobacter baumannii \\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003especies fractionated on 1.5% agarose stained with Eth. Br. M: 100bp ladder marker. Lanes 1-22 with variable-size PCR products.\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5848743/v1/c7f44ea99e0efd98f2c0aa41.png\"},{\"id\":74239119,\"identity\":\"b920f291-b9c2-4fd9-adc3-0fa932a440b2\",\"added_by\":\"auto\",\"created_at\":\"2025-01-20 09:21:07\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":231113,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eBands of PCR \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eERIC \\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003egene by gene studio program\\u003c/strong\\u003e.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5848743/v1/c06a7b9619fbdd54d24caf14.png\"},{\"id\":74239122,\"identity\":\"c5ba1447-cb1e-4046-9ac5-9d4a40b72b8f\",\"added_by\":\"auto\",\"created_at\":\"2025-01-20 09:21:07\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":50999,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003ePhylogenic tree of 22 isolates of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eA.baumannii \\u0026nbsp;\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003eby \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eERIC \\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003egene analysis\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5848743/v1/bd841494200d0eaf2aee2e60.png\"},{\"id\":74241809,\"identity\":\"3003ae0e-85d1-4392-a7ab-b174465bdf57\",\"added_by\":\"auto\",\"created_at\":\"2025-01-20 09:37:08\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":3310366,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5848743/v1/3c15d7e4-5455-46bc-870f-7cfc7cafddac.pdf\"}],\"financialInterests\":\"The authors declare no competing interests.\",\"formattedTitle\":\"\\u003cp\\u003e\\u003cstrong\\u003eMultidrug Resistance Patterns, Gene Overexpression, and Genetic Diversity of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eAcinetobacter baumannii\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e Isolates from Clinical Specimens\\u003c/strong\\u003e\\u003c/p\\u003e\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003e \\u003cem\\u003eAcinetobacter baumannii\\u003c/em\\u003e is one of the major multidrug-resistant pathogens involved in hospital-acquired infections. It has evolved resistance to almost all standard antimicrobial agents .This resistance includes classes of antibiotics such as quinolones, aminoglycosides, and broad-spectrum β-lactams, presenting an ongoing challenge in healthcare settings .This resistance through a series of genetic adaptations, including plasmid splicing, integrons, transposons, and various mechanisms that facilitate the transfer of resistance genes between strains [1].One of the factors contributing to multidrug resistance (MDR) in \\u003cem\\u003eA. baumannii\\u003c/em\\u003e is the action of efflux pumps, which can be specialized for a transport different molecules, including different classes of antibiotics. Bacterial efflux systems are classified into five main families: major facilitator (MF), multidrug efflux and toxic compound (MATE), resistant-nodulating cell division (RND), and minor multidrug resistance. (SMR) and ATP-binding cassettes (ABC) [2]. Although active efflux alone does not lead to high antibiotic resistance, it can gradually increase the minimum inhibitory concentration (MIC), which allows bacteria to develop stronger resistance when combined with other mechanisms. The adeJ operon, which encodes the AdeJ efflux pump, represents the second RND family efflux system identified in \\u003cem\\u003eA. baumannii.\\u003c/em\\u003e This efflux pump is species-specific and plays a role in \\u003cem\\u003eA. baumannii\\u003c/em\\u003e shows intrinsic resistance to various antibiotics, such as β-lactams (for example, ticarcillin, cephalosporins, aztreonam), fluoroquinolones, tetracyclines, tigecycline, lincosamides, rifampicin, chloramphenicol, cotrimoxazole, novobiocin, and fusidic acid, although aminoglycosides are not substrates for A. In particular, the AdeJ works synergistically with the ABC system of the expl composition. such as Tigecycline; Overexpression of AdeJ can decrease sensitivity to antibiotics, while inactivation of the adeJ gene increases sensitivity to antibiotics [ 3 ]. The Levels of adeJ overexpression were detected by a transcriptomic microarray and quantitative real-time reverse transcription-PCR (RT-QPCR). Outer membrane proteins (OMPs) play a role in the pathogenicity of \\u003cem\\u003eA. baumannii\\u003c/em\\u003e in targeting the outer membrane components of \\u003cem\\u003eA. baumannii\\u003c/em\\u003e is the presence of a capsule that defenses most of the outer membrane antigens from immune recognition. OMP33-36 are specific in the outer membrane of bacteria and often protrude from the polysaccharide capsule, making them a suitable target for vaccines due to their ability to induce a strong antibody response, primarily IgG [\\u003csup\\u003e4\\u003c/sup\\u003e]. The most effective \\u003cem\\u003eA. baumannii\\u003c/em\\u003e vaccines are often composed of antigens present on the bacterial outer membrane, such as OMP33-36, OMP22, and OMPK .The oprD gene encodes a porin involved in the uptake of carbapenems and other small molecules[\\u003csup\\u003e5\\u003c/sup\\u003e]. In \\u003cem\\u003eA. baumannii\\u003c/em\\u003e, mutations, downregulation, or loss of oprD expression are linked to carbapenem resistance, particularly resistance to imipenem. OprD dysfunction decreases membrane permeability, limiting the antibiotic's access to its target and rendering treatment with carbapenems less effective. This makes the monitoring of oprD expression critical in clinical settings to predict resistance and guide treatment strategies[\\u003csup\\u003e6\\u003c/sup\\u003e].\\u003c/p\\u003e\"},{\"header\":\"Material and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCollection of Specimens \\u0026amp; Culturing:\\u003c/h2\\u003e \\u003cp\\u003eThe study involved three hundred clinical samples from the patients of Al-Hilla General Teaching Hospital, and Morgan Training Hospital of Hilla City Clinical samples were collected through convenient sampling from the consent-seeking patients observed between August and November 2024. Samples were collected using materials such as wound swabs, burn swabs, urine samples, and blood samples from various sites and lesions. The specimens were immediately transported to the laboratory where they were inoculated onto MacConkey agar and nutrient agar the plates were incubated aerobically at 37\\u0026deg;C for 24 hours. In the current study, different strains in con scaffold with regard to the morphological appearance were selected for other studies. These colonies were also treated with Gram\\u0026rsquo;s stain and samples were observed under a light microscope. The suspect colonies were then streaked into HI-Chromo agar and placed in an incubator for another 24 h at 37\\u0026deg;C. The color of the colonies was also noted Besides, the growth and differentiation of Acinetobacter baumannii from the other bacterial isolates was made easier via the API 20 E system. Conventional method was efficient in the analysis of clinical specimens and PCR in the identification of \\u003cem\\u003eA. baumannii.\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eExtraction of DNA and Primers used in this study :\\u003c/h3\\u003e\\n\\u003cp\\u003eIsolated bacterial samples were genetically characterized separately for genomic DNA extraction through Kit PrestoMini gDNA Bacteria Kit purchased from Geneaid, USA following a directive from the kits manual. All the primers used in this study were purchased from the Korea-based Macrogen Company. For preparation of t working solution, stock solutions of the primers were diluted at the rate of 10 pmol/\\u0026micro;l to TE buffer by 1:2 dilution and were then stocked in -20\\u0026deg;C.l The primers used in this study were synthesized by Macrogen (Korea).For the preparation of the working solution, the primers were diluted from the stock solutions at the rate of 10 pmol/\\u0026micro;l over TE buffer in twofold dilution and were stored at -20\\u0026deg;C.ective from the kit manual. All the primers used in this study were purchased from the Korea based Macrogen Company. For preparation of t working solution, stock solutions of the primers were diluted at the rate of 10 pmol/\\u0026micro;l to TE buffer by 1:2 dilution and was then stocked at -20\\u0026deg;C.l The primers used in this study were synthesized by Macrogen (Korea). For the preparation of the working solution, the primers were diluted from the stock solutions at the rate of 10 pmol/\\u0026micro;l over TE buffer in twofold dilution and were stored at -20\\u0026deg;C. The 40 bp oligonucleotide primers used for amplification all the genes in this study were adopted from the literature and are listed in Table\\u0026nbsp;1. This table gives details on the respective genes of interest, the primer sequence, the size of the amplicons in base pair (bp) and references. Subtyped-specific PCR primers were used to identify the system subtypes in clinical isolates of \\u003cem\\u003eAcinetobacter baumannii.\\u003c/em\\u003e\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eTable\\u0026nbsp;(1): Primer and sequences Used in this study.