{"paper_id":"0d4e837c-d8d8-4f0f-a268-e9e03ca1ae5e","body_text":"Macrophages are the target cells for genotype VII Newcastle disease virus and promote the infection and apoptosis of chicken splenic T cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Macrophages are the target cells for genotype VII Newcastle disease virus and promote the infection and apoptosis of chicken splenic T cells Miao Cai, Qing Chen, Yifei Liu, Cong Wang, Muyao Li, Xiaolong Lu, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6627962/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 30 Oct, 2025 Read the published version in Veterinary Research → Version 1 posted You are reading this latest preprint version Abstract Infection with genotype VII Newcastle disease virus (NDV) poses a significant threat to poultry health, characterized by severe damage to immune organs such as lymphocyte depletion. However, the precise mechanisms underlying this phenomenon remain unclear. Our present investigation focused on the dynamic changes of macrophages, T cells, and B cells in the spleen of chickens infected with genotype VII NDV by using multicolor flow cytometry. We found that NDV selectively infected chicken splenic macrophages and significantly increased the number of macrophages at 4 days post-infection. In contrast, T and B cells became progressively depleted. In vitro experiment revealed that following genotype VII NDV infection, T cells underwent apoptosis more potently when co-cultured with macrophages than that without macrophages. Overall, our findings highlight the changes in chicken splenic immune cell populations triggered by genotype VII NDV and illuminate the role of macrophages in T cell depletion. Newcastle disease virus Flow cytometry analysis Lymphocytes Macrophages T cells Apoptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Newcastle disease (ND) is an acute, highly contagious avian infectious disease caused by virulent Newcastle disease virus (NDV) and has caused pandemics worldwide [ 1 ]. NDV, which belongs to the genus Orthoavulavirus, is classified into avirulent (lentogenic), intermediate (mesogenic), and virulent (velogenic) pathotypes based on their pathogenicity [ 2 ]. Phylogenetic analysis of the fusion (F) gene further categorizes NDV into two classes: class I and class II, with genotype VII strains currently driving the fourth and ongoing pandemic [ 3 – 5 ]. Virulent NDV strains are typically lymphophilic and can cause lymphocytes depletion in the spleen, bursa, and thymus, along with significant upregulation of genes involved in the innate immune response [ 6 – 8 ]. NDV viral loads in these organs correlate well with the severity of clinical signs and tissue damage [ 9 ]. Compared with other genotype strains, genotype VII NDV can cause more severe damage to the immune organs of poultry, inducing strong immune response and cell death in lymphoid tissues, particularly in the spleen [ 10 ]. Therefore, even if vaccinated with traditional vaccines, the immunized poultry flocks can still be infected by genotype VII NDVs, leading to a reduction in protective efficacy. In chickens, splenic mononuclear cells (SMNCs) primarily consist of lymphocytes with a small quantity of macrophages and dendritic cells (DCs) [ 11 – 13 ]. Based on available antibodies specific to chicken immune cell surface markers as previously published [ 11 ], we developed a multicolor flow cytometry protocol to precisely quantify splenic macrophages and lymphocytes, enabling detailed analysis of their dynamics post-NDV infection. Macrophages are essential for maintaining homeostasis in the body and play a central role in the antiviral immune response. Macrophages are innate immune cells that release inflammatory factors during viral invasion. They also function as antigen-presenting cells, contributing to both innate and adaptive immune responses. Additionally, they can engulf pathogens and clear cellular debris through phagocytosis [ 14 , 15 ]. Their longevity and migratory capacity also make them ideal targets for viral exploitation [ 16 – 19 ]. NDV has an affinity for macrophages and can enter chicken macrophages through pH-dependent, dynamin-mediated endocytic pathways involving small vesicles [ 20 ] and induces macrophage apoptosis, subverting host immunity and exacerbating tissue injury [ 21 ]. Thus, macrophages may critically influence NDV pathogenicity. Cell-mediated immunity (CMI), orchestrated by T lymphocytes, is essential for antiviral defense. In the spleen, CD4 + T helper cells, CD8 + cytotoxic T cells, and γδ T cells drive CMI responses. While αβ T cells recognize antigen-MHC complexes on antigen-presenting cells (APCs), γδ T cells directly detect pathogens and mediate cytotoxicity [ 22 – 24 ]. CMI responses emerge as early as 2–3 days post-NDV infection or vaccination [ 25 , 26 ] and likely mitigate viral spread by eliminating infected cells [ 27 ]. Macrophages and T lymphocytes are the important immune cells in chicken spleen, and play critical role in viral infection and immunity. However, the dynamic changes in immune cell populations within the chicken spleen during NDV infection, along with the mechanisms driving the significant depletion of T lymphocytes, remain poorly characterized. Here, we analyzed the dynamic change of main splenic immunocytes after genotype VII NDV infection, and investigated the relationship between the macrophages and the T cells with variation in opposite direction. Our findings provide insights into the pathogenesis of genotype VII NDV-induced splenic damage. Materials and methods Ethics statement This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the Ministry of Science and Technology of the People’s Republic of China. All experiments involving NDV were executed in the animal biosafety level 3 facility (CNAS registration No. CNAS BL0015) at Yangzhou University in strict accordance with the recommendations of the institutional biosafety manual and supervised by the Institutional Biosafety Committee of Yangzhou University. Cells and virus Chicken SMNCs were isolated from 4-week-old specific pathogen-free (SPF) white leghorn chickens through density gradient centrifugation using a Chicken Splenic Mononuclear Cells isolation kit (Haoyang, Tianjin, China). SMNCs were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) (ThermoFisher Scientific, Waltham, MA, USA) at 37℃, 5% CO 2 . T cells were sorted from SMNCs and cultured in MH-S specific culture medium (RPMI 1640 medium supplemented with 10% FBS, 0.05mM β-mercaptoethanol and 1% P/S; Procell, Wuhan, China) at 37℃, 5% CO 2 . Macrophages were also sorted form chicken SMNCs and cultured in MH-S specific culture medium at 37℃, 5% CO 2 . The recombinant genotype VII NDV rI4-EGFP was preserved in our laboratory and propagated in 9-day-old SPF chicken embryos. Antibodies and reagents Mouse Anti-Chicken Bu-1-AF647 monoclonal antibody (8395-31), Mouse Anti-Chicken CD45-SPRD monoclonal antibody (8270-13), Mouse Anti-Chicken Monocyte/Macrophage-PE monoclonal antibody (8420-09), Mouse Anti-Chicken CD3-SPRD monoclonal antibody (8200-13), Mouse Anti-Chicken TCRγδ-BIOT monoclonal antibody (8230-08), Mouse Anti-Chicken CD8α-AF700 monoclonal antibody (8220-27) and Mouse Anti-Chicken CD4-PACBLU monoclonal antibody (8210-26) were purchased from Southern Biotech (Birmingham, AL, USA). Brilliant Violet 510 Streptavidin (405233) was purchased from BioLegend (San Diego, CA, USA). CD3 Monoclonal Antibody (Biotin, MA5-28695) and Fixable Viability Dye eFluor 780 (65-0865-14) was purchased from ThermoFisher Scientific (Waltham, MA, USA). Anti-Biotin MicroBeads (130-090-485) and MS Separation columns (130-042-201) were purchased from Miltenyi Biotec (Bergisch Gladbach, Germany). Challenge experiments in chickens Thirty four-week-old SPF chickens were randomly divided into two groups. Fifteen of them were inoculated with the recombinant virus rI4-EGFP via eye drops at a dose of 10 5 EID 50 , while the other 15 were inoculated with an equal volume of sterile PBS through the same route, serving as the control group. On days 2, 4, and 6 post-infection, five chickens were randomly selected from each group and euthanized. The spleens were then harvested and SMNCs suspension was prepared for cell phenotype analysis. Splenic mononuclear cell preparation The chicken SMNCs was made following manufacturer's instructions. The whole spleen was mechanically disrupted, and an appropriate amount of tissue homogenization liquid was added, then the mixture was pushed through a 70µm cell strainer (Corning, NY, USA) using a 5mL syringe plunger. The cells were then centrifuged at 400×g for 10 min. After discarding the supernatant, cells were resuspended with an appropriate amount of sample dilution liquid and layered onto an equal volume of SMNCs separation liquid, followed by centrifugation at 500×g for 25 min. The SMNCs were collected and washed. The isolated cells were resuspended in a complete RPMI-1640 medium. The final cell concentration was adjusted to 1×10 7 cells/mL. Cell counts were performed using the SmartCell 200 (SC1001) purchased from Monwei (Shanghai, China). Cell sorting by flow cytometry 4×10 7 cells were collected and centrifuged at 300×g for 5 minutes. After discarding the supernatant, a 1 mL antibody cocktail containing anti-chicken monocyte/macrophage, Bu-1, and CD3 antibodies was incubated in each sample tube in the dark at 4℃ for 30 minutes. Control tubes without antibodies and single positive tubes for the three antibodies were also set up for compensation adjustment. After washing with flow buffer, 1 mL buffer was added to each tube to resuspend the cells. FACS Aria SORP (Becton Dickinson, USA) was used to sort the various cells, and a collection of 1-2×10 6 cells was obtained. Chicken splenic T cell sorting by magnetic beads 10 8 cells were collected and centrifuged at 300×g for 5 min. Then, the supernatant was discarded and cells were resuspended in 1mL of MACS buffer. After centrifugation, cells were resuspended in 1mL of MACS buffer. Then 13µL CD3-Biotin antibody was added and was incubated at 4℃ for 30 min. After centrifugation, cells were washed once with MACS buffer and resuspended in 475µL of MACS buffer. 25µL of magnetic beads were added, mixed well, incubated at 4℃ for 15 min. After centrifugation and washing, the cells were then resuspended in 500µL of MACS buffer and performed sorting using a magnetic rack. The sorted T cells were cultured in MH-S medium at 37℃ with 5% CO 2 . The purification of chicken splenic macrophage Referencing the separation of macrophages from Peripheral Blood Mononuclear Cells (PBMCs) [ 28 ], a two-step adherence culture method was used to separate macrophages from splenic cells. Chicken SMNCs were cultured at a density of 1×10 7 cells per well in a 6-well plate. At the 24h and 48h post-culturing, cells were washed twice with phosphate-buffered saline (PBS) to remove non-adherent cells. The remaining adherent cells were used for subsequent experiments. qRT-PCR analysis for viral load The virus mRNA was extracted from the cells using the Universal RNA Extraction Ki (2161, GENENODE, China) after infection with rI4-EGFP. Then, cDNA synthesis was performed using HiScript II Q Select RT SuperMix for qPCR (+ gDNA wiper) (R233-01, Vazyme, Nanjing, China) and qRT-PCR reaction was performed using AceQ qPCR Probe Master Mix (Q112-02, Vazyme, Nanjing, China) according to the manufacturer’s instructions on LightCycler 480 (Roche, Basel, Switzerland). The specific primers and the probe used for qPCR are listed in Table 1 . Table 1 Primers and probes for qPCR of F gene Primer Sequence (5’–3’) I4-F GGTCAATCATAGTCAAGTTGCTCC I4-R AACCCCAAGAGCTACACTGCC Probe FAM-AAGCGTTTTTGTCTCCTTCCTCC-BHQ1 Establishment of Macrophage – T cell co-culture model We established the macrophage-T cell co-culture model based on the previous study [ 29 ]. Macrophage were detached with trypsin, counted, and seeded at 1×10 6 per well in a 12-well plate, and cultured overnight in RPMI 1640 medium supplemented with 10% FBS and 1% penicillin/streptomycin. Subsequently, the medium was carefully removed, and 4×10 6 sorted T cells were added to each well, followed by the addition of fresh MHS-specific medium for continued culture. NDV infection on SMNCs, T cells, and co-cultured cells SMNCs and sorted T cells were seeded at 3×10 6 cells per well in a 12-well plate, and co-culture cells were seeded at 5×10 6 cells per well in a 12-well plate. These cells were infected with the rI4-EGFP strain at the indicated MOI for a designated period and were cultured in MHS-specific medium at 37℃ under a 5% CO 2 atmosphere. After viral infection, the cell samples were used for following analysis. Analysis of different cell population percentages by flow cytometry Three flow cytometry staining panels were designed based on the previous study [ 11 ], with Panel 1 for detecting macrophages and B cells and myeloid lineage, Panel 2 for detecting T cell subsets, and Panel 3 for assessing T cell viability. The specific protocols are shown in Table 2 and the gating strategies are shown in Additional file 1 and 2. 