{"paper_id":"0e6779ab-8ea3-49e0-851a-d60541069ef2","body_text":"Identification and pathogenicity of Raoultella and Pseudomonas species associated with roots of Taraxacum kok-saghyz | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Identification and pathogenicity of Raoultella and Pseudomonas species associated with roots of Taraxacum kok-saghyz Levon Martirosyan, Valentina Martirosyan, Yuriy Rybakov, Alexander Amerik, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7867960/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 6 You are reading this latest preprint version Abstract Natural rubber (NR) is a critical raw material essential for the production of thousands different rubber and latex products. In most cases, it cannot be replaced by synthetic rubber alternatives. At the present time, NR is produced solely from a single species, Hevea brasiliensis , which is grown in tropical regions. Several important reasons including the danger that South American Leaf Blight disease might spread to Southeast Asia stimulate the search for alternative rubber producers. One of them, Taraxacum kok-saghyz , attracts particular attention. In this study, performed in an aeroponic phytotron, as well as in vitro culture, we identified two bacteria associated with root rot of the NR-producing plant T. kok-saghyz - Pseudomonas putida and Raoultella terrigena . According to the literature, interaction of these bacteria with plants is described as symbiosis. However, our data suggest that under certain conditions well-characterized endophytic bacteria can act as pathogens. We showed that plants, cured of phytopathogens, demonstrate fast growth rates, even in at high summer daytime temperatures. T. kok-saghyz continued to grow (defoliation did not occur) and to build up a biomass, which may lead to an increase in the accumulation of NR and inulin in the roots. Our research demonstrates that aeroponic cultivation is a promising way to grow T. kok-saghyz , for production of NR and inulin. In this study we show that plant-associated microorganisms are an important factor influencing plant responses to changes in cultivation conditions. Taraxacum kok-saghyz natural rubber phytotron root rot disease endophytes Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Fundamental study of physiological and biochemical mechanisms underlying the functioning of biological systems is the basis of modern biotechnology. Today, controlled biosynthesis provides production of many target products (substances for pharmacological preparations, human and animal nutrition components, enzymes, fuels etc.) with the necessary quantitative and qualitative properties. New methods for production of natural rubber (NR) from alternative sources are also a strategically important goal of biotechnological community. NR is a critical raw material essential for the production of more than 50,000 different rubber and latex products. In most cases, it cannot be replaced by synthetic rubber alternatives (Cherian et al., 2019 ). It possesses unique properties such as elasticity, resiliency, shock resistance, effective heat dispersion, and ability to maintain plasticity at low temperature (Eng & Ong, 2000 ; McIntyre et al., 2000 ; Puskas, 2001 ; Gronover et al., 2011 ). NR is an isoprenoid because its basic backbone structure composed exclusively of 1,4-polymers of the isoprene unit (C 5 H 8 ) with a cis -double bond (Tanaka, 2001 ; Yamashita & Takahashi, 2020 ). More than 2500 plant species produce NR (Cornish, 2001 ); however, only few of them are able to synthesize a high-quality NR with molecular mass about 10 6 Da (Mooibroek & Cornish, 2000 ; van Beilen & Poirier, 2007a b ). At the present time natural rubber is produced solely from a single species, the rubber tree ( Hevea brasiliensis ), which is grown as genetically similar clones in tropical regions. According to forecasts by the Association of Natural Rubber Producing Countries (ANRPC), total NR consumption is expected to reach 16.7 million tons by 2026 ( https://www.reportlinker.com/dataset/228401ad9f7e5cafa9fcca28f25d7f286b8dba1a ), and there is no doubt that demand will continue to increase. Therefore, it cannot be ruled out that humanity will face a shortage of NR in near future. Moreover, even regardless of growing demands, NR production from H. brasiliensis is at risk, because only a very few closely related clones were used to establish the NR plantations (Cornish, 2017 ). Thus, a lack of genetic diversity puts hundreds of thousands of hectares of plantations in danger. Indeed, genetically almost identical trees are exposed to numerous phytopathogenic infections, including fungal South American Leaf Blight (SALB), caused by Microcyclus (Pseudocercospora) ulei (Guyot et al., 2008 ; Guyot & Guen, 2018 ). This disease is lethal for H. brasiliensis. It prevented NR production in Brazil, the country of origin of this species. Currently, the work on developing SALB-resistant plants is in progress, but it will take at least 25 years to introduce high NR yielding, SALB resistant trees (Cornish, 2017 ). Also, it should be noted that Hevea latex products cause severe allergic reactions because of proteins naturally associated with the rubber particles (Siler et al., 1996 ; Bousquet et al., 2006 ). Therefore, biodiversification of the NR sources is an essential goal that attracts increasing attention from scientific community. Several rubber-producing species are under development to find a reliable alternative source of NR. These are Rubber dandelion ( Taraxacum kok-sagyz ) (Arias et al., 2016 ), Guayule ( Parthenium argentatum ) (Rousset et al., 2021 ), and undeservedly forgotten Tau-saghyz ( Scorzonera tau-saghyz ) (Buranov & Elmuradov, 2010 ). One of them, T. kok-saghyz , fits to obvious requirement to effective NR producer better than others. It has a very short life-cycle (6–8 months) relative to other plants, such as H. brasiliensis , and is amenable to genetic manipulations. Moreover, its rubber phenotype can be meaningfully analyzed after only ten weeks of cultivation (Amerik et al., 2018 ; Amerik et al., 2021 ). Remarkably, the agricultural ranges of T. kok-saghyz covers most of the regions of the world, and the plant shows little dependence on the climatic conditions of the growing zone. So, it was logical to further investigate this crop in order to make it more attractive for commercial cultivation (Cornish, 2017 ). Numerous studies on the physical and chemical properties of the dandelion NR clearly demonstrated that it has an outstanding quality. For instance, tiers, made from the T. kok-saghyz NR are as resilient as those made from H. brasiliensis polymer (Araujo-Morera et al., 2021 ). Notably, molecular mass of dandelion NR is very high. It was reported that it can be as high as 2.2 x 10 6 Da (Mooibroek & Cornish, 2000 ; Hallahan & Keiper-Hrynko, 2004 ; Cornish, 2017 ). The only potential problem is a large number of associated proteins, similarly to Hevea NR (van Beilen & Poirier, 2007a ). Therefore, people who are sensitized to H. brasiliensis NR, may also develop an allergic reaction to T. kok-saghyz NR (Siler et al., 1996 ; Bousquet et al., 2006 ). Thus, NR from dandelion should not be used in medical industry. It should be considered for conventional dry rubber application such as tire production ( https://www.continental.com/en/press/press-releases/20220927-forschungsnetzwerk-neuer-zuechter ). The principal tasks of improving the characteristics of this potential alternative source of NR are as follows: acceleration growth and development of plants, formation of a large root biomass, increasing the content of target products, and selection of forms resistant to phytopathogens. To date, industrial cultivation of T. kok-saghyz in the field is complicated by the low productivity of plants, even under protected ground conditions, high vulnerability to bacterial and fungal pathogens, and the necessity to create special technologies for collecting and processing rubber-containing roots. Development of methods for the selective destruction of weeds is also a difficult task. Other complications include the danger of over-pollination, uneven germination of seeds, high sensitivity of plants to fluctuations in weather conditions, etc. The time frame is also important. In the field conditions, T. kok-saghyz is cultivated for 2 years. The development of a new technology for growing T. kok-saghyz plants under controlled phytotron conditions (Fig. 1 ) would speed up the solution of many of these problems. The use of the aeroponic cultivation method with optimization of all factors affecting the rate of plant growth and development may lead to improvement of the biosynthesis of target products. Potentially, this approach has obvious commercial prospects. As noted above, among several factors limiting NR production from Hevea fungal disease SALB is the most prominent one because it has a devastating impact on NR production (Guyot et al., 2008 ; Guyot & Guen, 2018 ). SALB wiped out the large-scale H. brasiliensis plantations in Brazil and it has not been possible to restart production since that catastrophe. The present production of NR in Brazil is the marginal 1% of world production. Accidental spread of SALB to Southeast Asia would have a severe impact on the NR industry including reduction of production by millions of tons, serious shortage, and, as a result, to drastically higher prices (Cornish, 2017 ). Unfortunately, similar problems arose during the adaptation of T. kok-saghyz plants to the conditions of aeroponic cultivation. Plants grew normally for 60–70 days of cultivation. Then many specimens showed signs of vascular bacteriosis (withering). Darkening and maceration were observed in plants in the root area, and, finally, roots fell off the shoots (Fig. 2 ). It was assumed that this was happening due to increased humidity in the root zone in a phytotron. However, other processes also might be involved including intensification of plant cultivation. It is also likely that latent infection was present initially in seeds, then in plants grown from them. This led to the infected root culture of T. kok-saghyz . Remarkably, the \"hairy roots\" (HR) cultures after some time of cultivation showed clear signs of vascular bacteriosis (Fig. 3 ). Here we describe isolation of pathogens from infected plants, their identification and biochemical characterization. We also discuss the results of our studies demonstrating the influence of plant growth conditions ( in vitro , in a phytotron and in soil) on interaction of endophytic microorganisms with host plants. Materials and Methods Plants used in this study To perform this study, a collection of T. kok-saghyz plants consisting of various population samples was created in the laboratory. Seeds and plants were received from the Vavilov Institute of Plant Genetic Resources (Saint Petersburg, Russian Federation) and from the Institute of Plant Biology and Biotechnology (Almaty, Republic of Kazakhstan). From this collection, highly productive plants with a high content of NR and inulin (the second valuable product that increases commercial value of T. kok-saghyz ) were selected. Subsequently, with the help of chemotherapy and thermotherapy of seeds (Grondeau et al., 1994 ; Sanna et al., 2022 ), we created a collection of T. kok-saghyz plants cured of phytopathogens in vitro (Fig. 4 ). These plants were subsequently used to obtain a culture of transformed roots and as a planting material for adaptation and cultivation in an aeroponic phytotrons. Manifestations of bacterial infection obviously depended on the quality of asepticization of plant explants. However, as subsequent experiments demonstrated, neither effective asepticization of plant explants nor compliance with aseptic rules guaranteed the absence of bacterial infections in in vitro cultures. Root rot appeared in all variants of cultivation of T. kok-saghyz plants - under in vitro conditions, in an aeroponic phytotron, in a culture of HR, as well as when in soil grown plants. Growing plants in an aeroponic phytotron As noted, for controlled growing of plants, automatic devices (phytotrons) have been developed (Fig. 1 ). Remarkably, several critical parameters including temperature, composition of the gas environment with adjustable CO 2 concentration, spectral composition and intensity of the light flux are under strict control in phytotrons (Martirosyan et al., 2023 ). The major principle of the aeroponic cultivation is to provide plants with mineral components without use of soil or soil substitutes. Thus, growing plants in artificial climatic conditions leads to the creation of the most favorable environment for their growth and development (Martirosyan et al., 2020 ; Martirosyan et al., 2023 ). T. kok-saghyz plants, grown from treated seeds in vitro in the phase of 3–4 true leaves (days19-20), were adapted and planted in aeroponic phytotrons. Plants received mineral nutrition components by finely dispersed spraying a nutrient solution directly into the root system zone, balanced in composition for each phase of T. kok-saghyz growth. In a phytotron, plants reached full size and high NR content (up to 7–10%), in about 120 days of vegetation period (Martirosyan et al., 2023 ). Creation of the root culture with the HR phenotype and T. kok-saghyz composite plants It was important to investigate whether the biosynthesis rate and concentration of NR and inulin would increase with increasing root biomass. For this purpose, we transformed the T. kok-saghyz root culture with bacterium Agrobacterium rhizogenes (strain R1000). This led to the so-called HR phenotype. The culture of transformed roots is a convenient system that is often used for studying the metabolic processes of plants (Thwe et al., 2016 ; Khazaei et al., 2019 ). The resulting root cultures will be examined for NR and inulin content. Subsequently, these cultures were used for obtaining the composite plants. Specifically, roots had a pronounced HR phenotype, while the aerial parts looked like the original wild-type plants. Vegetative growth of plants and manifestation of pathogenesis In the process of curing T. kok-saghyz of the internal infection that affected the root system, two types of bacteria were initially isolated (below). Subsequently, the infectivity of the resultant bacterial cultures was analyzed. T. kok-saghyz roots were treated with the bacteria, and pronounced symptoms of bacteriosis were observed. The symptoms were identical to those initially observed in growing T. kok-saghyz plants under aeroponic conditions, as well as in vitro . Remarkably, the same pattern of damage was seen during vegetation experiments in soil mixture (peat, sand and soil, 2:1:1). To avoid the influence of other microorganisms on growth processes the soil was pre-autoclaved twice. Plants were grown outdoors in natural climatic conditions of Moscow region for 180 days, from May to October (Table 1). Plants were divided into 3groups: 1 control and 2 experimental. Each group consisted of 10 vegetation vessels with plants. Experiments were repeated three times. Thus, 90 vessels were analyzed. Specifically: 1st group. Control, intact plants in vitro . Grown from seeds that have undergone thermotherapy and chemotherapy, without bacterial infection. 2nd group. Intact plants grown from seeds that have undergone chemotherapy and thermotherapy, infected with isolated bacteria during the vegetation season. 3rd group. Intact plants grown from seeds that have not undergone chemotherapy and thermotherapy, infected with isolated bacteria during the vegetation season. Bacterial cultures isolated as described below were grown in a rich liquid nutrient medium. (g/l: peptone 10; yeast extract 5; NaCl 10). Cultures were incubated for 72 hours on an orbital shaker, 200 rpm, 28°C. For inoculation, plants, before the onset of the budding phase, were watered with a diluted (1:20) suspension of bacteria (approximately 100 ml per plant). Isolation of the pathogenic microorganisms Isolation of bacterial cells was carried out as follows. Infected plants were washed with sterile water and dried in air. Next, at the junction of the root collar with the caudex, where the symptoms of necrosis were most pronounced, transverse sections (3–5 mm thick) were made with a sterile scalpel. For surface asepticization, fragments of T. kok-saghyz infected roots were placed in sterile 100 ml conical flasks containing 50 ml 70% ethanol. Flasks were shaken on a rotary shaker for 120 sec. To remove residual ethanol, the plant material was washed 5 times with sterile distilled water. Then, the root fragments were transferred to sterile flasks containing 50 ml 5% sodium hypochlorite (NaClO), for 60 s. To remove residual NaClO, the plant material was washed 10 times with sterile distilled water. Finally, the plant material was placed into the 50 ml 6% H 2 O 2 solution for 60 sec. To remove H 2 O 2 the root fragments were where washed 5 times with 100 ml sterile H 2 O. The surface asepticization procedure was done in a laminar flow hood. Approximately 100 mg of treated roots of each sample were cut into small pieces and placed in sterile 2 ml microtubes containing sterile stainless-steel balls, (5mm diameter), for further homogenization in TissueLyser LT (Qiagen). Next, the roots, crushed into a pulp, were centrifuged (1 min, 2500g) and 1 ml of the supernatants was transferred into sterile 15 ml tubes, then 10 ml of sterile distilled water was added. The tubes were hermetically sealed and placed on a rotary shaker (150 rpm) at 25°C for 2 h. 100 µl of each sample was plated in triplicate onto Petri dishes with LB medium and incubated at 28°C for 120 hours. Colonies were selected from each plate based on their color, texture, and morphology. To evaluate the effectiveness of surface sterilization, 100 µl of liquid after the last wash (for each analyzed sample) was plated on Luria nutrient agar. Biochemical identification of the plant pathogens (Ksz-1, Ksz-2) For identification of isolated bacterial cultures, named Ksz-1 and Ksz-2, biochemical approaches were employed. The API 20 NE (Biomerieux, France) system facilitates identification of non-fastidious Gram-negative rod bacteria not belonging to the Enterobacteriaceae . The API 20 NE strip consists of microtubes containing dehydrated media and substrates. The media microtubes containing conventional tests were inoculated with a bacterial suspension which reconstituted the media. After incubation, the metabolic end products were detected by indicator systems or addition of reagents. The substrate microtubes contained assimilation tests and were inoculated with a minimal medium. If bacteria were capable of utilizing the corresponding substrate, then they would grow. Briefly, 5ml of distilled water was added to the honeycombed wells of the tray of an incubation box to create a humid atmosphere. Then API 20 NE strip was placed in the box. 1–4 colonies of identical morphology were resuspended in 2ml of API 0.85% saline in a sterile test tube. All tests (GLU, ADH, URE, ESC, GEL, PNPG, NO3, TRP etc.) were performed as described in the manufacturer’s manual. The APIWEB™ software was employed for identification of the organisms. API 10 S (Biomerieux, France) is a qualitative standardized system intended of identification of Enterobacteriaceae and other Gram-negative rod bacteria. The protocol API 10 S is very similar to the protocol described above. All tests were done according to the manufacturer’s manual. Molecular-biological identification of the T. kok-saghyz pathogens, PCR and sequencing For the preliminary identification of the bacterial species PCR amplification and sequencing of the variable 16S rDNA (Yamamoto & Harayama, 1998 ) region of Ksz-1 and Ksz-2 were performed using conservative primers 8f – agagtttgatcctggctcag and 926r – ccgtcaattcctttagagttt. The amplification was conducted as follows: denaturation at 95 o C for 3 min followed by 35 cycles of 95 o C for 30 s, annealing at 57 o C for 30 s, and extension at 72 o C for 1 min 30 s; with a final extension at 72 o C for 5 min. Partial nucleotide sequences of the 16S rRNA genes were determined directly from the PCR fragments according to the method of Edwards (Edwards et al., 1989 ). For further characterization of the Pseudomonas species (Ksz-1), PCR amplification of the gyr B and rpo D variable gene fragments (Yamamoto & Harayama, 1998 ; Yamamoto et al., 2000 ). was performed using conservative pairs of primers ggagcagtacatcaaggacga/ gggtccatggtggtttcccacA and cctccgaaggtggccgtctgtc/ ACATGCGCAGGAAGTCGGCACG for gyr B and rpo D respectively. gyrB encodes subunit B of DNA gyrase, rpoD – sigma factor of RNA polymerase. The amplification was conducted as described above. Amplified DNA fragments were gel purified using QIAquick Gel Extraction Kit (Qiagen) and cloned into pAL2-T plasmid (Eurogen). Nucleotide sequences of the cloned DNAs were determined using plasmid specific SP6 – ATTTAGGTGACACTATAGAATACT and T7 – GTAATACGACTCACTATAGGG primers. Identification of the Raoultella species (Ksz-2) was conducted similarly. The BLASTn software was employed to compare determined sequences to GenBank. Inoculation of a culture of isolated HR and plants in vitro with bacteria isolated from the roots of T. kok-saghyz An inoculation media was prepared from bacteria grown on Petri dishes with LB media for 24 hours. Bacteria were resuspended in 10 mM MgCl 2 , Silwet L-77 was added at a final concentration of 200 mkl l − 1 . OD 600 of inoculation media was 0.05 (approximately 2.5 × 10 7 colony forming units per ml (CFU ml − 1 ). The fragments of healthy HR and in vitro intact plants were placed in 100 ml conical flasks containing 50 ml of inoculation media. Flasks were placed in a vacuum chamber and vacuuming was carried out at 0.8 atm for 120 sec. Next, HR cultures and plants were washed three times with 100 ml sterile distilled water. Washed HR-infected cultures were placed on Petri dishes, and plants were placed in phytocontainers on agar with minimal MS medium (Murashige-Skoog), which does not contain carbohydrates. So, the only source of carbon was the roots of T. kok-saghyz . Incubation of the dishes was carried out at 28 ºС for 10 days, phytocontainers - for 3 days. Number of repetitions − 10. Then the dishes were placed on light racks (light intensity of 100 µmol/m2s) for 25 days. Phytocontainers were placed on light racks for 32 days. The development of symptoms of bacteriosis (darkening) of the roots were monitored. Dishes with uninfected HR roots on MS medium and with bacterial cultures on carbohydrate-free MS medium were used as a control. Phytocontainers with healthy plants of an appropriate age in complete MS medium served as another control. Results Molecular biological and biochemical identification of the T. kok-saghyz pathogens As noted, cultures designated as Kcz-1 and Kcz-2 were isolated from microbiota of infected roots. They were grown on L-agar and minimal medium with pectin, respectively. Remarkably, Gram staining showed that these bacteria are gram-negative (Fig. S1 ) PCR-amplification and sequence analysis (comparison to GenBank database) of the variable fragments of 16S rDNA revealed that Ksz-1 belongs to the systematic groups: Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales; Pseudomonadaceae; Pseudomonas. Five species of Pseudomonas show highest levels of identity to the 16S rDNA Ksz-1 fragment. These species are: Pseudomonas putida , Pseudomonas plecoglossicida , Pseudomonas taiwanensis , Pseudomonas monteilii , and Pseudomonas fluorescens. Similarly, the 16S rDNA sequence of Ksz-2 was also compared to the GenBank database. It was shown that Ksz-2 belongs to the systematic groups: Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Entrobacteriaceae; Klebsiella/Raoultella group; Raoultella . Sequence analysis suggested that Ksz-2 is likely Raoultella terrigena , Raoultella ornithinolytica , or Klebsiella aerogenes . These bacteria are differed slightly in their gene sequences. So, identification of Ksz-1 and Ksz-2 is difficult at the 16S rDNA level. In an attempt to identify bacterial species, we relied on biochemical testing as the types of biochemical reactions of each organism act as a thumbprint for its identification (Brenner et al., 2005 ). We used API 20 NE and API 10 S tests for biochemical strain characterization (Tables S1, S2). Kcz-1 demonstrated close similarity to the P. putida species (the ability to grow on mannitol, maltose, mannose and acetylglucosamine as the only carbon sources), but, on the other hand, unlike P. putida , Kcz-1 produced indole from tryptophan, lacked arginine dihydrolase activity, and assimilated arabinose. Several features of Ksz-2, such as absence of gelatinase activity, indole formation during growth on a medium containing tryptophan, absence of the urease activity and high ornithine decarboxylase activity, as