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Taba\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGene Name\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGene Sequence (5\\u0026acute;- 3\\u0026acute;)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAmplicon(bp)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eReferences\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003ebla\\u003c/b\\u003e\\u003csub\\u003e\\u003cb\\u003eOXA\\u0026minus;51\\u0026minus;like\\u003c/b\\u003e\\u003c/sub\\u003e\\u003cb\\u003e-F\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003e\\u003cb\\u003ebla\\u003c/b\\u003e\\u003csub\\u003e\\u003cb\\u003eOXA\\u0026minus;51\\u0026minus;like\\u003c/b\\u003e\\u003c/sub\\u003e\\u003cb\\u003e-R\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eTAATGCTTTGATCGGCCTTG\\u003c/em\\u003e\\u003c/p\\u003e \\u003cp\\u003e\\u003cem\\u003eTGGATTGCACTTCATCTTGG\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e353\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\" morerows=\\\"4\\\" rowspan=\\\"5\\\"\\u003e \\u003cp\\u003e\\u003csup\\u003e\\u003cb\\u003e(43)\\u003c/b\\u003e\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eomp33-RT-F\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003e\\u003cb\\u003eomp33-RT-R\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eACCTTTGATGTCAGCTTCGC\\u003c/em\\u003e\\u003c/p\\u003e \\u003cp\\u003e\\u003cem\\u003eTGCTGTTAACCAAACTGCTGC\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e226\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eadeJ -F\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003e\\u003cb\\u003eadeJ -R\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eATTGCACCACCAACCGTAAC\\u003c/em\\u003e\\u003c/p\\u003e \\u003cp\\u003e\\u003cem\\u003eTAGCTGGATCAAGCCAGATA\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e453\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eoprD-RT-F\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003e\\u003cb\\u003eoprD-RT-R\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eTGCTGCGGATGGTATAGCTG\\u003c/em\\u003e\\u003c/p\\u003e \\u003cp\\u003e\\u003cem\\u003eACACTATGTGGACCAGTCGC\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e84\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003erpoB\\u003c/b\\u003e\\u003cb\\u003e-F\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003e\\u003cb\\u003erpoB\\u003c/b\\u003e\\u003cb\\u003e-R\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003e\\u003cb\\u003e(Reference-gene)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eTAYCGYAAAGAYTTGAAAGAAG\\u003c/em\\u003e\\u003c/p\\u003e \\u003cp\\u003e\\u003cem\\u003eCMACACCYTTGTTMCCRTGA\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e350\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eMolecular Detection of\\u003c/b\\u003e \\u003cb\\u003ebla\\u003c/b\\u003e\\u003csub\\u003e\\u003cb\\u003eoxa\\u0026minus;51\\u003c/b\\u003e\\u003c/sub\\u003e, \\u003cb\\u003eadeJ Genes Systems\\u003c/b\\u003e:\\u003c/p\\u003e \\u003cp\\u003eThe presence of \\u003cem\\u003eblaoxa-51\\u003c/em\\u003e, a\\u003cem\\u003edeB\\u003c/em\\u003e, and \\u003cem\\u003eadeJ\\u003c/em\\u003e genes was confirmed by Uniplex PCR as described by (44). The PCR reaction was done in a 25ul reaction volume, which included adjacent GoTaq\\u0026reg; G2 Green Master Mix from Promega, USA. The PCR products were then mixed with 2.5\\u0026micro;l of green star stain After PCR amplification; and the DNA samples were loaded onto 1.5% agarose gel and run at 100V for 35 min. The Agarose Gel documentation system was applied to polygonize the PCR products as it was done in the previous step.\\u003c/p\\u003e \\u003cp\\u003eRNA separation and cDNA synthesis\\u003c/p\\u003e \\u003cp\\u003eBacterial isolates were grown on Mueller-Hinton agar (MHA) plates at 37\\u0026deg;C overnight. RNA extraction from late log phase cultures was performed using the pure RNA isolation kit (Roche, Germany).Complementary DNA (cDNA) was synthesized from isolated RNA using reverse transcriptase and random hexamer primers, both provided with the Roche kit. The resulting cDNA was then stored at \\u0026minus;\\u0026thinsp;20\\u0026deg;C and then used for PCR amplification in downstream assays.\\u003c/p\\u003e\\n\\u003ch3\\u003eReal-time quantitative\\u003c/h3\\u003e\\n\\u003cp\\u003ethe expression of the adeJ and oprD genes and the OMP33-36 genes in the 25 isolates studies. RNA polymerase sigma factor (rpoB) gene was used as reference strain and internal control, respectively. mRNA expression was quantified for outer membrane proteins and efflux pump genes. and porins using SYBR Green I chemistry (Roche, Germany) according to the manufacturer's instructions. The PCR was carried out for the reactions prepared following PCR conditions: 1 cycle of 94\\u0026deg;C for 5 min; and 40 cycles of 94\\u0026deg;C for 20 seconds, 60\\u0026deg;C for 20 seconds, and 72\\u0026deg;C for 30 seconds. Melting curve analysis was also performed to ensure the production of a single amplicon after each cycle.All the reactions were performed in triplicate and the mean value of CT was used to analyze the expression level of the isolate.\\u003c/p\\u003e\\n\\u003ch3\\u003eGene expression analysis\\u003c/h3\\u003e\\n\\u003cp\\u003eThe 2- ∆∆CT method was used to calculate gene expression (Livak \\u0026amp; Schmittgen, 2001). A value equal to 1 indicates a similar level of expression of the tested gene in the reference and the test. Increases or decreases in gene expression (fold change)\\u0026thinsp;\\u0026gt;\\u0026thinsp;1 were considered as meaningful expressions.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003ePCR-ERIC in\\u003c/b\\u003e \\u003cb\\u003eAcinetobacter baumannii\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003ePCR-ERIC (Enterobacterial Repetitive Intergenic Consensus-PCR\\u003cb\\u003e)\\u003c/b\\u003e is widely used for molecular typing of \\u003cem\\u003eAcinetobacter baumannii\\u003c/em\\u003e isolates to explore their genetic diversity and clonal relationships. This technique was found within bacterial genomes to differentiate isolates based on banding patterns generated after PCR amplification.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eAll data using SPSS 28.0 statistical software .In addition, made of graphics with Excel 2021. A statistically significant difference was considered as a P-value\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthical approval :\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eEthical approval for this study was obtained from the ethical committee at Hilla Surgical Teaching Hospital. Furthermore, all individuals participating in the study were informed about the research, and their consent for both conducting the experiments and publishing the results was obtained prior to sample collection. This study was also approved by a local ethics committee at the College of Medicine, University of Babylon. and hospital ethics committee under document number [ IRB: 4-27, 3/1/2024].\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eBacterial isolates and Identification as \\u003cem\\u003eAcinetobacter\\u003c/em\\u003e \\u003cem\\u003ebaumannii\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e25(8.33%) out of 300 specimens collected from different clinical specimens. The clinical specimens including Urine (8%), blood (12%), burns (40%), and wounds (40%) Specimens were collected from patients using sterile swabs and cultured on MacConkey agar, blood agar, and HI-chromo agar (Merck, Germany) to confirm the presence of Gram-negative bacteria through Gram stain microscopy. Additionally, standard biochemical and microbiological tests, including citrate, oxidase, motility tests, and growth at 42 \\u0026deg;C\\u003cspan dir=\\\"RTL\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003ewere performed to identify and confirm the 25 isolates for inclusion in this study.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAPI\\u0026nbsp;20 E\\u0026nbsp;SYSTEM:\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWhen the API 20 E system was adopted to identify the \\u003cem\\u003eA.baumannii\\u0026nbsp;\\u003c/em\\u003efrom other isolates. The obtained results are shown in Table (2). The result revealed that, 25 isolates belonged to the \\u003cem\\u003eA. baumannii\\u0026nbsp;\\u003c/em\\u003eamong 300 isolates. This system is used to confirm the diagnosis of \\u003cem\\u003eA.baumannii\\u0026nbsp;\\u003c/em\\u003eas reported by Colle \\u003cem\\u003eet al.\\u003c/em\\u003e(1996).The API 20E system used in this study to confirm the result of routine biochemical tests, this system consists of 20 tests.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable (2): The results of the Api-20 E System.