100µl cell suspension, adjusted to a concentration of 2×10 6 cells, was added to 1.5mL tubes for antibody staining and final flow analysis. Cells were centrifuged at 300×g for 5 min, and the supernatant was discarded. The cells were resuspended with FACS buffer (PBS containing 0.5% BSA from Sigma company), and anti-chicken antibodies were added. The mixture was incubated at 4℃ in the dark for 30 minutes. Cells were stained with fixable viability dye (FVD) eFluor 780 to exclude dead cells. After centrifugation, the cells were washed twice with flow cytometry buffer and finally resuspended in 400µl of the same buffer for FACS analysis. Concurrently with surface staining in the experimental wells, blank control wells (without any antibodies) and single positive control wells for all antibodies (for compensation adjustment) were also set up. The data were analyzed by FlowJo software (Tree Star Inc., USA). Table 2 The multicolor flow cytometry panel design for SMNCs analysis Fluorochrome APC APC-780 PE PerCP-Cy5.5 Pacific Blue BV510 Alexa eFluor 700 Panel-1 Bu-1 KUL01 CD45 Panel-2 CD3 CD4 TCR1 CD8ɑ Panel-3 FVD CD3 Western blot analysis of viral protein expression SMNCs and T cells were treated as indicated and then washed three times with cold PBS before being lysed in RIPA (P0013B, Beyotime Biotech, Shanghai, China) buffer supplemented with the proteinase inhibitor PMSF (ST506, Beyotime Biotech, Shanghai, China). The total protein concentration in the cell lysate was then measured using the BCA Protein Assay Kit (P0012, Beyotime Biotech, Shanghai, China). The denatured proteins were separated using 10% SDS-PAGE and further transferred to polyvinylidene difluoride (PVDF) membranes. Subsequently, the PVDF membranes were blocked and incubated with diluted primary and secondary antibodies. Detection was performed by incubating the membranes with a chemiluminescent substrate and exposure in a dark room with a ChemiDoc Imager (Bio-Rad Laboratories, CA, USA). Apoptosis analysis of macrophages, T cells, and co-cultured cells The apoptosis ratio was measured by AnnexinV-FITC/PI Cell Apoptosis Detection Kit (C1062M, Beyotime Biotech, Shanghai, China) according to the manufacturer’s instructions. Briefly, macrophages were trypsinized by non-EDTA trypsin, and T cells were collected by centrifugation at 500 g, 4℃ for 5 minutes. Then, cells were washed thrice with PBS and resuspended in 195µL pre-chilled Annexin V-FITC Binding Buffer, supplemented with 5µL Annexin V-FITC and 10µL PI. Cells were incubated at room temperature for 10 minutes in the dark. After incubation, 400 µL Annexin-binding buffer was added, and samples were immediately analyzed in a FACS LSRFortessa (BD Biosciences, Franklin Lakes, NJ, USA). Statistical analysis All data were presented as means ± SD as indicated. Student’s t-test, one-way, and two-way ANOVA tests were used for the analysis of studies where appropriate. All statistical analyses and calculations were carried out using GraphPad Prism software (San Diego, USA). A P value of less than 0.05 was regarded as statistically significant. NS means no significant difference, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Result The dynamic changes in SMNCs following infection with genotype VII NDV To elucidate the dynamics of immune cells in the spleen of chickens following genotype VII NDV infection, we conducted a comprehensive analysis of splenocyte populations. Spleens from infected chickens were harvested, and single-cell suspensions were prepared and counted for detailed immunophenotyping using flow cytometry with specific markers for cell labeling. Our data revealed a significant decrease in the total number of SMNCs over time post-infection, with the most pronounced decline occurring at 6 dpi (Fig. 1 A). The proportion of macrophages in the infected group showed no significant difference compared to the control group at 2 dpi, but was significantly increased at 4 dpi and 6 dpi (Fig. 1 B and 1 C). The absolute number of macrophages also significantly increased at 4 dpi (Fig. 1 D). For B cells, the proportion in the infected group showed no significant change compared to the control group at 2 dpi, but significantly decreased afterward, with a sharp drop at 6 dpi (Fig. 1 E and 1 F). The number of B cells in the infected group was consistently lower than in the control group, with a sharp decline at 6 dpi (Fig. 1 G). The proportion of T cells in the infected group showed no significant change during the infection (Fig. 1 H and 1 I), but their number significantly decreased over time (Fig. 1 J). These results highlight the dynamic changes in immune cells in the spleens of chickens following genotype VII NDV infection. Notably, there was a significant drop in SMNCs, an increase in macrophage proportion, a decrease in both B cell proportion and count, and a stable T cell proportion with reduced numbers. Changes in various T cell subsets after viral infection To further investigate changes in various T cell subsets, we conducted flow cytometric analysis of TCRγδ + T cells, CD4 + T cells, and CD8 + T cells in chicken spleens (Fig. 2 A and 2 D). The results showed that the percentage of TCRγδ + T cells among lymphocytes in the infected group was not significantly different from the control group (Fig. 2 B). However, the absolute number of TCRγδ + T cells was significantly lower in the infected group compared to the control group and continued to decrease (Fig. 2 C). The percentage of CD4 + T cells among TCRγδ − cells showed no significant difference compared to the control group after infection (Fig. 2 E), while the percentage of CD8 + T cells among TCRγδ − cells significantly decreased at 4 and 6 dpi (Fig. 2 G). In terms of cell numbers, both CD4 + and CD8 + T cells were fewer than those in the control group at 2 dpi and continued to decrease (Fig. 2 F and Fig. 2 H). In summary, the numbers of all T lymphocyte subsets in chicken spleens were significantly reduced following viral infection, with a notable decrease in the proportion of CD8 + T cells. NDV exhibits a marked tropism for macrophages To assess the infectivity of various splenocyte types in chickens by NDV, we used flow cytometry to detect GFP expression, which serves as a marker for the virus, in different cell types. The results showed that no green fluorescent signal from the virus was detected in the SMNCs of the control group (Fig. 3 A). In the immune cells from the spleens of infected chickens, the proportion of GFP + cells in macrophages was the highest, significantly greater than in the other three immune cell types (Fig. 3 B). At 4 dpi, the proportion of GFP + T cells in CD4 + T cells significantly increased, though it remained much lower than in macrophages. We then used FACS to isolate macrophages, B cells, and T cells from SMNCs for viral load detection. The purity of the sorted cells exceeded 90%, as determined by FACS analysis (Fig. 3 C). Subsequently, we utilized quantitative real-time PCR to measure the viral load within the sorted T cells, B cells, and macrophages. The data revealed that the viral copy number in macrophages remained significantly higher than that in T cells and B cells at 2, 4 and 6 dpi (Fig. 3 D). To more accurately evaluate the viral tropism for macrophages, T cells, and B cells in the spleen, we determined the relative viral load by calculating the ratio of viral copies to the relative proportion of each cell type. A higher relative viral load indicated a higher susceptibility of the cell to NDV. The results demonstrated that macrophages had a significantly higher relative viral content compared to the other two cell types (Fig. 3 E). These findings suggest that genotype VII NDV exhibits preferential tropism for splenic macrophages in chickens, identifying them as the primary target cells following viral infection of the spleen. The effect of NDV infection on T cell death T cells represent the largest proportion of chicken splenic lymphocytes; however, our previous research has demonstrated a significant decrease in T cell numbers following the NDV infection. To investigate the mechanisms underlying T cell depletion, we utilized magnetic bead-based cell sorting to purify T cells from chicken spleens, achieving a purity exceeding 95% post-sorting (Fig. 4 A). Subsequently, SMNCs and sorted T cells were each infected with rI4-EGFP, and T cell viability was assessed using FACS. The results showed that after viral infection, T cell viability exhibited time (Fig. 4 B and 4 D) and dose-dependent decreases (Fig. 4 C and 4 E) in both the splenocyte and sorted T cell groups. However, the decline in T cell viability is less severe in the sorted T cell group than in the splenocyte group. Furthermore, SMNCs and sorted T cells were each infected with rI4-EGFP at 1 MOI, and T cell viability was assessed at 24 hpi. We found that T cell viability was significantly lower in the splenocyte population than in the sorted T cell group (Fig. 4 F). Additionally, we detected viral protein expression in both cell groups, which exhibited a time-dependent pattern. The NP expression level was significantly higher in the splenocyte group than in the sorted T cell group (Fig. 4 G). These findings indicate that when NDV infects SMNCs in vitro, it induces substantial T cell death, with a more severe degree of cell death compared to the purified T cell group infected with NDV. Macrophages enhance the NDV infectivity on T cells Macrophages were identified as the primary target cells for NDV infection in chicken spleens, we hypothesized that macrophages might play the role in T cell death. To this end, macrophages were isolated with a purity of 80–90% using a two-step adherence method (Fig. 5 A) and co-cultured them with sorted T cells. After infecting the co-culture model with rI4-EGFP, the results showed that the survival rate of T cells in the co-culture group was significantly lower than that in the sorted T cell group (Fig. 5 B), and the proportion of NDV-positive T cells was higher in the co-culture group (Fig. 5 C). We also found that a higher proportion of macrophages led to a more pronounced decrease in T cell survival (Fig. 5 D). Furthermore, we removed macrophages from SMNCs, reducing the macrophage proportion from 22.8–0.27% (Fig. 5 E). Upon elimination of macrophages, the T cell survival rate increased significantly (Fig. 5 F). The data mentioned above suggest that macrophages can enhance NDV infectivity in T cells and exacerbate T cell death. Macrophages induce T cell apoptosis after NDV infection Macrophages can induce T cell apoptosis through the extrinsic apoptosis pathway[ 29 ]. To evaluate T cell apoptosis within the T cell–macrophage co-culture model, we first labeled T cells with a CD3-SPRD antibody, then used the AnnexinV-FITC/PI Cell Apoptosis Detection Kit. The results indicated that rI4-EGFP infection led to significant apoptosis in splenic macrophages (Fig. 6 A and 6 B), aligning with previous reports. Infection of sorted T cells with the virus did not induce apoptosis (Fig. 6 C and 6 E). However, significant T cell apoptosis was observed in the co-culture model (Figs. 6 D and 6 E). These findings indicate that NDV infection does not directly induce T cell apoptosis, and the presence of macrophages may explain this phenomenon. Discussion Newcastle Disease Virus (NDV) causes severe damage to lymphoid tissues. Notably, genotype VII NDV exhibits a stronger tropism for the spleen, characterized by lymphocyte depletion and necrosis [ 30 , 31 ]. While prior studies have documented macroscopic pathological changes in the spleen post-NDV infection, they primarily focused on broad fluctuations in splenic cell populations, leaving detailed analyses of individual immune cell subsets unexplored. To address this gap, we employed multicolor flow cytometry with a panel of fluorochrome-conjugated antibodies to analyze dynamic changes in splenic macrophages, T cells, and B cells at various post-infection time points. Our findings revealed a significant decline in the numbers of SMNCs, T cells, and B cells during NDV infection. Notably, macrophage numbers surged at 4 dpi but returned to levels comparable to the control group at 6 dpi, likely due to the drastic reduction in SMNCs. Furthermore, higher levels of viral replication were detected in macrophages, identifying them as the primary target for viral infection. Previous research has shown that T cell-deficient mice exhibit significantly higher mortality rates and inflammatory cytokine levels after viral infection than wild-type