well as the ability to grow at 10°C and at 41°C suggest that this species is R. terrigena . However, it was reported that all species of Raoultella , lacked pectinase activity (Hansen et al., 2004 ; Sekowska, 2019 ), while corresponding activity of the Kcz-2 strain was relatively high. Interestingly, the Ksz-2 strain grew equally efficiently on media containing apple and citrus pectin and on a medium with polygalacturonic acid as the sole carbon source. By contrast, the Kcz-1 strain was capable of growing only on the last indicated medium (data not shown). Perhaps, this isolate lacks the esterases pectin methylesterase and pectin acetylesterase, suggesting that it lacks pectin esterase activity. Thus, biochemical approaches, as well as analysis of the 16S rDNA sequences failed to identify T. kok-saghyz pathogenic species. To distinguish between these species, we PCR-amplified and sequenced fragments of the gyrB and rpoD genes that have been successfully used for analysis of the Pseudomonas spp (Yamamoto & Harayama, 1998 ; Yamamoto et al., 2000 ). Comparison to the GeneBank database convincingly demonstrated that Ksz-1 is P. putida (Kivisaar, 2020 ) (99.79% and 98.79% of identity for gyrB and rpoD fragments respectively). Sequences of the P. putida gyrB and rpoD genes are available in the GenBank database (accession numbers CP046872 and LR135071). Primers, corresponding to the conserved regions of the P. putida gyrB gene, were successfully used for amplification of the Ksz-2 fragment. The identity level of this fragment to the R. terrigena gyrB gene was 99.07%. Interestingly, rpoD primers have failed to amplify the R. terrigena gene, but non-specific PCR have led to amplification of the era gene encoding GTP-binding protein (March, 1992 ). A very high identity level of the Ksz-2 era gene (99.53%), combined with the gyrB data, clearly demonstrate that Ksz-2 is R. terrigena (Appel et al., 2021 ). Sequences of the R. terrigena gyrB and era genes are available in the GenBank data base (accession numbers LR134253.1 and LR13127.1). The influence of the environment on the development of pathogenesis in T. kok-saghyz Vascular bacteriosis of roots of T. kok-saghyz cultivated by plantation methods was previously described (below). We performed similar experiments in Moscow region (moderate climate, Table 1). At the beginning of the vegetation season, the plants developed evenly and bloomed profusely, and seeds were set. In the beginning of May, the weather was moderate, the average daily air temperature ranged from + 15 ºС to 21ºС. The plants from all three groups developed evenly, without signs of bacterial infection, and basically all specimens bloomed vigorously. In June-July, daytime temperatures rose to 30 ºС, and on certain days up to 33°С. A pronounced period of high daytime air temperatures lasted 8–10 days. Those plants that were grown from cured material in vitro (group 1) were not affected by heat and continued to actively grow and develop (Fig. 5 ). In experimental groups, the plants gradually began to wither, and eventually the leaves dried out and fell off (Fig. 6 , 7 ). After the onset of moderate daytime temperatures favorable for the growth of T. kok-saghyz (15–20ºС), plants from the experimental group 2 began to recover new, green leaves grew without signs of bacterial infection. In the group 3, plants initially showed signs of recovery, but both bacterial isolates caused extensive damage to above-ground tissue, resulting in plant death approximately 47–50 days after inoculation (not shown). Thus, bacterial infection affects resistance of T. kok-saghyz to elevated temperature. P. putida and R. terrigena are causative agents of T. kok-saghyz root rot The pathogenicity of P. putida and R. terrigena was tested on a culture of isolated T. kok-saghyz roots with the HR phenotype and on plants in vitro . Both of bacteria were introduced into T. kok-saghys HR cultures and plants in vitro by vacuum infiltration. This led to characteristic disease-like symptoms such as black necrotic areas initially at the root tips. Remarkably, after 30 days of growth the root biomass became completely brown (Fig. 8 ). Plants infected with P. putida and R. terrigena in vitro showed gradually increasing symptoms of infection. Initially infection affected roots and fully developed leaves located at the base of the plant (in 6–7 days after inoculation. Then infection started to spread to the upper part of the plant in approximately 14 days after inoculation. Finally, in 35 days after introduction of bacteria into T. kok-saghyz tissue, plant died. The severity of disease symptoms did not change in plants with cut root tips compared to uncut roots, even though bacterial plant pathogens typically require a wound or natural opening to enter the tissue. In addition to in vitro studies, we tested the ability of isolates to infect soil-grown T. kok-saghyz plants in growing vessels. Both bacterial isolates caused extensive damage to above-ground part of the plants, resulting in plant death in approximately 37–40 days after penetration of inoculates into the soil, immediately surrounding the root system. Both bacterial isolates also caused plant death when penetrating into the leaves (data not shown). Discussion As noted in the introduction, ontrolled biosynthesis provides unique opportunity to obtain target products with the necessary quantitative and qualitative characteristics. However, the results, in addition to establishing the optimal parameters of the bioprocess, critically depend on the properties of the starting biological material. During in vitro cultivation of plants, the long-term and asymptomatic presence of endophytic bacteria is due to the suppression of their growth by factors that influence the processes of cultivation of plant explants (low temperature and light intensity, the presence of immune activators, antibiotics and other plant protection chemicals in the culture media). On the other hand, plants generate a sufficient amount of root exudates to support bacterial growth and activity. Bacteria associated with plant tissues in in vitro culture play an important role in various physiological and pathogenetic processes. Their identification helps to understand how these microorganisms affect plant growth and development, disease resistance and productivity (Trivedi et al., 2020 ). In this study, performed in an aeroponic phytotron, as well as in vitro culture of plants and HR, we identified two bacteria associated with root rot of the NR-producing plant T. kok-saghyz - P. putida and R. terrigena . We also investigated their pathogenicity. Remarkably, the relationships between these bacterial species and other plant species have been described in the literature (Kivisaar, 2020 ; Mengistu, 2020 ; Martínez-García & de Lorenzo, 2024). It is noteworthy that several studies demonstrated that P. putida species are involved a wide range of processes, ranging from plant growth stimulation and bioremediation to pathogenicity (Kivisaar, 2020 ). It was also shown that some endophytic strains of P. putida and R. terrigena have the ability to stimulate plant growth in a natural ecosystem (Costa-Gutierrez et al., 2022 ; Zakharchenko et al., 2024 ). Interestingly, three strains of P. putida , were characterized in a gnotobiotic system, with a specific microbial community. A clear inhibitory effect on pea growth under different environmental conditions was demonstrated. Moreover, these strains affected the root morphology, which led to a decrease in root biomass (Berggren et al., 2001 ). It is also important to note that some bacterial isolates previously identified as growth promoters may have detrimental effects on plant growth if the titer is too high (Glick et al., 1998 ; Reed & Glick, 2005 ; Premachandra et al., 2016 ). Interaction of the bacteria P. putida and R. terrigena with plants is usually described as symbiosis (Hardoim et al., 2015 ). However, our data suggest that under certain conditions well-characterized endophytic bacteria can act as pathogens. To prove that, in fact, the two bacterial species we isolated can be pathogens of T. kok-saghyz , we used them to infect HR cultures and reinfect in vitro plants of T. kok-saghyz that had previously have been cured of these bacteria. The high adaptability of P. putida is based on many features, including high genetic plasticity and broad metabolic, transport, signaling and regulatory capabilities (Nikel & de Lorenzo, 2018 ). Interestingly, Pseudomonas species can use various chemical compounds, simple and complex, as the only source of carbon depending on their living conditions (Song et al., 2015 ). Thus, P. putida strain mt-2 isolated from soil in Japan is able to grow on meta-toluate as the sole carbon source (Vercellone-Smith & Herson, 1997 ) . Sequencing of its genome has shown that it contains multiple genes encoding proteins responsible for degradation of plant-derived chemicals, including various methoxylated aromatic acids, hydroxylated aromatic acids, and other compounds (Castillo et al., 2008 ). Remarkably, genome also contains genes encoding proteins responsible for degradation of fructose (Velazquez et al., 2004 ) and glucose (Castillo et al., 2008 ), which are the most common sugars present in plant root exudates (Kamilova et al., 2006 ). Some diseases of T. kok-saghyz cultivated by plantation methods were previously described. These diseases are typically caused by soil bacteria, fungi, and oomycetes that penetrate roots and enter xylem, where they interfere with the transport of water and minerals. Among them, vascular bacteriosis of roots. The causative agent of the disease is a bacterium Pseudomonas campestris (Tscheremissinov, 1951 ). Seedlings and young plants die. The disease is more common in soils with a very high humidity. Diseased plants appear wilted in the second half of the day. Yellowing or browning of the central cylinder is clearly visible. As a result, leaves wither and die. This can lead to damage to the entire plant and ultimately to the plant death (Tscheremissinov, 1951 ). Similar changes can be caused by increased temperature and drought, and together they affect the composition, abundance or activity of microbial communities associated with plants. It should be noted that similar symptoms can appear in plants despite the presence of sufficient water in the soil, which the plant cannot absorb (Martirosyan L. et al., personal communication). We observed similar phenomena during vegetation experiments (above). The summer drought caused the T. kok-saghyz plants to shed leaves and flower buds. This phenomenon was called “summer dormancy” (Scarth et al., 1947 ). Originally it was assumed that the reason was adverse conditions such as drought. However, currently “summer dormancy” is defined as an intrinsic trait independent of environmental conditions (Volaire & Norton, 2006 ). Conceivably, the reason of summer dormancy is a consortium of bacteria and their antagonism towards the host plant. We assume that some of endophytic bacteria, upon the onset of unfavorable conditions for them, synthesize plant growth inhibitors, in particular, abscisic acid, which triggers plant defense mechanisms from drought (Chen et al., 2020 ). When such mechanisms are launched, additional watering does not lead to an improvement in the condition of the plants, but on contrary, some bacteria from the consortium are activated, and destruction of plant tissue occurs, primarily in the area where the roots join the caudex. Obviously, optimal growth conditions are not reachable in most environments and, therefore, plants exposed to numerous abiotic and biotic stresses are prone to diseases. For example, an auxin-secreting strain of P. putida negatively affects the tolerance of Arabidopsis thaliana to water stress, while promoting plant growth under normal watered conditions. Plants subjected to water stress and simultaneously inoculated with P. putida showed signs of wilting and decreased moisture content compared to plants subjected to water stress without inoculation. Certainly, the severity of the reaction depended on the amount of inoculum (Shah et al., 2017 ). It has been demonstrated that environmental factors are key components influencing the development of plant diseases (Keane & Kerr, 1997 ; Brader et al., 2017 ). These include temperature, precipitation (i.e., dew, rainfall, and snow) intensity and duration, wind, and aerial pollution (including CO 2 and ozone content). Soil parameters such as organic compound, pH, nutrient content, and content of toxic components (e.g., metals, salt, and pesticides) are also critical (Brader et al., 2017 ). Moreover, quantity and quality of light required for plant immunity (Hua, 2013 ). Interestingly, temperature stress signal pathways overlap with multiple pathways responsible for the expression of disease-resistance proteins and defense mechanisms against fungi, nematodes, and viruses (Hua, 2013 ). Also, resistance to pathogen attack can be enhanced by ozone and UV stresses. This phenomenon is called cross-tolerance (Bowler & Fluhr, 2000 ). Noteworthy, humidity plays a pivotal role in disease development (Gent at al., 2013; Giauque & Hawkes, 2013 ) . Biotic factors also play an important role in infection process. The most crucial is certainly microbiota containing endophytes and microbes of rhizosphere (Mortier et al., 2012 Brader et al., 2017 ). In the natural environment, bacteria face a variety of stress conditions, such as carbon starvation, suboptimal nutrient balance (e.g., lack of N or P sources), changes in hydration conditions, desiccation, lack of suitable terminal electron acceptors, and suboptimal pH and temperature (Ramos et al., 2015 ). Thus, suggestion that environment plays a key role in pathogenicity led to numerous models that shed light on the mechanistic insides of plant diseases (Garrett et al., 2022 ; Juroszek et al., 2022 ). The influence of climatic factors, including increases in temperature and CO 2 levels, and extreme fluctuations in humidity levels, on the interaction of plants and microorganisms is actively being studied (Juroszek & Von Tiedemann, 2011 ; Velasquez et al., 2018 ). As noted, in most cases, under these conditions, endophytic microorganisms have a beneficial effect on plants. However, endophytic microorganisms associated with plants react to some environmental changes in a very unique way. Specifically, catabolic processes are activated. This stimulates pathogenesis in the plant-microorganism relationship (Tanaka et al., 2006 ; Eaton et al, 2011 ). Overall, pathogens trigger a cascade of reactions in plants that lead to the synthesis of stress metabolites, including H 2 O 2 , phytoalexins, and stress signals such as abscisic acid, jasmonic acid, and salicylic acid (Lichtenthaler, 1998 ; Fan et al., 2009 ; Bharath et al., 2021 ). The pathogenicity of opportunistic endophytes depends on the triggering of a cascade of regulatory reactions in metabolic processes. These bacteria use a number of genetic tools to cause diseases in their hosts. Significant progress has been made in recent years in identifying virulence factors of opportunistic bacteria. For example, a disease known as Fern Deformation Syndrome (FDS) results from latent infections with harmful fluorescent pseudomonads, which cause damage when a threshold population is reached (Kloepper et al., 2013 ). Catabolic processes in plant cells play a key role in the life of bacteria. As a result of activation of the plant catabolic systems by bacteria, the rate of breakdown of complex molecules is accelerated and the energy necessary to maintain the vital activity of bacterial cells is released. Bacteria use this energy for synthesis of substances necessary for their own needs. Conceivably, under stress conditions (e. g. heat or light intensity, starvation etc.), the activity of catabolic processes may increase, allowing bacterial cells to mobilize the necessary resources for survival and recovery. The activity of the catabolic systems of endophytic bacteria depends on availability of nutrients such as carbohydrates, fats and proteins. A lack of essential macro- and microelements may slow down the catabolic processes. Plant growth regulators, such as abscisic acid, ethylene, gibberellic acid etc. may potentially affect catabolic processes. Infection by phytopathogens or pests (e. g. insects) may also significantly change the rate of catabolism. We suggest that in T. kok-saghyz plants, the so-called \"summer dormancy\" may develop due to high ambient temperatures. Suboptimal, high temperatures in the root zone of plants may initiate the activity of bacterial enzymes. They, in turn, can accelerate metabolic processes, including catabolic ones. In addition, these factors may synergistically interact with each other, affecting the overall activity of catabolic systems. The size of potential pathogen population is also important for disease development. Leatherleaf fern ( Rumohra adiantiformis ) is a valuable ornamental plant used in cut flower arrangements. The disease known as FDS (above) was reported in 1980s. It causes distortions of ferns and other prominent symptoms (Kloepper et al., 2010 ). Interestingly, the severity of FDS correlates with the size of populations of opportunistic endophytic fluorescent Pseudomonas inside rhizomes of plants with distorted fronds (Kloepper et al., 2010 ). It was noted that distribution of FDS coincided with the areas of widespread use of Benlate systemic fungicide (Mills et al., 1996 ). Conceivably, Benlate act as an inducing factor for FDS. It was shown that 24 months after treatment with Benlate pronounced FDS symptoms were present along with increased endophytic populations of fluorescent pseudomonads inside rhizomes (Kremer et al., 1996 ). Under aeroponic growing conditions, plant metabolism changes significantly. Specifically, fluctuations in moisture levels in the root zone and on the leaf surface have a significant impact on concentration, osmolarity and other characteristics of the components of the nutrient solution, which, in turn, affect their availability for adsorption and uptake by root hairs (Chiaranunt & White, 2023 ). During the period of growth and development of T. kok-saghyz in a phytotron, the physical and chemical parameters of the environment constantly change as the root system and leaves grow from the juvenile stage to the aging stage. The morphology and anatomical features of tissues and organs also change. Some substances accumulate, while the biosynthesis of others slows down or stops altogether. These changes certainly affect the physiology and biochemistry of the consortium of bacteria, which are always present both on the surface of plants and in the intercellular space of plant tissues [Martirosyan et al., 2023 ]. The results of antagonistic interactions between opportunistic endophytic bacteria and their plant hosts depend on the virulence factors of the induced bacteria, i.e. bacteria that have emerged from the dormant state in response to changes in the host's metabolic products. Nevertheless, much remains to be discovered about the causes and mechanisms of triggering pathogenesis processes by opportunistic endophytes. A characteristic feature of growth in a phytotron is that endophytic bacteria living in plants are forced to exist in a constantly changing physical and chemical environment. The life and activity of endophytes depend on the type and quantity of plant assimilates. These parameters are important for the stable life of bacteria. Likewise, the quantity and composition of these species-specific plant assimilates can control the structure of endophytic communities and regulate their activity (Gorke & Stulke, 2008 ). Under the influence of the controlled environment and artificial light in a phytotron, plant organs, and consequently the bacteria inhabiting them, undergo various transformations. This leads to corresponding changes in the metabolism of endophytic bacteria (Kremer et al., 2024 ). Most bacteria can selectively utilize substrates from a mixture of different carbon sources. The presence of preferred carbon sources prevents the expression of genes and the corresponding activities of catabolic systems that allow the use of alternative substrates. Normally, the presence of preferred carbon sources does not lead to activation of pathogenesis. The lack of these substrates forces endophytic bacteria to radically rearrange their interaction with the host plant cells. The ability of bacteria to adapt to various environmental changes is determined genetically and depends on certain signals. Recognition of such signals and the transformation of this information into specific transcriptional responses play a key role in signal transduction (Parkinson & Kofoid, 1992 ) . Remarkably, most bacteria have a two-component system responsible for this process (Celine et al., 1999 ). Phosphorylation is an important mechanism of signal transduction since addition of phosphoryl groups affects functional activities of proteins (Stock et al., 1989 ). This may stimulate synthesis of pectolytic, cellulolytic and other related enzymes (Deutscher et al., 2006 ). Most endophytes act as commensals with no known effect on their host plant, but numerous bacteria and fungi establish mutualistic relationships with plants. However, some microbes act as pathogens. The outcome of these plant-microbe interactions depends on biotic and abiotic environmental factors, as well as the genotype of the host and interacting microorganism. In addition, endophytic microbiota and the numerous interactions between members, including pathogens, have a profound effect on plant function and pathobiome development. Collectively, these events may lead to pathogenesis. Interestingly, it has been shown that bacterial strains belonging to a known pathogenic species of a particular host plant can even exert a growth-promoting effect on another plant (Reiter et al., 2002 ; Coombs & Franco, 2003 ). The effects attributed to endophytes in healthy plants may change if host plants are grown under less favorable or even stressful conditions. Remarkably, it is difficult to reliably distinguish a non-pathogenic endophyte from a pathogen and that properties such as pathogenicity or mutualism may depend on many factors, including plant and microbe genotype, microbe number and quorum sensing, or environmental conditions (Hardoim et al., 2015 ). The interaction of plants and bacteria is a complex and multifaceted process, where positive and negative effects may depend on specific environmental conditions, plants and microorganisms. The obvious suggestion for changes in the behavior of endophytic bacteria associated with cells/tissues of the T. kok-saghyz plants is the influence of plant cultivation conditions. Conceivably this may have an impact on plant hormonal systems and, via adjustment of metabolic pathways of carbohydrate exchange, activate specialized enzymes of endophytic bacteria that destroy plant tissue. The distinction between endophytes and pathogens is not always obvious, as both live on and within plant tissues, where opportunities for recombination often arise following horizontal gene transfer, a process that imparts new phenotypic traits (or sets of traits) to bacteria sharing an ecological habitat (Berg et al., 2005 ). Therefore, virulence factor genes can move between species of bacterial phylogenetic groups in the rhizosphere or within plants, and virulence factor expression can be linked to bacterial strain population density. Several virulence factors have been shown to be regulated by bacterial cell density through quorum sensing. These include the tobacco hypersensitivity testing system, which has been used to determine the phytopathogenic potential of plant-associated bacteria (Mathesius et al. 2003 ), indole acetic acid production (Preston, 2004 ), and biosynthesis of cell wall degrading enzymes including pectinase (Berg et al., 2005 ; Laasik et al., 2006 ). In addition, quorum sensing regulates both horizontal gene transfer and bacterial colonization of host plants (Berg et al., 2005 ). Conclusion In conclusion, this study shows that plant-associated microorganisms are an important factor affecting plant responses to changes in cultivation conditions. It led to identification of two bacterial species associated with root rot of the NR-producing plant T. kok-saghyz - Pseudomonas putida and Raoultella terrigena . According to the literature, interaction of these bacteria with plants is described as symbiosis. However, our data clearly demonstrate that under certain conditions well-characterized endophytic bacteria can act as pathogens. Moreover, we showed that plants, cured of phytopathogens, demonstrate significant increase in fitness. Plants exhibit resistance to high ambient temperatures, which is not typical for these species. T. kok-saghyz continued