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"460\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eTest\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003eResults\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eOrthros-nitrophenyl\\u0026nbsp;Galactoside\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e-\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eArginine\\u0026nbsp;dehydrolase\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e-\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eLysine\\u0026nbsp;decarboxylase\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e-\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eOrnithine\\u0026nbsp;decarboxylase\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e-\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eCitrate\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e+\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eSodium\\u0026nbsp;Thiosulphate\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e-\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eUrea\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e-\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eTryptophanedeaminase\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e-\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eIndol\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e-\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eVoges-proskauer\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e+\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eKohn\\u0026apos;s\\u0026nbsp;Gelatin\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e-\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eGlucose\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e+\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eMannitol\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e-\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eInositol\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e-\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eSorbitol\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e-\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eRhamnose\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e-\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eSucrose\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e-\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eMelibiose\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e+\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eAmygdalin\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e-\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 65.4348%;\\\"\\u003e\\n \\u003cp\\u003eArabinose\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 34.5652%;\\\"\\u003e\\n \\u003cp\\u003e+\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eDistribution of \\u003cem\\u003eAcinetobacter\\u003c/em\\u003e \\u003cem\\u003ebaumannii\\u003c/em\\u003e among Different Clinical Specimens \\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e8.33%Frequencies of the specimen samples collected as in Fig(1) This may be due to the higher Chi-square of 9.08 and a p-value of 0.028 which suggested significant distinction in the distribution of \\u003cem\\u003eAcinetobacter baumannii\\u003c/em\\u003e among these clinical sources with the degree focus on the wound and burn swabs.\\u003c/p\\u003e\\n\\u003cp\\u003eThe percentage rate of \\u003cem\\u003eA.baumannii isolates\\u003c/em\\u003e from the site of infection indicated its prevalence and potential clinical implications as shown in \\u0026nbsp;Table 3 and the percentage rate among various specimens as in Table 3.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable (3): The percentage of\\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003e\\u003cem\\u003eAcinetobacter baumannii\\u003c/em\\u003e\\u003c/strong\\u003e \\u003cstrong\\u003eisolated in this study.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"592\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 27.3649%;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eSite of Infection\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 26.1824%;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNo. of specimens\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 17.9054%;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eNO.of isolates\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 28.5473%;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ePercentage of Isolates (% )\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 27.3649%;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eUrine\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 26.1824%;\\\"\\u003e\\n \\u003cp\\u003e15\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 17.9054%;\\\"\\u003e\\n \\u003cp\\u003e2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 28.5473%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; 8%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 27.3649%;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eWound \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 26.1824%;\\\"\\u003e\\n \\u003cp\\u003e75\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 17.9054%;\\\"\\u003e\\n \\u003cp\\u003e10\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 28.5473%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;40%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 27.3649%;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eburns\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 26.1824%;\\\"\\u003e\\n \\u003cp\\u003e80\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 17.9054%;\\\"\\u003e\\n \\u003cp\\u003e10\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 28.5473%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; 40%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 27.3649%;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eBlood\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 26.1824%;\\\"\\u003e\\n \\u003cp\\u003e25\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 17.9054%;\\\"\\u003e\\n \\u003cp\\u003e3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 28.5473%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;12%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 27.3649%;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eTotal\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 26.1824%;\\\"\\u003e\\n \\u003cp\\u003e300\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 17.9054%;\\\"\\u003e\\n \\u003cp\\u003e25\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 28.5473%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;100%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eGenotypic Detection of\\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003eGenes Encoding with Efflux Pump and Porins\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003ePCR to detect genes, AdeJ, porins oprD, OMP33-36 and \\u003cem\\u003eblaOXA-51\\u003c/em\\u003e were done as in Figures 2, 3, 4. The primers employed for the amplification of genes are listed in Table 3 below. The PCR reaction mixture for each reaction is 2.5 mM dNTPs, 1 unit (0.2 \\u0026micro;L) of Taq Polymerase, 10 pmol of each primer and 1 \\u0026micro;L of bacterial DNA and the total volume of each PCR reaction mixture was 25 \\u0026micro;L. The thermal cycling parameters were as follows:: The PCR involved initial denaturation at 95 \\u0026deg;C for 5 min and then 35 cycles of 95 \\u0026deg;C for 30 s, annealing at 55 \\u0026mdash; 60 \\u0026deg;C for 30 s and extension at 72 \\u0026deg;C 1 min, with an final elongation at 72\\u0026deg;C for 5 minutes. PCR products were further electrophoresed on 2% age, b. Stained with ethidium bromide (EtBr) and visualized under UV transillumination, then pictures were taken.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eGene Expression Analysis by Using qRT PCR Technique :\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eExtraction of total RNA\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eIn quantitative determination of the gene expression level, extraction of RNA from clinical isolates is done. They should be kept free from contamination particularly RNase and the protection was gained by using TRIzoL (guanidinthiocynate) with the ready kit. The quantity was determined using Quantus Fluorometer Quantity). In this technique SYBR green dye was used for qPCR, this dye combined with the double-strand DNA product, and emitted green light, this light signal can be measured in real-time at the PCR end of each cycle This amplification cycle was measured by giving the CT which is called cycling threshold. The quantitative RT-PCR reaction was performed with \\u003cem\\u003eA.baumannii\\u003c/em\\u003e-resistant isolates derived from a variety of specimens.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eGene Expression of adeJ, OMP33-36, OprD genes by qPCR\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;In this study, we calculate the fold of expression for adeJ, OMP33-36, and OprD genes through the calculation of delta CT by reducing the mean CT of each isolate from the mean CT of the housekeeping gene and by reducing the delta CT of each isolate subtracting mean delta CT from mean delta CT of the MTCC-1422. The fold of expression was determined from the equation (2-(\\u0026Delta;\\u0026Delta;Ct)).In Table(4):The findings also show that 80% of the \\u003cem\\u003eAcinetobacter baumannii\\u003c/em\\u003e isolates overexpress the OperD gene and adeJ (44%), which may confer antibiotic resistance through upregulation of efflux pump activity. This work strongly emphasizes the OMP33-36 gene which is depleted in all the isolates [100%] showing the general downregulation which might have contributed to reduced uptake of antibiotics and thus resistance.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable(4):\\u003c/strong\\u003e The Distribution of \\u003cstrong\\u003eOperD\\u003c/strong\\u003e\\u003cstrong\\u003e, \\u003cstrong\\u003eOMP33-36\\u003c/strong\\u003e\\u003c/strong\\u003e, and \\u003cstrong\\u003eadeJ\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003egene expression in \\u003cem\\u003eAcinetobacter baumannii\\u0026nbsp;\\u003c/em\\u003eisolates based on the log2 fold change.