mice, suggesting that T cell-mediated suppression of innate immune responses may be critically important in acute infection pathogenesis [ 32 ]. Given that T cells make up approximately 60% of splenic lymphocytes in chickens and play a pivotal role in NDV defense [ 27 ], a reduction in this subset could undermine cellular immunity and facilitate genotype VII NDV infection. This study provides a comprehensive profile of dynamic splenocyte variation following genotype VII NDV infection and offers crucial insights into viral pathogenesis. To elucidate the relationship between T cell reduction and viral infection, we attempted to isolate chicken splenic T cells. While methods for mammalian T cell isolation are well-established [ 29 , 33 ], protocols for avian T cells require refinement. In this study, both flow cytometry and magnetic bead sorting techniques were employed to enrich chicken splenic T cells. We found that magnetic bead sorting could successfully increase T cell yield and maintain viability, providing a solid foundation for subsequent experiments. The data showed that, following NDV infection, T cell mortality was significantly higher in the mixed splenic cell population than in the sorted T cell population. Additionally, Western blot analysis showed relatively lower NDV viral protein expression in sorted T cells. These findings suggest that genotype VII NDV has limited capacity to infect T cells directly and is not solely responsible for T cell depletion. Macrophages are the primary target cells of genotype VII NDV, and their numbers increase significantly during infection. To clarify the role of macrophages in T cell reduction during genotype VII NDV infection, we prepared high-purity macrophages using a double adhesion culture method and co-cultured them with T cells to create a co-culture model. After viral infection, severe T cell death occurred in the co-culture group, accompanied by a marked increase in virus-infected T cells. Conversely, removing macrophages from the SMNCs significantly increased T cell survival, confirming the crucial role of macrophages in promoting T cell death and viral infection. NDV infection can induce various modes of cell death, including apoptosis [ 34 ], necroptosis [ 35 ], ferroptosis [ 36 ], and pyroptosis [ 37 ]. Apoptosis is recognized as the primary mechanism by which NDV infection induces cell death and mediates pathogenicity [ 38 ]. Studies have shown that NDV infection immediately activates the PI3K/Akt pathway in CEF, inhibiting premature apoptosis during early infection [ 39 ] and thereby promoting viral replication. In later stages of infection, both intrinsic and extrinsic apoptotic pathways become activated. Previous studies indicate that NDV can induce apoptosis in SMNCs [ 10 ]. Our results showed that direct infection of T cells by genotype VII NDV did not cause significant apoptosis. However, when macrophages were co-cultured with T cells, marked T cell apoptosis occurred. Therefore, macrophages promote T cell apoptosis during NDV infection. The previous study has shown that macrophages highly express FasL on their surface, which could interact with FAS on T cells to induce T cell death [ 29 ]. Since the Fas-FasL signaling pathway can activate the apoptotic pathway, we also examined the apoptosis of macrophages and found that NDV infection also caused the apoptosis of macrophages. Thus, we hypothesize that the Fas-FasL signaling pathway may play a critical role in macrophage-mediated T cell apoptosis. In summary, genotype VII NDV triggers a potent immune response through a complex network of immune cell alterations and regulatory mechanisms. Macrophages not only serve as direct viral targets but also contribute to the infection and damage of other immune-related cells, thereby enhancing viral pathogenicity. These findings deepen our understanding of genotype VII NDV’s pathogenic mechanisms and offer a theoretical basis for developing future antiviral strategies. Declarations Competing interests The authors declare that they have no competing interests. Funding This work was funded by The Earmarked Fund for China Agriculture Research System (CARS-40), the National Natural Science Foundation of China (32202767), Yangzhou University Student Academic Science and Technology Innovation Fund (XCX20230744), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). Authors’ contributions MC, QC, and YFL participated in all of the experiments and drafted the manuscript. CW and MYL assisted with the experiments. XLL and TXL analyzed the experimental data. XWL and YC reviewed the article. SLH and XFL helped to design the study. All of the authors have read and approved the final manuscript. Acknowledgements We thank Dr Xiulong Xu (College of Veterinary Medicine, Yangzhou University) for his advice and guidance on this paper. Data availability All data generated or analyzed during this study are included in this published article. References Alexander DJ, Aldous EW, Fuller CM (2012) The long view: a selective review of 40 years of Newcastle disease research. Avian pathology: J W V P A 41(4):329–335 Hanson RP, Brandly CA (1955) Identification of vaccine strains of Newcastle disease virus. Sci (New York N Y) 122(3160):156–157 Miller PJ, Haddas R, Simanov L, Lublin A, Rehmani SF, Wajid A, Bibi T, Khan TA, Yaqub T, Setiyaningsih S, Afonso CL (2015) Identification of new sub-genotypes of virulent Newcastle disease virus with potential panzootic features, Infection, genetics and evolution: journal of molecular epidemiology and evolutionary genetics in infectious diseases 29 216 – 29 Bello MB, Yusoff K, Ideris A, Hair-Bejo M, Peeters BPH, Omar AR (2018) Diagnostic and Vaccination Approaches for Newcastle Disease Virus in Poultry: The Current and Emerging Perspectives, BioMed research international (2018) 7278459 de Leeuw OS, Koch G, Hartog L, Ravenshorst N, Peeters BPH (2005) Virulence of Newcastle disease virus is determined by the cleavage site of the fusion protein and by both the stem region and globular head of the haemagglutinin-neuraminidase protein, The Journal of general virology 86(Pt 6) 1759–1769 Anis Z, Morita T, Azuma K, Ito H, Ito T, Shimada A (2013) Histopathological alterations in immune organs of chickens and ducks after experimental infection with virulent 9a5b newcastle disease virus. J Comp Pathol 149(1):82–93 Harrison L, Brown C, Afonso C, Zhang J, Susta L (2011) Early occurrence of apoptosis in lymphoid tissues from chickens infected with strains of Newcastle disease virus of varying virulence. J Comp Pathol 145(4):327–335 Wang X, Jia Y, Ren J, Liu H, Adam FA, Wang X, Yang Z (2019) Insights into the chicken bursa of fabricius response to Newcastle disease virus at 48 and 72 hours post-infection through RNA-seq. Vet Microbiol 236:108389 Lu A, Diao Y, Chen H, Wang J, Ge P, Sun X, Hao D (2014) Evaluation of histopathological changes, viral load and immune function of domestic geese infected with Newcastle disease virus, Avian pathology: journal of the W.V.P.A 43(4) 325 – 32 Hu Z, Hu J, Hu S, Liu X, Wang X, Zhu J, Liu X (2012) Strong innate immune response and cell death in chicken splenocytes infected with genotype VIId Newcastle disease virus. Virol J 9:208 Hao X, Li S, Chen L, Dong M, Wang J, Hu J, Gu M, Wang X, Hu S, Peng D, Liu X, Shang S (2020) Establishing a Multicolor Flow Cytometry to Characterize Cellular Immune Response in Chickens Following H7N9 Avian Influenza Virus Infection. Viruses 12(12) Hofmann T, Schmucker S (2021) Characterization of Chicken Leukocyte Subsets from Lymphatic Tissue by Flow Cytometry. Cytometry Part A: J Int Soc Anal Cytol 99(3):289–300 Al-Ogaili AS, Hameed SS (2021) Development of lymphocyte subpopulations in local breed chickens. Veterinary world 14(7):1846–1852 Murray PJ, Wynn TA (2011) Protective and pathogenic functions of macrophage subsets, Nature reviews. Immunology 11(11):723–737 Lee M, Du H, Winer DA, Clemente-Casares X, Tsai S (2022) Mechanosensing in macrophages and dendritic cells in steady-state and disease. Front cell Dev biology 10:1044729 Wan SW, Wu-Hsieh BA, Lin YS, Chen WY, Huang Y, Anderson R (2018) The monocyte-macrophage-mast cell axis in dengue pathogenesis. J Biomed Sci 25(1):77 Cline TD, Beck D, Bianchini E (2017) Influenza virus replication in macrophages: balancing protection and pathogenesis. J Gen Virol 98(10):2401–2412 Amarasinghe A, Abdul-Cader MS, Nazir S, De Silva Senapathi U, van der Meer F, Cork SC, Gomis S (2017) Abdul-Careem, Infectious bronchitis corona virus establishes productive infection in avian macrophages interfering with selected antimicrobial functions. PLoS ONE 12(8):e0181801 Cornax I, Diel DG, Rue CA, Estevez C, Yu Q, Miller PJ, Afonso CL (2013) Newcastle disease virus fusion and haemagglutinin-neuraminidase proteins contribute to its macrophage host range, The Journal of general virology 94(Pt 6) 1189–1194 Zhao R, Shi Q, Han Z, Fan Z, Ai H, Chen L, Li L, Liu T, Sun J, Liu S (2021) Newcastle Disease Virus Entry into Chicken Macrophages via a pH-Dependent, Dynamin and Caveola-Mediated Endocytic Pathway That Requires Rab5. J Virol 95(13):e0228820 Ni J, Deng J, Chen Q, Liao T, Hu J, Chen Y, Hu S, Hu Z, Liu X (2023) Role of Macrophages in the Pathogenesis of Genotype VII Newcastle Disease Virus in Chickens, Animals: an open access journal from MDPI 13(13) Linti AE, Göbel TW, Früh SP (2024) Chicken γδ T cells proliferate upon IL-2 and IL-12 treatment and show a restricted receptor repertoire in cell culture. Front Immunol 15:1325024 Born WK, Yin Z, Hahn YS, Sun D, O'Brien RL (1950) Analysis of gamma delta T cell functions in the mouse, Journal of immunology (Baltimore, Md.: 184(8) (2010) 4055-61 Swain SL, McKinstry KK, Strutt TM (2012) Expanding roles for CD4⁺ T cells in immunity to viruses, Nature reviews. Immunology 12(2):136–148 Ghumman JS, Wiggins AD, Bankowski RA (1976) Antibody response and resistance of turkeys to Newcastle disease vaccine strain LaSota. Avian Dis 20(1):1–8 Reynolds DL, Maraqa AD (2000) Protective immunity against Newcastle disease: the role of cell-mediated immunity. Avian Dis 44(1):145–154 Russell PH, Dwivedi PN, Davison TF (1997) The effects of cyclosporin A and cyclophosphamide on the populations of B and T cells and virus in the Harderian gland of chickens vaccinated with the Hitchner B1 strain of Newcastle disease virus. Vet Immunol Immunopathol 60(1–2):171–185 Reddy VR, Trus I, Desmarets LM, Li Y, Theuns S, Nauwynck HJ (2016) Productive replication of nephropathogenic infectious bronchitis virus in peripheral blood monocytic cells, a strategy for viral dissemination and kidney infection in chickens. Vet Res 47(1):70 Roth S, Cao J, Singh V, Tiedt S, Hundeshagen G, Li T, Boehme JD, Chauhan D, Zhu J, Ricci A, Gorka O, Asare Y, Yang J, Lopez MS, Rehberg M, Bruder D, Zhang S, Groß O, Dichgans M, Hornung V, Liesz A (2021) Post-injury immunosuppression and secondary infections are caused by an AIM2 inflammasome-driven signaling cascade. Immunity 54(4):648–659e8 Rue CA, Susta L, Cornax I, Brown CC, Kapczynski DR, Suarez DL, King DJ, Miller PJ, Afonso CL (2011) Virulent Newcastle disease virus elicits a strong innate immune response in chickens, The Journal of general virology 92(Pt 4) 931-9 Hu Z, Hu J, Hu S, Song Q, Ding P, Zhu J, Liu X, Wang X, Liu X (2015) High levels of virus replication and an intense inflammatory response contribute to the severe pathology in lymphoid tissues caused by Newcastle disease virus genotype VIId. Arch Virol 160(3):639–648 Kim KD, Zhao J, Auh S, Yang X, Du P, Tang H, Fu YX (2007) Adaptive immune cells temper initial innate responses. Nat Med 13(10):1248–1252 Mascarau R, Woottum M, Fromont L, Gence R, Cantaloube-Ferrieu V, Vahlas Z, Lévêque K, Bertrand F, Beunon T, Métais A, El Costa H, Jabrane-Ferrat N, Gallois Y, Guibert N, Davignon JL, Favre G, Maridonneau-Parini I, Poincloux R, Lagane B, Bénichou S, Raynaud-Messina B, Vérollet C (2023) Productive HIV-1 infection of tissue macrophages by fusion with infected CD4 + T cells. J Cell Biol 222(5) Chen Y, Zhu S, Liao T, Wang C, Han J, Yang Z, Lu X, Hu Z, Hu J, Wang X, Gu M, Gao R, Liu K, Liu X, Ding C, Hu S, Liu X (2024) The HN protein of Newcastle disease virus induces cell apoptosis through the induction of lysosomal membrane permeabilization. PLoS Pathog 20(2):e1011981 Koks CA, Garg AD, Ehrhardt M, Riva M, Vandenberk L, Boon L, De Vleeschouwer S, Agostinis P, Graf N, Van Gool SW (2015) Newcastle disease virotherapy induces long-term survival and tumor-specific immune memory in orthotopic glioma through the induction of immunogenic cell death. Int J Cancer 136(5):E313–E325 Sun Y, Tang L, Kan X, Tan L, Song C, Qiu X, Liao Y, Nair V, Ding C, Liu X, Sun Y (2024) Oncolytic Newcastle disease virus induced degradation of YAP through E3 ubiquitin ligase PRKN to exacerbate ferroptosis in tumor cells. J Virol 98(3):e0189723 Gao