to build up a biomass, which may lead to an increase in accumulation of NR and inulin in the roots. In addition, our research showed that aeroponic cultivation is a promising way to grow T. kok-saghyz , for production of NR and inulin. Free access to the root zone allows rapid assessment of the conditions of the roots and their biochemical composition directly during the process of plant growth and development. Our results indicate the need for further research for understanding the mechanisms of biochemical and physiological interactions between microbes and plants. New developments in high-throughput technologies such as next-generation sequencing enable the exploration of complex microbiomes and facilitate in-depth studies of the largest possible number of microbial communities. Genomic analysis of individual microbial strains and metagenomic studies of entire microbial communities will provide insights into the composition and physiological potential of plant-associated microorganisms (Knief, 2014 ). Conceivably, in the future, with more information on the microbiome of T. kok-saghyz and its growth under different cultivation conditions available, it will be possible to achieve maximum productivity of this NR-producing plant. Declarations Acknowledgements We are grateful to Oleg Malyuchenko, Yakov Alekseev and Julia Monakhova who helped with DNA sequencing, data collection and analysis. Data Availability All data generated or analyzed during this study are included in this manuscript Ethics approval consent This study did not involve human participants or animals, and therefore ethical approval was not required. Conflict of interest The authors have neither conflict of interests nor competing interests to declare References Amerik, A.Y., Martirosyan, Y.T, & Gachok, I.V. (2018). Regulation of natural rubber biosynthesis by proteins associated with rubber particles. Russian Journal of Bioorganic Chemistry ,44(2), 140-149. https://doi.org/10.1134/S106816201801003X Amerik, A.Y., Martirosyan, Y.T., Martirosyan, L.Y., Goldberg, V.M., Uteulin. K.R., &Varfolomeev, S.D. (2021).Molecular genetic analysis of natural rubber biosynthesis. Russian Journal of Plant Physiology , 68(1), 31-45. https://doi.org/10.1134/S1021443721010039 Appel, T.M., Quijano-Martínez, N., De La Cadena. E., Mojica, M., &Villegas, M.V. (2021). Microbiological and Clinical Aspects of Raoultella spp. Frontiers in Public Health 9, 686789. https://doi.org/10.3389/fpubh.2021.686789 Araujo-Morera, J., Verdejo, R., Lopez-Manchado, M.A., & Santana, M.H. (2021). Sustainable mobility: the route of tires through the circular economy model. Waste Management 126(1 May), 309-322. https://doi.org/10.1016/j.wasman.2021.03.025 Arias, M., Herrero, J., Ricobaraza, M., Hernandez M., & Ritter E. (2016). Evaluation of root biomass, rubber and inulin contents in nine Taraxacum kok-saghyz Rodin populations. Industrial Crops and Products 83(May 2016), 316-321. https://doi.org/10.1016/j.indcrop.2016.01.023 Berg, G., Eberl. L., & Hartman A. (2005). The rhizosphere as a reservoir for opportunistic human pathogenic bacteria. Environmental Microbiology , 7(11), 1673–1685. https://doi.org/10.1111/j.1462-2920.2005.00891.x. Berggren, I., Alstrom, S., & Martensson, A.M. (2001). Deleterious properties of certain rhizosphere bacteria on field pea ( Pisum sativum ) under gnotobiotic and non-sterile conditions. Applied Soil Ecology , 16(2), 169-177. doi: 10.1016/S0929-1393(00)00111-6 Bharath,P., Gahir, S., & Raghavendra, A.S. (2021).Abscisic Acid-Induced Stomatal Closure: An Important Component of Plant Defense Against Abiotic and Biotic Stress. Frontiers in Plant Science , 12, 615114. https://doi.org/10.3389/fpls.2021.615114 Bousquet, J., Flahault, A., Vandenplas, O., Ameille, J., Duron, J.J., Pecquet, C., Chevrie, K., & Annesi-Maesano I. (2006). Natural rubber latex allergy among health care workers: A systematic review of the evidence. Journal of Allergy and Clinical Immunology , 118(2), 447-454. https://doi.org/10.1016/j.jaci.2006.03.048 Bowler, C., & Fluhr, R. (2000). The role of calcium and activated oxygens as signals for controlling cross-tolerance. Trends in Plant Science , 5(6), 241–246. https://doi.org/10.1016/s1360-1385(00)01628-9 Brader, G., Compant, S., Vescio, K., Mitter, B., Trognitz, F.L.J, & Sessitsch A. 2017. Ecology and genomic insights into plant-pathogenic and -nonpathogenic endophytes. Annual Review of Phytopathology, 55(Aug.4), 61-83. https://doi.org/10.1146/annurev-phyto-080516-035641 Brenner, D.J., Staley, J.T., Krieg, N.R. (2005). Classification of Procaryotic Organisms and the Concept of Bacterial Speciation. In: D.J. Brenner, N.R. Krieg, J.T. Staley, & G.M. Garrity (Eds.), Bergey's Manual of Systematic Bacteriology (v. 2., pp. 27-32). Springer. Buranov, A.U., Elmuradov, B.J. (2010). Extraction and characterization of latex and natural rubber from rubber-bearing plants. Journal of Agricultural and Food Chemistry , 58(2), 734-43. https://doi.org/10.1021/jf903096z Castillo, T,, Duque, E., Juan, L., Ramos, J.L. (2008). A Set of activators and repressors control peripheral glucose pathways in Pseudomonas putida to yield a common central intermediate. Journal of Bacteriology , 190(7), 2331-2339. https://doi.org/10.1128/jb.01726-07 Celine, F., Feher, V.A, Hoch J.A. (1999). Two-component signal transduction in Bacillus subtilis : how one organism sees its world. Journal of bacteriology , 181(7), 1975-1983. https://doi.org/10.1128/jb.181.7.1975-1983.1999 Chen, K, Li, G.-J., Bressan, R.A,, Song, C.-P., Jian, J/-K, Zhao, Y. (2020). Abscisic acid dynamics, signaling, and functions in plants. Journal of Integrative Plant Biology , 62(1), 25-54. https://doi.org/10.1111/jipb.12899 Cherian SS, Ryu SB, Cornish K. (2019). Natural rubber biosynthesis in plants, the rubber transferase complex, and metabolic engineering progress and prospects. Plant Biotechnol ogy Journal, 17(11), 2041-2061. https://doi.org/10.1111/pbi.13181 Chiaranunt, P., White, J.F. (2023). Plant beneficial bacteria and their potential applications in vertical farming systems. Plants, 12, 400. https://doi.org/10.3390/plants12020400 Coombs, J.T., Franco, C.M. (2003). Isolation and identification of actinobacteria from surface-sterilized wheat roots. Applied and environmental microbiology, 69(9), 5603-5608. https://doi.org/ 10.1128/AEM.69.9.5603-5608.2003 Cornish, K. (2001).Biochemistry of natural rubber, a vital raw material, emphasizing biosynthetic rate, molecular weight and compartmentalization, in evolutionarily divergent plant species. Natural Product Report 18(2), 182-189. https://doi.org/10.1039/a902191d Cornish, K. (2017). Alternative natural rubber crops: why should we care?. Technology and Innovation 18: 245-256. https://doi.org/10.21300/18.4.2017.245 Costa-Gutierrez, S.B., Adler, C., Espinosa-Urgel, M., de Cristóbal,R.E . (2022). Pseudomonas putida and its close relatives: mixing and mastering the perfect tune for plants. Applied Microbiology and Biotechnology 106 (9-10), 3351–3367. https://doi.org/ 10.1007/s00253-022-11881-7 Deutscher, J., Francke, C., Postma, P.W. (2006). How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiology and molecular biology Reviews 70(4), 939-1031. doi: 10.1128/MMBR.00024-06 Eaton, C.J., Cox, M.P., Scott, B. (2011). What triggers grass endophytes to switch from mutualism to pathogenism? Plant Science , 180(2), 190-195. https://doi.org/10.1016/j.plantsci.2010.10.002 Edwards, U., Rogall, T., Blocker, H., Emde, M., Bottger, E.C. (1989). Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. Nucleic Acids Res, 17(19), 7843–7853. https://doi.org/10.1093/nar/17.19.7843 Eng, A.H., Ong, E.L.(2000). Hevea natural rubber. In A.K. Bhowmick, & H.L.Stephens (Eds.) Plastics engineering: handbook of elastomers (v. 61., pp. 29-59) Marcel Dekker. Fan, J., Hill, L., Crooks, C., Doerner, P., Lamb, C. (2009).Abscisic Acid Has a Key Role in Modulating Diverse Plant-Pathogen Interactions. Plant Physiology, 150(4), 1750-1761. https://doi.org/10.1104/pp.109.137943 Garrett, K.A., Bebber, D.P., Etherton, B.A, Gold, KM, Plex Sula, A.I., Selvaraj, M.G. (2022). Climate change effects on pathogen emergence: Artificial intelligence to translate big data for mitigation. Annual Review of Phytopathology, 60, 357-378. https://doi.org/10.1146/annurev-phyto-021021-042636 Gent, D.H., Mahaffee, W.F., McRoberts, N., Pfender, W.F. (2013). The use and role of predictive systems in disease management. Annual Review of Phytopathology, 51, 267-289. https://doi.org/10.1146/annurev-phyto-082712-102356 Giauque, H., Hawkes C.V. (2013). Climate affects symbiotic fungal endophyte diversity and performance. American Journal of Botany, 100(7),1435-1444. https://doi.org/10.3732/ajb.1200568 Glick,BR, Penrose, D.M., Li, J. (1998). A model for the lowering of plant ethylene concentrations by plant growth-promoting bacteria. Journal of Theoretical Biology , 190(1), 63-68. https://doi.org/10.1006/jtbi.1997.0532 Gorke, B, Stulke, J. (2008). Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. Nature Reviews Microbiology, 6(8), 613-624. https://doi.org/10.1038/nrmicro1932 Grondeau, C., Samson, R., Sands, D.C. (1994). A review of thermotherapy to free plant materials from pathogens, especially seeds from bacteria. Critical Reviews in Plant Sciences , 13(1), 57-75. https://doi.org/10.1080/07352689409701908 Gronover, C.S., Wahler, D., Prufer, D. (2011). Natural rubber biosynthesis and physic-chemical studies of plant derived latex. In M. Elnashar (Ed), Biotechnology of Biopolymers : (pp. 75-88) InTech. https://doi.org/10.5772/17144 Guyot, J., Cilas, C., Sache I. (2008). Influence of host resistance and phenology on South American leaf blight of the rubber tree with special consideration of temporal dynamics. European Journal of Plant Pathology , 120 (2): 111-124. https://doi.org/10.1007/s10658-0079197-6 Guyot, J., Le Guen, V. (2018). A review of a century of studies on South America leaf blight of the rubber tree. Plant Disease, 102(6), 1052-1065. https://doi.org/10.1094/PDIS-04-17-0592-FE Hallahan, D.L., Keiper-Hrynko, N.M. (2004). Cis-prenyltransferases from the rubber-producing plants Russian dandelion ( Taraxacum kok-saghyz ) and sunflower ( Helianthus annus ). US Patent 2004/044173 . Hansen, D.S., Aucken, H.M., Abiola, T., Podschun, R. (2004). Recommended test panel for differentiation of Klebsiella species on the basis of a trilateral interlaboratory evaluation of 18 biochemical tests. Journal of clinical microbiology, 42(8), 3665-3669. https://doi.org/10.1128/JCM.42.8.3665-3669.2004 Hardoim, P.R., van Overbeek, L.S., Berg, G., Pirttila, A.M., Compant S, Campisano, A., Doring, M., Sessitsch, A. (2015). The hidden world within plants: ecological and evolutionary considerations for defining functioning of microbial endophytes. Microbiology and Molecular Biology Review, 79(3), 293-320. https://doi.org/10.1128/MMBR.00050-14 Hua, J. (2013). Modulation of plant immunity by light, circadian rhythm, and temperature. Current Opinion in Plant Biology, 16(4), 406-413. https://doi.org/10.1016/j.pbi.2013.06.017 Juroszek, P., Von Tiedemann, A. (2011). Potential strategies and future requirements for plant disease management under a changing climate. Plant Pathology , 60(1), 100-112. https://doi.org/10.1111/j.1365-3059.2010.02410.x Juroszek, P., Bartsch, L., Fontaine, J.F., Racca, P., Kleinhenz, B. (2022). Summary of the worldwide available crop disease risk simulation studies that were driven by climate change scenarios and published during the past 20 years. Plant Pathology 71(9), 1815-1838. https://doi.org/10.1111/ppa.13634 Kamilova, F., Kravchenko, L.V., Shaposhnikov, A.I., Azarova, T., Makarova, N., Lugtenberg, B. (2006).Organic acids, sugars, and L-tryptophane in exudates of vegetables growing on stonewool and their effects on activities of rhizosphere bacteria. Molecular Plant-Microbe Interactions, 19(3), 250-256. https://doi.org/10.1094/MPMI-19-0250 Keane, P.J., Kerr, A. (1997). Factors affecting disease development. In J.F. Brown, & H.J. Ogles, (Eds.), Pathogens and Plant Diseases . pp.267-298) Rockvale Publications. Khazaei, A., Bahramnejad, B., Mozafari, A. A., Dastan, D., Mohammadi, S. (2019).Hairy root induction and Farnesiferol B production of endemic medicinal plant Ferula pseudalliacea . 3 Biotech 9(11), 407. https://doi.org/10.1007/s13205-019-1935-x Kivisaar, M. 2020 . Narrative of a versatile and adept species Pseudomonas putida. Journal of Medicine Microbiology 69(3), 324-338. https://doi.org/10.1099/jmm.0.001137 Kloepper, JW, Saborio F, Bustamante E, Polston JE, Sanchez E, Umana G. 2010. Fern Distortion Syndrome of Leatherleaf Fern in Costa Rica: symptoms, incidence, and severity. Plant Disease . 94(8), 940-954. https://doi.org/10.1094/ PDIS-94-8-0940 Kloepper, J.W., McInroy, J.A., Ke, K., Hu, C-H. (2013).Symptoms of Fern Distortion Syndrome Resulting from inoculation with opportunistic endophytic fluorescent Pseudomonas spp. PLoS One. 8(3), e58531. https://doi.org/10.1371/journal.pone.0058531 Knief, C. (2014). Analysis of plant microbe interactions in the era of next generation sequencing technologies. Frontiers in plant science . 5, 216. https://doi.org/10.3389/fpls.2014.00216 Kremer, R.J., Sasseville, D.N., Mills, H.A. 1996. Promotion of phytotoxic bacteria in rhizospheres of leatherleaf fern by Benlate DF. Journal of Plant Nutrition, 19(6), 939-953. https://doi.org/10.1080/01904169609365171 Kremer, M., Schulze, S., Eisenbruch, N., Nagel, F.,Vogt, R.,Berndt, L., Dorre, B., Palm, G.J., Hoppen, J., Girbardt, B.,Albrecht, D., Sievers, S., Delcea, M., Baumann, U., Schnetz , K., Lammers, M. (2024). Bacteria employ lysine acetylation of transcriptional regulators to adapt gene expression to cellular metabolism . Nature Communication, 15(1), 1674. https://doi.org/10.1038/s41467-024-46039-8 Laasik, E., Andresen L., Mae A. (2006). Type II quorum sensing regulates virulence in Erwinia carotovora ssp. carotovora . FEMS Microbiology Letters 258(2), 227–234. https://doi.org/10.1111/j.1574-6968.2006.00222.x Lichtenthaler, H.K. (1998).The Stress Concept in Plants: An Introduction. Annals of the New York Academy of Sciences , 851, 187-198. doi: 10.1111/j.1749-6632.1998.tb08993.x. March, P.E. (1992). Membrane-associated GTPases in bacteria . Molecular Microbiology, 10, 1253-1257. https://doi.org/10.1111/j.1365-2958.1992.tb00845.x Martinez-Garcia, E., de Lorenzo, V. (2024). Pseudomonas putida as a synthetic biology chassis and a metabolic engineering platform. Current opinion in biotechnology 85, 103025. https://doi.org/10.1016/j.copbio.2023.103025 Martirosyan, Y.T., Varfolomeev, S.D., Goldberg, V.M., Martirosyan, L.Y., Ryazantsev, D.M., Minikh, A.A. (2020). RF Patent RU 196013U1 . Martirosyan, L.Y., Martirosyan, Y.T., Kosobryukhov, A.A., Goldberg, V.M., Gachok, I.V., Martirosyan, V.V., Gladchenko, M.A., Gaydamaka, S.N., Amerik, A.Y., Minih, A.A., Varfolomeev, S.D. (2023). Biosynthesis of rubber and inulin depending on the spectral composition of light and activity of the photosynthetic apparatus during aeroponic cultivation of Taraxacum kok-saghys E.Rodin. Agricultural Biology 58(1), 100-113. https://doi.org/ 10.15389/agrobiology.2023.1.100 Mathesius, U., Mulders, S., Gao, M., Teplitski, M., Caetano-Anollés, G., Rolfe, B.G., Bauer, W.D. (2003). Extensive and specific responses of a eukaryote to bacterial quorum-sensing signals. PNAS, 100(3), 1444-1449. https://doi.org/10.1073/pnas.262672599 McIntyre, D., Stephens, H.L., Schloman, W.W., Bhowmick, A.K. (2000). Guayule rubber. In A.K. Bhowmick, & H.L.Stephens (Eds.), Plastics engineering: handbook of elastomers . (v. 61, pp. 1-27). Marcel Dekker. Mengistu, A.A. (2020). Endophytes: colonization, behavior, and their role in defense mechanism. International Journal of Microbiology, 2020: 6927219. https://doi.org/10.1155/2020/6927219 Mills, H.A., Sasseville, D.N., Kremer, R.J. (1996). Effects of Benlate on leatherleaf fern growth, root morphology and rhizosphere bacteria. Journal of Plant Nutrition, 19(6), 917-937. https://doi.org/10.1080/01904169609365170 Mooibroek, H., Cornish, K. (2000). Alternative sources of natural rubber. Applied Microbiology and Biotechnolog y, 53, 355-365. https://doi.org/10.1007/s002530051627 Mortier, V., Holsters, M., Goormachtig, S. (2012). Never too many? How legumes control nodule numbers. Plant Cell & Environment 35(2),245-258. https://doi.org/10.1111/j.1365-3040.2011.02406.x Nikel, P.I., de Lorenzo, V. (2018). Pseudomonas putida as a functional chassis for industrial biocatalysis: from native biochemistry to trans-metabolism. Metabolic engineering, 50, 142-155. https://doi.org/10.1016/j.ymben.2018.05.005 Parkinson, J.S., Kofoid, E.C. (1992). Communication modules in bacterial signaling proteins. Annual review of genetics, 26, 71-112. https://doi.org/10.1146/annurev.ge.26.120192.000443 Premachandra, D., Hudek, L., Brau, L. (2016). Bacterial modes of action for enhancing of plant growth. Journal of Biotechnology & Biomaterials, 6(3), 236. https://doi.org/10.4172/2155-952X.1000236 Preston, G.M. (2004). Plant perceptions of plant growth-promoting Pseudomonas. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences , 359(1446), 907-918. https://doi.org/10.1098/rstb.2003.1384 Puskas, J.E. (2001). Producers and world market of synthetic rubbers. In T. Koyama, & A. Steinbuchel (Eds.) Biopolymers, Polyisoprenoids .(v. 2 pp. 287-320) Wiley. Ramos, J.L., Cuenca, M., Molina-Santiago, C., Segura, A., Duque, E., Gómez-García, M.R., Udaondo, Z., Roca, A. (2015). Mechanisms of solvent resistance mediated by interplay of cellular factors in Pseudomonas putida . FEMS microbiology reviews, 39(4), 555-566. https://doi.org/10.1093/femsre/fuv006 Reed, M.L.E., Glick, B.R. (2005). Growth of canola ( Brassica napus ) in the presence of plant growth-promoting bacteria and either copper or polycyclic aromatic hydrocarbons. Canadian Journal of Microbiology , 51(12), 1061-1069. https://doi.org/10.1139/w05-094 doi: 10.1139/w05-094 Reiter, B., Pfeifer, U., Schwab, H., Sessitsch, A. (2002).Response of endophytic bacterial communities in potato plants to infection with Erwinia carotovora subsp. atroseptica. Applied and environmental microbiology, 68(5), 2261-2268. https://doi.org/10.1128/AEM.68.5.2261-2268.2002 Rousset, A., Amor, A., Punvichai, T., Perino, S., Palu, S., Dorget, M., Pioch, D., Chemat, F. (2021). Guayule ( Parthenium argentatum A. Gray), a renewable resource for natural polyisoprene and resin: composition, processes and applications. Molecules, 26(3), 664. https://doi.org/10.3390/molecules26030664 Sanna, M., Gilardi, G., Gullino, M.L., Mezzalama, M. (2022). Evaluation of physical and chemical disinfection methods of Brassica oleracea seeds naturally contaminated with Xanthomonas campestris pv. campestris . Journal of Plant Diseases and Protection, 129,1145–1152. https://doi.org/10.1007/s41348-022-00635-2 Scarth, G.W., Gooding, H.B., Shaw, M. (1947). Factors influencing growth and summer dormancy in Taraxacum kok-saghyz . Canadian journal of research , 25c, 27-42. https://doi.org/10.1007/s41348-022-00635-2 Sekowska, A. (2019). The many faces of Raoultella spp . Advances in Hygiene and Experimental Medicine , 73, 713-720. https://doi.org/10.5604/01.3001.0013.6377 Shah, D.A., Sen, S., Shalini, A., Ghosh, D., Grover, M., Mohapatra, S. (2017). An auxin secreting Pseudomonas putida rhizobacterial strain that negatively impacts water-stress tolerance in Arabidopsis thaliana . Rhizosphere 3(1), 16-19. https://doi.org/10.1016/j.rhisph.2016.11.002 Siler, D.J., Cornish, K., Hamilton, R.G. (1996). Absence of cross-reactivity of IgE antibodies from subjects allergic to Hevea brasiliensis latex with a new source of natural rubber latex from guayule ( Parthenium argentatum ). Journal of Allergy and Clinical Immunology , 98(5), 895-902. https://doi.org/10.1016/s0091-6749(96)80005-4 Song, X., Schlosburg, J.E., Janda, K.D. (2015). A new strategy for smoking cessation: characterization of a bacterial enzyme for the degradation of nicotine. Journal of the American Chemical Society , 137(32), 10136-10139. https://doi.org/10.1021/jacs.5b06605 Stock, J.B., Ninfa, A.J., Stock, A. (1989). Protein phosphorylation and regulation of adaptive responses in bacteria. Microbiological reviews , 53(4), 450-490. https://doi.org/10.1128/mr.53.4.450-490.1989 Tanaka, Y. (2001). Structural characterization of natural polyisoprenes: solve the mystery of natural rubber based on structural study. Rubber Chemistry and Technology , 74, 355-375. https://doi.org/23 10.5254/1.3547643 Tanaka, A., Christensen, M.J., Takemoto, D., Park, P., Scott, B. (2006). Reactive oxygen species play a role in regulating a fungus–perennial ryegrass mutualistic interaction. The Plant Cell , 18(4), 1052-1066. https://doi.org/10.1105/tpc.105.039263 Thwe, A., Valan Arasu, M., Li, X., Park, C.H., Kim, S.J., Al-Dhabi, N.A., Park, S.U. (2016). Effect of different Agrobacterium rhizogenes strains on hairy root induction and phenylpropanoid biosynthesis in tartary buckwheat ( Fagopyrum tataricum Gaertn). Frontiers in microbiology , 7, 318. https://doi.org/10.3389/fmicb.2016.00318 Trivedi, P., Leach, J.E., Tringe, S.G., Sa, T., Singh,B.K. (2020). Plant-microbiome interactions: from community assembly to plant health. Nature Review Microbiology , 18(11), 607-621. https://doi.org/10.1038/s41579-020-0412-1 Tscheremissinov, N.A. (1951). Pathogenic mycoflora of T. kok-saghyz. Botanicheskie materialy Instituta Sporovykh Rastenii Glavnogo Botanicheskogo Sada RSFSR , 7, 155-170 (in Russian). van Beilen, J., Poirier, Y. (2007a). Guayule and Russian dandelion as alternative sources of natural rubber. Critical Reviews in Biotechnology , 27(4), 217-231. https://doi.org/10.1080/07388550701775927 van Beilen, J., Poirier, Y. (2007b). Establishment of new crops for the production of natural rubber. Trends in Biotechnology , 25(11), 522-529. https://doi.org/10.1016/j.tibtech.2007.08.009 Velazquez, F., Di Bartolo, I., De Lorenzo, V. (2004). Genetic evidence that catabolites of the Entner-Doudoroff pathway signal C source repression of the σ54 Pu promoter of Pseudomonas putida . Journal of bacteriology , 186(24), 8267-8275. https://doi.org/10.1128/JB.186.24.8267-8275.2004 Velasquez, A.C., Castroverde, C.D.M., He, S.Y. (2018). Plant-pathogen warfare under changing climate conditions. Current biology 28(10), R619-R634. https://doi.org/10.1016/j.cub.2018.03.054 Vercellone-Smith, P., Herson, D.S. (1997).Toluene elicits a carbon starvation response in Pseudomonas putida mt-2 containing the TOL plasmid pWW0 . Applied and Environmental Microbiology 63(5), 1925-1932. https://doi.org/10.1128/aem.63.5.1925-1932.1997 Volaire, F., Norton, M. (2006). Summer dormancy in perennial temperate grasses. Annals of botany , 98(5), 927-933. https://doi.org/10.1093/aob/mcl195 Yamamoto, S., Harayama, S. (1998).Phylogenetic relationships of Pseudomonas putida strains deduced from the nucleotide sequences of gyrB , rpoD and 16S rRNA genes. International Journal of Systematic Bacteriology , 48(3), 813-819. https://doi.org/10.1099/00207713-48-3-813 Yamamoto, S., Kasai, H., Dawn, L., Arnold, D.L., Robert, W., Jackson R.W., Vivian, A., Harayama, S. (2000). Phylogeny of the genus Pseudomonas: intrageneric structure reconstructed from the nucleotide sequences of gyrB and rpoD genes. Microbiology , 146(10), 2385-2394. https://doi.org/10.1099/00221287-146-10-2385 Yamashita, S., Takahashi, S. (2020). Molecular mechanisms of natural rubber biosynthesis. Annual Review of Biochemistry 89, 821-851. https://doi.org/10.1146/annurev-biochem-013118-111107 Zakharchenko, N.S., Rukavtsova, E.B., Yampolsky, I.V., Balakirev, D.O., Dyadishchev, I.V., Ponomarenko, S.A., Luponosov, Y.N., Filonov, A.E., Mikhailov, P.A., Zvonarev, A.N., Akhmetov, L.I., Terentyev, V.V., Khudyakova, A.Y., Zalomova, L.V., Tarlachkov, S.V., Aripovsky, A.V., Puntus, I.F., Khramov, R.N. (2024). Effect of photoluminophore light-correcting coatings and bacterization by associative microorganisms on the growth and productivity of Brassica juncea L. plants. Microbiology Research , 15 (4), 1957-1972. https://doi.org/10.3390/microbiolres15040131 Table Table 1 is available in the Supplementary Files section. Supplementary Files TableS1.docx TableS2.docx Fig.S1.tiff SupportingFigureLegends.docx Table1.