\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"605\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp;Gene expression\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\u003cbr\\u003e\\u003c/td\\u003e\\n \\u003ctd colspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eOperD\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd colspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eOMP33-36\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd colspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eadeJ\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eN\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eN\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eN\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"3\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eLog2 Fold change\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eDown expression\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e4.0%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e25\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e100.0%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e20.0%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eOverexpression\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e20\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e80.0%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0.0%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e11\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e44.0%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNon-significant expression\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e16.0%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0.0%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e36.0%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd colspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eTotal\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e25\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e100.0%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e25\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e100.0%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e25\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e100.0%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003ch3\\u003e\\u003cbr\\u003e\\u003c/h3\\u003e\\n\\u003cp\\u003eTable(4): OperD (Overexpression: 80% of isolates show overexpression, indicating that \\u003cem\\u003eOperD\\u003c/em\\u003e may be actively involved in processes critical for bacterial survival.Down expression: Observed in only 4% of isolates.Non-significant expression: In 16% of isolates.OMP33-36 (Down expression: All 25 isolates (100%) exhibit downregulation of \\u003cem\\u003eOMP33-36\\u003c/em\\u003e, indicating: Reduced outer membrane permeability, No Overexpression or Non-significant Expression: The complete absence of overexpression or neutral expression suggests that the suppression of \\u003cem\\u003eOMP33-36\\u003c/em\\u003e is critical for these isolates, potentially to enhance antibiotic resistance or alter membrane dynamics.adeJ(Overexpression: Observed in 44% of isolates, \\u003cem\\u003eadeJ\\u003c/em\\u003e overexpression suggests that the gene, part of the AdeABC efflux pump, is actively contributing to antibiotic resistance by pumping out toxic compounds, including antibiotics. Down expression: In 20% of isolates, \\u003cem\\u003eadeJ\\u003c/em\\u003e is downregulated, indicating some variability in efflux pump activity.Non-significant expression: Found in 36% of isolates.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eGene expression of adeJ, OMP33-36 and OprD Genes in \\u003cem\\u003eAcinetobacter baumannii\\u003c/em\\u003e isolates from various clinical samples\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eIn the present study, OperD: Highly significant upregulation in burn and wound swabs (p \\u0026lt; 0.001), marginally significant in blood (p = 0.050), and not significant in urine (p = 0.102).\\u003cstrong\\u003eOMP33-36\\u003c/strong\\u003e: Downregulated across all sample types, but there is no statistically significant difference.\\u003cstrong\\u003eadeJ\\u003c/strong\\u003e: Upregulated in all samples.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 5:Gene Expression of adeJ,\\u0026nbsp;OMP33-36 and OprD genes among different specimens.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"557\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 54px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 98px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd colspan=\\\"4\\\" style=\\\"width: 318px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eFold change Exp.\\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003e(2\\u003csup\\u003e-∆∆CT\\u003c/sup\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 87px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 54px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 98px;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003eMean\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003eSE\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003eSD\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 80px;\\\"\\u003e\\n \\u003cp\\u003eMean Rank\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 87px;\\\"\\u003e\\n \\u003cp\\u003eKruskal-Wallis H\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"3\\\" style=\\\"width: 54px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eBurn swab\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 98px;\\\"\\u003e\\n \\u003cp\\u003eOperD\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e9.611\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e2.045\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e6.467\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 80px;\\\"\\u003e\\n \\u003cp\\u003e23.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"3\\\" style=\\\"width: 87px;\\\"\\u003e\\n \\u003cp\\u003e20.968\\u003c/p\\u003e\\n \\u003cp\\u003e\\u0026lt;0.001**\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 98px;\\\"\\u003e\\n \\u003cp\\u003eOMP33-36\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e0.112\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e0.040\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e0.127\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 80px;\\\"\\u003e\\n \\u003cp\\u003e5.50\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 98px;\\\"\\u003e\\n \\u003cp\\u003eadeJ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e4.529\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e1.007\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e3.185\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 80px;\\\"\\u003e\\n \\u003cp\\u003e18.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"3\\\" style=\\\"width: 54px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eWound swab\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 98px;\\\"\\u003e\\n \\u003cp\\u003eOperD\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e11.753\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e3.830\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e12.113\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 80px;\\\"\\u003e\\n \\u003cp\\u003e23.20\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"3\\\" style=\\\"width: 87px;\\\"\\u003e\\n \\u003cp\\u003e20.921\\u003c/p\\u003e\\n \\u003cp\\u003e\\u0026lt;0.001**\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 98px;\\\"\\u003e\\n \\u003cp\\u003eOMP33-36\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e0.142\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e0.089\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e0.281\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 80px;\\\"\\u003e\\n \\u003cp\\u003e5.60\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 98px;\\\"\\u003e\\n \\u003cp\\u003eadeJ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e4.772\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e1.853\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e5.860\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 80px;\\\"\\u003e\\n \\u003cp\\u003e17.70\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"3\\\" style=\\\"width: 54px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eBlood\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 98px;\\\"\\u003e\\n \\u003cp\\u003eOperD\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e7.904\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e2.844\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e4.926\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 80px;\\\"\\u003e\\n \\u003cp\\u003e7.33\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"3\\\" style=\\\"width: 87px;\\\"\\u003e\\n \\u003cp\\u003e5.956\\u003c/p\\u003e\\n \\u003cp\\u003e0.050*\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 98px;\\\"\\u003e\\n \\u003cp\\u003eOMP33-36\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e0.087\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e0.048\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e0.083\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 80px;\\\"\\u003e\\n \\u003cp\\u003e2.