P, Chen L, Fan L, Ren J, Du H, Sun M, Li Y, Xie P, Lin Q, Liao M, Xu C, Ning Z, Ding C, Xiang B, Ren T (2020) Newcastle disease virus RNA-induced IL-1β expression via the NLRP3/caspase-1 inflammasome. Vet Res 51(1):53 Zhang D, Ding Z, Xu X (2023) Pathologic Mech Newctle Disease Virus Viruses 15(4) Kang Y, Yuan R, Zhao X, Xiang B, Gao S, Gao P, Dai X, Feng M, Li Y, Xie P, Li Y, Gao X, Ren T (2017) Transient activation of the PI3K/Akt pathway promotes Newcastle disease virus replication and enhances anti-apoptotic signaling responses. Oncotarget 8(14):23551–23563 Supplementary Files Additionalfile1.tif Additional file 1. Gating strategies of panel-1 to identify chicken B-cells and myeloid lineage. Splenic mononuclear cells were harvested from 4-week-old chickens and surface stained with antibody cocktails. The leukocytes were gated with CD45 positive (A) and then single cells were gated using FSC-A and FSC-H (B). Lymphocyte populations were subsequently gated using FSC-A/SSC-A parameters (C), and Bu-1+ B cells were defined (F). By excluding Bu-1+B cell (E), the KUL01+ cells were identified (D). Additionalfile2.tif Additional file 2. Gating strategies of panel-2 and panel-3 to identify T cell subsets. Lymphocytes were initially gated using FSC-A versus SSC-A (A), with single cells confirmed by FSC-A and FSC-H (B). T cells were identified as CD3 positive (C, D). Live cells were defined as FVD eFluor 780-negative (G). Subsequent analysis of CD3 and TCRγδ expression delineated CD3⁺TCRγδ⁺ (γδ T cells), CD3⁺TCRγδ⁻, and CD3⁻TCRγδ⁻ populations (F). CD3⁺TCRγδ⁻ T cells were subdivided into TCRγδ⁻CD3⁺CD4⁺ and TCRγδ⁻CD3⁺CD8α⁺ subsets (E). Cite Share Download PDF Status: Published Journal Publication published 30 Oct, 2025 Read the published version in Veterinary Research → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6627962\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":456577513,\"identity\":\"a494b3c1-aa5d-481a-b643-33c0cd13dafa\",\"order_by\":0,\"name\":\"Miao Cai\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yangzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Miao\",\"middleName\":\"\",\"lastName\":\"Cai\",\"suffix\":\"\"},{\"id\":456577514,\"identity\":\"d8f78e47-bb7f-4469-b6dc-c9b41efb5ea6\",\"order_by\":1,\"name\":\"Qing Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yangzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Qing\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":456577515,\"identity\":\"11d74510-070f-40fc-8625-c3e17da0d509\",\"order_by\":2,\"name\":\"Yifei Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yangzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yifei\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":456577516,\"identity\":\"36540356-949c-4b1e-9e1d-b945395ff0d2\",\"order_by\":3,\"name\":\"Cong Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yangzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Cong\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":456577517,\"identity\":\"124c48c1-8730-4867-9c76-181b931b30d2\",\"order_by\":4,\"name\":\"Muyao Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yangzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Muyao\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":456577518,\"identity\":\"a105957d-7e15-47c9-b763-5c74230eb113\",\"order_by\":5,\"name\":\"Xiaolong Lu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yangzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaolong\",\"middleName\":\"\",\"lastName\":\"Lu\",\"suffix\":\"\"},{\"id\":456577519,\"identity\":\"976458e4-dbe6-4320-8bf0-a0eee378e2b7\",\"order_by\":6,\"name\":\"Tianxing Liao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yangzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tianxing\",\"middleName\":\"\",\"lastName\":\"Liao\",\"suffix\":\"\"},{\"id\":456577520,\"identity\":\"70698a3b-38c5-44f8-af5c-9958af5315ac\",\"order_by\":7,\"name\":\"Xiaowen Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yangzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaowen\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":456577521,\"identity\":\"7b3ee73c-1506-4bfd-b916-882de8985b7f\",\"order_by\":8,\"name\":\"Xiaoli Hao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yangzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaoli\",\"middleName\":\"\",\"lastName\":\"Hao\",\"suffix\":\"\"},{\"id\":456577522,\"identity\":\"9d3fdbd4-fb70-48b7-b60c-8d503b193dbc\",\"order_by\":9,\"name\":\"Yu Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yangzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yu\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":456577523,\"identity\":\"668c9920-d6a7-4505-9480-aead65d7af89\",\"order_by\":10,\"name\":\"Shunlin Hu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yangzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shunlin\",\"middleName\":\"\",\"lastName\":\"Hu\",\"suffix\":\"\"},{\"id\":456577524,\"identity\":\"73813d9c-a9d5-4376-b824-fda2d25eba33\",\"order_by\":11,\"name\":\"Xiufan Liu\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAu0lEQVRIiWNgGAWjYDAC5sMNBxgqIGwJ4rSwJQK1nCFVCwNjGylaDI4xNh7mnXfY3uAA88HbPAx2eQS1SLYxNhzm3XaY2eAAW7I1D0NyMUEt/PKNYC1sBgd4zKR5GA4A3UkAsLGBbJlzmMfgAP834rTwg7U0HJYA2sJGnBaQXw7OOZZuIHmYzdhyjkEyYS0Gx5gPf3hTY23Pd7z54Y03FXaEtUBBMzAZgE0gUj0Q1BGvdBSMglEwCkYeAABN9zjPqAMwTgAAAABJRU5ErkJggg==\",\"orcid\":\"https://orcid.org/0000-0002-9924-6646\",\"institution\":\"Yangzhou University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Xiufan\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-05-09 11:13:45\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6627962/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6627962/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1186/s13567-025-01631-8\",\"type\":\"published\",\"date\":\"2025-10-30T15:57:58+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":82918890,\"identity\":\"49237023-20c3-4898-93cc-50015f8791dc\",\"added_by\":\"auto\",\"created_at\":\"2025-05-16 16:55:24\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":544235,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe dynamic changes in SMNCs after infection. (A)\\u003c/strong\\u003e The total number of SMNCs in the entire spleen of chickens was determined in both the control and infected groups at 2, 4, and 6 dpi. \\u003cstrong\\u003e(B)\\u003c/strong\\u003e Representative dot-plots depict KUL01\\u003csup\\u003e+\\u003c/sup\\u003ecells in the spleens of chickens\\u003cstrong\\u003e. \\u003c/strong\\u003eThe percentages \\u003cstrong\\u003e(C)\\u003c/strong\\u003e and numbers \\u003cstrong\\u003e(D) \\u003c/strong\\u003eof KUL01\\u003csup\\u003e+\\u003c/sup\\u003e cells in the spleens were measured. \\u003cstrong\\u003e(E)\\u003c/strong\\u003eRepresentative dot-plots illustrate Bu-1\\u003csup\\u003e+\\u003c/sup\\u003e B cells and the percentages \\u003cstrong\\u003e(F)\\u003c/strong\\u003e and total numbers \\u003cstrong\\u003e(G)\\u003c/strong\\u003e of Bu-1\\u003csup\\u003e+\\u003c/sup\\u003e B cells in the spleens were measured.\\u003cstrong\\u003e (H)\\u003c/strong\\u003e Representative dot-plots depict CD3\\u003csup\\u003e+ \\u003c/sup\\u003eT cells in the spleens of chickens\\u003cstrong\\u003e.\\u003c/strong\\u003e The percentages \\u003cstrong\\u003e(I)\\u003c/strong\\u003e and total numbers \\u003cstrong\\u003e(J)\\u003c/strong\\u003e of CD3\\u003csup\\u003e+\\u003c/sup\\u003e T cells in the spleens were also measured.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Onlinefigure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6627962/v1/c0f81ebcfd6f898cc1db4ff5.png\"},{\"id\":82918877,\"identity\":\"c513d730-67a7-4f0e-a8e1-c2cc4efe82f2\",\"added_by\":\"auto\",\"created_at\":\"2025-05-16 16:55:24\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":479118,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eAlterations in T cell subsets following viral infection. (A)\\u003c/strong\\u003e Representative dot-plots showing changes in TCRγδ\\u003csup\\u003e+\\u003c/sup\\u003e T cells and CD3\\u003csup\\u003e+\\u003c/sup\\u003e TCRγδ\\u003csup\\u003e-\\u003c/sup\\u003e T cells. \\u003cstrong\\u003e(B)\\u003c/strong\\u003e The proportion of TCRγδ\\u003csup\\u003e+\\u003c/sup\\u003e T cells among lymphocytes. (\\u003cstrong\\u003eC\\u003c/strong\\u003e) The absolute number of TCRγδ\\u003csup\\u003e+\\u003c/sup\\u003e T cells in the spleen. \\u003cstrong\\u003e(D)\\u003c/strong\\u003e Representative dot-plots showing changes in the proportions of CD4\\u003csup\\u003e+\\u003c/sup\\u003e T cells and CD8\\u003csup\\u003e+\\u003c/sup\\u003e T cells within CD3\\u003csup\\u003e+\\u003c/sup\\u003e TCRγδ\\u003csup\\u003e-\\u003c/sup\\u003e T cells. \\u003cstrong\\u003e(E)\\u003c/strong\\u003e The proportion of CD4\\u003csup\\u003e+\\u003c/sup\\u003e T cells within CD3\\u003csup\\u003e+\\u003c/sup\\u003e TCRγδ\\u003csup\\u003e-\\u003c/sup\\u003e T cells. \\u003cstrong\\u003e(F) \\u003c/strong\\u003eThe absolute number of CD4\\u003csup\\u003e+\\u003c/sup\\u003e T cells in the spleen. \\u003cstrong\\u003e(G)\\u003c/strong\\u003e The proportion of CD8\\u003csup\\u003e+\\u003c/sup\\u003e T cells within CD3\\u003csup\\u003e+\\u003c/sup\\u003e TCRγδ\\u003csup\\u003e-\\u003c/sup\\u003e T cells. \\u003cstrong\\u003e(H)\\u003c/strong\\u003e The absolute number of CD8\\u003csup\\u003e+\\u003c/sup\\u003e T cells in the spleen.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Onlinefigure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6627962/v1/791ed7aa551d80dfa5bf9f14.png\"},{\"id\":82918878,\"identity\":\"d4258d24-bbdb-4520-9636-64c93abe861d\",\"added_by\":\"auto\",\"created_at\":\"2025-05-16 16:55:24\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":228166,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eNDV exhibits a marked tropism for macrophages. (A)\\u003c/strong\\u003eRepresentative peak plots showing the proportion of GFP\\u003csup\\u003e+\\u003c/sup\\u003e cells in chicken SMNCs. \\u003cstrong\\u003e(B)\\u003c/strong\\u003eThe proportion of GFP\\u003csup\\u003e+\\u003c/sup\\u003e cells in chicken SMNCs.\\u003cstrong\\u003e (C)\\u003c/strong\\u003e High purity of B cells, T cells and KUL01\\u003csup\\u003e+\\u003c/sup\\u003e cell isolated from chicken SMNCs at 2, 4, and 6 dpi using FACS. \\u003cstrong\\u003e(D)\\u003c/strong\\u003eThe viral load within these three types of cells was quantified using fluorescent quantitative detection. \\u003cstrong\\u003e(E)\\u003c/strong\\u003eThe relative viral content of each cell was determined by calculating the ratio of intracellular viral copies to the relative proportion of that cell. Statistical graphics were generated using GraphPad Prism software.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Onlinefigure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6627962/v1/0d9e0df9167eec5481c4dd69.png\"},{\"id\":82918895,\"identity\":\"964420c9-80ca-4cab-9d44-1a7a72771798\",\"added_by\":\"auto\",\"created_at\":\"2025-05-16 16:55:25\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":210195,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eT cell death detection in NDV-infected SMNCs.\\u003c/strong\\u003e Chicken spleens were sterilely harvested and prepared into a single cell suspension. T cells were then labeled with a biotin-conjugated anti-chicken CD3 antibody. \\u003cstrong\\u003e(A) \\u003c/strong\\u003eThe cells were collected using streptavidin magnetic beads, and the purity of T cells was assessed using flow cytometry. \\u003cstrong\\u003e(B) \\u003c/strong\\u003eT cell survival in SMNCs was assessed at different time points following viral infection. \\u003cstrong\\u003e(C) \\u003c/strong\\u003eT cell survival in SMNCs was assessed after infection with MOIs of 0.1, 1, and 5. \\u003cstrong\\u003e(D) \\u003c/strong\\u003eT cell survival was assessed in isolated T cells at different time points following viral infection. \\u003cstrong\\u003e(E) \\u003c/strong\\u003eT cell survival was examined in isolated T cells after infection with MOIs of 0.1, 1, and 5. \\u003cstrong\\u003e(F) \\u003c/strong\\u003eT cell survival was compared between isolated T cells and SMNCs at 24 hpi with an MOI of 1. \\u003cstrong\\u003e(G) \\u003c/strong\\u003eDetection of the NP via Western blotting\\u003cstrong\\u003e. \\u003c/strong\\u003eSMNCs and T cells were infected with NDV at an MOI of 1 for 6, 12, 18, or 24 hpi, then harvested and lysed in RIPA buffer containing PMSF. Western blotting was then performed using specific antibodies to detect the expression levels of NDV NP and HN.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Onlinefigure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6627962/v1/d2b1aeab5a272dfee24a2b79.png\"},{\"id\":82918882,\"identity\":\"0a24e297-ad96-4f5a-820d-206eedb9b54d\",\"added_by\":\"auto\",\"created_at\":\"2025-05-16 16:55:24\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":179838,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe role of macrophages in T cell death.