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revisions 09 Mar, 2026 Reviewers agreed at journal 05 Jan, 2026 Reviewers invited by journal 04 Nov, 2025 Editor invited by journal 29 Oct, 2025 Editor assigned by journal 28 Oct, 2025 First submitted to journal 24 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-7867960\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":539685905,\"identity\":\"54f1f314-e52d-4de4-8543-1d3f5144ebb9\",\"order_by\":0,\"name\":\"Levon Martirosyan\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0003-1769-6377\",\"institution\":\"All-Russian Research Institute of Agricultural Biotechnology: Vserossijskij naucno-issledovatel'skij institut sel'skohozajstvennoj biotehnologii\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Levon\",\"middleName\":\"\",\"lastName\":\"Martirosyan\",\"suffix\":\"\"},{\"id\":539685906,\"identity\":\"2e5f4789-547d-4ace-9ba6-48fbdc51194b\",\"order_by\":1,\"name\":\"Valentina Martirosyan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"All-Russian Research Institute of Agricultural Biotechnology: Vserossijskij naucno-issledovatel'skij institut sel'skohozajstvennoj biotehnologii\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Valentina\",\"middleName\":\"\",\"lastName\":\"Martirosyan\",\"suffix\":\"\"},{\"id\":539685907,\"identity\":\"fb5d4416-b69f-4947-aa08-d0b0696edd62\",\"order_by\":2,\"name\":\"Yuriy Rybakov\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"National Research Center Kurchatov Institute: Nacional'nyj issledovatel'skij centr Kurcatovskij institut\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yuriy\",\"middleName\":\"\",\"lastName\":\"Rybakov\",\"suffix\":\"\"},{\"id\":539685908,\"identity\":\"b6e93e48-26ae-46a6-943b-88a21ecb1269\",\"order_by\":3,\"name\":\"Alexander Amerik\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"All-Russian Research Institute of Agricultural Biotechnology: Vserossijskij naucno-issledovatel'skij institut sel'skohozajstvennoj biotehnologii\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Alexander\",\"middleName\":\"\",\"lastName\":\"Amerik\",\"suffix\":\"\"},{\"id\":539685909,\"identity\":\"2064ab29-63cb-4f91-9174-60dbab189106\",\"order_by\":4,\"name\":\"Yuriy Martirosyan\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAsElEQVRIiWNgGAWjYPACGx4GCdJ0JKSRruUwA/FaDG5kJ36u/HFehn92A+OHHwz3EhsIa8ndLHkm4TaPxJ0DzJI9DMVEadkg2QDUwnAjgUEa6ETibPnZkHCOR/5GAvNvYrVsA9pygMfgRgIbcbZInnm7zbIhLZnH8M7BNssegwRjglr4juduvtlgY2cvd7v58I0fFQmyBLUoHIAzGYGKDQipBwJ5goaOglEwCkbBKAAAv3k+cOvPELwAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"All-Russian Research Institute of Agricultural Biotechnology: Vserossijskij naucno-issledovatel'skij institut sel'skohozajstvennoj biotehnologii\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Yuriy\",\"middleName\":\"\",\"lastName\":\"Martirosyan\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-10-15 12:09:25\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-7867960/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-7867960/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":96242975,\"identity\":\"ad269dea-4cf8-41c1-84ac-ca544b2688b3\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:15:04\",\"extension\":\"tiff\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7068006,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.4.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/9b54c149263f7e3c31260452.tiff\"},{\"id\":95895317,\"identity\":\"5a299838-d54c-4faa-830a-b68725de2177\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:02\",\"extension\":\"tiff\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7063502,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.1.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/4ff8fc7494e4f20dcba31ebd.tiff\"},{\"id\":96242581,\"identity\":\"cfd9b45c-adf4-4b0d-9860-4d6df5eac5d8\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:13:31\",\"extension\":\"tiff\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7068006,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.2.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/34c2bc74ce02b0c53f81b325.tiff\"},{\"id\":95895356,\"identity\":\"a39dab1e-da26-4aab-8e70-b378fd8fa0de\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:05\",\"extension\":\"tiff\",\"order_by\":5,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7068006,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.3.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/9c4edc9d596a32d379144bff.tiff\"},{\"id\":96242396,\"identity\":\"472421ca-b6f2-4357-b9b7-c8ef0c02a304\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:12:54\",\"extension\":\"tiff\",\"order_by\":7,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7068006,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.5.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/a9a9a7f3be11002ff8091e48.tiff\"},{\"id\":95895328,\"identity\":\"512a54bf-0ecd-45d0-8921-07194ea08683\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:02\",\"extension\":\"tiff\",\"order_by\":9,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7068006,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.6.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/8ee75975ed9d6d69c41a82d6.tiff\"},{\"id\":95895327,\"identity\":\"0fcedcd6-f707-4371-bce4-44e82384ae1b\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:02\",\"extension\":\"tiff\",\"order_by\":10,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7068006,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.7.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/24ea03953300398e4fc1ba38.tiff\"},{\"id\":95895331,\"identity\":\"3324986a-bfd0-428f-b098-7d1399051994\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:02\",\"extension\":\"tiff\",\"order_by\":11,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7070590,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.8.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/4b656bb36e4b238f400212c9.tiff\"},{\"id\":95895330,\"identity\":\"10fd8418-c2f2-4eb9-9d70-b36dd0c0cc7b\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:02\",\"extension\":\"tiff\",\"order_by\":12,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7068006,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.S1.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/54ef04ed232ed0dc0e0b1b80.tiff\"},{\"id\":95895322,\"identity\":\"6ed3ba9b-0cc5-4c38-a601-cc7ea9f3cb59\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:02\",\"extension\":\"xml\",\"order_by\":13,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":10368,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"ejppEJPPD2500801.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/39fbd0f5cbda0c9aa28f9b9e.xml\"},{\"id\":95895333,\"identity\":\"2b629941-fa6f-4622-83ae-b16eb1d35f49\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:03\",\"extension\":\"xml\",\"order_by\":14,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":1416,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"EJPPD250080127826.go.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/b67bdcbd4e406a43889dc09b.xml\"},{\"id\":95895340,\"identity\":\"fb452be4-2b90-4ab3-ad2f-3cebd10d3f27\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:03\",\"extension\":\"xml\",\"order_by\":15,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":897,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"EJPPD2500801Import.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/720c0adb42ceb8f68a3203a5.xml\"},{\"id\":95895342,\"identity\":\"de807850-fc20-44a1-a932-0fa6864b6bca\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:03\",\"extension\":\"xml\",\"order_by\":18,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":277946,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"EJPPD25008010enriched.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/42ed2d76fddf3314a1067ebc.xml\"},{\"id\":95895354,\"identity\":\"ed418cd6-2fe3-4cfe-87d6-138dcabb8d5c\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:03\",\"extension\":\"tiff\",\"order_by\":19,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7068006,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.4.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/c48d5c74c7c04a6152f8916c.tiff\"},{\"id\":96242275,\"identity\":\"9d6b80a3-ca68-4f9e-b4e1-997cab40113f\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:12:30\",\"extension\":\"tiff\",\"order_by\":20,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7063502,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.1.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/bb799937c8aa5ee7b5248b6d.tiff\"},{\"id\":95895338,\"identity\":\"c327cf3e-dea0-4c97-8e18-ad92be7558b1\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:03\",\"extension\":\"tiff\",\"order_by\":21,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7068006,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.2.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/717b7bcb1f966d1cc48999a2.tiff\"},{\"id\":96242425,\"identity\":\"083bd1d8-d554-4dab-bf48-8d43a71d56d5\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:12:57\",\"extension\":\"tiff\",\"order_by\":22,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7068006,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.3.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/b914daf2201a7bf5eaad3ef9.tiff\"},{\"id\":95895341,\"identity\":\"40b6e913-ad00-46a4-a398-9cd40fd98a13\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:03\",\"extension\":\"tiff\",\"order_by\":23,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7068006,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.5.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/f82543470e8144a6fdec6b10.tiff\"},{\"id\":96242912,\"identity\":\"1f9ff072-f54e-4357-bae0-e53f51fc417b\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:14:51\",\"extension\":\"tiff\",\"order_by\":24,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7068006,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.6.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/89afd84501b58e84ea9c2910.tiff\"},{\"id\":95895334,\"identity\":\"a5741df0-d36c-41df-a1d6-47ab41d745f1\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:03\",\"extension\":\"tiff\",\"order_by\":25,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7068006,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.7.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/c96787c71794649434f82cd5.tiff\"},{\"id\":96244089,\"identity\":\"79ae79b7-3b2f-4917-b747-5c19a97572c5\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:17:41\",\"extension\":\"tiff\",\"order_by\":26,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":7070590,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.8.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/07ad1cbd1bcac90e4bf05efb.tiff\"},{\"id\":95895348,\"identity\":\"c0429d2e-1ecd-4887-92de-fd912afb23d6\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:03\",\"extension\":\"png\",\"order_by\":28,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":202346,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"OnlineFig.4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/a36641e9c41f2a15f3c22ef0.png\"},{\"id\":95895329,\"identity\":\"7b6c7e6f-51f3-4359-a803-fd98e6154db1\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:02\",\"extension\":\"png\",\"order_by\":29,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":142988,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"OnlineFig.1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/01aebf893386027c6b706e59.png\"},{\"id\":96243157,\"identity\":\"dbaa3492-fb0f-4b0d-83ee-81077dc0744f\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:15:45\",\"extension\":\"png\",\"order_by\":30,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":141358,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"OnlineFig.2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/5feb76c3e67b8f09b14bcbb7.png\"},{\"id\":95895349,\"identity\":\"f002330e-0d6f-4c89-9a45-b720cde2f4a8\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:03\",\"extension\":\"png\",\"order_by\":31,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":103020,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"OnlineFig.3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/086f4cd74cd3e4c3b3939ca6.png\"},{\"id\":95895345,\"identity\":\"df208055-17f7-4e1c-84c7-e065be51414a\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:03\",\"extension\":\"png\",\"order_by\":32,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":251762,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"OnlineFig.5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/dba01928f3382026be3e2ecb.png\"},{\"id\":96242240,\"identity\":\"8747a247-6383-44fc-8ebd-ea58f8adf44a\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:12:23\",\"extension\":\"png\",\"order_by\":33,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":278780,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"OnlineFig.6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/aa3397e19858c73fc91ac546.png\"},{\"id\":96243979,\"identity\":\"78f065eb-9645-4367-8e53-89ae8cfb08ff\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:17:26\",\"extension\":\"png\",\"order_by\":34,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":133031,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"OnlineFig.7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/e210010039a9f50a1a7998f2.png\"},{\"id\":96242835,\"identity\":\"5967c343-cc53-42ee-9c0b-bc88e9886a8e\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:14:33\",\"extension\":\"png\",\"order_by\":35,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":143817,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"OnlineFig.8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/c2b2891c177c5150512d1388.png\"},{\"id\":96242391,\"identity\":\"1fbfc344-b9bf-4106-9080-29b3abc331b3\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:12:54\",\"extension\":\"png\",\"order_by\":36,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":312062,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"OnlineFig.S1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/1b37f2d0562181f151092526.png\"},{\"id\":95895347,\"identity\":\"d3266e0f-9d42-4e23-8dbb-60756d169e7c\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:03\",\"extension\":\"xml\",\"order_by\":37,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":275207,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"EJPPD25008010structuring.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/f70786478fa6c6f7d6ed384c.xml\"},{\"id\":96242866,\"identity\":\"3d990e28-ac0e-4217-a96f-ff9a64e195d1\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:14:42\",\"extension\":\"html\",\"order_by\":38,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":292680,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"earlyproof.html\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/650d910b8a2895e2184f85ad.html\"},{\"id\":95895359,\"identity\":\"b1d12064-1a0b-4602-9b9b-ab8330557d98\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:06\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2808043,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e plants growing in an aeroponic phytotron - enclosed research facility used for studying interactions between plants and the environment. It provides controlled conditions of light irradiation (intensity and spectral composition), temperature, humidity, mineral nutrition, and gas composition of the environment.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig.1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/23f55b357b48c3b018e33801.png\"},{\"id\":95895358,\"identity\":\"0953c918-dd9d-4a04-8adf-de7fc82c2c92\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:06\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2946860,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eRoot rot is a disease that primarily affects the roots of plants, causing them to decay and die. \\u0026nbsp;Symptoms can include stunted growth, yellowing or browning leaves, and even wilting and death. The symptoms of root rot disease in \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e plants grown in an aeroponic phytotron. Healthy roots (A). Roots affected with the disease (B). The symptoms appear after 60-70 days of cultivation. The disease begins with softening in the root collar area, at the junction of the root base with the caudex.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig.2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/f6247c550e839e997acdd3ce.png\"},{\"id\":96242562,\"identity\":\"6cf89427-3b6d-4188-bcd3-c6c3760f73ae\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:13:27\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2908226,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe symptoms of root rot disease in the HR cultures. Healthy culture (A). Culture affected with the disease (B). Manifestations appear during long-term (70 days or more) cultivation, despite the fact that the nutrient solution is periodically changed.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig.3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/271116179e723cf62b64e53e.png\"},{\"id\":96243427,\"identity\":\"f5a0ab47-211b-42b2-9711-ec853c034d18\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:16:18\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":4789825,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e plants (A) and roots (B) cured of phytopathogens. Chemotherapy and thermotherapy approaches were employed. Both thermotherapy and chemotherapy are techniques used to eliminate pathogens from plants, particularly in the context of \\u003cem\\u003ein vitro\\u003c/em\\u003e culture and propagation. Thermotherapy involves heat treatment of seeds to kill pathogens, while chemotherapy utilizes specific chemicals. These methods can be used alone or in combination to enhance pathogen eradication success.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig.4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/ddf48f022b2141d59b7b07f8.png\"},{\"id\":95895325,\"identity\":\"5a144a63-e3fe-4021-997e-20bea9d9cf72\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:02\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":4725676,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e plants, grown from seeds in vegetative vessels in the soil, cured of pathogens using chemo- and thermotherapy, grow actively at high outside air temperatures (30-33ºС). They were not subjected to secondary infection with bacteria isolated from the roots of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e(control plants, group 1).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig.5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/143715b84e181298f245d7db.png\"},{\"id\":95895326,\"identity\":\"0230b556-f0b1-4b6d-b2e5-66d9cf974655\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:02\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":4504859,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSecondary infection with bacteria isolated from the roots of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e causes plant sensitivity to high outside air temperatures (30-33°C);(experimental plants cured of pathogens, group 2). At lower temperatures (20-22°C) plant growth is restored.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig.6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/eb351eb16ba40a24a08a9d82.png\"},{\"id\":95895355,\"identity\":\"d96a6afb-5ae2-4671-bf9c-de07419f9c46\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:04\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2157611,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePlants grown from seeds containing endogenous pathogens subjected to secondary infection with bacteria isolated from \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e roots. They are very sensitive to high outside air temperatures (30-33°C); (experimental plants, group 3). At lower temperatures (20-22 °C), plant growth is not restored.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig.7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/6218820656beb0f54873cdf2.png\"},{\"id\":95895336,\"identity\":\"766b669d-3a91-48ca-86af-d003de463fdf\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:03\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2781105,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHR root culture (A) and \\u003cem\\u003ein vitro\\u003c/em\\u003e plants (B) subjected to secondary infection with \\u003cem\\u003eP. putida\\u003c/em\\u003e and \\u003cem\\u003eR. terrigena\\u003c/em\\u003e bacteria isolated from \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003eroots. Infection leads to the development of the root rot disease symptoms.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig.8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/82dd7e41c6c25d6b98d32001.png\"},{\"id\":96255234,\"identity\":\"2eb348bb-0c09-4fa6-b6b2-f6c3e31ba283\",\"added_by\":\"auto\",\"created_at\":\"2025-11-19 07:48:10\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":26268808,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/c5540c52-21b9-4f2a-a979-5d92b663cab2.pdf\"},{\"id\":95895357,\"identity\":\"bfbb2818-0258-44f8-bf1f-31df6cebfc8f\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:05\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":19926,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"TableS1.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/0c5bf0af2ee4e9f3e142d380.docx\"},{\"id\":95895314,\"identity\":\"5810dac0-11e8-4085-a9f9-f294774691bf\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:02\",\"extension\":\"docx\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":25167,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"TableS2.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/a1da515f490d59880e0e36dd.docx\"},{\"id\":95895319,\"identity\":\"60e3c2b8-4c33-4b98-8c4f-c895e7a967f9\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:02\",\"extension\":\"tiff\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":7068006,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Fig.S1.tiff\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/6f2b725669a6fc9aa6539343.tiff\"},{\"id\":95895315,\"identity\":\"357ca0a0-fff8-4f9e-bcb0-1c9251d5c619\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:02\",\"extension\":\"docx\",\"order_by\":4,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":16175,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupportingFigureLegends.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/faccaacab1b444faf1dc71c7.docx\"},{\"id\":95895316,\"identity\":\"f9bc04ec-bf61-42cd-bdd1-acc72bc4eae4\",\"added_by\":\"auto\",\"created_at\":\"2025-11-14 07:12:02\",\"extension\":\"docx\",\"order_by\":5,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":15019,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Table1.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7867960/v1/69250964ffea595528f0e9d3.docx\"}],\"financialInterests\":\"\",\"formattedTitle\":\"Identification and pathogenicity of Raoultella and Pseudomonas species associated with roots of Taraxacum kok-saghyz\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eFundamental study of physiological and biochemical mechanisms underlying the functioning of biological systems is the basis of modern biotechnology. Today, controlled biosynthesis provides production of many target products (substances for pharmacological preparations, human and animal nutrition components, enzymes, fuels etc.) with the necessary quantitative and qualitative properties. New methods for production of natural rubber (NR) from alternative sources are also a strategically important goal of biotechnological community.