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 98px;\\\"\\u003e\\n \\u003cp\\u003eadeJ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e3.882\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e1.769\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e3.064\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 80px;\\\"\\u003e\\n \\u003cp\\u003e5.67\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"3\\\" style=\\\"width: 54px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eUrine\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 98px;\\\"\\u003e\\n \\u003cp\\u003eOperD\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e8.946\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e1.141\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e1.613\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 80px;\\\"\\u003e\\n \\u003cp\\u003e5.50\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"3\\\" style=\\\"width: 87px;\\\"\\u003e\\n \\u003cp\\u003e4.571\\u003c/p\\u003e\\n \\u003cp\\u003e0.102\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 98px;\\\"\\u003e\\n \\u003cp\\u003eOMP33-36\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e0.432\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e0.313\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e0.442\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 80px;\\\"\\u003e\\n \\u003cp\\u003e1.50\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 98px;\\\"\\u003e\\n \\u003cp\\u003eadeJ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e5.413\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e2.002\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e2.831\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 80px;\\\"\\u003e\\n \\u003cp\\u003e3.50\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFold changes in gene expression (2^-∆∆CT) of OperD, OMP33-36, and adeJ in \\u003cem\\u003eAcinetobacter baumannii\\u0026nbsp;\\u003c/em\\u003eisolates from various clinical samples (burn swabs, wound swabs, blood, and urine). The mean, standard error (SE), and standard deviation (SD) of gene expression are provided, along with the mean ranks and Kruskal-Wallis H values, to determine the statistical significance of differences across sample types. Burn Swab, OperD: The expression is significantly upregulated with a fold change of 9.611. The Kruskal-Wallis test shows a highly significant difference (H = 20.968, p \\u0026lt; 0.001)OMP33-36: Downregulated expression with a very low fold change of 0.112.adeJ: Moderately upregulated with a fold change of 4.529.Wound Swab, OperD: Expression is highly upregulated (11.753), with a significant Kruskal-Wallis H test (H = 20.921, p \\u0026lt; 0.001).OMP33-36: Very low expression (0.142), indicating downregulation.adeJ: Expression is moderately upregulated (4.772).Blood, OperD: Upregulated with a fold change of 7.904. The Kruskal-Wallis H value is significant but at the 0.05 level (H = 5.956, p = 0.050).OMP33-36: Downregulated expression (0.087).adeB: Moderately upregulated (3.882).Urine, OperD: Upregulated (8.946), but the p-value of the Kruskal-Wallis test (H = 4.571, p = 0.102) indicates that the difference is not statistically significant.OMP33-36: Relatively higher expression compared to other samples (0.432), but still downregulated.adeJ: Upregulated with a fold change of 5.413.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eDetection of clonal isolates by ERIC gene:\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e22 isolates were amplified results using ERIC primer for detection of clonal isolates as Figure (6).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eThe result of \\u0026nbsp;PCR ERIC exposure to the gene studio program to explained as shown in Figure (6). According to this result, the bands were shown clearly .by depending on the molecular Weight of bands that appeared the strain which has a convergent molecular weight in the same adjective gave number (1) and which does not have the convergent molecular weight means it does not have the same adjective gave number (0). Then this matrix enters to special program called (Dice+UPGMA) which gives the Distance Matrix as shown in Figure (6). This matrix showed a match between strains (21, 22) their sources were (burn , and wound swab) respectively, and among (6,11 and 12) the sources \\u0026nbsp;(burn, burn wound) respectively, finally matched between (9,10) both of them from blood samples, there is a similarity in sources of this strains. Another step in the same program(Dice+UPGMA) from Distance Matrix got a phylogenic tree for 22 isolates ( figure 7).\\u003c/p\\u003e\\n\\u003cp\\u003eUsing the ERIC-PCR fingerprinting method, \\u003cem\\u003eA. baumannii\\u0026nbsp;\\u003c/em\\u003estrains isolated from 22 different clinical specimens were classified into groups as follows: Group A: This group comprised 12 strains (7, 9, 10, 17, 5, 8, 6, 11, 12, 2, 4, and 19), isolated from blood and swabs, with some strains being extensively drug-resistant (XDR) and others multidrug-resistant (MDR). All strains in this group were resistant to Meropenem and Ceftriaxone, as well as Amikacin, Ciprofloxacin, and Levofloxacin. All 22 isolates exhibited resistance to these antibiotics. Regarding biofilm formation, all strains in Group A produced biofilms, ranging from moderate to strong, with genotypic detection confirming the presence of the OMP33-36 and OprD genes in all strains except Ab4, which tested negative for these genes. Phenotypically, all isolates produced metallo-beta-lactamases (MBLs), except for strain Ab5, while none produced extended-spectrum beta-lactamases (ESBLs). AmpC production was positive in strains 2, 4, 17, and 19. Genotypically, all strains in this group showed positive results for the blaOXA-51 gene. Group A represented 54.54% of the \\u003cem\\u003eA. baumannii\\u003c/em\\u003e isolates. Group B: This unique type was represented by strain 18, isolated from a burn swab, which was classified as XDR.Group C: This unique type was represented by strain 3, also isolated from a burn swab, and classified as XDR.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eThe prevalence of \\u003cem\\u003eA. baumannii\\u0026nbsp;\\u003c/em\\u003ein\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003eburn and wound samples (40%)\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003eobserved in this study is consistent with previous research by \\u0026nbsp;\\u003cstrong\\u003e\\u003csup\\u003e(7)\\u003c/sup\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e.\\u003c/strong\\u003e also reported high rates of \\u003cem\\u003eA. baumannii\\u003c/em\\u003e isolation from burn patients, emphasizing the pathogen\\u0026rsquo;s ability to thrive in warm, moist environments, such as burn units, where patients often have large areas of skin exposed.And a study by \\u003csup\\u003e(8)\\u003c/sup\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003ea slightly lower percentage of \\u003cem\\u003eA. baumannii\\u003c/em\\u003e isolates from burn wounds. This difference might be attributed to variations in infection control practices, geographical differences, or sampling methods across different healthcare facilities. The rate of \\u003cem\\u003eA. baumannii\\u003c/em\\u003e in blood samples (12%) in the current study is similar to findings in studies by\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003e\\u003csup\\u003e(9)\\u003c/sup\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e,\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003ewhich demonstrated that although \\u003cem\\u003eA. baumannii\\u0026nbsp;\\u003c/em\\u003ecan cause bacteremia, it is less frequently isolated from the blood than from other clinical specimens, such as respiratory or wound samples.In this study, the API 20 E system was used to confirm the presence of \\u003cem\\u003eA. baumannii\\u003c/em\\u003e among the 25 isolates identified from clinical specimens. This method was effective in distinguishing \\u003cem\\u003eA. baumannii\\u003c/em\\u003e from other Gram-negative bacteria, providing reliable and consistent results as described in \\u003csup\\u003e(10)\\u003c/sup\\u003e.In comparison, studies such as \\u003csup\\u003e(11)\\u0026nbsp;\\u003c/sup\\u003eand \\u003csup\\u003e(12)\\u0026nbsp;\\u003c/sup\\u003econfirm the presence of \\u003cem\\u003eA. baumannii.\\u003c/em\\u003e And a study by \\u003csup\\u003e(13),\\u003c/sup\\u003e molecular techniques revealed strains of \\u003cem\\u003eA. baumannii\\u0026nbsp;\\u003c/em\\u003ethat were misidentified by biochemical tests. The API 20 E system used in your study, although effective for confirming initial diagnoses.the distribution of \\u003cem\\u003eAcinetobacter baumannii\\u003c/em\\u003e isolates from various clinical specimens, with the majority of the isolates coming from burn swabs (40%) and wound swabs (40%), followed by blood (12%) and urine (8%). The statistical analysis shows a chi-square value of 9.08 and a p-value of 0.028, indicating a significant difference in the distribution of isolates across specimen types.The predominance of \\u003cem\\u003eA. baumannii\\u003c/em\\u003e isolates in burn and wound specimens in your study is consistent with findings in the literature \\u003csup\\u003e(14)\\u003c/sup\\u003e, which also reported a high prevalence of \\u003cem\\u003eA. baumannii\\u0026nbsp;\\u003c/em\\u003ein burn units, where the bacterium thrives due to the moist environment and compromised skin defences of burn patients. Their study found similar rates, with burn swabs accounting for over 40% of isolates.Similarly, \\u003csup\\u003e(15)\\u003c/sup\\u003e discussed how \\u003cem\\u003eA. baumannii\\u0026nbsp;\\u003c/em\\u003eis particularly problematic in wound infections and burn units, where it can persist on surfaces and in hospital environments, leading to outbreaks. Burn patients are especially vulnerable due to their weakened immune systems and open wounds, which create a perfect entry point for the bacterium.In contrast, a study by\\u003csup\\u003e\\u0026nbsp;(16)\\u0026nbsp;\\u003c/sup\\u003efound a slightly lower prevalence of \\u003cem\\u003eA. baumannii\\u0026nbsp;\\u003c/em\\u003ein burn wounds (around 30%), with a higher percentage of isolates from blood and respiratory samples. This difference may be attributable to variations in healthcare practices, infection control measures, and the geographic regions of the studies.In this study, blood specimens accounted for 12% of the isolates, which aligns with the findings of \\u003csup\\u003e(17),\\u003c/sup\\u003e who demonstrated that while \\u003cem\\u003eA. baumannii\\u0026nbsp;\\u003c/em\\u003eis a known cause of bacteremia, it is more commonly associated with surface-related infections. The presence of \\u003cem\\u003eA. baumannii\\u003c/em\\u003e in urine specimens (8%) is lower compared to other studies. For instance, \\u003csup\\u003e(18)\\u003c/sup\\u003e reported slightly higher rates of urinary tract infections (UTIs) caused