\\u003c/strong\\u003e SMNCs were cultured in a 10cm dish, and the supernatant was discarded, followed by washing with PBS twice every 24 hours. The adherent cells at the bottom were collected, and their purity was determined by flow cytometry following incubation with macrophage surface marker antibodies at 48hpi \\u003cstrong\\u003e(A)\\u003c/strong\\u003e. Macrophages and T cells were co-cultured at a ratio of 1:4, and both co-cultured cells and T cells were infected with rI4-EGFP at an MOI of 1. After 24 hours, samples were collected, and T cell viability \\u003cstrong\\u003e(B)\\u003c/strong\\u003e and the proportion of CD3\\u003csup\\u003e+\\u003c/sup\\u003eGFP\\u003csup\\u003e+\\u003c/sup\\u003e cells \\u003cstrong\\u003e(C) \\u003c/strong\\u003ewere assessed by flow cytometry. Macrophages and T cells were co-cultured at ratios of 1:2 and 1:4, and both co-cultured cells and T cells were infected with rI4-EGFP at an MOI of 1. After 24 hours, samples were collected, and T cell viability was assessed by flow cytometry\\u003cstrong\\u003e(D)\\u003c/strong\\u003e. Macrophages were removed from SMNCs cells using the adherence method \\u003cstrong\\u003e(E)\\u003c/strong\\u003e. Subsequently, both s SMNCs with and without macrophages were infected with the virus at an MOI of 1, and T cell viability was determined by flow cytometry \\u003cstrong\\u003e(F)\\u003c/strong\\u003e.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Onlinefigure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6627962/v1/bd6a3089b66e4dd2637cdc80.png\"},{\"id\":82919603,\"identity\":\"ad6f7340-0614-4f02-90c8-b3876a86e32d\",\"added_by\":\"auto\",\"created_at\":\"2025-05-16 17:11:24\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":262058,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSevere apoptosis of T cells within co-cultured cells. \\u003c/strong\\u003eCells were infected with rI4-EGFP at an MOI of 1, and cell samples were collected at 24hpi. The cells were incubated with Annexin V-FITC apoptosis detection reagent kit and anti-chicken CD3 antibody. Apoptosis levels of primary macrophages \\u003cstrong\\u003e(A)\\u003c/strong\\u003e, T cells \\u003cstrong\\u003e(C)\\u003c/strong\\u003e, and T cells in co-culture \\u003cstrong\\u003e(D)\\u003c/strong\\u003e were assessed by flow cytometry. \\u003cstrong\\u003e(B, E) \\u003c/strong\\u003eStatistical analysis of the results was performed using GraphPad Prism 9.0 software.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Onlinefigure6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6627962/v1/6d74d7ef75609b1a92bbf969.png\"},{\"id\":95040636,\"identity\":\"483d53a4-69f5-4206-8666-afe85696b4cf\",\"added_by\":\"auto\",\"created_at\":\"2025-11-03 16:10:04\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":3893738,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6627962/v1/41c9ed54-e73d-4fbc-bb31-a6b6e15fbd8a.pdf\"},{\"id\":82918881,\"identity\":\"3efe12d2-a9dc-4cf3-a24c-69b61b12e060\",\"added_by\":\"auto\",\"created_at\":\"2025-05-16 16:55:24\",\"extension\":\"tif\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":1417580,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eAdditional file 1.\\u003c/strong\\u003e \\u003cstrong\\u003eGating strategies of panel-1 to identify chicken B-cells and myeloid lineage.\\u003c/strong\\u003e Splenic mononuclear cells were harvested from 4-week-old chickens and surface stained with antibody cocktails. The leukocytes were gated with CD45 positive (A) and then single cells were gated using FSC-A and FSC-H (B). Lymphocyte populations were subsequently gated using FSC-A/SSC-A parameters (C), and Bu-1+ B cells were defined (F). By excluding Bu-1+B cell (E), the KUL01+ cells were identified (D).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Additionalfile1.tif\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6627962/v1/9b3a05e7fbc10e6fb3912dda.tif\"},{\"id\":82918885,\"identity\":\"d38a9433-8ba6-48ea-b3f8-dc10100d0987\",\"added_by\":\"auto\",\"created_at\":\"2025-05-16 16:55:24\",\"extension\":\"tif\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":1510288,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eAdditional file 2. Gating strategies of panel-2 and panel-3 to identify T cell subsets. \\u003c/strong\\u003eLymphocytes were initially gated using FSC-A versus SSC-A \\u003cstrong\\u003e(A)\\u003c/strong\\u003e, with single cells confirmed by FSC-A and FSC-H \\u003cstrong\\u003e(B)\\u003c/strong\\u003e. T cells were identified as CD3 positive \\u003cstrong\\u003e(C, D)\\u003c/strong\\u003e. Live cells were defined as FVD eFluor 780-negative \\u003cstrong\\u003e(G)\\u003c/strong\\u003e. Subsequent analysis of CD3 and TCRγδ expression delineated CD3⁺TCRγδ⁺ (γδ T cells), CD3⁺TCRγδ⁻, and CD3⁻TCRγδ⁻ populations \\u003cstrong\\u003e(F)\\u003c/strong\\u003e. CD3⁺TCRγδ⁻ T cells were subdivided into TCRγδ⁻CD3⁺CD4⁺ and TCRγδ⁻CD3⁺CD8α⁺ subsets \\u003cstrong\\u003e(E)\\u003c/strong\\u003e.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Additionalfile2.tif\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6627962/v1/2d3685051104cceab73a1740.tif\"}],\"financialInterests\":\"\",\"formattedTitle\":\"Macrophages are the target cells for genotype VII Newcastle disease virus and promote the infection and apoptosis of chicken splenic T cells\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eNewcastle disease (ND) is an acute, highly contagious avian infectious disease caused by virulent Newcastle disease virus (NDV) and has caused pandemics worldwide [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. NDV, which belongs to the genus Orthoavulavirus, is classified into avirulent (lentogenic), intermediate (mesogenic), and virulent (velogenic) pathotypes based on their pathogenicity [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. Phylogenetic analysis of the fusion (F) gene further categorizes NDV into two classes: class I and class II, with genotype VII strains currently driving the fourth and ongoing pandemic [\\u003cspan additionalcitationids=\\\"CR4\\\" citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. Virulent NDV strains are typically lymphophilic and can cause lymphocytes depletion in the spleen, bursa, and thymus, along with significant upregulation of genes involved in the innate immune response [\\u003cspan additionalcitationids=\\\"CR7\\\" citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. NDV viral loads in these organs correlate well with the severity of clinical signs and tissue damage [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. Compared with other genotype strains, genotype VII NDV can cause more severe damage to the immune organs of poultry, inducing strong immune response and cell death in lymphoid tissues, particularly in the spleen [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. Therefore, even if vaccinated with traditional vaccines, the immunized poultry flocks can still be infected by genotype VII NDVs, leading to a reduction in protective efficacy.\\u003c/p\\u003e \\u003cp\\u003eIn chickens, splenic mononuclear cells (SMNCs) primarily consist of lymphocytes with a small quantity of macrophages and dendritic cells (DCs) [\\u003cspan additionalcitationids=\\\"CR12\\\" citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. Based on available antibodies specific to chicken immune cell surface markers as previously published [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e], we developed a multicolor flow cytometry protocol to precisely quantify splenic macrophages and lymphocytes, enabling detailed analysis of their dynamics post-NDV infection.\\u003c/p\\u003e \\u003cp\\u003eMacrophages are essential for maintaining homeostasis in the body and play a central role in the antiviral immune response. Macrophages are innate immune cells that release inflammatory factors during viral invasion. They also function as antigen-presenting cells, contributing to both innate and adaptive immune responses. Additionally, they can engulf pathogens and clear cellular debris through phagocytosis [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. Their longevity and migratory capacity also make them ideal targets for viral exploitation [\\u003cspan additionalcitationids=\\\"CR17 CR18\\\" citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. NDV has an affinity for macrophages and can enter chicken macrophages through pH-dependent, dynamin-mediated endocytic pathways involving small vesicles [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e] and induces macrophage apoptosis, subverting host immunity and exacerbating tissue injury [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Thus, macrophages may critically influence NDV pathogenicity.\\u003c/p\\u003e \\u003cp\\u003eCell-mediated immunity (CMI), orchestrated by T lymphocytes, is essential for antiviral defense. In the spleen, CD4\\u003csup\\u003e+\\u003c/sup\\u003e T helper cells, CD8\\u003csup\\u003e+\\u003c/sup\\u003e cytotoxic T cells, and γδ T cells drive CMI responses. While αβ T cells recognize antigen-MHC complexes on antigen-presenting cells (APCs), γδ T cells directly detect pathogens and mediate cytotoxicity [\\u003cspan additionalcitationids=\\\"CR23\\\" citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. CMI responses emerge as early as 2\\u0026ndash;3 days post-NDV infection or vaccination [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e] and likely mitigate viral spread by eliminating infected cells [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eMacrophages and T lymphocytes are the important immune cells in chicken spleen, and play critical role in viral infection and immunity. However, the dynamic changes in immune cell populations within the chicken spleen during NDV infection, along with the mechanisms driving the significant depletion of T lymphocytes, remain poorly characterized. Here, we analyzed the dynamic change of main splenic immunocytes after genotype VII NDV infection, and investigated the relationship between the macrophages and the T cells with variation in opposite direction. Our findings provide insights into the pathogenesis of genotype VII NDV-induced splenic damage.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eEthics statement\\u003c/h2\\u003e \\u003cp\\u003e This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the Ministry of Science and Technology of the People’s Republic of China. All experiments involving NDV were executed in the animal biosafety level 3 facility (CNAS registration No. CNAS BL0015) at Yangzhou University in strict accordance with the recommendations of the institutional biosafety manual and supervised by the Institutional Biosafety Committee of Yangzhou University.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eCells and virus\\u003c/h3\\u003e\\n\\u003cp\\u003eChicken SMNCs were isolated from 4-week-old specific pathogen-free (SPF) white leghorn chickens through density gradient centrifugation using a Chicken Splenic Mononuclear Cells isolation kit (Haoyang, Tianjin, China). SMNCs were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) (ThermoFisher Scientific, Waltham, MA, USA) at 37℃, 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e. T cells were sorted from SMNCs and cultured in MH-S specific culture medium (RPMI 1640 medium supplemented with 10% FBS, 0.05mM β-mercaptoethanol and 1% P/S; Procell, Wuhan, China) at 37℃, 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e. Macrophages were also sorted form chicken SMNCs and cultured in MH-S specific culture medium at 37℃, 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e. The recombinant genotype VII NDV rI4-EGFP was preserved in our laboratory and propagated in 9-day-old SPF chicken embryos.\\u003c/p\\u003e\\n\\u003ch3\\u003eAntibodies and reagents\\u003c/h3\\u003e\\n\\u003cp\\u003eMouse Anti-Chicken Bu-1-AF647 monoclonal antibody (8395-31), Mouse Anti-Chicken CD45-SPRD monoclonal antibody (8270-13), Mouse Anti-Chicken Monocyte/Macrophage-PE monoclonal antibody (8420-09), Mouse Anti-Chicken CD3-SPRD monoclonal antibody (8200-13), Mouse Anti-Chicken TCRγδ-BIOT monoclonal antibody (8230-08), Mouse Anti-Chicken CD8α-AF700 monoclonal antibody (8220-27) and Mouse Anti-Chicken CD4-PACBLU monoclonal antibody (8210-26) were purchased from Southern Biotech (Birmingham, AL, USA). Brilliant Violet 510 Streptavidin (405233) was purchased from BioLegend (San Diego, CA, USA). CD3 Monoclonal Antibody (Biotin, MA5-28695) and Fixable Viability Dye eFluor 780 (65-0865-14) was purchased from ThermoFisher Scientific (Waltham, MA, USA). Anti-Biotin MicroBeads (130-090-485) and MS Separation columns (130-042-201) were purchased from Miltenyi Biotec (Bergisch Gladbach, Germany).