\\u003c/p\\u003e\\u003cp\\u003eNR is a critical raw material essential for the production of more than 50,000 different rubber and latex products. In most cases, it cannot be replaced by synthetic rubber alternatives (Cherian et al., \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). It possesses unique properties such as elasticity, resiliency, shock resistance, effective heat dispersion, and ability to maintain plasticity at low temperature (Eng \\u0026amp; Ong, \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e2000\\u003c/span\\u003e; McIntyre et al., \\u003cspan citationid=\\\"CR62\\\" class=\\\"CitationRef\\\"\\u003e2000\\u003c/span\\u003e; Puskas, \\u003cspan citationid=\\\"CR72\\\" class=\\\"CitationRef\\\"\\u003e2001\\u003c/span\\u003e; Gronover et al., \\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e). NR is an isoprenoid because its basic backbone structure composed exclusively of 1,4-polymers of the isoprene unit (C\\u003csub\\u003e5\\u003c/sub\\u003eH\\u003csub\\u003e8\\u003c/sub\\u003e) with a \\u003cem\\u003ecis\\u003c/em\\u003e-double bond (Tanaka, \\u003cspan citationid=\\\"CR84\\\" class=\\\"CitationRef\\\"\\u003e2001\\u003c/span\\u003e; Yamashita \\u0026amp; Takahashi, \\u003cspan citationid=\\\"CR98\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). More than 2500 plant species produce NR (Cornish, \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e2001\\u003c/span\\u003e); however, only few of them are able to synthesize a high-quality NR with molecular mass about 10\\u003csup\\u003e6\\u003c/sup\\u003e Da (Mooibroek \\u0026amp; Cornish, \\u003cspan citationid=\\\"CR66\\\" class=\\\"CitationRef\\\"\\u003e2000\\u003c/span\\u003e; van Beilen \\u0026amp; Poirier, \\u003cspan citationid=\\\"CR89\\\" class=\\\"CitationRef\\\"\\u003e2007a\\u003c/span\\u003e\\u003cspan citationid=\\\"CR90\\\" class=\\\"CitationRef\\\"\\u003eb\\u003c/span\\u003e). At the present time natural rubber is produced solely from a single species, the rubber tree (\\u003cem\\u003eHevea brasiliensis\\u003c/em\\u003e), which is grown as genetically similar clones in tropical regions. According to forecasts by the Association of Natural Rubber Producing Countries (ANRPC), total NR consumption is expected to reach 16.7\\u0026nbsp;million tons by 2026\\u003c/p\\u003e\\u003cp\\u003e(\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.reportlinker.com/dataset/228401ad9f7e5cafa9fcca28f25d7f286b8dba1a\\u003c/span\\u003e\\u003cspan address=\\\"https://www.reportlinker.com/dataset/228401ad9f7e5cafa9fcca28f25d7f286b8dba1a\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e),\\u003c/p\\u003e\\u003cp\\u003eand there is no doubt that demand will continue to increase. Therefore, it cannot be ruled out that humanity will face a shortage of NR in near future. Moreover, even regardless of growing demands, NR production from \\u003cem\\u003eH. brasiliensis\\u003c/em\\u003e is at risk, because only a very few closely related clones were used to establish the NR plantations (Cornish, \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). Thus, a lack of genetic diversity puts hundreds of thousands of hectares of plantations in danger. Indeed, genetically almost identical trees are exposed to numerous phytopathogenic infections, including fungal South American Leaf Blight (SALB), caused by \\u003cem\\u003eMicrocyclus (Pseudocercospora) ulei\\u003c/em\\u003e (Guyot et al., \\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e; Guyot \\u0026amp; Guen, \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). This disease is lethal for \\u003cem\\u003eH. brasiliensis.\\u003c/em\\u003e It prevented NR production in Brazil, the country of origin of this species. Currently, the work on developing SALB-resistant plants is in progress, but it will take at least 25 years to introduce high NR yielding, SALB resistant trees (Cornish, \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). Also, it should be noted that Hevea latex products cause severe allergic reactions because of proteins naturally associated with the rubber particles (Siler et al., \\u003cspan citationid=\\\"CR81\\\" class=\\\"CitationRef\\\"\\u003e1996\\u003c/span\\u003e; Bousquet et al., \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e). Therefore, biodiversification of the NR sources is an essential goal that attracts increasing attention from scientific community.\\u003c/p\\u003e\\u003cp\\u003eSeveral rubber-producing species are under development to find a reliable alternative source of NR. These are Rubber dandelion (\\u003cem\\u003eTaraxacum kok-sagyz\\u003c/em\\u003e) (Arias et al., \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e), Guayule (\\u003cem\\u003eParthenium argentatum\\u003c/em\\u003e) (Rousset et al., \\u003cspan citationid=\\\"CR76\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e), and undeservedly forgotten Tau-saghyz (\\u003cem\\u003eScorzonera tau-saghyz\\u003c/em\\u003e) (Buranov \\u0026amp; Elmuradov, \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e). One of them, \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e, fits to obvious requirement to effective NR producer better than others. It has a very short life-cycle (6\\u0026ndash;8 months) relative to other plants, such as \\u003cem\\u003eH. brasiliensis\\u003c/em\\u003e, and is amenable to genetic manipulations. Moreover, its rubber phenotype can be meaningfully analyzed after only ten weeks of cultivation (Amerik et al., \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e; Amerik et al., \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). Remarkably, the agricultural ranges of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e covers most of the regions of the world, and the plant shows little dependence on the climatic conditions of the growing zone. So, it was logical to further investigate this crop in order to make it more attractive for commercial cultivation (Cornish, \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eNumerous studies on the physical and chemical properties of the dandelion NR clearly demonstrated that it has an outstanding quality. For instance, tiers, made from the \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e NR are as resilient as those made from \\u003cem\\u003eH. brasiliensis\\u003c/em\\u003e polymer (Araujo-Morera et al., \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). Notably, molecular mass of dandelion NR is very high. It was reported that it can be as high as 2.2 x 10\\u003csup\\u003e6\\u003c/sup\\u003e Da (Mooibroek \\u0026amp; Cornish, \\u003cspan citationid=\\\"CR66\\\" class=\\\"CitationRef\\\"\\u003e2000\\u003c/span\\u003e; Hallahan \\u0026amp; Keiper-Hrynko, \\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e2004\\u003c/span\\u003e; Cornish, \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). The only potential problem is a large number of associated proteins, similarly to Hevea NR (van Beilen \\u0026amp; Poirier, \\u003cspan citationid=\\\"CR89\\\" class=\\\"CitationRef\\\"\\u003e2007a\\u003c/span\\u003e). Therefore, people who are sensitized to \\u003cem\\u003eH. brasiliensis\\u003c/em\\u003e NR, may also develop an allergic reaction to \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e NR (Siler et al., \\u003cspan citationid=\\\"CR81\\\" class=\\\"CitationRef\\\"\\u003e1996\\u003c/span\\u003e; Bousquet et al., \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e). Thus, NR from dandelion should not be used in medical industry. It should be considered for conventional dry rubber application such as tire production (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.continental.com/en/press/press-releases/20220927-forschungsnetzwerk-neuer-zuechter\\u003c/span\\u003e\\u003cspan address=\\\"https://www.continental.com/en/press/press-releases/20220927-forschungsnetzwerk-neuer-zuechter\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e). The principal tasks of improving the characteristics of this potential alternative source of NR are as follows: acceleration growth and development of plants, formation of a large root biomass, increasing the content of target products, and selection of forms resistant to phytopathogens.\\u003c/p\\u003e\\u003cp\\u003eTo date, industrial cultivation of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e in the field is complicated by the low productivity of plants, even under protected ground conditions, high vulnerability to bacterial and fungal pathogens, and the necessity to create special technologies for collecting and processing rubber-containing roots. Development of methods for the selective destruction of weeds is also a difficult task. Other complications include the danger of over-pollination, uneven germination of seeds, high sensitivity of plants to fluctuations in weather conditions, etc. The time frame is also important. In the field conditions, \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e is cultivated for 2 years.\\u003c/p\\u003e\\u003cp\\u003eThe development of a new technology for growing \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e plants under controlled phytotron conditions (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e) would speed up the solution of many of these problems. The use of the aeroponic cultivation method with optimization of all factors affecting the rate of plant growth and development may lead to improvement of the biosynthesis of target products. Potentially, this approach has obvious commercial prospects.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eAs noted above, among several factors limiting NR production from Hevea fungal disease SALB is the most prominent one because it has a devastating impact on NR production (Guyot et al., \\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e; Guyot \\u0026amp; Guen, \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). SALB wiped out the large-scale \\u003cem\\u003eH. brasiliensis\\u003c/em\\u003e plantations in Brazil and it has not been possible to restart production since that catastrophe. The present production of NR in Brazil is the marginal 1% of world production. Accidental spread of SALB to Southeast Asia would have a severe impact on the NR industry including reduction of production by millions of tons, serious shortage, and, as a result, to drastically higher prices (Cornish, \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eUnfortunately, similar problems arose during the adaptation of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e plants to the conditions of aeroponic cultivation. Plants grew normally for 60\\u0026ndash;70 days of cultivation. Then many specimens showed signs of vascular bacteriosis (withering). Darkening and maceration were observed in plants in the root area, and, finally, roots fell off the shoots (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). It was assumed that this was happening due to increased humidity in the root zone in a phytotron. However, other processes also might be involved including intensification of plant cultivation. It is also likely that latent infection was present initially in seeds, then in plants grown from them. This led to the infected root culture of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e. Remarkably, the \\\"hairy roots\\\" (HR) cultures after some time of cultivation showed clear signs of vascular bacteriosis (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eHere we describe isolation of pathogens from infected plants, their identification and biochemical characterization. We also discuss the results of our studies demonstrating the influence of plant growth conditions (\\u003cem\\u003ein vitro\\u003c/em\\u003e, in a phytotron and in soil) on interaction of endophytic microorganisms with host plants.\\u003c/p\\u003e\"},{\"header\":\"Materials and Methods\",\"content\":\"\\u003cp\\u003ePlants used in this study\\u003c/p\\u003e\\u003cp\\u003eTo perform this study, a collection of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e plants consisting of various population samples was created in the laboratory. Seeds and plants were received from the Vavilov Institute of Plant Genetic Resources (Saint Petersburg, Russian Federation) and from the Institute of Plant Biology and Biotechnology (Almaty, Republic of Kazakhstan). From this collection, highly productive plants with a high content of NR and inulin (the second valuable product that increases commercial value of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e) were selected. Subsequently, with the help of chemotherapy and thermotherapy of seeds (Grondeau et al., \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e1994\\u003c/span\\u003e; Sanna et al., \\u003cspan citationid=\\\"CR77\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e), we created a collection of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e plants cured of phytopathogens \\u003cem\\u003ein vitro\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). These plants were subsequently used to obtain a culture of transformed roots and as a planting material for adaptation and cultivation in an aeroponic phytotrons.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eManifestations of bacterial infection obviously depended on the quality of asepticization of plant explants. However, as subsequent experiments demonstrated, neither effective asepticization of plant explants nor compliance with aseptic rules guaranteed the absence of bacterial infections in \\u003cem\\u003ein vitro\\u003c/em\\u003e cultures. Root rot appeared in all variants of cultivation of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e plants - under \\u003cem\\u003ein vitro\\u003c/em\\u003e conditions, in an aeroponic phytotron, in a culture of HR, as well as when in soil grown plants.\\u003c/p\\u003e\\u003cp\\u003eGrowing plants in an aeroponic phytotron\\u003c/p\\u003e\\u003cp\\u003eAs noted, for controlled growing of plants, automatic devices (phytotrons) have been developed (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). Remarkably, several critical parameters including temperature, composition of the gas environment with adjustable CO\\u003csub\\u003e2\\u003c/sub\\u003e concentration, spectral composition and intensity of the light flux are under strict control in phytotrons (Martirosyan et al., \\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). The major principle of the aeroponic cultivation is to provide plants with mineral components without use of soil or soil substitutes. Thus, growing plants in artificial climatic conditions leads to the creation of the most favorable environment for their growth and development (Martirosyan et al., \\u003cspan citationid=\\\"CR59\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e; Martirosyan et al., \\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e plants, grown from treated seeds \\u003cem\\u003ein vitro\\u003c/em\\u003e in the phase of 3\\u0026ndash;4 true leaves (days19-20), were adapted and planted in aeroponic phytotrons. Plants received mineral nutrition components by finely dispersed spraying a nutrient solution directly into the root system zone, balanced in composition for each phase of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e growth. In a phytotron, plants reached full size and high NR content (up to 7\\u0026ndash;10%), in about 120 days of vegetation period (Martirosyan et al., \\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eCreation of the root culture with the HR phenotype and \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e composite plants\\u003c/p\\u003e\\u003cp\\u003eIt was important to investigate whether the biosynthesis rate and concentration of NR and inulin would increase with increasing root biomass. For this purpose, we transformed the \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e root culture with bacterium \\u003cem\\u003eAgrobacterium rhizogenes\\u003c/em\\u003e (strain R1000). This led to the so-called HR phenotype. The culture of transformed roots is a convenient system that is often used for studying the metabolic processes of plants (Thwe et al., \\u003cspan citationid=\\\"CR86\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e; Khazaei et al., \\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). The resulting root cultures will be examined for NR and inulin content. Subsequently, these cultures were used for obtaining the composite plants. Specifically, roots had a pronounced HR phenotype, while the aerial parts looked like the original wild-type plants.\\u003c/p\\u003e\\u003cp\\u003eVegetative growth of plants and manifestation of pathogenesis\\u003c/p\\u003e\\u003cp\\u003eIn the process of curing \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e of the internal infection that affected the root system, two types of bacteria were initially isolated (below). Subsequently, the infectivity of the resultant bacterial cultures was analyzed. \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e roots were treated with the bacteria, and pronounced symptoms of bacteriosis were observed. The symptoms were identical to those initially observed in growing \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e plants under aeroponic conditions, as well as \\u003cem\\u003ein vitro\\u003c/em\\u003e. Remarkably, the same pattern of damage was seen during vegetation experiments in soil mixture (peat, sand and soil, 2:1:1). To avoid the influence of other microorganisms on growth processes the soil was pre-autoclaved twice. Plants were grown outdoors in natural climatic conditions of Moscow region for 180 days, from May to October (Table\\u0026nbsp;1). Plants were divided into 3groups: 1 control and 2 experimental. Each group consisted of 10 vegetation vessels with plants. Experiments were repeated three times. Thus, 90 vessels were analyzed. Specifically:\\u003c/p\\u003e\\u003cp\\u003e1st group. Control, intact plants \\u003cem\\u003ein vitro\\u003c/em\\u003e. Grown from seeds that have undergone thermotherapy and chemotherapy, without bacterial infection.\\u003c/p\\u003e\\u003cp\\u003e2nd group. Intact plants grown from seeds that have undergone chemotherapy and thermotherapy, infected with isolated bacteria during the vegetation season.\\u003c/p\\u003e\\u003cp\\u003e3rd group. Intact plants grown from seeds that have not undergone chemotherapy and thermotherapy, infected with isolated bacteria during the vegetation season.\\u003c/p\\u003e\\u003cp\\u003eBacterial cultures isolated as described below were grown in a rich liquid nutrient medium. (g/l: peptone 10; yeast extract 5; NaCl 10). Cultures were incubated for 72 hours on an orbital shaker, 200 rpm, 28\\u0026deg;C. For inoculation, plants, before the onset of the budding phase, were watered with a diluted (1:20) suspension of bacteria (approximately 100 ml per plant).\\u003c/p\\u003e\\u003cp\\u003eIsolation of the pathogenic microorganisms\\u003c/p\\u003e\\u003cp\\u003eIsolation of bacterial cells was carried out as follows. Infected plants were washed with sterile water and dried in air. Next, at the junction of the root collar with the caudex, where the symptoms of necrosis were most pronounced, transverse sections (3\\u0026ndash;5 mm thick) were made with a sterile scalpel. For surface asepticization, fragments of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e infected roots were placed in sterile 100 ml conical flasks containing 50 ml 70% ethanol. Flasks were shaken on a rotary shaker for 120 sec. To remove residual ethanol, the plant material was washed 5 times with sterile distilled water. Then, the root fragments were transferred to sterile flasks containing 50 ml 5% sodium hypochlorite (NaClO), for 60 s. To remove residual NaClO, the plant material was washed 10 times with sterile distilled water. Finally, the plant material was placed into the 50 ml 6% H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e solution for 60 sec. To remove H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e the root fragments were where washed 5 times with 100 ml sterile H\\u003csub\\u003e2\\u003c/sub\\u003eO. The surface asepticization procedure was done in a laminar flow hood.\\u003c/p\\u003e\\u003cp\\u003eApproximately 100 mg of treated roots of each sample were cut into small pieces and placed in sterile 2 ml microtubes containing sterile stainless-steel balls, (5mm diameter), for further homogenization in TissueLyser LT (Qiagen).\\u003c/p\\u003e\\u003cp\\u003eNext, the roots, crushed into a pulp, were centrifuged (1 min, 2500g) and 1 ml of the supernatants was transferred into sterile 15 ml tubes, then 10 ml of sterile distilled water was added. The tubes were hermetically sealed and placed on a rotary shaker (150 rpm) at 25\\u0026deg;C for 2 h. 100 \\u0026micro;l of each sample was plated in triplicate onto Petri dishes with LB medium and incubated at 28\\u0026deg;C for 120 hours. Colonies were selected from each plate based on their color, texture, and morphology. To evaluate the effectiveness of surface sterilization, 100 \\u0026micro;l of liquid after the last wash (for each analyzed sample) was plated on Luria nutrient agar.\\u003c/p\\u003e\\u003cp\\u003eBiochemical identification of the plant pathogens (Ksz-1, Ksz-2)\\u003c/p\\u003e\\u003cp\\u003eFor identification of isolated bacterial cultures, named Ksz-1 and Ksz-2, biochemical approaches were employed. The API 20 NE (Biomerieux, France) system facilitates identification of non-fastidious Gram-negative rod bacteria not belonging to the \\u003cem\\u003eEnterobacteriaceae\\u003c/em\\u003e. The API 20 NE strip consists of microtubes containing dehydrated media and substrates. The media microtubes containing conventional tests were inoculated with a bacterial suspension which reconstituted the media. After incubation, the metabolic end products were detected by indicator systems or addition of reagents. The substrate microtubes contained assimilation tests and were inoculated with a minimal medium. If bacteria were capable of utilizing the corresponding substrate, then they would grow. Briefly, 5ml of distilled water was added to the honeycombed wells of the tray of an incubation box to create a humid atmosphere. Then API 20 NE strip was placed in the box. 1\\u0026ndash;4 colonies of identical morphology were resuspended in 2ml of API 0.85% saline in a sterile test tube. All tests (GLU, ADH, URE, ESC, GEL, PNPG, NO3, TRP etc.) were performed as described in the manufacturer\\u0026rsquo;s manual. The APIWEB\\u0026trade; software was employed for identification of the organisms.\\u003c/p\\u003e\\u003cp\\u003eAPI 10 S (Biomerieux, France) is a qualitative standardized system intended of identification of \\u003cem\\u003eEnterobacteriaceae\\u003c/em\\u003e and other Gram-negative rod bacteria. The protocol API 10 S is very similar to the protocol described above. All tests were done according to the manufacturer\\u0026rsquo;s manual.\\u003c/p\\u003e\\u003cp\\u003eMolecular-biological identification of the \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e pathogens, PCR and sequencing\\u003c/p\\u003e\\u003cp\\u003eFor the preliminary identification of the bacterial species PCR amplification and sequencing of the variable 16S rDNA (Yamamoto \\u0026amp; Harayama, \\u003cspan citationid=\\\"CR95\\\" class=\\\"CitationRef\\\"\\u003e1998\\u003c/span\\u003e) region of Ksz-1 and Ksz-2 were performed using conservative primers 8f \\u0026ndash; agagtttgatcctggctcag and 926r \\u0026ndash; ccgtcaattcctttagagttt. The amplification was conducted as follows: denaturation at 95\\u003csup\\u003eo\\u003c/sup\\u003eC for 3 min followed by 35 cycles of 95\\u003csup\\u003eo\\u003c/sup\\u003eC for 30 s, annealing at 57\\u003csup\\u003eo\\u003c/sup\\u003eC for 30 s, and extension at 72\\u003csup\\u003eo\\u003c/sup\\u003eC for 1 min 30 s; with a final extension at 72\\u003csup\\u003eo\\u003c/sup\\u003eC for 5 min. Partial nucleotide sequences of the 16S rRNA genes were determined directly from the PCR fragments according to the method of Edwards (Edwards et al., \\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e1989\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eFor further characterization of the \\u003cem\\u003ePseudomonas\\u003c/em\\u003e species (Ksz-1), PCR amplification of the \\u003cem\\u003egyr B\\u003c/em\\u003e and \\u003cem\\u003erpo D\\u003c/em\\u003e variable gene fragments (Yamamoto \\u0026amp; Harayama, \\u003cspan citationid=\\\"CR95\\\" class=\\\"CitationRef\\\"\\u003e1998\\u003c/span\\u003e; Yamamoto et al., \\u003cspan citationid=\\\"CR97\\\" class=\\\"CitationRef\\\"\\u003e2000\\u003c/span\\u003e). was performed using conservative pairs of primers ggagcagtacatcaaggacga/ gggtccatggtggtttcccacA and cctccgaaggtggccgtctgtc/ ACATGCGCAGGAAGTCGGCACG for \\u003cem\\u003egyr B\\u003c/em\\u003e and \\u003cem\\u003erpo D\\u003c/em\\u003e respectively. \\u003cem\\u003egyrB\\u003c/em\\u003e encodes subunit B of DNA gyrase, \\u003cem\\u003erpoD\\u003c/em\\u003e \\u0026ndash; sigma factor of RNA polymerase. The amplification was conducted as described above. Amplified DNA fragments were gel purified using QIAquick Gel Extraction Kit (Qiagen) and cloned into pAL2-T plasmid (Eurogen). Nucleotide sequences of the cloned DNAs were determined using plasmid specific SP6 \\u0026ndash; ATTTAGGTGACACTATAGAATACT and T7 \\u0026ndash; GTAATACGACTCACTATAGGG primers. Identification of the \\u003cem\\u003eRaoultella\\u003c/em\\u003e species (Ksz-2) was conducted similarly.\\u003c/p\\u003e\\u003cp\\u003eThe BLASTn software was employed to compare determined sequences to GenBank.\\u003c/p\\u003e\\u003cp\\u003eInoculation of a culture of isolated HR and plants \\u003cem\\u003ein vitro\\u003c/em\\u003e with bacteria isolated from the roots of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003eAn inoculation media was prepared from bacteria grown on Petri dishes with LB media for 24 hours. Bacteria were resuspended in 10 mM MgCl\\u003csub\\u003e2\\u003c/sub\\u003e, Silwet L-77 was added at a final concentration of 200 mkl l\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e. OD 600 of inoculation media was 0.05 (approximately 2.5 \\u0026times; 10 \\u003csup\\u003e7\\u003c/sup\\u003e colony forming units per ml (CFU ml \\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e). The fragments of healthy HR and \\u003cem\\u003ein vitro\\u003c/em\\u003e intact plants were placed in 100 ml conical flasks containing 50 ml of inoculation media. Flasks were placed in a vacuum chamber and vacuuming was carried out at 0.8 atm for 120 sec. Next, HR cultures and plants were washed three times with 100 ml sterile distilled water. Washed HR-infected cultures were placed on Petri dishes, and plants were placed in phytocontainers on agar with minimal MS medium (Murashige-Skoog), which does not contain carbohydrates. So, the only source of carbon was the roots of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e. Incubation of the dishes was carried out at 28 \\u0026ordm;С for 10 days, phytocontainers - for 3 days. Number of repetitions \\u0026minus;\\u0026thinsp;10. Then the dishes were placed on light racks (light intensity of 100 \\u0026micro;mol/m2s) for 25 days. Phytocontainers were placed on light racks for 32 days. The development of symptoms of bacteriosis (darkening) of the roots were monitored. Dishes with uninfected HR roots on MS medium and with bacterial cultures on carbohydrate-free MS medium were used as a control. Phytocontainers with healthy plants of an appropriate age in complete MS medium served as another control.