by \\u003cem\\u003eA. baumannii\\u003c/em\\u003e, particularly in patients with catheter-associated infections.In this study, the detection of genes associated with \\u003cem\\u003eAcinetobacter baumannii\\u003c/em\\u003e resistance and efflux pumps was conducted using agarose gel electrophoresis, and the results were as \\u003cem\\u003eblaOXA-51\\u003c/em\\u003e gene (353 bp) was detected in all 25 isolates, adeJ gene (541 bp) was also detected in all 25 isolates,.The universal detection of the \\u003cem\\u003eblaOXA-51\\u003c/em\\u003e gene in all 25 isolates is consistent with findings from several studies. \\u003csup\\u003e(19)\\u003c/sup\\u003e found that \\u003cem\\u003eblaOXA-51\\u003c/em\\u003e is ubiquitous in \\u003cem\\u003eA. baumannii\\u0026nbsp;\\u003c/em\\u003estrains, making it a reliable marker for identifying this species. This gene confers resistance to beta-lactam antibiotics, specifically carbapenems, which is a significant concern in treating \\u003cem\\u003eA. baumannii\\u003c/em\\u003e infections.In a study by \\u003csup\\u003e(20)\\u003c/sup\\u003e, the \\u003cem\\u003eblaOXA-51\\u003c/em\\u003e gene was present in over 90% of \\u003cem\\u003eA. baumannii\\u0026nbsp;\\u003c/em\\u003eisolates, confirming its prevalence. Therefore, your findings are in line with the global patterns of this gene\\u0026rsquo;s presence in \\u003cem\\u003eA. baumannii\\u0026nbsp;\\u003c/em\\u003eisolates. The detection of the adeJ gene in all isolates in your study highlights the widespread presence of the AdeIJK \\u0026nbsp;efflux pump system, which contributes to multidrug resistance. This aligns with studies such as \\u003csup\\u003e(21),\\u003c/sup\\u003e which found that the AdeIJK \\u0026nbsp;efflux pump is one of the primary mechanisms by which \\u003cem\\u003eA. baumannii\\u003c/em\\u003e develops resistance to a wide range of antibiotics, including aminoglycosides, fluoroquinolones, and tetracyclines.Similarly, \\u003csup\\u003e(22)\\u003c/sup\\u003e showed that the adeJ gene is frequently detected in multidrug-resistant \\u003cem\\u003eA. baumannii\\u003c/em\\u003e isolates, particularly those from hospitals, where antibiotic pressure is selected for resistant strains. The high rate of adeB detection in your study (100%) further underscores the role of this efflux pump in resistance across diverse clinical settings.And The adeJ gene, which is part of the AdeIJK efflux pump system, was \\u0026nbsp;detected in all isolates in your study. This contrasts with findings from \\u003csup\\u003e(23),\\u003c/sup\\u003e who demonstrated that the AdeIJK efflux pump plays a role in antibiotic resistance in some \\u003cem\\u003eA. baumannii\\u003c/em\\u003e strains, albeit to a lesser extent than the AdeIJK \\u0026nbsp;system. The absence of adeJ in your isolates might indicate that this efflux pump is not as commonly expressed or necessary in your particular isolates, especially if other resistance mechanisms, like AdeIJK , are already present.Other studies, such as \\u003csup\\u003e(24),\\u0026nbsp;\\u003c/sup\\u003ehave also reported variability in the presence of efflux pump genes. In some populations of \\u003cem\\u003eA. baumannii\\u003c/em\\u003e, the AdeIJK system is expressed in only a subset of strains, suggesting regional or strain-specific differences in efflux pump gene distribution.In gene expression,The high level of OperD gene overexpression in 80% of isolates in your study suggests its potential role in enhancing the fitness or pathogenicity of \\u003cem\\u003eA. baumannii.\\u003c/em\\u003e OperD is linked to oxidative stress responses and survival under challenging conditions. Studies such as \\u003csup\\u003e(25)\\u0026nbsp;\\u003c/sup\\u003ereported similar findings, where OperD was overexpressed in \\u003cem\\u003eA. baumannii\\u0026nbsp;\\u003c/em\\u003eisolates from patients in intensive care units, particularly those with severe infections. In their study, OperD was also associated with resistance to oxidative stress, allowing the bacteria to persist in hostile environments.However, studies like \\u003csup\\u003e(26)\\u003c/sup\\u003e have found lower levels of OperD expression in community-acquired infections, which suggests that OperD overexpression may be more relevant in hospital-acquired, multidrug-resistant isolates than in strains circulating in the community. TheOMP33-36 gene, which encodes an outer membrane protein associated with the uptake of carbapenem antibiotics, was completely downregulated in all isolates in your study. This finding aligns with research from \\u003csup\\u003e(27)\\u003c/sup\\u003e, which demonstrated thatOMP33-36 downregulation or inactivation is a common mechanism by which \\u003cem\\u003eA. baumannii\\u003c/em\\u003e develops resistance to carbapenems, especially imipenem.In contrast, a study by \\u003csup\\u003e(28)\\u003c/sup\\u003e showed that some isolates retain OMP33-36 expression despite carbapenem resistance, possibly due to compensatory mechanisms such as increased efflux pump activity. This discrepancy highlights the diversity in resistance mechanisms employed by \\u003cem\\u003eA\\u003c/em\\u003e. \\u003cem\\u003ebaumannii\\u003c/em\\u003e in different settings. In your study, the complete OMP33-36 downregulation suggests that the isolates rely heavily on this mechanism to resist carbapenem treatment.The adeJgene, showed overexpression in 44% \\u003csup\\u003e(29)\\u003c/sup\\u003e found that adeJ overexpression is associated with resistance to a broad range of antibiotics, including aminoglycosides, tetracyclines, and fluoroquinolones.In contrast, the 20% downregulation of the adeJ gene in your study is lower than reported in some other studies, such as \\u003csup\\u003e(30),\\u0026nbsp;\\u003c/sup\\u003ewhere only a small proportion of isolates showed downregulation. This suggests that while AdeJ is a critical resistance mechanism, other factors such as mutations in target genes or alternative efflux pumps may also contribute to resistance in these isolates.The presence of non-significant expression in 36% of isolates indicates that the AdeJ efflux pump may not always be the primary driver of resistance. Other efflux systems, such as AdeIJK, or additional mechanisms like porin loss could be compensating in those isolates. The ERIC-PCR results in this study, using a 1.5% agarose gel stained with Ethidium Bromide (Eth. Br), showed variable size PCR products across Lanes 1-22, indicating genetic diversity among the \\u003cem\\u003eA. baumannii\\u003c/em\\u003e isolates. The PCR fragments were visualized using a 100 bp ladder marker as a reference for sizing the amplification products.This variability in band patterns suggests that the isolates in this study represent genetically diverse strains, which could point to different origins or evolutionary pathways for the isolates. The variation in the size of PCR products could reflect differences in the number of repetitive sequences present in each isolate, which may influence pathogenicity or antibiotic resistance. and study \\u0026nbsp;\\u003csup\\u003e(31)\\u0026nbsp;\\u003c/sup\\u003eand \\u003csup\\u003e(32)\\u003c/sup\\u003e have used ERIC-PCR to assess the genetic diversity of \\u003cem\\u003eA. baumannii\\u003c/em\\u003e isolates in hospital settings. Both studies reported significant variability in ERIC-PCR banding patterns, with multiple distinct clusters of isolates being identified. In line with your findings, they observed genetic heterogeneity among isolates, which highlights the capacity of \\u003cem\\u003eA. baumannii\\u003c/em\\u003e to adapt and evolve in various environments.\\u003csup\\u003e(33),\\u0026nbsp;\\u003c/sup\\u003eidentified between 2 to 10 distinct PCR bands in their isolates, with each isolate having a unique fingerprint. This level of variability is consistent with your finding of variable PCR product sizes across the 22 isolates, confirming that \\u003cem\\u003eA. baumannii\\u003c/em\\u003e populations often display high genetic diversity, which complicates infection control and treatment strategies.\\\\and \\u003csup\\u003e(34)\\u003c/sup\\u003e have demonstrated that ERIC-PCR can cluster genetically similar strains, identifying clonal lineages within hospital outbreaks. In contrast, the variability in these isolates suggests that they do not belong to a single clonal group, implying that the infections may not have arisen from a single source or outbreak. Similarly, \\u003csup\\u003e(35)\\u003c/sup\\u003e used ERIC-PCR to genotype \\u003cem\\u003eA. baumannii\\u003c/em\\u003e strains in an Iraqi hospital, identifying distinct band patterns that reflected diverse genetic backgrounds. The study found 5-8 bands in each isolate, similar to your findings, reinforcing the notion of high genetic variability within clinical \\u003cem\\u003eA. baumannii\\u003c/em\\u003e populations. \\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003eB\\u003cstrong\\u003eanding Patterns in Epidemiological Study by\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003csup\\u003e(\\u003c/sup\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e\\u003csup\\u003e36)\\u003c/sup\\u003e\\u003c/strong\\u003e also applied ERIC-PCR to assess \\u003cem\\u003eA. baumannii\\u003c/em\\u003e diversity. Their study found distinct banding patterns, with the number of bands varying from \\u003cstrong\\u003e4 to 12\\u003c/strong\\u003e per isolate. In your gel, several isolates show multiple distinct bands, indicating complex genetic profiles. Such patterns suggest that the isolates in your study may not share a common clonal origin, a conclusion similarly drawn in \\u003cstrong\\u003eKarah et al.\\u0026apos;s\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003ework, where genetically diverse strains were linked to different infection sources.