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eChallenge experiments in chickens\\u003c/b\\u003eThirty four-week-old SPF chickens were randomly divided into two groups. Fifteen of them were inoculated with the recombinant virus rI4-EGFP via eye drops at a dose of 10\\u003csup\\u003e5\\u003c/sup\\u003e EID\\u003csub\\u003e50\\u003c/sub\\u003e, while the other 15 were inoculated with an equal volume of sterile PBS through the same route, serving as the control group. On days 2, 4, and 6 post-infection, five chickens were randomly selected from each group and euthanized. The spleens were then harvested and SMNCs suspension was prepared for cell phenotype analysis.\\u003c/p\\u003e\\n\\u003ch3\\u003eSplenic mononuclear cell preparation\\u003c/h3\\u003e\\n\\u003cp\\u003eThe chicken SMNCs was made following manufacturer's instructions. The whole spleen was mechanically disrupted, and an appropriate amount of tissue homogenization liquid was added, then the mixture was pushed through a 70µm cell strainer (Corning, NY, USA) using a 5mL syringe plunger. The cells were then centrifuged at 400×g for 10 min. After discarding the supernatant, cells were resuspended with an appropriate amount of sample dilution liquid and layered onto an equal volume of SMNCs separation liquid, followed by centrifugation at 500×g for 25 min. The SMNCs were collected and washed. The isolated cells were resuspended in a complete RPMI-1640 medium. The final cell concentration was adjusted to 1×10\\u003csup\\u003e7\\u003c/sup\\u003e cells/mL. Cell counts were performed using the SmartCell 200 (SC1001) purchased from Monwei (Shanghai, China).\\u003c/p\\u003e\\n\\u003ch3\\u003eCell sorting by flow cytometry\\u003c/h3\\u003e\\n\\u003cp\\u003e4×10\\u003csup\\u003e7\\u003c/sup\\u003e cells were collected and centrifuged at 300×g for 5 minutes. After discarding the supernatant, a 1 mL antibody cocktail containing anti-chicken monocyte/macrophage, Bu-1, and CD3 antibodies was incubated in each sample tube in the dark at 4℃ for 30 minutes. Control tubes without antibodies and single positive tubes for the three antibodies were also set up for compensation adjustment. After washing with flow buffer, 1 mL buffer was added to each tube to resuspend the cells. FACS Aria SORP (Becton Dickinson, USA) was used to sort the various cells, and a collection of 1-2×10\\u003csup\\u003e6\\u003c/sup\\u003e cells was obtained.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eChicken splenic T cell sorting by magnetic beads\\u003c/h2\\u003e \\u003cp\\u003e10\\u003csup\\u003e8\\u003c/sup\\u003e cells were collected and centrifuged at 300×g for 5 min. Then, the supernatant was discarded and cells were resuspended in 1mL of MACS buffer. After centrifugation, cells were resuspended in 1mL of MACS buffer. Then 13µL CD3-Biotin antibody was added and was incubated at 4℃ for 30 min. After centrifugation, cells were washed once with MACS buffer and resuspended in 475µL of MACS buffer. 25µL of magnetic beads were added, mixed well, incubated at 4℃ for 15 min. After centrifugation and washing, the cells were then resuspended in 500µL of MACS buffer and performed sorting using a magnetic rack. The sorted T cells were cultured in MH-S medium at 37℃ with 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eThe purification of chicken splenic macrophage\\u003c/h3\\u003e\\n\\u003cp\\u003eReferencing the separation of macrophages from Peripheral Blood Mononuclear Cells (PBMCs) [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e], a two-step adherence culture method was used to separate macrophages from splenic cells. Chicken SMNCs were cultured at a density of 1×10\\u003csup\\u003e7\\u003c/sup\\u003e cells per well in a 6-well plate. At the 24h and 48h post-culturing, cells were washed twice with phosphate-buffered saline (PBS) to remove non-adherent cells. The remaining adherent cells were used for subsequent experiments.\\u003c/p\\u003e\\n\\u003ch3\\u003eqRT-PCR analysis for viral load\\u003c/h3\\u003e\\n\\u003cp\\u003eThe virus mRNA was extracted from the cells using the Universal RNA Extraction Ki (2161, GENENODE, China) after infection with rI4-EGFP. Then, cDNA synthesis was performed using HiScript II Q Select RT SuperMix for qPCR (+ gDNA wiper) (R233-01, Vazyme, Nanjing, China) and qRT-PCR reaction was performed using AceQ qPCR Probe Master Mix (Q112-02, Vazyme, Nanjing, China) according to the manufacturer’s instructions on LightCycler 480 (Roche, Basel, Switzerland). The specific primers and the probe used for qPCR are listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePrimers and probes for qPCR of F gene\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e\\u003ccolgroup cols=\\\"2\\\"\\u003e\\u003c/colgroup\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer\\u003c/p\\u003e \\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eSequence (5’–3’)\\u003c/p\\u003e \\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eI4-F\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGGTCAATCATAGTCAAGTTGCTCC\\u003c/p\\u003e \\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eI4-R\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAACCCCAAGAGCTACACTGCC\\u003c/p\\u003e \\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eProbe\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eFAM-AAGCGTTTTTGTCTCCTTCCTCC-BHQ1\\u003c/p\\u003e \\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/table\\u003e\\u003c/div\\u003e \\u003cp\\u003e\\u003c/p\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eEstablishment of Macrophage – T cell co-culture model\\u003c/h2\\u003e \\u003cp\\u003eWe established the macrophage-T cell co-culture model based on the previous study [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. Macrophage were detached with trypsin, counted, and seeded at 1×10\\u003csup\\u003e6\\u003c/sup\\u003e per well in a 12-well plate, and cultured overnight in RPMI 1640 medium supplemented with 10% FBS and 1% penicillin/streptomycin. Subsequently, the medium was carefully removed, and 4×10\\u003csup\\u003e6\\u003c/sup\\u003e sorted T cells were added to each well, followed by the addition of fresh MHS-specific medium for continued culture.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eNDV infection on SMNCs, T cells, and co-cultured cells\\u003c/h2\\u003e \\u003cp\\u003eSMNCs and sorted T cells were seeded at 3×10\\u003csup\\u003e6\\u003c/sup\\u003e cells per well in a 12-well plate, and co-culture cells were seeded at 5×10\\u003csup\\u003e6\\u003c/sup\\u003e cells per well in a 12-well plate. These cells were infected with the rI4-EGFP strain at the indicated MOI for a designated period and were cultured in MHS-specific medium at 37℃ under a 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e atmosphere. After viral infection, the cell samples were used for following analysis.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAnalysis of different cell population percentages by flow cytometry\\u003c/h2\\u003e \\u003cp\\u003eThree flow cytometry staining panels were designed based on the previous study [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e], with Panel 1 for detecting macrophages and B cells and myeloid lineage, Panel 2 for detecting T cell subsets, and Panel 3 for assessing T cell viability. The specific protocols are shown in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e and the gating strategies are shown in Additional file 1 and 2. 100µl cell suspension, adjusted to a concentration of 2×10\\u003csup\\u003e6\\u003c/sup\\u003e cells, was added to 1.5mL tubes for antibody staining and final flow analysis. Cells were centrifuged at 300×g for 5 min, and the supernatant was discarded. The cells were resuspended with FACS buffer (PBS containing 0.5% BSA from Sigma company), and anti-chicken antibodies were added. The mixture was incubated at 4℃ in the dark for 30 minutes. Cells were stained with fixable viability dye (FVD) eFluor 780 to exclude dead cells. After centrifugation, the cells were washed twice with flow cytometry buffer and finally resuspended in 400µl of the same buffer for FACS analysis. Concurrently with surface staining in the experimental wells, blank control wells (without any antibodies) and single positive control wells for all antibodies (for compensation adjustment) were also set up. The data were analyzed by FlowJo software (Tree Star Inc., USA).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c8\\\" colnum=\\\"8\\\"\\u003e\\u003c/div\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eThe multicolor flow cytometry panel design for SMNCs analysis\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e\\u003ccolgroup cols=\\\"8\\\"\\u003e\\u003c/colgroup\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eFluorochrome\\u003c/p\\u003e \\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAPC\\u003c/p\\u003e \\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAPC-780\\u003c/p\\u003e \\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003ePE\\u003c/p\\u003e \\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003ePerCP-Cy5.5\\u003c/p\\u003e \\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003ePacific Blue\\u003c/p\\u003e \\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eBV510\\u003c/p\\u003e \\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003eAlexa eFluor 700\\u003c/p\\u003e \\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePanel-1\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eBu-1\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eKUL01\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eCD45\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePanel-2\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eCD3\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eCD4\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eTCR1\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003eCD8ɑ\\u003c/p\\u003e \\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePanel-3\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eFVD\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eCD3\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/table\\u003e\\u003c/div\\u003e \\u003cp\\u003e\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eWestern blot analysis of viral protein expression\\u003c/h2\\u003e \\u003cp\\u003eSMNCs and T cells were treated as indicated and then washed three times with cold PBS before being lysed in RIPA (P0013B, Beyotime Biotech, Shanghai, China) buffer supplemented with the proteinase inhibitor PMSF (ST506, Beyotime Biotech, Shanghai, China). The total protein concentration in the cell lysate was then measured using the BCA Protein Assay Kit (P0012, Beyotime Biotech, Shanghai, China). The denatured proteins were separated using 10% SDS-PAGE and further transferred to polyvinylidene difluoride (PVDF) membranes. Subsequently, the PVDF membranes were blocked and incubated with diluted primary and secondary antibodies. Detection was performed by incubating the membranes with a chemiluminescent substrate and exposure in a dark room with a ChemiDoc Imager (Bio-Rad Laboratories, CA, USA).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eApoptosis analysis of macrophages, T cells, and co-cultured cells\\u003c/h2\\u003e \\u003cp\\u003eThe apoptosis ratio was measured by AnnexinV-FITC/PI Cell Apoptosis Detection Kit (C1062M, Beyotime Biotech, Shanghai, China) according to the manufacturer’s instructions. Briefly, macrophages were trypsinized by non-EDTA trypsin, and T cells were collected by centrifugation at 500 g, 4℃ for 5 minutes. Then, cells were washed thrice with PBS and resuspended in 195µL pre-chilled Annexin V-FITC Binding Buffer, supplemented with 5µL Annexin V-FITC and 10µL PI. Cells were incubated at room temperature for 10 minutes in the dark. After incubation, 400 µL Annexin-binding buffer was added, and samples were immediately analyzed in a FACS LSRFortessa (BD Biosciences, Franklin Lakes, NJ, USA).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eAll data were presented as means ± SD as indicated. Student’s t-test, one-way, and two-way ANOVA tests were used for the analysis of studies where appropriate. All statistical analyses and calculations were carried out using GraphPad Prism software (San Diego, USA). A P value of less than 0.05 was regarded as statistically significant. NS means no significant difference, *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001, ****P \\u0026lt; 0.0001.