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003eMolecular biological and biochemical identification of the \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e pathogens\\u003c/p\\u003e\\u003cp\\u003eAs noted, cultures designated as Kcz-1 and Kcz-2 were isolated from microbiota of infected roots. They were grown on L-agar and minimal medium with pectin, respectively.\\u003c/p\\u003e\\u003cp\\u003eRemarkably, Gram staining showed that these bacteria are gram-negative (Fig.\\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e)\\u003c/p\\u003e\\u003cp\\u003ePCR-amplification and sequence analysis (comparison to GenBank database) of the variable fragments of 16S rDNA revealed that Ksz-1 belongs to the systematic groups: \\u003cem\\u003eBacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales; Pseudomonadaceae; Pseudomonas.\\u003c/em\\u003e Five species of \\u003cem\\u003ePseudomonas\\u003c/em\\u003e show highest levels of identity to the 16S rDNA Ksz-1 fragment. These species are: \\u003cem\\u003ePseudomonas putida\\u003c/em\\u003e, \\u003cem\\u003ePseudomonas plecoglossicida\\u003c/em\\u003e, \\u003cem\\u003ePseudomonas taiwanensis\\u003c/em\\u003e, \\u003cem\\u003ePseudomonas monteilii\\u003c/em\\u003e, and \\u003cem\\u003ePseudomonas fluorescens.\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003eSimilarly, the 16S rDNA sequence of Ksz-2 was also compared to the GenBank database. It was shown that Ksz-2 belongs to the systematic groups: Bacteria; \\u003cem\\u003eProteobacteria; Gammaproteobacteria; Enterobacteriales; Entrobacteriaceae; Klebsiella/Raoultella group; Raoultella\\u003c/em\\u003e. Sequence analysis suggested that Ksz-2 is likely \\u003cem\\u003eRaoultella terrigena\\u003c/em\\u003e, \\u003cem\\u003eRaoultella ornithinolytica\\u003c/em\\u003e, or \\u003cem\\u003eKlebsiella aerogenes\\u003c/em\\u003e.\\u003c/p\\u003e\\u003cp\\u003eThese bacteria are differed slightly in their gene sequences. So, identification of Ksz-1 and Ksz-2 is difficult at the 16S rDNA level. In an attempt to identify bacterial species, we relied on biochemical testing as the types of biochemical reactions of each organism act as a thumbprint for its identification (Brenner et al., \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e). We used API 20 NE and API 10 S tests for biochemical strain characterization (Tables S1, S2). Kcz-1 demonstrated close similarity to the \\u003cem\\u003eP. putida\\u003c/em\\u003e species (the ability to grow on mannitol, maltose, mannose and acetylglucosamine as the only carbon sources), but, on the other hand, unlike \\u003cem\\u003eP. putida\\u003c/em\\u003e, Kcz-1 produced indole from tryptophan, lacked arginine dihydrolase activity, and assimilated arabinose. Several features of Ksz-2, such as absence of gelatinase activity, indole formation during growth on a medium containing tryptophan, absence of the urease activity and high ornithine decarboxylase activity, as well as the ability to grow at 10\\u0026deg;C and at 41\\u0026deg;C suggest that this species is \\u003cem\\u003eR. terrigena\\u003c/em\\u003e. However, it was reported that all species of \\u003cem\\u003eRaoultella\\u003c/em\\u003e, lacked pectinase activity (Hansen et al., \\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e2004\\u003c/span\\u003e; Sekowska, \\u003cspan citationid=\\\"CR79\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e), while corresponding activity of the Kcz-2 strain was relatively high. Interestingly, the Ksz-2 strain grew equally efficiently on media containing apple and citrus pectin and on a medium with polygalacturonic acid as the sole carbon source. By contrast, the Kcz-1 strain was capable of growing only on the last indicated medium (data not shown). Perhaps, this isolate lacks the esterases pectin methylesterase and pectin acetylesterase, suggesting that it lacks pectin esterase activity. Thus, biochemical approaches, as well as analysis of the 16S rDNA sequences failed to identify \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e pathogenic species.\\u003c/p\\u003e\\u003cp\\u003eTo distinguish between these species, we PCR-amplified and sequenced fragments of the \\u003cem\\u003egyrB\\u003c/em\\u003e and \\u003cem\\u003erpoD\\u003c/em\\u003e genes that have been successfully used for analysis of the \\u003cem\\u003ePseudomonas spp\\u003c/em\\u003e (Yamamoto \\u0026amp; Harayama, \\u003cspan citationid=\\\"CR95\\\" class=\\\"CitationRef\\\"\\u003e1998\\u003c/span\\u003e; Yamamoto et al., \\u003cspan citationid=\\\"CR97\\\" class=\\\"CitationRef\\\"\\u003e2000\\u003c/span\\u003e). Comparison to the GeneBank database convincingly demonstrated that Ksz-1 is \\u003cem\\u003eP. putida\\u003c/em\\u003e (Kivisaar, \\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e) (99.79% and 98.79% of identity for \\u003cem\\u003egyrB\\u003c/em\\u003e and \\u003cem\\u003erpoD\\u003c/em\\u003e fragments respectively). Sequences of the \\u003cem\\u003eP. putida gyrB\\u003c/em\\u003e and \\u003cem\\u003erpoD\\u003c/em\\u003e genes are available in the GenBank database (accession numbers CP046872 and LR135071). Primers, corresponding to the conserved regions of the \\u003cem\\u003eP. putida gyrB\\u003c/em\\u003e gene, were successfully used for amplification of the Ksz-2 fragment. The identity level of this fragment to the \\u003cem\\u003eR. terrigena gyrB\\u003c/em\\u003e gene was 99.07%. Interestingly, \\u003cem\\u003erpoD\\u003c/em\\u003e primers have failed to amplify the \\u003cem\\u003eR. terrigena\\u003c/em\\u003e gene, but non-specific PCR have led to amplification of the \\u003cem\\u003eera\\u003c/em\\u003e gene encoding GTP-binding protein (March, \\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e1992\\u003c/span\\u003e). A very high identity level of the Ksz-2 \\u003cem\\u003eera\\u003c/em\\u003e gene (99.53%), combined with the \\u003cem\\u003egyrB\\u003c/em\\u003e data, clearly demonstrate that Ksz-2 is \\u003cem\\u003eR. terrigena\\u003c/em\\u003e (Appel et al., \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). Sequences of the \\u003cem\\u003eR. terrigena gyrB\\u003c/em\\u003e and \\u003cem\\u003eera\\u003c/em\\u003e genes are available in the GenBank data base (accession numbers LR134253.1 and LR13127.1).\\u003c/p\\u003e\\u003cp\\u003eThe influence of the environment on the development of pathogenesis in \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003eVascular bacteriosis of roots of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e cultivated by plantation methods was previously described (below). We performed similar experiments in Moscow region (moderate climate, Table\\u0026nbsp;1). At the beginning of the vegetation season, the plants developed evenly and bloomed profusely, and seeds were set. In the beginning of May, the weather was moderate, the average daily air temperature ranged from +\\u0026thinsp;15 \\u0026ordm;С to 21\\u0026ordm;С. The plants from all three groups developed evenly, without signs of bacterial infection, and basically all specimens bloomed vigorously. In June-July, daytime temperatures rose to 30 \\u0026ordm;С, and on certain days up to 33\\u0026deg;С. A pronounced period of high daytime air temperatures lasted 8\\u0026ndash;10 days. Those plants that were grown from cured material \\u003cem\\u003ein vitro\\u003c/em\\u003e (group 1) were not affected by heat and continued to actively grow and develop (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e). In experimental groups, the plants gradually began to wither, and eventually the leaves dried out and fell off (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e, \\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003e). After the onset of moderate daytime temperatures favorable for the growth of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e (15\\u0026ndash;20\\u0026ordm;С), plants from the experimental group 2 began to recover new, green leaves grew without signs of bacterial infection. In the group 3, plants initially showed signs of recovery, but both bacterial isolates caused extensive damage to above-ground tissue, resulting in plant death approximately 47\\u0026ndash;50 days after inoculation (not shown). Thus, bacterial infection affects resistance of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e to elevated temperature.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eP. putida\\u003c/em\\u003e and \\u003cem\\u003eR. terrigena\\u003c/em\\u003e are causative agents of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e root rot\\u003c/p\\u003e\\u003cp\\u003eThe pathogenicity of \\u003cem\\u003eP. putida\\u003c/em\\u003e and \\u003cem\\u003eR. terrigena\\u003c/em\\u003e was tested on a culture of isolated \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e roots with the HR phenotype and on plants \\u003cem\\u003ein vitro\\u003c/em\\u003e. Both of bacteria were introduced into T. \\u003cem\\u003ekok-saghys\\u003c/em\\u003e HR cultures and plants \\u003cem\\u003ein vitro\\u003c/em\\u003e by vacuum infiltration. This led to characteristic disease-like symptoms such as black necrotic areas initially at the root tips. Remarkably, after 30 days of growth the root biomass became completely brown (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003ePlants infected with \\u003cem\\u003eP. putida\\u003c/em\\u003e and \\u003cem\\u003eR. terrigena in vitro\\u003c/em\\u003e showed gradually increasing symptoms of infection. Initially infection affected roots and fully developed leaves located at the base of the plant (in 6\\u0026ndash;7 days after inoculation. Then infection started to spread to the upper part of the plant in approximately 14 days after inoculation. Finally, in 35 days after introduction of bacteria into \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e tissue, plant died.\\u003c/p\\u003e\\u003cp\\u003eThe severity of disease symptoms did not change in plants with cut root tips compared to uncut roots, even though bacterial plant pathogens typically require a wound or natural opening to enter the tissue. In addition to \\u003cem\\u003ein vitro\\u003c/em\\u003e studies, we tested the ability of isolates to infect soil-grown \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e plants in growing vessels. Both bacterial isolates caused extensive damage to above-ground part of the plants, resulting in plant death in approximately 37\\u0026ndash;40 days after penetration of inoculates into the soil, immediately surrounding the root system. Both bacterial isolates also caused plant death when penetrating into the leaves (data not shown).\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eAs noted in the introduction, ontrolled biosynthesis provides unique opportunity to obtain target products with the necessary quantitative and qualitative characteristics. However, the results, in addition to establishing the optimal parameters of the bioprocess, critically depend on the properties of the starting biological material. During \\u003cem\\u003ein vitro\\u003c/em\\u003e cultivation of plants, the long-term and asymptomatic presence of endophytic bacteria is due to the suppression of their growth by factors that influence the processes of cultivation of plant explants (low temperature and light intensity, the presence of immune activators, antibiotics and other plant protection chemicals in the culture media). On the other hand, plants generate a sufficient amount of root exudates to support bacterial growth and activity. Bacteria associated with plant tissues in \\u003cem\\u003ein vitro\\u003c/em\\u003e culture play an important role in various physiological and pathogenetic processes. Their identification helps to understand how these microorganisms affect plant growth and development, disease resistance and productivity (Trivedi et al., \\u003cspan citationid=\\\"CR87\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eIn this study, performed in an aeroponic phytotron, as well as \\u003cem\\u003ein vitro\\u003c/em\\u003e culture of plants and HR, we identified two bacteria associated with root rot of the NR-producing plant \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e - \\u003cem\\u003eP. putida\\u003c/em\\u003e and \\u003cem\\u003eR. terrigena\\u003c/em\\u003e. We also investigated their pathogenicity. Remarkably, the relationships between these bacterial species and other plant species have been described in the literature (Kivisaar, \\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e; Mengistu, \\u003cspan citationid=\\\"CR63\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e; Mart\\u0026iacute;nez-Garc\\u0026iacute;a \\u0026amp; de Lorenzo, 2024). It is noteworthy that several studies demonstrated that \\u003cem\\u003eP. putida\\u003c/em\\u003e species are involved a wide range of processes, ranging from plant growth stimulation and bioremediation to pathogenicity (Kivisaar, \\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). It was also shown that some endophytic strains of \\u003cem\\u003eP. putida\\u003c/em\\u003e and \\u003cem\\u003eR. terrigena\\u003c/em\\u003e have the ability to stimulate plant growth in a natural ecosystem (Costa-Gutierrez et al., \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e; Zakharchenko et al., \\u003cspan citationid=\\\"CR99\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eInterestingly, three strains of \\u003cem\\u003eP. putida\\u003c/em\\u003e, were characterized in a gnotobiotic system, with a specific microbial community. A clear inhibitory effect on pea growth under different environmental conditions was demonstrated. Moreover, these strains affected the root morphology, which led to a decrease in root biomass (Berggren et al., \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e2001\\u003c/span\\u003e). It is also important to note that some bacterial isolates previously identified as growth promoters may have detrimental effects on plant growth if the titer is too high (Glick et al., \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e1998\\u003c/span\\u003e; Reed \\u0026amp; Glick, \\u003cspan citationid=\\\"CR74\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e; Premachandra et al., \\u003cspan citationid=\\\"CR70\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eInteraction of the bacteria \\u003cem\\u003eP. putida\\u003c/em\\u003e and \\u003cem\\u003eR. terrigena\\u003c/em\\u003e with plants is usually described as symbiosis (Hardoim et al., \\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e). However, our data suggest that under certain conditions well-characterized endophytic bacteria can act as pathogens. To prove that, in fact, the two bacterial species we isolated can be pathogens of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e, we used them to infect HR cultures and reinfect \\u003cem\\u003ein vitro\\u003c/em\\u003e plants of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e that had previously have been cured of these bacteria.\\u003c/p\\u003e\\u003cp\\u003eThe high adaptability of \\u003cem\\u003eP. putida\\u003c/em\\u003e is based on many features, including high genetic plasticity and broad metabolic, transport, signaling and regulatory capabilities (Nikel \\u0026amp; de Lorenzo, \\u003cspan citationid=\\\"CR68\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). Interestingly, \\u003cem\\u003ePseudomonas\\u003c/em\\u003e species can use various chemical compounds, simple and complex, as the only source of carbon depending on their living conditions (Song et al., \\u003cspan citationid=\\\"CR82\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e). Thus, \\u003cem\\u003eP. putida\\u003c/em\\u003e strain mt-2 isolated from soil in Japan is able to grow on meta-toluate as the sole carbon source (Vercellone-Smith \\u0026amp; Herson, \\u003cspan citationid=\\\"CR93\\\" class=\\\"CitationRef\\\"\\u003e1997\\u003c/span\\u003e\\u003cb\\u003e)\\u003c/b\\u003e. Sequencing of its genome has shown that it contains multiple genes encoding proteins responsible for degradation of plant-derived chemicals, including various methoxylated aromatic acids, hydroxylated aromatic acids, and other compounds (Castillo et al., \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e). Remarkably, genome also contains genes encoding proteins responsible for degradation of fructose (Velazquez et al., \\u003cspan citationid=\\\"CR91\\\" class=\\\"CitationRef\\\"\\u003e2004\\u003c/span\\u003e) and glucose (Castillo et al., \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e), which are the most common sugars present in plant root exudates (Kamilova et al., \\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eSome diseases of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e cultivated by plantation methods were previously described. These diseases are typically caused by soil bacteria, fungi, and oomycetes that penetrate roots and enter xylem, where they interfere with the transport of water and minerals. Among them, vascular bacteriosis of roots. The causative agent of the disease is a bacterium \\u003cem\\u003ePseudomonas campestris\\u003c/em\\u003e (Tscheremissinov, \\u003cspan citationid=\\\"CR88\\\" class=\\\"CitationRef\\\"\\u003e1951\\u003c/span\\u003e). Seedlings and young plants die. The disease is more common in soils with a very high humidity. Diseased plants appear wilted in the second half of the day. Yellowing or browning of the central cylinder is clearly visible. As a result, leaves wither and die. This can lead to damage to the entire plant and ultimately to the plant death (Tscheremissinov, \\u003cspan citationid=\\\"CR88\\\" class=\\\"CitationRef\\\"\\u003e1951\\u003c/span\\u003e). Similar changes can be caused by increased temperature and drought, and together they affect the composition, abundance or activity of microbial communities associated with plants. It should be noted that similar symptoms can appear in plants despite the presence of sufficient water in the soil, which the plant cannot absorb (Martirosyan L. et al., personal communication). We observed similar phenomena during vegetation experiments (above).\\u003c/p\\u003e\\u003cp\\u003eThe summer drought caused the \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e plants to shed leaves and flower buds. This phenomenon was called \\u0026ldquo;summer dormancy\\u0026rdquo; (Scarth et al., \\u003cspan citationid=\\\"CR78\\\" class=\\\"CitationRef\\\"\\u003e1947\\u003c/span\\u003e). Originally it was assumed that the reason was adverse conditions such as drought. However, currently \\u0026ldquo;summer dormancy\\u0026rdquo; is defined as an intrinsic trait independent of environmental conditions (Volaire \\u0026amp; Norton, \\u003cspan citationid=\\\"CR94\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e). Conceivably, the reason of summer dormancy is a consortium of bacteria and their antagonism towards the host plant. We assume that some of endophytic bacteria, upon the onset of unfavorable conditions for them, synthesize plant growth inhibitors, in particular, abscisic acid, which triggers plant defense mechanisms from drought (Chen et al., \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). When such mechanisms are launched, additional watering does not lead to an improvement in the condition of the plants, but on contrary, some bacteria from the consortium are activated, and destruction of plant tissue occurs, primarily in the area where the roots join the caudex.\\u003c/p\\u003e\\u003cp\\u003eObviously, optimal growth conditions are not reachable in most environments and, therefore, plants exposed to numerous abiotic and biotic stresses are prone to diseases.\\u003c/p\\u003e\\u003cp\\u003eFor example, an auxin-secreting strain of \\u003cem\\u003eP. putida\\u003c/em\\u003e negatively affects the tolerance of \\u003cem\\u003eArabidopsis thaliana\\u003c/em\\u003e to water stress, while promoting plant growth under normal watered conditions. Plants subjected to water stress and simultaneously inoculated with \\u003cem\\u003eP. putida\\u003c/em\\u003e showed signs of wilting and decreased moisture content compared to plants subjected to water stress without inoculation. Certainly, the severity of the reaction depended on the amount of inoculum (Shah et al., \\u003cspan citationid=\\\"CR80\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eIt has been demonstrated that environmental factors are key components influencing the development of plant diseases (Keane \\u0026amp; Kerr, \\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e1997\\u003c/span\\u003e; Brader et al., \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). These include temperature, precipitation (i.e., dew, rainfall, and snow) intensity and duration, wind, and aerial pollution (including CO\\u003csub\\u003e2\\u003c/sub\\u003e and ozone content). Soil parameters such as organic compound, pH, nutrient content, and content of toxic components (e.g., metals, salt, and pesticides) are also critical (Brader et al., \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). Moreover, quantity and quality of light required for plant immunity (Hua, \\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). Interestingly, temperature stress signal pathways overlap with multiple pathways responsible for the expression of disease-resistance proteins and defense mechanisms against fungi, nematodes, and viruses (Hua, \\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). Also, resistance to pathogen attack can be enhanced by ozone and UV stresses. This phenomenon is called cross-tolerance (Bowler \\u0026amp; Fluhr, \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e2000\\u003c/span\\u003e). Noteworthy, humidity plays a pivotal role in disease development (Gent at al., 2013; Giauque \\u0026amp; Hawkes, \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e\\u003cb\\u003e)\\u003c/b\\u003e. Biotic factors also play an important role in infection process. The most crucial is certainly microbiota containing endophytes and microbes of rhizosphere (Mortier et al., \\u003cspan citationid=\\\"CR67\\\" class=\\\"CitationRef\\\"\\u003e2012\\u003c/span\\u003e Brader et al., \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). In the natural environment, bacteria face a variety of stress conditions, such as carbon starvation, suboptimal nutrient balance (e.g., lack of N or P sources), changes in hydration conditions, desiccation, lack of suitable terminal electron acceptors, and suboptimal pH and temperature (Ramos et al., \\u003cspan citationid=\\\"CR73\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eThus, suggestion that environment plays a key role in pathogenicity led to numerous models that shed light on the mechanistic insides of plant diseases (Garrett et al., \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e; Juroszek et al., \\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e). The influence of climatic factors, including increases in temperature and CO\\u003csub\\u003e2\\u003c/sub\\u003e levels, and extreme fluctuations in humidity levels, on the interaction of plants and microorganisms is actively being studied (Juroszek \\u0026amp; Von Tiedemann, \\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e; Velasquez et al., \\u003cspan citationid=\\\"CR92\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). As noted, in most cases, under these conditions, endophytic microorganisms have a beneficial effect on plants. However, endophytic microorganisms associated with plants react to some environmental changes in a very unique way. Specifically, catabolic processes are activated. This stimulates pathogenesis in the plant-microorganism relationship (Tanaka et al., \\u003cspan citationid=\\\"CR85\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e; Eaton et al, \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e). Overall, pathogens trigger a cascade of reactions in plants that lead to the synthesis of stress metabolites, including H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e, phytoalexins, and stress signals such as abscisic acid, jasmonic acid, and salicylic acid (Lichtenthaler, \\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e1998\\u003c/span\\u003e; Fan et al., \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e2009\\u003c/span\\u003e; Bharath et al., \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eThe pathogenicity of opportunistic endophytes depends on the triggering of a cascade of regulatory reactions in metabolic processes. These bacteria use a number of genetic tools to cause diseases in their hosts. Significant progress has been made in recent years in identifying virulence factors of opportunistic bacteria. For example, a disease known as Fern Deformation Syndrome (FDS) results from latent infections with harmful fluorescent pseudomonads, which cause damage when a threshold population is reached (Kloepper et al., \\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eCatabolic processes in plant cells play a key role in the life of bacteria. As a result of activation of the plant catabolic systems by bacteria, the rate of breakdown of complex molecules is accelerated and the energy necessary to maintain the vital activity of bacterial cells is released. Bacteria use this energy for synthesis of substances necessary for their own needs. Conceivably, under stress conditions (e. g. heat or light intensity, starvation etc.), the activity of catabolic processes may increase, allowing bacterial cells to mobilize the necessary resources for survival and recovery. The activity of the catabolic systems of endophytic bacteria depends on availability of nutrients such as carbohydrates, fats and proteins. A lack of essential macro- and microelements may slow down the catabolic processes. Plant growth regulators, such as abscisic acid, ethylene, gibberellic acid etc. may potentially affect catabolic processes. Infection by phytopathogens or pests (e. g. insects) may also significantly change the rate of catabolism. We suggest that in \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e plants, the so-called \\\"summer dormancy\\\" may develop due to high ambient temperatures. Suboptimal, high temperatures in the root zone of plants may initiate the activity of bacterial enzymes. They, in turn, can accelerate metabolic processes, including catabolic ones. In addition, these factors may synergistically interact with each other, affecting the overall activity of catabolic systems.