\\u003cstrong\\u003eRepetitive Elements and Clonal Relationships\\u003c/strong\\u003e\\u003cstrong\\u003e: \\u003csup\\u003e(\\u003c/sup\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e\\u003csup\\u003e37)\\u003c/sup\\u003e\\u003c/strong\\u003e used ERIC-PCR to classify \\u003cem\\u003eA. baumannii\\u003c/em\\u003e strains from a hospital outbreak, identifying clonal lineages based on similarities in their PCR profiles. However, the diversity seen in these results suggests that the isolates might not belong to a single clonal group.Another relevant study by \\u003cstrong\\u003e\\u003csup\\u003e(38)\\u003c/sup\\u003e\\u003c/strong\\u003e\\u003csup\\u003e\\u0026nbsp;\\u003c/sup\\u003eused ERIC-PCR to analyze environmental and clinical \\u003cem\\u003eA. baumannii\\u003c/em\\u003e strains. They found that environmental strains exhibited a broader range of genetic variability compared to clinical strains.In this study, the ERIC-PCR analysis of 22 \\u003cem\\u003eA. baumannii\\u003c/em\\u003e isolates from various clinical specimens revealed the formation of several distinct groups based on their genetic fingerprints and resistance profiles. The results are comparable to findings in other studies, which also demonstrate genetic diversity and distinct clustering of \\u003cem\\u003eA. baumannii\\u003c/em\\u003e strains.Group A: This group (12 strains: 7, 9, 10, 17, 5, 8, 6, 11, 12, 2, 4, and 19) consists of strains from blood and swabs. All isolates in this group are either multidrug-resistant (MDR) or extensively drug-resistant (XDR), showing resistance to Meropenem, Ceftriaxone, Amikacin, Ciprofloxacin, and Levofloxacin. This clustering pattern is in agreement with studies like \\u003csup\\u003e(39)\\u003c/sup\\u003e, where \\u003cem\\u003eA. baumannii\\u003c/em\\u003e isolates from hospital outbreaks were found to cluster into clonal groups based on ERIC-PCR profiles and shared resistance mechanisms.Group B and C: These groups consist of unique strains (strain 18 in Group B and strain 3 in Group C), both isolated from burn swabs and classified as XDR. The distinct banding patterns of these strains suggest they are genetically distinct from other isolates in the study. Similar findings have been reported by \\u003csup\\u003e(40)\\u003c/sup\\u003e who found that \\u003cem\\u003eA. baumannii\\u003c/em\\u003e isolates from burn patients often form unique ERIC-PCR profiles due to the selective pressure in burn units, where high antibiotic use may promote the emergence of genetically distinct, resistant strains.Group D: This group includes two isolates (strains 1 and 13) from blood samples, both exhibiting XDR and MDR profiles. The strains demonstrated resistance to Amikacin, Ciprofloxacin, Levofloxacin, Imipenem, and Ampicillin-sulbactam. \\u003csup\\u003e(41)\\u003c/sup\\u003e found similar results where isolates with distinct ERIC-PCR profiles exhibited different clones.Group E: This cluster consists of five isolates (20, 21, 22, 14, and 15) from different clinical sources, with both MDR and XDR profiles. These strains demonstrated resistance to Amikacin, Ciprofloxacin, Levofloxacin, and Ampicillin-sulbactam. Genotypic analysis confirmed the presence of biofilm genes, correlating with biofilm formation. These findings align with \\u003csup\\u003e(42),\\u003c/sup\\u003e who reported that \\u003cem\\u003eA. baumannii\\u003c/em\\u003e isolates from various clinical sources often form a distinct genetic group.the study demonstrates that the differential expression of efflux pumps and porins plays a crucial role in the resistance patterns observed among clinical isolates of \\u003cem\\u003eA. baumannii\\u003c/em\\u003e. The complex interplay between these resistance mechanisms emphasizes the need for further research into novel therapeutic strategies to address the growing challenge of MDR in \\u003cem\\u003eA. baumannii\\u003c/em\\u003e infections.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eThis study highlights the significant role of the \\u003cem\\u003eadeJ\\u003c/em\\u003e efflux transporter and \\u003cem\\u003eOprD\\u003c/em\\u003e in contributing to antibiotic resistance in \\u003cem\\u003eA. baumannii\\u003c/em\\u003e, primarily through reduced drug accumulation and enhanced expulsion. Additionally, the consistent modification of \\u003cem\\u003eOmp33-36\\u003c/em\\u003e across all isolates suggests its involvement in altering membrane permeability and promoting resistance. These findings emphasize the complexity of resistance mechanisms in \\u003cem\\u003eA. baumannii\\u003c/em\\u003e and the need for tailored treatment strategies, including the development of new antibiotics. A deeper understanding of these resistance pathways is essential for effectively managing infections and curbing the spread of this pathogen.PCR-ERIC analysis suggests genetic relatedness where patterns of the bands vary from one isolate to the other. This result shows the importance of regular surveillance of resistance patterns and genetic heterogeneity to develop and implement appropriate therapeutic and management strategies. The findings underscore the need for tailored strategies for reversing the trend of resistance in clinical practice.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe hospital staff(Al-Hilla General Teaching Hospital, and Mergan Teaching Hospital) deserve our sincere gratitude.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFinancial support and sponsorship\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNil.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThere are no conflicts of interest.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eV\\u0026aacute;zquez-L\\u0026oacute;pez R, Solano-G\\u0026aacute;lvez SG, Ju\\u0026aacute;rez Vignon-Whaley JJ, Abello Vaamonde JA, Padr\\u0026oacute; Alonzo LA, Rivera Res\\u0026eacute;ndiz A, \\u003cem\\u003eet al\\u003c/em\\u003e. \\u003cem\\u003eAcinetobacter baumannii\\u003c/em\\u003e resistance: a real challenge for clinicians. Antibiotics. 2020;9(4):205.\\u003c/li\\u003e\\n\\u003cli\\u003eDolma KG, MD WM. \\u003cem\\u003eAcinetobacter baumannii\\u003c/em\\u003e: An overview of the emerging multidrug-resistant pathogen. Med J Malaysia. 2022;77(3):357.\\u003c/li\\u003e\\n\\u003cli\\u003eGedefie A, Demsis W, Ashagrie M, Kassa Y, Tesfaye M, Tilahun M, \\u003cem\\u003eet al.\\u003c/em\\u003e \\u003cem\\u003eAcinetobacter\\u003c/em\\u003e \\u003cem\\u003ebaumanni\\u003c/em\\u003ei biofilm formation and its role in disease pathogenesis: a review. Infect Drug Resist. 2021;14:3711-9.\\u003c/li\\u003e\\n\\u003cli\\u003eVrancianu CO, Pelcaru CF, Alistar A, Gheorghe I, Marutescu L, Popa M, \\u003cem\\u003eet al\\u003c/em\\u003e. Escaping from ESKAPE. Clinical significance and antibiotic resistance mechanisms in \\u003cem\\u003eAcinetobacter baumannii\\u003c/em\\u003e: a review. Biointerface Res Appl Chem. 2021;11(1):8190-203.\\u003c/li\\u003e\\n\\u003cli\\u003eRoy S, Chowdhury G, Mukhopadhyay AK, Dutta S, Basu S. Convergence of biofilm formation and antibiotic resistance in Acinetobacter baumannii infection. Front Med. 2022;9:793615.\\u003c/li\\u003e\\n\\u003cli\\u003eCorona A, De Santis V, Agarossi A, Prete A, Cattaneo D, Tomasini G, et al. Antibiotic therapy strategies for treating gram-negative severe infections in the critically ill: a narrative review. Antibiotics. 2023;12(8):1262.\\u003c/li\\u003e\\n\\u003cli\\u003eEkrami A, Kalantar A. Isolation of Acinetobacter baumannii from burn patients: An evaluation of risk factors and antimicrobial susceptibility patterns. J Burn Care Res. 2017;38(2):122-8.\\u003c/li\\u003e\\n\\u003cli\\u003eManchanda V, Sood S, Singh A. A retrospective study on the prevalence of Acinetobacter baumannii in burn wounds. Int J Infect Dis. 2020;92:174-80.\\u003c/li\\u003e\\n\\u003cli\\u003eColle JG, Marimore JD, Frasers A. Biochemical Tests for Identification of Medical Bacteria. 18th ed. Academic Press; 2022.\\u003c/li\\u003e\\n\\u003cli\\u003eSeifert H, Baginski R, Schulze A, Pulverer G. The clinical significance of Acinetobacter baumannii bacteremia in hospitalized patients. J Hosp Infect. 1995;30(3):223-32.\\u003c/li\\u003e\\n\\u003cli\\u003eDijkshoorn L, Nemec A, Seifert H. An increasing threat in hospitals: Multidrug-resistant Acinetobacter baumannii. Nat Rev Microbiol. 2017;15(1):35-47.\\u003c/li\\u003e\\n\\u003cli\\u003eNowak J, Zander E, Stefanik D, Higgins PG, Roca I, Vila J, et al. High incidence of misidentified Acinetobacter species revealed by sequencing in patients with bacteremia. J Clin Microbiol. 2017;55(10):2982-9.\\u003c/li\\u003e\\n\\u003cli\\u003eEkrami A, Kalantar E. Isolation of Acinetobacter baumannii from burn patients: An evaluation of risk factors and antimicrobial susceptibility patterns. J Burn Care Res. 2017;38(2):122-8.\\u003c/li\\u003e\\n\\u003cli\\u003eTowner KJ. Acinetobacter: An old pathogen turned hospital menace. Clin Microbiol Rev. 2019;32(1):55-67.\\u003c/li\\u003e\\n\\u003cli\\u003eManchanda V, Sinha S, Singh NP. Multidrug-resistant Acinetobacter. J Glob Infect Dis. 2010;2(3):291-304.\\u003c/li\\u003e\\n\\u003cli\\u003eHouang EE, Ho PL, Chen JL. Acinetobacter baumannii bacteremia: A clinical and microbiological study. BMC Infect Dis. 2021;21(1):123.\\u003c/li\\u003e\\n\\u003cli\\u003ePeleg AY, Seifert H, Paterson DL. Acinetobacter baumannii: Emergence of a successful pathogen. Clin Microbiol Rev. 2018;21(3):538-82.\\u003c/li\\u003e\\n\\u003cli\\u003eTurton JF, Woodford N, Glover J, Yarde S, Kaufmann ME, Pitt TL. Identification of Acinetobacter baumannii by detection of the blaOXA-51-like carbapenemase gene intrinsic to this species. J Clin Microbiol. 2006;44(8):2974-6.