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Result\",\"content\":\"\\u003ch2\\u003eThe dynamic changes in SMNCs following infection with genotype VII NDV\\u003c/h2\\u003e\\u003cp\\u003eTo elucidate the dynamics of immune cells in the spleen of chickens following genotype VII NDV infection, we conducted a comprehensive analysis of splenocyte populations. Spleens from infected chickens were harvested, and single-cell suspensions were prepared and counted for detailed immunophenotyping using flow cytometry with specific markers for cell labeling. Our data revealed a significant decrease in the total number of SMNCs over time post-infection, with the most pronounced decline occurring at 6 dpi (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). The proportion of macrophages in the infected group showed no significant difference compared to the control group at 2 dpi, but was significantly increased at 4 dpi and 6 dpi (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB and \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC). The absolute number of macrophages also significantly increased at 4 dpi (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD). For B cells, the proportion in the infected group showed no significant change compared to the control group at 2 dpi, but significantly decreased afterward, with a sharp drop at 6 dpi (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eE and \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eF). The number of B cells in the infected group was consistently lower than in the control group, with a sharp decline at 6 dpi (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eG). The proportion of T cells in the infected group showed no significant change during the infection (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eH and \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eI), but their number significantly decreased over time (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eJ).\\u003c/p\\u003e\\u003cp\\u003eThese results highlight the dynamic changes in immune cells in the spleens of chickens following genotype VII NDV infection. Notably, there was a significant drop in SMNCs, an increase in macrophage proportion, a decrease in both B cell proportion and count, and a stable T cell proportion with reduced numbers.\\u003c/p\\u003e\\u003ch2\\u003eChanges in various T cell subsets after viral infection\\u003c/h2\\u003e\\u003cp\\u003eTo further investigate changes in various T cell subsets, we conducted flow cytometric analysis of TCRγδ\\u003csup\\u003e+\\u003c/sup\\u003e T cells, CD4\\u003csup\\u003e+\\u003c/sup\\u003e T cells, and CD8\\u003csup\\u003e+\\u003c/sup\\u003e T cells in chicken spleens (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD). The results showed that the percentage of TCRγδ\\u003csup\\u003e+\\u003c/sup\\u003e T cells among lymphocytes in the infected group was not significantly different from the control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). However, the absolute number of TCRγδ\\u003csup\\u003e+\\u003c/sup\\u003e T cells was significantly lower in the infected group compared to the control group and continued to decrease (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC). The percentage of CD4\\u003csup\\u003e+\\u003c/sup\\u003e T cells among TCRγδ\\u003csup\\u003e−\\u003c/sup\\u003e cells showed no significant difference compared to the control group after infection (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE), while the percentage of CD8\\u003csup\\u003e+\\u003c/sup\\u003e T cells among TCRγδ\\u003csup\\u003e−\\u003c/sup\\u003e cells significantly decreased at 4 and 6 dpi (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eG). In terms of cell numbers, both CD4\\u003csup\\u003e+\\u003c/sup\\u003e and CD8\\u003csup\\u003e+\\u003c/sup\\u003e T cells were fewer than those in the control group at 2 dpi and continued to decrease (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eF and Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eH).\\u003c/p\\u003e\\u003cp\\u003eIn summary, the numbers of all T lymphocyte subsets in chicken spleens were significantly reduced following viral infection, with a notable decrease in the proportion of CD8\\u003csup\\u003e+\\u003c/sup\\u003e T cells.\\u003c/p\\u003e\\u003ch2\\u003eNDV exhibits a marked tropism for macrophages\\u003c/h2\\u003e\\u003cp\\u003eTo assess the infectivity of various splenocyte types in chickens by NDV, we used flow cytometry to detect GFP expression, which serves as a marker for the virus, in different cell types. The results showed that no green fluorescent signal from the virus was detected in the SMNCs of the control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). In the immune cells from the spleens of infected chickens, the proportion of GFP\\u003csup\\u003e+\\u003c/sup\\u003e cells in macrophages was the highest, significantly greater than in the other three immune cell types (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB). At 4 dpi, the proportion of GFP\\u003csup\\u003e+\\u003c/sup\\u003e T cells in CD4\\u003csup\\u003e+\\u003c/sup\\u003e T cells significantly increased, though it remained much lower than in macrophages. We then used FACS to isolate macrophages, B cells, and T cells from SMNCs for viral load detection. The purity of the sorted cells exceeded 90%, as determined by FACS analysis (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC). Subsequently, we utilized quantitative real-time PCR to measure the viral load within the sorted T cells, B cells, and macrophages. The data revealed that the viral copy number in macrophages remained significantly higher than that in T cells and B cells at 2, 4 and 6 dpi (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). To more accurately evaluate the viral tropism for macrophages, T cells, and B cells in the spleen, we determined the relative viral load by calculating the ratio of viral copies to the relative proportion of each cell type. A higher relative viral load indicated a higher susceptibility of the cell to NDV. The results demonstrated that macrophages had a significantly higher relative viral content compared to the other two cell types (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eE). These findings suggest that genotype VII NDV exhibits preferential tropism for splenic macrophages in chickens, identifying them as the primary target cells following viral infection of the spleen.\\u003c/p\\u003e\\u003ch2\\u003eThe effect of NDV infection on T cell death\\u003c/h2\\u003e\\u003cp\\u003eT cells represent the largest proportion of chicken splenic lymphocytes; however, our previous research has demonstrated a significant decrease in T cell numbers following the NDV infection. To investigate the mechanisms underlying T cell depletion, we utilized magnetic bead-based cell sorting to purify T cells from chicken spleens, achieving a purity exceeding 95% post-sorting (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA). Subsequently, SMNCs and sorted T cells were each infected with rI4-EGFP, and T cell viability was assessed using FACS. The results showed that after viral infection, T cell viability exhibited time (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB and \\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eD) and dose-dependent decreases (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC and \\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eE) in both the splenocyte and sorted T cell groups. However, the decline in T cell viability is less severe in the sorted T cell group than in the splenocyte group. Furthermore, SMNCs and sorted T cells were each infected with rI4-EGFP at 1 MOI, and T cell viability was assessed at 24 hpi. We found that T cell viability was significantly lower in the splenocyte population than in the sorted T cell group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eF). Additionally, we detected viral protein expression in both cell groups, which exhibited a time-dependent pattern. The NP expression level was significantly higher in the splenocyte group than in the sorted T cell group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eG). These findings indicate that when NDV infects SMNCs in vitro, it induces substantial T cell death, with a more severe degree of cell death compared to the purified T cell group infected with NDV.\\u003c/p\\u003e\\u003ch2\\u003eMacrophages enhance the NDV infectivity on T cells\\u003c/h2\\u003e\\u003cp\\u003eMacrophages were identified as the primary target cells for NDV infection in chicken spleens, we hypothesized that macrophages might play the role in T cell death. To this end, macrophages were isolated with a purity of 80–90% using a two-step adherence method (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA) and co-cultured them with sorted T cells. After infecting the co-culture model with rI4-EGFP, the results showed that the survival rate of T cells in the co-culture group was significantly lower than that in the sorted T cell group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB), and the proportion of NDV-positive T cells was higher in the co-culture group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC). We also found that a higher proportion of macrophages led to a more pronounced decrease in T cell survival (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eD). Furthermore, we removed macrophages from SMNCs, reducing the macrophage proportion from 22.8–0.27% (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eE). Upon elimination of macrophages, the T cell survival rate increased significantly (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eF). The data mentioned above suggest that macrophages can enhance NDV infectivity in T cells and exacerbate T cell death.\\u003c/p\\u003e\\u003ch2\\u003eMacrophages induce T cell apoptosis after NDV infection\\u003c/h2\\u003e\\u003cp\\u003eMacrophages can induce T cell apoptosis through the extrinsic apoptosis pathway[\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. To evaluate T cell apoptosis within the T cell–macrophage co-culture model, we first labeled T cells with a CD3-SPRD antibody, then used the AnnexinV-FITC/PI Cell Apoptosis Detection Kit. The results indicated that rI4-EGFP infection led to significant apoptosis in splenic macrophages (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA and \\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eB), aligning with previous reports. Infection of sorted T cells with the virus did not induce apoptosis (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eC and \\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eE). However, significant T cell apoptosis was observed in the co-culture model (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eD and \\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eE). These findings indicate that NDV infection does not directly induce T cell apoptosis, and the presence of macrophages may explain this phenomenon.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eNewcastle Disease Virus (NDV) causes severe damage to lymphoid tissues. Notably, genotype VII NDV exhibits a stronger tropism for the spleen, characterized by lymphocyte depletion and necrosis [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. While prior studies have documented macroscopic pathological changes in the spleen post-NDV infection, they primarily focused on broad fluctuations in splenic cell populations, leaving detailed analyses of individual immune cell subsets unexplored. To address this gap, we employed multicolor flow cytometry with a panel of fluorochrome-conjugated antibodies to analyze dynamic changes in splenic macrophages, T cells, and B cells at various post-infection time points. Our findings revealed a significant decline in the numbers of SMNCs, T cells, and B cells during NDV infection. Notably, macrophage numbers surged at 4 dpi but returned to levels comparable to the control group at 6 dpi, likely due to the drastic reduction in SMNCs. Furthermore, higher levels of viral replication were detected in macrophages, identifying them as the primary target for viral infection. Previous research has shown that T cell-deficient mice exhibit significantly higher mortality rates and inflammatory cytokine levels after viral infection than wild-type mice, suggesting that T cell-mediated suppression of innate immune responses may be critically important in acute infection pathogenesis [\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]. Given that T cells make up approximately 60% of splenic lymphocytes in chickens and play a pivotal role in NDV defense [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e], a reduction in this subset could undermine cellular immunity and facilitate genotype VII NDV infection. This study provides a comprehensive profile of dynamic splenocyte variation following genotype VII NDV infection and offers crucial insights into viral pathogenesis.