\\u003c/p\\u003e\\u003cp\\u003eThe size of potential pathogen population is also important for disease development. Leatherleaf fern (\\u003cem\\u003eRumohra adiantiformis\\u003c/em\\u003e) is a valuable ornamental plant used in cut flower arrangements. The disease known as FDS (above) was reported in 1980s. It causes distortions of ferns and other prominent symptoms (Kloepper et al., \\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e). Interestingly, the severity of FDS correlates with the size of populations of opportunistic endophytic fluorescent \\u003cem\\u003ePseudomonas\\u003c/em\\u003e inside rhizomes of plants with distorted fronds (Kloepper et al., \\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e). It was noted that distribution of FDS coincided with the areas of widespread use of Benlate systemic fungicide (Mills et al., \\u003cspan citationid=\\\"CR65\\\" class=\\\"CitationRef\\\"\\u003e1996\\u003c/span\\u003e). Conceivably, Benlate act as an inducing factor for FDS. It was shown that 24 months after treatment with Benlate pronounced FDS symptoms were present along with increased endophytic populations of fluorescent pseudomonads inside rhizomes (Kremer et al., \\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e1996\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eUnder aeroponic growing conditions, plant metabolism changes significantly. Specifically, fluctuations in moisture levels in the root zone and on the leaf surface have a significant impact on concentration, osmolarity and other characteristics of the components of the nutrient solution, which, in turn, affect their availability for adsorption and uptake by root hairs (Chiaranunt \\u0026amp; White, \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). During the period of growth and development of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e in a phytotron, the physical and chemical parameters of the environment constantly change as the root system and leaves grow from the juvenile stage to the aging stage. The morphology and anatomical features of tissues and organs also change. Some substances accumulate, while the biosynthesis of others slows down or stops altogether. These changes certainly affect the physiology and biochemistry of the consortium of bacteria, which are always present both on the surface of plants and in the intercellular space of plant tissues [Martirosyan et al., \\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e]. The results of antagonistic interactions between opportunistic endophytic bacteria and their plant hosts depend on the virulence factors of the induced bacteria, i.e. bacteria that have emerged from the dormant state in response to changes in the host's metabolic products. Nevertheless, much remains to be discovered about the causes and mechanisms of triggering pathogenesis processes by opportunistic endophytes.\\u003c/p\\u003e\\u003cp\\u003eA characteristic feature of growth in a phytotron is that endophytic bacteria living in plants are forced to exist in a constantly changing physical and chemical environment. The life and activity of endophytes depend on the type and quantity of plant assimilates. These parameters are important for the stable life of bacteria. Likewise, the quantity and composition of these species-specific plant assimilates can control the structure of endophytic communities and regulate their activity (Gorke \\u0026amp; Stulke, \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e). Under the influence of the controlled environment and artificial light in a phytotron, plant organs, and consequently the bacteria inhabiting them, undergo various transformations. This leads to corresponding changes in the metabolism of endophytic bacteria (Kremer et al., \\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). Most bacteria can selectively utilize substrates from a mixture of different carbon sources. The presence of preferred carbon sources prevents the expression of genes and the corresponding activities of catabolic systems that allow the use of alternative substrates. Normally, the presence of preferred carbon sources does not lead to activation of pathogenesis. The lack of these substrates forces endophytic bacteria to radically rearrange their interaction with the host plant cells. The ability of bacteria to adapt to various environmental changes is determined genetically and depends on certain signals. Recognition of such signals and the transformation of this information into specific transcriptional responses play a key role in signal transduction (Parkinson \\u0026amp; Kofoid, \\u003cspan citationid=\\\"CR69\\\" class=\\\"CitationRef\\\"\\u003e1992\\u003c/span\\u003e\\u003cb\\u003e)\\u003c/b\\u003e. Remarkably, most bacteria have a two-component system responsible for this process (Celine et al., \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e1999\\u003c/span\\u003e). Phosphorylation is an important mechanism of signal transduction since addition of phosphoryl groups affects functional activities of proteins (Stock et al., \\u003cspan citationid=\\\"CR83\\\" class=\\\"CitationRef\\\"\\u003e1989\\u003c/span\\u003e). This may stimulate synthesis of pectolytic, cellulolytic and other related enzymes (Deutscher et al., \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eMost endophytes act as commensals with no known effect on their host plant, but numerous bacteria and fungi establish mutualistic relationships with plants. However, some microbes act as pathogens. The outcome of these plant-microbe interactions depends on biotic and abiotic environmental factors, as well as the genotype of the host and interacting microorganism. In addition, endophytic microbiota and the numerous interactions between members, including pathogens, have a profound effect on plant function and pathobiome development. Collectively, these events may lead to pathogenesis. Interestingly, it has been shown that bacterial strains belonging to a known pathogenic species of a particular host plant can even exert a growth-promoting effect on another plant (Reiter et al., \\u003cspan citationid=\\\"CR75\\\" class=\\\"CitationRef\\\"\\u003e2002\\u003c/span\\u003e; Coombs \\u0026amp; Franco, \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e2003\\u003c/span\\u003e). The effects attributed to endophytes in healthy plants may change if host plants are grown under less favorable or even stressful conditions. Remarkably, it is difficult to reliably distinguish a non-pathogenic endophyte from a pathogen and that properties such as pathogenicity or mutualism may depend on many factors, including plant and microbe genotype, microbe number and quorum sensing, or environmental conditions (Hardoim et al., \\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eThe interaction of plants and bacteria is a complex and multifaceted process, where positive and negative effects may depend on specific environmental conditions, plants and microorganisms. The obvious suggestion for changes in the behavior of endophytic bacteria associated with cells/tissues of the \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e plants is the influence of plant cultivation conditions. Conceivably this may have an impact on plant hormonal systems and, via adjustment of metabolic pathways of carbohydrate exchange, activate specialized enzymes of endophytic bacteria that destroy plant tissue. The distinction between endophytes and pathogens is not always obvious, as both live on and within plant tissues, where opportunities for recombination often arise following horizontal gene transfer, a process that imparts new phenotypic traits (or sets of traits) to bacteria sharing an ecological habitat (Berg et al., \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eTherefore, virulence factor genes can move between species of bacterial phylogenetic groups in the rhizosphere or within plants, and virulence factor expression can be linked to bacterial strain population density. Several virulence factors have been shown to be regulated by bacterial cell density through quorum sensing. These include the tobacco hypersensitivity testing system, which has been used to determine the phytopathogenic potential of plant-associated bacteria (Mathesius et al. \\u003cspan citationid=\\\"CR61\\\" class=\\\"CitationRef\\\"\\u003e2003\\u003c/span\\u003e), indole acetic acid production (Preston, \\u003cspan citationid=\\\"CR71\\\" class=\\\"CitationRef\\\"\\u003e2004\\u003c/span\\u003e), and biosynthesis of cell wall degrading enzymes including pectinase (Berg et al., \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e; Laasik et al., \\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e). In addition, quorum sensing regulates both horizontal gene transfer and bacterial colonization of host plants (Berg et al., \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e).\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eIn conclusion, this study shows that plant-associated microorganisms are an important factor affecting plant responses to changes in cultivation conditions. It led to identification of two bacterial species associated with root rot of the NR-producing plant \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e - \\u003cem\\u003ePseudomonas putida\\u003c/em\\u003e and \\u003cem\\u003eRaoultella terrigena\\u003c/em\\u003e. According to the literature, interaction of these bacteria with plants is described as symbiosis. However, our data clearly demonstrate that under certain conditions well-characterized endophytic bacteria can act as pathogens. Moreover, we showed that plants, cured of phytopathogens, demonstrate significant increase in fitness. Plants exhibit resistance to high ambient temperatures, which is not typical for these species. \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e continued to build up a biomass, which may lead to an increase in accumulation of NR and inulin in the roots. In addition, our research showed that aeroponic cultivation is a promising way to grow \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e, for production of NR and inulin. Free access to the root zone allows rapid assessment of the conditions of the roots and their biochemical composition directly during the process of plant growth and development.\\u003c/p\\u003e\\u003cp\\u003eOur results indicate the need for further research for understanding the mechanisms of biochemical and physiological interactions between microbes and plants. New developments in high-throughput technologies such as next-generation sequencing enable the exploration of complex microbiomes and facilitate in-depth studies of the largest possible number of microbial communities. Genomic analysis of individual microbial strains and metagenomic studies of entire microbial communities will provide insights into the composition and physiological potential of plant-associated microorganisms (Knief, \\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). Conceivably, in the future, with more information on the microbiome of \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e and its growth under different cultivation conditions available, it will be possible to achieve maximum productivity of this NR-producing plant.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u0026nbsp;\\u003c/strong\\u003eWe are grateful to Oleg Malyuchenko, Yakov Alekseev and Julia Monakhova who helped with DNA sequencing, data collection and analysis.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData Availability\\u003c/strong\\u003e All data generated or analyzed during this study are included in this manuscript\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics approval consent\\u003c/strong\\u003e This study did not involve human participants or animals, and therefore ethical approval was not required.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of interest\\u003c/strong\\u003e The authors have neither conflict of interests nor competing interests to declare\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eAmerik, A.Y., Martirosyan, Y.T, \\u0026amp; Gachok, I.V. (2018). Regulation of natural rubber biosynthesis by proteins associated with rubber particles. \\u003cem\\u003eRussian Journal of Bioorganic Chemistry\\u003c/em\\u003e,44(2), 140-149. https://doi.org/10.1134/S106816201801003X\\u003c/li\\u003e\\n\\u003cli\\u003eAmerik, A.Y., Martirosyan, Y.T., Martirosyan, L.Y., Goldberg, V.M., Uteulin. K.R., \\u0026amp;Varfolomeev, S.D. (2021).Molecular genetic analysis of natural rubber biosynthesis. \\u003cem\\u003eRussian Journal of Plant\\u003c/em\\u003e \\u003cem\\u003ePhysiology\\u003c/em\\u003e, 68(1), 31-45. https://doi.org/10.1134/S1021443721010039\\u003c/li\\u003e\\n\\u003cli\\u003eAppel, T.M., Quijano-Mart\\u0026iacute;nez, N., De La Cadena. E., Mojica, M., \\u0026amp;Villegas, M.V. (2021).\\u003c/li\\u003e\\n\\u003cli\\u003eMicrobiological and Clinical Aspects of \\u003cem\\u003eRaoultella \\u003c/em\\u003espp. \\u003cem\\u003eFrontiers in Public Health\\u003c/em\\u003e 9, 686789. https://doi.org/10.3389/fpubh.2021.686789\\u003c/li\\u003e\\n\\u003cli\\u003eAraujo-Morera, J., Verdejo, R., Lopez-Manchado, M.A., \\u0026amp; Santana, M.H. (2021). Sustainable mobility: the route of tires through the circular economy model. \\u003cem\\u003eWaste Management\\u003c/em\\u003e 126(1 May), 309-322. https://doi.org/10.1016/j.wasman.2021.03.025\\u003c/li\\u003e\\n\\u003cli\\u003eArias, M., Herrero, J., Ricobaraza, M., Hernandez M., \\u0026amp; Ritter E. (2016). Evaluation of root biomass, rubber and inulin contents in nine \\u003cem\\u003eTaraxacum kok-saghyz\\u003c/em\\u003e Rodin populations. \\u003cem\\u003eIndustrial Crops and Products\\u003c/em\\u003e 83(May 2016), 316-321. https://doi.org/10.1016/j.indcrop.2016.01.023\\u003c/li\\u003e\\n\\u003cli\\u003eBerg, G., Eberl. L., \\u0026amp; Hartman A. (2005). The rhizosphere as a reservoir for opportunistic human pathogenic bacteria. \\u003cem\\u003eEnvironmental Microbiology\\u003c/em\\u003e, 7(11), 1673\\u0026ndash;1685. https://doi.org/10.1111/j.1462-2920.2005.00891.x.\\u003c/li\\u003e\\n\\u003cli\\u003eBerggren, I., Alstrom, S., \\u0026amp; Martensson, A.M. (2001). Deleterious properties of certain rhizosphere bacteria on field pea (\\u003cem\\u003ePisum sativum\\u003c/em\\u003e) under gnotobiotic and non-sterile conditions. \\u003cem\\u003eApplied Soil Ecology\\u003c/em\\u003e, 16(2), 169-177. doi: 10.1016/S0929-1393(00)00111-6\\u003c/li\\u003e\\n\\u003cli\\u003eBharath,P., Gahir, S., \\u0026amp; Raghavendra, A.S. (2021).Abscisic Acid-Induced Stomatal Closure: An Important Component of Plant Defense Against Abiotic and Biotic Stress. \\u003cem\\u003eFrontiers in Plant Science\\u003c/em\\u003e, 12, 615114. https://doi.org/10.3389/fpls.2021.615114\\u003c/li\\u003e\\n\\u003cli\\u003eBousquet, J., Flahault, A., Vandenplas, O., Ameille, J., Duron, J.J., Pecquet, C., Chevrie, K., \\u0026amp; Annesi-Maesano I. (2006). Natural rubber latex allergy among health care workers: A systematic review of the evidence. \\u003cem\\u003eJournal of Allergy and Clinical Immunology\\u003c/em\\u003e, 118(2), 447-454. https://doi.org/10.1016/j.jaci.2006.03.048\\u003c/li\\u003e\\n\\u003cli\\u003eBowler, C., \\u0026amp; Fluhr, R. (2000). The role of calcium and activated oxygens as signals for controlling cross-tolerance. \\u003cem\\u003eTrends in Plant Science\\u003c/em\\u003e, 5(6), 241\\u0026ndash;246. https://doi.org/10.1016/s1360-1385(00)01628-9\\u003c/li\\u003e\\n\\u003cli\\u003eBrader, G., Compant, S., Vescio, K., Mitter, B., Trognitz, F.L.J, \\u0026amp; Sessitsch A. 2017. Ecology and genomic insights into plant-pathogenic and -nonpathogenic endophytes. \\u003cem\\u003eAnnual Review of Phytopathology,\\u003c/em\\u003e 55(Aug.4), 61-83. https://doi.org/10.1146/annurev-phyto-080516-035641\\u003c/li\\u003e\\n\\u003cli\\u003eBrenner, D.J., Staley, J.T., Krieg, N.R. (2005). Classification of Procaryotic Organisms and the Concept of Bacterial Speciation. In: D.J. Brenner, N.R. Krieg, J.T. Staley, \\u0026amp; G.M. Garrity (Eds.), \\u003cem\\u003eBergey\\u0026apos;s Manual of Systematic Bacteriology \\u003c/em\\u003e(v. 2., pp. 27-32). Springer.\\u003c/li\\u003e\\n\\u003cli\\u003eBuranov, A.U., Elmuradov, B.J. (2010). Extraction and characterization of latex and natural rubber from rubber-bearing plants. \\u003cem\\u003eJournal of Agricultural and Food Chemistry\\u003c/em\\u003e, 58(2), 734-43. https://doi.org/10.1021/jf903096z\\u003c/li\\u003e\\n\\u003cli\\u003eCastillo, T,, Duque, E., Juan, L., Ramos, J.L. (2008). A Set of activators and repressors control peripheral glucose pathways in \\u003cem\\u003ePseudomonas putida\\u003c/em\\u003e to yield a common central intermediate.\\u003cem\\u003e Journal of Bacteriology\\u003c/em\\u003e, 190(7), 2331-2339. https://doi.org/10.1128/jb.01726-07\\u003c/li\\u003e\\n\\u003cli\\u003eCeline, F., Feher, V.A, Hoch J.A. (1999). Two-component signal transduction in \\u003cem\\u003eBacillus subtilis\\u003c/em\\u003e: how one organism sees its world. \\u003cem\\u003eJournal of bacteriology\\u003c/em\\u003e, 181(7), 1975-1983. https://doi.org/10.1128/jb.181.7.1975-1983.1999\\u003c/li\\u003e\\n\\u003cli\\u003eChen, K, Li, G.-J., Bressan, R.A,, Song, C.-P., Jian, J/-K, Zhao, Y. (2020). Abscisic acid dynamics, signaling, and functions in plants. \\u003cem\\u003eJournal of Integrative Plant Biology\\u003c/em\\u003e, 62(1), 25-54. https://doi.org/10.1111/jipb.12899\\u003c/li\\u003e\\n\\u003cli\\u003eCherian SS, Ryu SB, Cornish K. (2019). Natural rubber biosynthesis in plants, the rubber transferase complex, and metabolic engineering progress and prospects. \\u003cem\\u003ePlant Biotechnol\\u003c/em\\u003e\\u003cem\\u003eogy\\u003c/em\\u003e\\u003cem\\u003e Journal,\\u003c/em\\u003e 17(11), 2041-2061. https://doi.org/10.1111/pbi.13181\\u003c/li\\u003e\\n\\u003cli\\u003eChiaranunt, P., White, J.F. (2023). Plant beneficial bacteria and their potential applications in vertical farming systems. \\u003cem\\u003ePlants,\\u003c/em\\u003e 12, 400. https://doi.org/10.3390/plants12020400\\u003c/li\\u003e\\n\\u003cli\\u003eCoombs, J.T., Franco, C.M. (2003). Isolation and identification of actinobacteria from surface-sterilized wheat roots. \\u003cem\\u003eApplied and environmental microbiology,\\u003c/em\\u003e 69(9), 5603-5608. https://doi.org/ 10.1128/AEM.69.9.5603-5608.2003\\u003c/li\\u003e\\n\\u003cli\\u003eCornish, K. (2001).Biochemistry of natural rubber, a vital raw material, emphasizing biosynthetic rate, molecular weight and compartmentalization, in evolutionarily divergent plant species. \\u003cem\\u003eNatural Product Report\\u003c/em\\u003e 18(2), 182-189. https://doi.org/10.1039/a902191d\\u003c/li\\u003e\\n\\u003cli\\u003eCornish, K. (2017). Alternative natural rubber crops: why should we care?. \\u003cem\\u003eTechnology and Innovation\\u003c/em\\u003e 18: 245-256. https://doi.org/10.21300/18.4.2017.245\\u003c/li\\u003e\\n\\u003cli\\u003eCosta-Gutierrez, S.B., Adler, C., Espinosa-Urgel, M., de Crist\\u0026oacute;bal,R.E\\u003cem\\u003e.\\u003c/em\\u003e (2022). \\u003cem\\u003ePseudomonas putida\\u003c/em\\u003e and its close relatives: mixing and mastering the perfect tune for plants. \\u003cem\\u003eApplied Microbiology and Biotechnology\\u003c/em\\u003e 106 (9-10), 3351\\u0026ndash;3367. https://doi.org/ 10.1007/s00253-022-11881-7\\u003c/li\\u003e\\n\\u003cli\\u003eDeutscher, J., Francke, C., Postma, P.W. (2006). How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. \\u003cem\\u003eMicrobiology and molecular biology Reviews\\u003c/em\\u003e 70(4), 939-1031. doi: 10.1128/MMBR.00024-06\\u003c/li\\u003e\\n\\u003cli\\u003eEaton, C.J., Cox, M.P., Scott, B. (2011). What triggers grass endophytes to switch from mutualism to pathogenism? \\u003cem\\u003ePlant Science\\u003c/em\\u003e, 180(2), 190-195. https://doi.org/10.1016/j.plantsci.2010.10.002\\u003c/li\\u003e\\n\\u003cli\\u003eEdwards, U., Rogall, T., Blocker, H., Emde, M., Bottger, E.C. (1989). Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. \\u003cem\\u003eNucleic Acids Res,\\u003c/em\\u003e 17(19), 7843\\u0026ndash;7853. https://doi.org/10.1093/nar/17.19.7843\\u003c/li\\u003e\\n\\u003cli\\u003eEng, A.H., Ong, E.L.(2000). Hevea natural rubber. In A.K. Bhowmick, \\u0026amp; H.L.Stephens (Eds.) \\u003cem\\u003ePlastics engineering: handbook of elastomers \\u003c/em\\u003e(v. 61., pp. 29-59) Marcel Dekker.\\u003c/li\\u003e\\n\\u003cli\\u003eFan, J., Hill, L., Crooks, C., Doerner, P., Lamb, C. (2009).Abscisic Acid Has a Key Role in Modulating Diverse Plant-Pathogen Interactions. \\u003cem\\u003ePlant Physiology,\\u003c/em\\u003e 150(4), 1750-1761. https://doi.org/10.1104/pp.109.137943 \\u003c/li\\u003e\\n\\u003cli\\u003eGarrett, K.A., Bebber, D.P., Etherton, B.A, Gold, KM, Plex Sula, A.I., Selvaraj, M.G. (2022). Climate change effects on pathogen emergence: Artificial intelligence to translate big data for mitigation. Annual Review of Phytopathology, 60, 357-378. https://doi.org/10.1146/annurev-phyto-021021-042636\\u003c/li\\u003e\\n\\u003cli\\u003eGent, D.H., Mahaffee, W.F., McRoberts, N., Pfender, W.F. (2013). The use and role of predictive systems in disease management. \\u003cem\\u003eAnnual Review of Phytopathology,\\u003c/em\\u003e 51, 267-289. https://doi.org/10.1146/annurev-phyto-082712-102356\\u003c/li\\u003e\\n\\u003cli\\u003eGiauque, H., Hawkes C.V. (2013). Climate affects symbiotic fungal endophyte diversity and performance. \\u003cem\\u003eAmerican Journal of Botany,\\u003c/em\\u003e 100(7),1435-1444. https://doi.org/10.3732/ajb.1200568\\u003c/li\\u003e\\n\\u003cli\\u003eGlick,BR, Penrose, D.M., Li, J. (1998). A model for the lowering of plant ethylene concentrations by plant growth-promoting bacteria. \\u003cem\\u003eJournal of Theoretical Biology\\u003c/em\\u003e, 190(1), 63-68. https://doi.org/10.1006/jtbi.1997.0532\\u003c/li\\u003e\\n\\u003cli\\u003eGorke, B, Stulke, J. (2008). Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. \\u003cem\\u003eNature Reviews Microbiology,\\u003c/em\\u003e 6(8), 613-624. https://doi.org/10.1038/nrmicro1932\\u003c/li\\u003e\\n\\u003cli\\u003eGrondeau, C., Samson, R., Sands, D.C. (1994). A review of thermotherapy to free plant materials from pathogens, especially seeds from bacteria. \\u003cem\\u003eCritical Reviews in Plant Sciences\\u003c/em\\u003e, 13(1), 57-75. https://doi.org/10.1080/07352689409701908\\u003c/li\\u003e\\n\\u003cli\\u003eGronover, C.S., Wahler, D., Prufer, D. (2011). Natural rubber biosynthesis and physic-chemical studies of plant derived latex. In M. Elnashar (Ed), \\u003cem\\u003eBiotechnology of Biopolymers\\u003c/em\\u003e: (pp. 75-88) InTech. https://doi.org/10.5772/17144\\u003c/li\\u003e\\n\\u003cli\\u003eGuyot, J., Cilas, C., Sache I. (2008). Influence of host resistance and phenology on South American leaf blight of the rubber tree with special consideration of temporal dynamics. \\u003cem\\u003eEuropean Journal of Plant Pathology\\u003c/em\\u003e, 120 (2): 111-124. https://doi.org/10.1007/s10658-0079197-6\\u003c/li\\u003e\\n\\u003cli\\u003eGuyot, J., Le Guen, V. (2018). A review of a century of studies on South America leaf blight of the rubber tree. \\u003cem\\u003ePlant Disease,\\u003c/em\\u003e 102(6), 1052-1065. https://doi.org/10.1094/PDIS-04-17-0592-FE\\u003c/li\\u003e\\n\\u003cli\\u003eHallahan, D.L., Keiper-Hrynko, N.M. (2004). Cis-prenyltransferases from the rubber-producing plants Russian dandelion (\\u003cem\\u003eTaraxacum kok-saghyz\\u003c/em\\u003e) and sunflower (\\u003cem\\u003eHelianthus annus\\u003c/em\\u003e). \\u003cem\\u003eUS Patent 2004/044173\\u003c/em\\u003e. \\u003c/li\\u003e\\n\\u003cli\\u003eHansen, D.S., Aucken, H.M., Abiola, T., Podschun, R. (2004). Recommended test panel for differentiation of \\u003cem\\u003eKlebsiella\\u003c/em\\u003e species on the basis of a trilateral interlaboratory evaluation of 18 biochemical tests. \\u003cem\\u003eJournal of clinical microbiology,\\u003c/em\\u003e 42(8), 3665-3669. https://doi.org/10.1128/JCM.42.8.3665-3669.2004\\u003c/li\\u003e\\n\\u003cli\\u003eHardoim, P.R., van Overbeek, L.S., Berg, G., Pirttila, A.M., Compant S, Campisano, A., Doring, M., Sessitsch, A. (2015). The hidden world within plants: ecological and evolutionary considerations for defining functioning of microbial endophytes. \\u003cem\\u003eMicrobiology and Molecular Biology Review,\\u003c/em\\u003e 79(3), 293-320. https://doi.org/10.1128/MMBR.00050-14\\u003c/li\\u003e\\n\\u003cli\\u003eHua, J. (2013). Modulation of plant immunity by light, circadian rhythm, and temperature. \\u003cem\\u003eCurrent Opinion in Plant Biology,\\u003c/em\\u003e 16(4), 406-413. https://doi.org/10.1016/j.pbi.2013.06.017\\u003c/li\\u003e\\n\\u003cli\\u003eJuroszek, P., Von Tiedemann, A. (2011). Potential strategies and future requirements for plant disease management under a changing climate. \\u003cem\\u003ePlant Pathology\\u003c/em\\u003e, 60(1), 100-112. https://doi.org/10.1111/j.1365-3059.2010.02410.x\\u003c/li\\u003e\\n\\u003cli\\u003eJuroszek, P., Bartsch, L., Fontaine, J.F., Racca, P., Kleinhenz, B. (2022). Summary of the worldwide available crop disease risk simulation studies that were driven by climate change scenarios and published during the past 20 years. \\u003cem\\u003ePlant Pathology\\u003c/em\\u003e 71(9), 1815-1838. https://doi.org/10.1111/ppa.13634\\u003c/li\\u003e\\n\\u003cli\\u003eKamilova, F., Kravchenko, L.V., Shaposhnikov, A.I., Azarova, T., Makarova, N., Lugtenberg, B. (2006).Organic acids, sugars, and L-tryptophane in exudates of vegetables growing on stonewool and their effects on activities of rhizosphere bacteria. \\u003cem\\u003eMolecular Plant-Microbe Interactions,\\u003c/em\\u003e 19(3), 250-256. https://doi.org/10.1094/MPMI-19-0250\\u003c/li\\u003e\\n\\u003cli\\u003eKeane, P.J., Kerr, A. (1997). Factors affecting disease development. In J.F. Brown, \\u0026amp; H.J. Ogles, (Eds.), \\u003cem\\u003ePathogens and Plant Diseases\\u003c/em\\u003e. pp.267-298) Rockvale Publications.\\u003c/li\\u003e\\n\\u003cli\\u003eKhazaei, A., Bahramnejad, B., Mozafari, A. A., Dastan, D., Mohammadi, S. (2019).Hairy root induction and Farnesiferol B production of endemic medicinal plant \\u003cem\\u003eFerula pseudalliacea\\u003c/em\\u003e. \\u003cem\\u003e3 Biotech\\u003c/em\\u003e 9(11), 407. https://doi.org/10.1007/s13205-019-1935-x\\u003c/li\\u003e\\n\\u003cli\\u003eKivisaar, M. 2020\\u003cstrong\\u003e.\\u003c/strong\\u003e Narrative of a versatile and adept species \\u003cem\\u003ePseudomonas putida.\\u003c/em\\u003e \\u003cem\\u003eJournal of Medicine Microbiology\\u003c/em\\u003e 69(3), 324-338. https://doi.org/10.1099/jmm.0.001137\\u003c/li\\u003e\\n\\u003cli\\u003eKloepper, JW, Saborio F, Bustamante E, Polston JE, Sanchez E, Umana G. 2010. Fern Distortion Syndrome of Leatherleaf Fern in Costa Rica: symptoms, incidence, and severity. \\u003cem\\u003ePlant Disease\\u003c/em\\u003e. 94(8), 940-954. https://doi.org/10.1094/ PDIS-94-8-0940\\u003c/li\\u003e\\n\\u003cli\\u003eKloepper, J.W., McInroy, J.A., Ke, K., Hu, C-H. (2013).Symptoms of Fern Distortion Syndrome Resulting from inoculation with opportunistic endophytic fluorescent \\u003cem\\u003ePseudomonas\\u003c/em\\u003e spp. PLoS One. 8(3), e58531. https://doi.org/10.1371/journal.pone.0058531\\u003c/li\\u003e\\n\\u003cli\\u003eKnief, C. (2014). Analysis of plant microbe interactions in the era of next generation sequencing technologies. \\u003cem\\u003eFrontiers in plant science\\u003c/em\\u003e. 5, 216. https://doi.org/10.3389/fpls.2014.00216\\u003c/li\\u003e\\n\\u003cli\\u003eKremer, R.J., Sasseville, D.N., Mills, H.A. 1996. Promotion of phytotoxic bacteria in rhizospheres of leatherleaf fern by Benlate DF. \\u003cem\\u003eJournal of Plant Nutrition,\\u003c/em\\u003e 19(6), 939-953. https://doi.org/10.1080/01904169609365171\\u003c/li\\u003e\\n\\u003cli\\u003eKremer, M., Schulze, S., Eisenbruch, N., Nagel, F.,Vogt, R.,Berndt, L., Dorre, B., Palm, G.J., Hoppen, J., Girbardt, B.,Albrecht, D., Sievers, S., Delcea, M., Baumann, U., Schnetz , K., Lammers, M. (2024). Bacteria employ lysine acetylation of transcriptional regulators to adapt gene expression to cellular metabolism\\u003cem\\u003e. Nature Communication,\\u003c/em\\u003e 15(1), 1674. https://doi.org/10.1038/s41467-024-46039-8\\u003c/li\\u003e\\n\\u003cli\\u003eLaasik, E., Andresen L., Mae A. (2006). Type II quorum sensing regulates virulence in \\u003cem\\u003eErwinia carotovora\\u003c/em\\u003e ssp. \\u003cem\\u003ecarotovora\\u003c/em\\u003e. \\u003cem\\u003eFEMS Microbiology Letters\\u003c/em\\u003e 258(2), 227\\u0026ndash;234. https://doi.org/10.1111/j.1574-6968.2006.00222.x\\u003c/li\\u003e\\n\\u003cli\\u003eLichtenthaler, H.K. (1998).The Stress Concept in Plants: An Introduction. \\u003cem\\u003eAnnals of the New York Academy of Sciences\\u003c/em\\u003e, 851, 187-198. doi: 10.1111/j.1749-6632.1998.tb08993.x.\\u003c/li\\u003e\\n\\u003cli\\u003eMarch, P.E. (1992). Membrane-associated GTPases in bacteria\\u003cem\\u003e.\\u003c/em\\u003e \\u003cem\\u003eMolecular Microbiology,\\u003c/em\\u003e10, 1253-1257. https://doi.org/10.1111/j.1365-2958.1992.tb00845.x\\u003c/li\\u003e\\n\\u003cli\\u003eMartinez-Garcia, E., de Lorenzo, V. (2024). \\u003cem\\u003ePseudomonas putida\\u003c/em\\u003e as a synthetic biology chassis and a metabolic engineering platform. \\u003cem\\u003eCurrent opinion in biotechnology\\u003c/em\\u003e 85, 103025. https://doi.org/10.1016/j.copbio.2023.103025\\u003c/li\\u003e\\n\\u003cli\\u003eMartirosyan, Y.T., Varfolomeev, S.D., Goldberg, V.M., Martirosyan, L.Y., Ryazantsev, D.M., Minikh, A.A. (2020). \\u003cem\\u003eRF Patent RU 196013U1\\u003c/em\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eMartirosyan, L.Y., Martirosyan, Y.T., Kosobryukhov, A.A., Goldberg, V.M., Gachok, I.V., Martirosyan, V.V., Gladchenko, M.A., Gaydamaka, S.N., Amerik, A.Y., Minih, A.A., Varfolomeev, S.D. (2023). \\u003cstrong\\u003eBiosynthesis of rubber and inulin depending on the spectral composition of light and activity of the photosynthetic apparatus during aeroponic cultivation of \\u003c/strong\\u003e\\u003cem\\u003eTaraxacum kok-saghys\\u003c/em\\u003e\\u003cstrong\\u003eE.Rodin. \\u003c/strong\\u003e\\u003cem\\u003eAgricultural Biology\\u003c/em\\u003e\\u003cstrong\\u003e 58(1),\\u003c/strong\\u003e\\u003cstrong\\u003e100-113. \\u003c/strong\\u003ehttps://doi.org/\\u003cstrong\\u003e 10.15389/agrobiology.2023.1.100\\u003c/strong\\u003e\\u003c/li\\u003e\\n\\u003cli\\u003eMathesius, U., Mulders, S., Gao, M., Teplitski, M., Caetano-Anoll\\u0026eacute;s, G., Rolfe, B.G., Bauer, W.D. (2003). Extensive and specific responses of a eukaryote to bacterial quorum-sensing signals. \\u003cem\\u003ePNAS,\\u003c/em\\u003e 100(3), 1444-1449. https://doi.org/10.1073/pnas.262672599\\u003c/li\\u003e\\n\\u003cli\\u003eMcIntyre, D., Stephens, H.L., Schloman, W.W., Bhowmick, A.K. (2000). Guayule rubber. In A.K. Bhowmick, \\u0026amp; H.L.Stephens (Eds.), \\u003cem\\u003ePlastics engineering: handbook of elastomers\\u003c/em\\u003e. (v. 61, pp. 1-27). Marcel Dekker.\\u003c/li\\u003e\\n\\u003cli\\u003eMengistu, A.A. (2020). Endophytes: colonization, behavior, and their role in defense mechanism. \\u003cem\\u003eInternational Journal of Microbiology,\\u003c/em\\u003e 2020: 6927219. https://doi.org/10.1155/2020/6927219\\u003c/li\\u003e\\n\\u003cli\\u003eMills, H.A., Sasseville, D.N., Kremer, R.J. (1996). Effects of Benlate on leatherleaf fern growth, root morphology and rhizosphere bacteria. \\u003cem\\u003eJournal of Plant Nutrition,\\u003c/em\\u003e 19(6), 917-937. https://doi.org/10.1080/01904169609365170\\u003c/li\\u003e\\n\\u003cli\\u003eMooibroek, H., Cornish, K. (2000). Alternative sources of natural rubber. \\u003cem\\u003eApplied Microbiology and Biotechnolog\\u003c/em\\u003ey, 53, 355-365. https://doi.org/10.1007/s002530051627\\u003c/li\\u003e\\n\\u003cli\\u003eMortier, V., Holsters, M., Goormachtig, S. (2012). Never too many? How legumes control nodule numbers. \\u003cem\\u003ePlant Cell \\u0026amp; Environment\\u003c/em\\u003e 35(2),245-258. https://doi.org/10.1111/j.1365-3040.2011.02406.x\\u003c/li\\u003e\\n\\u003cli\\u003eNikel, P.I., de Lorenzo, V. (2018). \\u003cem\\u003ePseudomonas putida\\u003c/em\\u003e as a functional chassis for industrial biocatalysis: from native biochemistry to trans-metabolism. \\u003cem\\u003eMetabolic engineering,\\u003c/em\\u003e 50, 142-155. https://doi.org/10.1016/j.ymben.2018.05.005\\u003c/li\\u003e\\n\\u003cli\\u003eParkinson, J.S., Kofoid, E.C. (1992). Communication modules in bacterial signaling proteins. \\u003cem\\u003eAnnual review of genetics,\\u003c/em\\u003e 26, 71-112. https://doi.org/10.1146/annurev.ge.26.120192.000443 \\u003c/li\\u003e\\n\\u003cli\\u003ePremachandra, D., Hudek, L., Brau, L. (2016). Bacterial modes of action for enhancing of plant growth. \\u003cem\\u003eJournal of Biotechnology \\u0026amp; Biomaterials,\\u003c/em\\u003e 6(3), 236. https://doi.org/10.4172/2155-952X.1000236\\u003c/li\\u003e\\n\\u003cli\\u003ePreston, G.M. (2004). Plant perceptions of plant growth-promoting Pseudomonas. \\u003cem\\u003ePhilosophical Transactions of the Royal Society of London. Series B: Biological Sciences\\u003c/em\\u003e, 359(1446), 907-918. https://doi.org/10.1098/rstb.2003.1384\\u003c/li\\u003e\\n\\u003cli\\u003ePuskas, J.E. (2001). Producers and world market of synthetic rubbers. In T. Koyama, \\u0026amp; A. Steinbuchel (Eds.) \\u003cem\\u003eBiopolymers, Polyisoprenoids\\u003c/em\\u003e.(v. 2 pp. 287-320) Wiley. \\u003c/li\\u003e\\n\\u003cli\\u003eRamos, J.L., Cuenca, M., Molina-Santiago, C., Segura, A., Duque, E., G\\u0026oacute;mez-Garc\\u0026iacute;a, M.R., Udaondo, Z., Roca, A. (2015). Mechanisms of solvent resistance mediated by interplay of cellular factors in \\u003cem\\u003ePseudomonas putida\\u003c/em\\u003e. \\u003cem\\u003eFEMS microbiology reviews,\\u003c/em\\u003e 39(4), 555-566. https://doi.org/10.1093/femsre/fuv006\\u003c/li\\u003e\\n\\u003cli\\u003eReed, M.L.E., Glick, B.R. (2005). Growth of canola (\\u003cem\\u003eBrassica napus\\u003c/em\\u003e) in the presence of plant growth-promoting bacteria and either copper or polycyclic aromatic hydrocarbons. \\u003cem\\u003eCanadian Journal of Microbiology\\u003c/em\\u003e, 51(12), 1061-1069. https://doi.org/10.1139/w05-094 doi: 10.1139/w05-094\\u003c/li\\u003e\\n\\u003cli\\u003eReiter, B., Pfeifer, U., Schwab, H., Sessitsch, A. (2002).Response of endophytic bacterial communities in potato plants to infection with Erwinia carotovora subsp. atroseptica. \\u003cem\\u003eApplied and environmental microbiology, \\u003c/em\\u003e68(5), 2261-2268. https://doi.org/10.1128/AEM.68.5.2261-2268.2002\\u003c/li\\u003e\\n\\u003cli\\u003eRousset, A., Amor, A., Punvichai, T., Perino, S., Palu, S., Dorget, M., Pioch, D., Chemat, F. (2021). Guayule (\\u003cem\\u003eParthenium argentatum\\u003c/em\\u003e A. Gray), a renewable resource for natural polyisoprene and resin: composition, processes and applications. \\u003cem\\u003eMolecules,\\u003c/em\\u003e 26(3), 664. https://doi.org/10.3390/molecules26030664\\u003c/li\\u003e\\n\\u003cli\\u003eSanna, M., Gilardi, G., Gullino, M.L., Mezzalama, M. (2022). Evaluation of physical and chemical disinfection methods of \\u003cem\\u003eBrassica oleracea\\u003c/em\\u003e seeds naturally contaminated with \\u003cem\\u003eXanthomonas campestris\\u003c/em\\u003e pv. \\u003cem\\u003ecampestris\\u003c/em\\u003e. \\u003cem\\u003eJournal of Plant Diseases and Protection,\\u003c/em\\u003e 129,1145\\u0026ndash;1152. https://doi.org/10.1007/s41348-022-00635-2\\u003c/li\\u003e\\n\\u003cli\\u003eScarth, G.W., Gooding, H.B., Shaw, M. (1947). Factors influencing growth and summer dormancy in \\u003cem\\u003eTaraxacum kok-saghyz\\u003c/em\\u003e. \\u003cem\\u003eCanadian journal of research\\u003c/em\\u003e, 25c, 27-42. https://doi.org/10.1007/s41348-022-00635-2\\u003c/li\\u003e\\n\\u003cli\\u003eSekowska, A. (2019). The many faces of \\u003cem\\u003eRaoultella spp\\u003c/em\\u003e. \\u003cem\\u003eAdvances in Hygiene and Experimental Medicine\\u003c/em\\u003e, 73, 713-720. https://doi.org/10.5604/01.3001.0013.6377\\u003c/li\\u003e\\n\\u003cli\\u003eShah, D.A., Sen, S., Shalini, A., Ghosh, D., Grover, M., Mohapatra, S. (2017). An auxin secreting \\u003cem\\u003ePseudomonas putida\\u003c/em\\u003e rhizobacterial strain that negatively impacts water-stress tolerance in \\u003cem\\u003eArabidopsis thaliana\\u003c/em\\u003e. \\u003cem\\u003eRhizosphere\\u003c/em\\u003e 3(1), 16-19. https://doi.org/10.1016/j.rhisph.2016.11.002\\u003c/li\\u003e\\n\\u003cli\\u003eSiler, D.J., Cornish, K., Hamilton, R.G. (1996). Absence of cross-reactivity of IgE antibodies from subjects allergic to \\u003cem\\u003eHevea brasiliensis\\u003c/em\\u003e latex with a new source of natural rubber latex from guayule (\\u003cem\\u003eParthenium argentatum\\u003c/em\\u003e). \\u003cem\\u003eJournal of Allergy and Clinical Immunology\\u003c/em\\u003e, 98(5), 895-902. https://doi.org/10.1016/s0091-6749(96)80005-4\\u003c/li\\u003e\\n\\u003cli\\u003eSong, X., Schlosburg, J.E., Janda, K.D. (2015). A new strategy for smoking cessation: characterization of a bacterial enzyme for the degradation of nicotine. \\u003cem\\u003eJournal of the American Chemical Society\\u003c/em\\u003e, 137(32), 10136-10139. https://doi.org/10.1021/jacs.5b06605\\u003c/li\\u003e\\n\\u003cli\\u003eStock, J.B., Ninfa, A.J., Stock, A. (1989). Protein phosphorylation and regulation of adaptive responses in bacteria. \\u003cem\\u003eMicrobiological reviews\\u003c/em\\u003e, 53(4), 450-490. https://doi.org/10.1128/mr.53.4.450-490.1989 \\u003c/li\\u003e\\n\\u003cli\\u003eTanaka, Y. (2001). Structural characterization of natural polyisoprenes: solve the mystery of natural rubber based on structural study. \\u003cem\\u003eRubber Chemistry and Technology\\u003c/em\\u003e, 74, 355-375. https://doi.org/23 10.5254/1.3547643\\u003c/li\\u003e\\n\\u003cli\\u003eTanaka, A., Christensen, M.J., Takemoto, D., Park, P., Scott, B. (2006). Reactive oxygen species play a role in regulating a fungus\\u0026ndash;perennial ryegrass mutualistic interaction. \\u003cem\\u003eThe Plant Cell\\u003c/em\\u003e, 18(4), 1052-1066. https://doi.org/10.1105/tpc.105.039263\\u003c/li\\u003e\\n\\u003cli\\u003eThwe, A., Valan Arasu, M., Li, X., Park, C.H., Kim, S.J., Al-Dhabi, N.A., Park, S.U. (2016). Effect of different \\u003cem\\u003eAgrobacterium rhizogenes\\u003c/em\\u003e strains on hairy root induction and phenylpropanoid biosynthesis in tartary buckwheat (\\u003cem\\u003eFagopyrum tataricum\\u003c/em\\u003e Gaertn). \\u003cem\\u003eFrontiers in microbiology\\u003c/em\\u003e, 7, 318. https://doi.org/10.3389/fmicb.2016.00318\\u003c/li\\u003e\\n\\u003cli\\u003eTrivedi, P., Leach, J.E., Tringe, S.G., Sa, T., Singh,B.K. (2020). Plant-microbiome interactions: from community assembly to plant health. \\u003cem\\u003eNature Review Microbiology\\u003c/em\\u003e, 18(11), 607-621. https://doi.org/10.1038/s41579-020-0412-1\\u003c/li\\u003e\\n\\u003cli\\u003eTscheremissinov, N.A. (1951). Pathogenic mycoflora of \\u003cem\\u003eT. kok-saghyz.\\u003c/em\\u003e\\u003cem\\u003eBotanicheskie materialy Instituta Sporovykh Rastenii Glavnogo Botanicheskogo Sada RSFSR\\u003c/em\\u003e, 7, 155-170 (in Russian).\\u003c/li\\u003e\\n\\u003cli\\u003evan Beilen, J., Poirier, Y. (2007a). Guayule and Russian dandelion as alternative sources of natural rubber. \\u003cem\\u003eCritical Reviews in Biotechnology\\u003c/em\\u003e, 27(4), 217-231. https://doi.org/10.1080/07388550701775927\\u003c/li\\u003e\\n\\u003cli\\u003evan Beilen, J., Poirier, Y. (2007b). Establishment of new crops for the production of natural rubber. \\u003cem\\u003eTrends in Biotechnology\\u003c/em\\u003e, 25(11), 522-529. https://doi.org/10.1016/j.tibtech.2007.08.009\\u003c/li\\u003e\\n\\u003cli\\u003eVelazquez, F., Di Bartolo, I., De Lorenzo, V. (2004). Genetic evidence that catabolites of the Entner-Doudoroff pathway signal C source repression of the \\u0026sigma;54 Pu promoter of \\u003cem\\u003ePseudomonas putida\\u003c/em\\u003e. \\u003cem\\u003eJournal of bacteriology\\u003c/em\\u003e, 186(24), 8267-8275. https://doi.org/10.1128/JB.186.24.8267-8275.2004\\u003c/li\\u003e\\n\\u003cli\\u003eVelasquez, A.C., Castroverde, C.D.M., He, S.Y. (2018). Plant-pathogen warfare under changing climate conditions. \\u003cem\\u003eCurrent biology\\u003c/em\\u003e 28(10), R619-R634. https://doi.org/10.1016/j.cub.2018.03.054\\u003c/li\\u003e\\n\\u003cli\\u003eVercellone-Smith, P., Herson, D.S. (1997).Toluene elicits a carbon starvation response in \\u003cem\\u003ePseudomonas putida\\u003c/em\\u003e mt-2 containing the TOL plasmid pWW0\\u003cem\\u003e. \\u003c/em\\u003e\\u003cem\\u003eApplied and Environmental Microbiology\\u003c/em\\u003e 63(5), 1925-1932. https://doi.org/10.1128/aem.63.5.1925-1932.1997\\u003c/li\\u003e\\n\\u003cli\\u003eVolaire, F., Norton, M. (2006). Summer dormancy in perennial temperate grasses. \\u003cem\\u003eAnnals of botany\\u003c/em\\u003e, 98(5), 927-933. https://doi.org/10.1093/aob/mcl195\\u003c/li\\u003e\\n\\u003cli\\u003eYamamoto, S., Harayama, S. (1998).Phylogenetic relationships of \\u003cem\\u003ePseudomonas putida\\u003c/em\\u003e strains deduced from the nucleotide sequences of \\u003cem\\u003egyrB\\u003c/em\\u003e, \\u003cem\\u003erpoD\\u003c/em\\u003e and 16S rRNA genes.\\u003c/li\\u003e\\n\\u003cli\\u003e\\u003cem\\u003eInternational Journal of Systematic Bacteriology\\u003c/em\\u003e, 48(3), 813-819. https://doi.org/10.1099/00207713-48-3-813\\u003c/li\\u003e\\n\\u003cli\\u003eYamamoto, S., Kasai, H., Dawn, L., Arnold, D.L., Robert, W., Jackson R.W., Vivian, A., Harayama, S. (2000). Phylogeny of the genus Pseudomonas: intrageneric structure reconstructed from the nucleotide sequences of \\u003cem\\u003egyrB\\u003c/em\\u003e and \\u003cem\\u003erpoD\\u003c/em\\u003e genes. \\u003cem\\u003eMicrobiology\\u003c/em\\u003e, 146(10), 2385-2394. https://doi.org/10.1099/00221287-146-10-2385\\u003c/li\\u003e\\n\\u003cli\\u003eYamashita, S., Takahashi, S. (2020). Molecular mechanisms of natural rubber biosynthesis. \\u003cem\\u003eAnnual Review of Biochemistry\\u003c/em\\u003e 89, 821-851. https://doi.org/10.1146/annurev-biochem-013118-111107\\u003c/li\\u003e\\n\\u003cli\\u003eZakharchenko, N.S., Rukavtsova, E.B., Yampolsky, I.V., Balakirev, D.O., Dyadishchev, I.V., Ponomarenko, S.A., Luponosov, Y.N., Filonov, A.E., Mikhailov, P.A., Zvonarev, A.N., Akhmetov, L.I., Terentyev, V.V., Khudyakova, A.Y., Zalomova, L.V., Tarlachkov, S.V., Aripovsky, A.V., Puntus, I.F., Khramov, R.N. (2024). Effect of photoluminophore light-correcting coatings and bacterization by associative microorganisms on the growth and productivity of \\u003cem\\u003eBrassica juncea\\u003c/em\\u003e L. plants. \\u003cem\\u003eMicrobiology Research\\u003c/em\\u003e, 15 (4), 1957-1972. https://doi.org/10.3390/microbiolres15040131\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"},{\"header\":\"Table\",\"content\":\"\\u003cp\\u003eTable 1 is available in the Supplementary Files section.\\u003c/p\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"european-journal-of-plant-pathology\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"ejpp\",\"sideBox\":\"Learn more about [European Journal of Plant Pathology](http://link.springer.com/journal/10658)\",\"snPcode\":\"10658\",\"submissionUrl\":\"https://www.editorialmanager.com/ejpp/default2.aspx\",\"title\":\"European Journal of Plant Pathology\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"Taraxacum kok-saghyz, natural rubber, phytotron, root rot disease, endophytes\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-7867960/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-7867960/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eNatural rubber (NR) is a critical raw material essential for the production of thousands different rubber and latex products. In most cases, it cannot be replaced by synthetic rubber alternatives. At the present time, NR is produced solely from a single species, \\u003cem\\u003eHevea brasiliensis\\u003c/em\\u003e, which is grown in tropical regions. Several important reasons including the danger that South American Leaf Blight disease might spread to Southeast Asia stimulate the search for alternative rubber producers. One of them, \\u003cem\\u003eTaraxacum kok-saghyz\\u003c/em\\u003e, attracts particular attention. In this study, performed in an aeroponic phytotron, as well as \\u003cem\\u003ein vitro\\u003c/em\\u003e culture, we identified two bacteria associated with root rot of the NR-producing plant \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e - \\u003cem\\u003ePseudomonas putida\\u003c/em\\u003e and \\u003cem\\u003eRaoultella terrigena\\u003c/em\\u003e. According to the literature, interaction of these bacteria with plants is described as symbiosis. However, our data suggest that under certain conditions well-characterized endophytic bacteria can act as pathogens. We showed that plants, cured of phytopathogens, demonstrate fast growth rates, even in at high summer daytime temperatures. \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e continued to grow (defoliation did not occur) and to build up a biomass, which may lead to an increase in the accumulation of NR and inulin in the roots. Our research demonstrates that aeroponic cultivation is a promising way to grow \\u003cem\\u003eT. kok-saghyz\\u003c/em\\u003e, for production of NR and inulin. In this study we show that plant-associated microorganisms are an important factor influencing plant responses to changes in cultivation conditions.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Identification and pathogenicity of Raoultella and Pseudomonas species associated with roots of Taraxacum kok-saghyz\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-11-14 07:11:57\",\"doi\":\"10.21203/rs.3.rs-7867960/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Major revisions\",\"date\":\"2026-03-09T23:30:32+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"\",\"date\":\"2026-01-05T18:35:30+00:00\",\"index\":0,\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2025-11-04T09:18:04+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvited\",\"content\":\"European Journal of Plant Pathology\",\"date\":\"2025-10-29T10:04:49+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2025-10-28T05:52:43+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"European Journal of Plant Pathology\",\"date\":\"2025-10-24T11:43:46+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"european-journal-of-plant-pathology\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"ejpp\",\"sideBox\":\"Learn more about [European Journal of Plant Pathology](http://link.springer.com/journal/10658)\",\"snPcode\":\"10658\",\"submissionUrl\":\"https://www.editorialmanager.com/ejpp/default2.aspx\",\"title\":\"European Journal of Plant Pathology\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"d751d1b0-4ea5-4afa-bc97-84b9441e3f5b\",\"owner\":[],\"postedDate\":\"November 14th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"under-review\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2026-05-15T03:11:37+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-11-14 07:11:57\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-7867960\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-7867960\",\"identity\":\"rs-7867960\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}