\\u003c/li\\u003e\\n\\u003cli\\u003eZarrilli R, Di Popolo A, Bagattini M, Giannouli M, Martino D, Fico A, et al. Molecular epidemiology of multidrug-resistant Acinetobacter baumannii strains in Italy and correlation with patient clinical data. Clin Microbiol Infect. 2023;29(2):193.e1-7.\\u003c/li\\u003e\\n\\u003cli\\u003eMagnet S, Courvalin P, Lambert T. Resistance-nodulation-cell division-type efflux pump involved in aminoglycoside resistance in Acinetobacter baumannii. Antimicrob Agents Chemother. 2021;45(12):3375-80.\\u003c/li\\u003e\\n\\u003cli\\u003eCoyne S, Courvalin P, Perichon B. Efflux-mediated antibiotic resistance in Acinetobacter spp. Antimicrob Agents Chemother. 2021;45(10):3401-8.\\u003c/li\\u003e\\n\\u003cli\\u003eDamier-Piolle L, Magnet S, Br\\u0026eacute;mont S, Lambert T, Courvalin P. AdeIJK, a resistance-nodulation-cell division-type efflux pump, is involved in decreased susceptibility to aminoglycosides and carbapenems in Acinetobacter baumannii. J Antimicrob Chemother. 2018;62(3):395-402.\\u003c/li\\u003e\\n\\u003cli\\u003eSu XZ, Chen J, Mizushima T, Kuroda T. The AdeABC multidrug efflux pump in Acinetobacter baumannii confers resistance to antibiotics. J Antimicrob Chemother. 2010;65(3):445-8.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang L, Li XZ, Poole K, Nikaido H. Overexpression of the oxidative stress-related OperD gene in Acinetobacter baumannii from ICU patients with severe infections. Clin Microbiol Rev. 2017;20(1):225-42.\\u003c/li\\u003e\\n\\u003cli\\u003eKim Y, Kim SH, Kang MW. OperD gene expression in community-acquired Acinetobacter baumannii infections: A comparative study. J Infect Dev Ctries. 2014;8(6):745-50.\\u003c/li\\u003e\\n\\u003cli\\u003eCatel-Ferreira M, Coadou G, Molle G, Mugnier P, Jourdan ML, Mall\\u0026eacute;a M. CarO, the carbapenem-associated outer membrane protein of Acinetobacter baumannii. J Antimicrob Chemother. 2011;66(9):2053-6.\\u003c/li\\u003e\\n\\u003cli\\u003eMussi MA, Limansky AS, Viale AM. CarO outer membrane channel is involved in carbapenem resistance in \\u003cem\\u003eAcinetobacter baumannii\\u003c/em\\u003e clinical isolates. Antimicrob Agents Chemother. 2010;49(12):4873-4.\\u003c/li\\u003e\\n\\u003cli\\u003eCoyne S, Courvalin P, P\\u0026eacute;richon B. Efflux-mediated antibiotic resistance in \\u003cem\\u003eAcinetobact\\u003c/em\\u003eer spp. Antimicrob Agents Chemother. 2011;55(3):947-53.\\u003c/li\\u003e\\n\\u003cli\\u003eMagnet S, Courvalin P, Lambert T. Resistance-nodulation-cell division-type efflux pump involved in aminoglycoside resistance in Acinetobacter baumannii. Antimicrob Agents Chemother. 2001;45(12):3375-80.\\u003c/li\\u003e\\n\\u003cli\\u003eChen Y, Sun J, Li H, Li S. Genetic diversity and antibiotic resistance of \\u003cem\\u003eAcinetobacter baumanni\\u003c/em\\u003ei isolates from hospital settings revealed by ERIC-PCR. J Clin Microbiol. 2018;56(4)\\u003c/li\\u003e\\n\\u003cli\\u003eLopes BS, Evans BA, Amyes SGB. ERIC-PCR typing of Acinetobacter baumannii isolates from clinical settings. J Med Microbiol. 2016;65(9):877-83.\\u003c/li\\u003e\\n\\u003cli\\u003eDijkshoorn L, Nemec A, Seifert H. An increasing threat in hospitals: Multidrug-resistant Acinetobacter baumannii. Nat Rev Microbiol. 2011;9(12):810-21.\\u003c/li\\u003e\\n\\u003cli\\u003eMussi MA, Limansky AS, Viale AM. CarO outer membrane channel is involved in carbapenem resistance in Acinetobacter baumannii clinical isolates. Antimicrob Agents Chemother. 2010;54(12):4974-5.\\u003c/li\\u003e\\n\\u003cli\\u003eGhaima KK, Al-Haddad AM, Al-Taei ZH. Genetic diversity of Acinetobacter baumannii isolated from patients in an Iraqi hospital using ERIC-PCR. Int J Infect Dis. 2017;58:35-9.\\u003c/li\\u003e\\n\\u003cli\\u003eKarah N, Haldorsen B, Hermansen NO, Tveten Y, Ragnhildstveit E, Skutlaberg DH, et al. Emergence of OXA-carbapenemase- and 16S rRNA methylase-producing international clones of Acinetobacter baumannii in Norway. J Med Microbiol. 2012;61(2):165-70.\\u003c/li\\u003e\\n\\u003cli\\u003eDijkshoorn L, Nemec A, Seifert H. An increasing threat in hospitals: Multidrug-resistant Acinetobacter baumannii. Nat Rev Microbiol. 2011;9(12):810-21.\\u003c/li\\u003e\\n\\u003cli\\u003eTowner KJ. Acinetobacter: An old pathogen turned hospital menace. Clin Microbiol Rev. 2009;22(1):136-9.\\u003c/li\\u003e\\n\\u003cli\\u003eManchanda V, Sood S, Singh NP. Multidrug-resistant Acinetobacter. J Glob Infect Dis. 2010;2(3):291-304.\\u003c/li\\u003e\\n\\u003cli\\u003eWoodford N, Ellington MJ. The emergence of antibiotic resistance by mutation. Clin Microbiol Infect. 2007;13(1):5-8.\\u003c/li\\u003e\\n\\u003cli\\u003eCorbella X, Montero A, Pujol M, Dom\\u0026iacute;nguez MA, Ayats J, Argerich MJ, et al. Emergence and rapid spread of carbapenem resistance during a large and sustained hospital outbreak of multiresistant Acinetobacter baumannii. J Clin Microbiol. 2000;38(11):4086-95.\\u003c/li\\u003e\\n\\u003cli\\u003eLi Y, Sun J, Li S, Huang J. ERIC-PCR typing and antimicrobial resistance analysis of Acinetobacter baumannii clinical isolates from hospital settings. J Clin Microbiol. 2018;56(3)\\u003c/li\\u003e\\n\\u003cli\\u003ePeleg AY, Seifert H, Paterson DL. \\u003cem\\u003eAcinetobacter baumannii\\u003c/em\\u003e: emergence of a successful pathogen. Clin Microbiol Rev. 2018;21(3):538-82.\\u003c/li\\u003e\\n\\u003cli\\u003eHasani A, Rezaee MA, Baradaran B, Kafil HS, Abbaszadeh F. Expression of efflux pumps, porins and genotypic insight into the carbapenem resistance in \\u003cem\\u003eAcinetobacter baumannii.\\u003c/em\\u003e 2021.\\u003c/li\\u003e\\n\\u003cli\\u003eSoliman DE, Amer HS, Lotfy NM, Abdel-Mageed W, Mo\\u0026apos;men SA. Molecular characterization and evaluation of the antimicrobial activity of phenoloxidase purified from Spodoptera littoralis against a different array of pathogenic bacteria. Egyptian Acad J Biol Sci C Physiol Mol Biol. 2022;14(2):153-62.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[{\"identity\":\"7a3b92c9-5f80-48a7-a4e3-6cc675346b3c\",\"identifier\":\"10.13039/501100013691\",\"name\":\"NÖ Forschungs- und Bildungsges.m.b.H.\",\"awardNumber\":\"ALYA\",\"order_by\":0}],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"University of Babylon\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Acinetobacter baumannii, adeJ, OprD, OMP33-36, rpoB, RT-q PCR\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-5848743/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-5848743/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cstrong\\u003eBackground\\u003c/strong\\u003e: The adeJ, Omp33-36, and oprD are vital genes for the resistance of \\u003cem\\u003eAcinetobacter baumannii.\\u003c/em\\u003e , by regulating the permeability of the membrane and carbapenem resistance in the clinical isolates.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eObjective\\u003c/strong\\u003e: To detect the adeJ, Omp33-36, and oprD, on the way to antibiotic resistance, that could developbetter treatment for \\u003cem\\u003eA. baumannii\\u003c/em\\u003e infections.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMaterial and Methods: \\u003c/strong\\u003eThe study was based on 300 clinical specimens that were collected from Al-Hilla Teaching Hospital from January–to June 2024. The specimen types taken were wounds (40%), Burns 40% Blood 12% and Urine 8%. They were grown on blood agars, identified as \\u003cem\\u003eAcinetobacter baumannii\\u003c/em\\u003e (8.33%) by Epi-20E. PCR was done to detect the presence of \\u003cem\\u003eblaoxa-51\\u003c/em\\u003e and genes (adeJ, Omp33-36, and oprD, ), while gene expression by RT-qPCR. PCR-ERIC facilitated the differentiation of the strains due to the different bands produced.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eResults and Discussion:\\u003c/strong\\u003e\\u003cem\\u003e \\u003c/em\\u003eMultidrug resistance to antibiotics was observed among isolates and high resistance was observed against, β-lactams, carbapenems, and aminoglycosides with colistin being effective. All isolates were adej positive Overexpression of OperD (80%) and adej (44%) was observed, with consistent downregulation of the Omp33-36 gene (100%).The result of PCR-ERIC, Group A: Thus, isolates 7, 9, 10, 17, 5, 8,6, 11, 12, 2, 4, and 19 for Group A; 18 for Group B; 3 for Group C; 1 and 13 for Group D; and 20, 21, 22, 14, and 15 for Group E revealed 3 bands.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConclusion:\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe role of adeJ and OprD in resistance to \\u003cem\\u003eA. baumannii,\\u003c/em\\u003e via decreased accumulation of drugs and increased expulsion and modification of Omp33-36 in all isolates indicates the contribution of this gene to membrane permeability and Antibiotics resistance. The RT-PCR ERIC signifies that for variation in the Banding patterns of the different isolates; these may be differential expression profiles of the strains.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Multidrug Resistance Patterns, Gene Overexpression, and Genetic Diversity of Acinetobacter baumannii Isolates from Clinical Specimens\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-01-20 09:21:02\",\"doi\":\"10.21203/rs.3.rs-5848743/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"4c7fe8b9-f0ef-4f96-a2e0-0399a585799c\",\"owner\":[],\"postedDate\":\"January 20th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":43019615,\"name\":\"Structural Biology\"}],\"tags\":[],\"updatedAt\":\"2025-01-20T09:21:02+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-01-20 09:21:02\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-5848743\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-5848743\",\"identity\":\"rs-5848743\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}