\\u003c/p\\u003e \\u003cp\\u003eTo elucidate the relationship between T cell reduction and viral infection, we attempted to isolate chicken splenic T cells. While methods for mammalian T cell isolation are well-established [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e], protocols for avian T cells require refinement. In this study, both flow cytometry and magnetic bead sorting techniques were employed to enrich chicken splenic T cells. We found that magnetic bead sorting could successfully increase T cell yield and maintain viability, providing a solid foundation for subsequent experiments. The data showed that, following NDV infection, T cell mortality was significantly higher in the mixed splenic cell population than in the sorted T cell population. Additionally, Western blot analysis showed relatively lower NDV viral protein expression in sorted T cells. These findings suggest that genotype VII NDV has limited capacity to infect T cells directly and is not solely responsible for T cell depletion.\\u003c/p\\u003e \\u003cp\\u003eMacrophages are the primary target cells of genotype VII NDV, and their numbers increase significantly during infection. To clarify the role of macrophages in T cell reduction during genotype VII NDV infection, we prepared high-purity macrophages using a double adhesion culture method and co-cultured them with T cells to create a co-culture model. After viral infection, severe T cell death occurred in the co-culture group, accompanied by a marked increase in virus-infected T cells. Conversely, removing macrophages from the SMNCs significantly increased T cell survival, confirming the crucial role of macrophages in promoting T cell death and viral infection.\\u003c/p\\u003e \\u003cp\\u003eNDV infection can induce various modes of cell death, including apoptosis [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e], necroptosis [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e], ferroptosis [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e], and pyroptosis [\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]. Apoptosis is recognized as the primary mechanism by which NDV infection induces cell death and mediates pathogenicity [\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e]. Studies have shown that NDV infection immediately activates the PI3K/Akt pathway in CEF, inhibiting premature apoptosis during early infection [\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e] and thereby promoting viral replication. In later stages of infection, both intrinsic and extrinsic apoptotic pathways become activated. Previous studies indicate that NDV can induce apoptosis in SMNCs [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. Our results showed that direct infection of T cells by genotype VII NDV did not cause significant apoptosis. However, when macrophages were co-cultured with T cells, marked T cell apoptosis occurred. Therefore, macrophages promote T cell apoptosis during NDV infection. The previous study has shown that macrophages highly express FasL on their surface, which could interact with FAS on T cells to induce T cell death [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. Since the Fas-FasL signaling pathway can activate the apoptotic pathway, we also examined the apoptosis of macrophages and found that NDV infection also caused the apoptosis of macrophages. Thus, we hypothesize that the Fas-FasL signaling pathway may play a critical role in macrophage-mediated T cell apoptosis.\\u003c/p\\u003e \\u003cp\\u003eIn summary, genotype VII NDV triggers a potent immune response through a complex network of immune cell alterations and regulatory mechanisms. Macrophages not only serve as direct viral targets but also contribute to the infection and damage of other immune-related cells, thereby enhancing viral pathogenicity. These findings deepen our understanding of genotype VII NDV\\u0026rsquo;s pathogenic mechanisms and offer a theoretical basis for developing future antiviral strategies.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003ch2\\u003eCompeting interests\\u003c/h2\\u003e \\u003cp\\u003eThe authors declare that they have no competing interests.\\u003c/p\\u003e \\u003ch2\\u003eFunding\\u003c/h2\\u003e \\u003cp\\u003eThis work was funded by The Earmarked Fund for China Agriculture Research System (CARS-40), the National Natural Science Foundation of China (32202767), Yangzhou University Student Academic Science and Technology Innovation Fund (XCX20230744), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).\\u003c/p\\u003e\\u003ch2\\u003eAuthors\\u0026rsquo; contributions\\u003c/h2\\u003e \\u003cp\\u003eMC, QC, and YFL participated in all of the experiments and drafted the manuscript. CW and MYL assisted with the experiments. XLL and TXL analyzed the experimental data. XWL and YC reviewed the article. SLH and XFL helped to design the study. All of the authors have read and approved the final manuscript.\\u003c/p\\u003e\\u003ch2\\u003eAcknowledgements\\u003c/h2\\u003e \\u003cp\\u003eWe thank Dr Xiulong Xu (College of Veterinary Medicine, Yangzhou University) for his advice and guidance on this paper.\\u003c/p\\u003e\\u003ch2\\u003eData availability\\u003c/h2\\u003e \\u003cp\\u003eAll data generated or analyzed during this study are included in this published article.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eAlexander DJ, Aldous EW, Fuller CM (2012) The long view: a selective review of 40 years of Newcastle disease research. Avian pathology: J W V P A 41(4):329\\u0026ndash;335\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHanson RP, Brandly CA (1955) Identification of vaccine strains of Newcastle disease virus. Sci (New York N Y) 122(3160):156\\u0026ndash;157\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMiller PJ, Haddas R, Simanov L, Lublin A, Rehmani SF, Wajid A, Bibi T, Khan TA, Yaqub T, Setiyaningsih S, Afonso CL (2015) Identification of new sub-genotypes of virulent Newcastle disease virus with potential panzootic features, Infection, genetics and evolution: journal of molecular epidemiology and evolutionary genetics in infectious diseases 29 216\\u0026thinsp;\\u0026ndash;\\u0026thinsp;29\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBello MB, Yusoff K, Ideris A, Hair-Bejo M, Peeters BPH, Omar AR (2018) Diagnostic and Vaccination Approaches for Newcastle Disease Virus in Poultry: The Current and Emerging Perspectives, BioMed research international (2018) 7278459\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ede Leeuw OS, Koch G, Hartog L, Ravenshorst N, Peeters BPH (2005) Virulence of Newcastle disease virus is determined by the cleavage site of the fusion protein and by both the stem region and globular head of the haemagglutinin-neuraminidase protein, The Journal of general virology 86(Pt 6) 1759\\u0026ndash;1769\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAnis Z, Morita T, Azuma K, Ito H, Ito T, Shimada A (2013) Histopathological alterations in immune organs of chickens and ducks after experimental infection with virulent 9a5b newcastle disease virus. J Comp Pathol 149(1):82\\u0026ndash;93\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHarrison L, Brown C, Afonso C, Zhang J, Susta L (2011) Early occurrence of apoptosis in lymphoid tissues from chickens infected with strains of Newcastle disease virus of varying virulence. J Comp Pathol 145(4):327\\u0026ndash;335\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang X, Jia Y, Ren J, Liu H, Adam FA, Wang X, Yang Z (2019) Insights into the chicken bursa of fabricius response to Newcastle disease virus at 48 and 72 hours post-infection through RNA-seq. Vet Microbiol 236:108389\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLu A, Diao Y, Chen H, Wang J, Ge P, Sun X, Hao D (2014) Evaluation of histopathological changes, viral load and immune function of domestic geese infected with Newcastle disease virus, Avian pathology: journal of the W.V.P.A 43(4) 325\\u0026thinsp;\\u0026ndash;\\u0026thinsp;32\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHu Z, Hu J, Hu S, Liu X, Wang X, Zhu J, Liu X (2012) Strong innate immune response and cell death in chicken splenocytes infected with genotype VIId Newcastle disease virus. Virol J 9:208\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHao X, Li S, Chen L, Dong M, Wang J, Hu J, Gu M, Wang X, Hu S, Peng D, Liu X, Shang S (2020) Establishing a Multicolor Flow Cytometry to Characterize Cellular Immune Response in Chickens Following H7N9 Avian Influenza Virus Infection. Viruses 12(12)\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHofmann T, Schmucker S (2021) Characterization of Chicken Leukocyte Subsets from Lymphatic Tissue by Flow Cytometry. Cytometry Part A: J Int Soc Anal Cytol 99(3):289\\u0026ndash;300\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAl-Ogaili AS, Hameed SS (2021) Development of lymphocyte subpopulations in local breed chickens. Veterinary world 14(7):1846\\u0026ndash;1852\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMurray PJ, Wynn TA (2011) Protective and pathogenic functions of macrophage subsets, Nature reviews. Immunology 11(11):723\\u0026ndash;737\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLee M, Du H, Winer DA, Clemente-Casares X, Tsai S (2022) Mechanosensing in macrophages and dendritic cells in steady-state and disease. Front cell Dev biology 10:1044729\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWan SW, Wu-Hsieh BA, Lin YS, Chen WY, Huang Y, Anderson R (2018) The monocyte-macrophage-mast cell axis in dengue pathogenesis. J Biomed Sci 25(1):77\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCline TD, Beck D, Bianchini E (2017) Influenza virus replication in macrophages: balancing protection and pathogenesis. J Gen Virol 98(10):2401\\u0026ndash;2412\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAmarasinghe A, Abdul-Cader MS, Nazir S, De Silva Senapathi U, van der Meer F, Cork SC, Gomis S (2017) Abdul-Careem, Infectious bronchitis corona virus establishes productive infection in avian macrophages interfering with selected antimicrobial functions. PLoS ONE 12(8):e0181801\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCornax I, Diel DG, Rue CA, Estevez C, Yu Q, Miller PJ, Afonso CL (2013) Newcastle disease virus fusion and haemagglutinin-neuraminidase proteins contribute to its macrophage host range, The Journal of general virology 94(Pt 6) 1189\\u0026ndash;1194\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhao R, Shi Q, Han Z, Fan Z, Ai H, Chen L, Li L, Liu T, Sun J, Liu S (2021) Newcastle Disease Virus Entry into Chicken Macrophages via a pH-Dependent, Dynamin and Caveola-Mediated Endocytic Pathway That Requires Rab5. J Virol 95(13):e0228820\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNi J, Deng J, Chen Q, Liao T, Hu J, Chen Y, Hu S, Hu Z, Liu X (2023) Role of Macrophages in the Pathogenesis of Genotype VII Newcastle Disease Virus in Chickens, Animals: an open access journal from MDPI 13(13)\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLinti AE, G\\u0026ouml;bel TW, Fr\\u0026uuml;h SP (2024) Chicken γδ T cells proliferate upon IL-2 and IL-12 treatment and show a restricted receptor repertoire in cell culture. Front Immunol 15:1325024\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBorn WK, Yin Z, Hahn YS, Sun D, O'Brien RL (1950) Analysis of gamma delta T cell functions in the mouse, Journal of immunology (Baltimore, Md.: 184(8) (2010) 4055-61\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSwain SL, McKinstry KK, Strutt TM (2012) Expanding roles for CD4⁺ T cells in immunity to viruses, Nature reviews. Immunology 12(2):136\\u0026ndash;148\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGhumman JS, Wiggins AD, Bankowski RA (1976) Antibody response and resistance of turkeys to Newcastle disease vaccine strain LaSota. Avian Dis 20(1):1\\u0026ndash;8\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eReynolds DL, Maraqa AD (2000) Protective immunity against Newcastle disease: the role of cell-mediated immunity. Avian Dis 44(1):145\\u0026ndash;154\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRussell PH, Dwivedi PN, Davison TF (1997) The effects of cyclosporin A and cyclophosphamide on the populations of B and T cells and virus in the Harderian gland of chickens vaccinated with the Hitchner B1 strain of Newcastle disease virus. Vet Immunol Immunopathol 60(1\\u0026ndash;2):171\\u0026ndash;185\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eReddy VR, Trus I, Desmarets LM, Li Y, Theuns S, Nauwynck HJ (2016) Productive replication of nephropathogenic infectious bronchitis virus in peripheral blood monocytic cells, a strategy for viral dissemination and kidney infection in chickens. Vet Res 47(1):70\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRoth S, Cao J, Singh V, Tiedt S, Hundeshagen G, Li T, Boehme JD, Chauhan D, Zhu J, Ricci A, Gorka O, Asare Y, Yang J, Lopez MS, Rehberg M, Bruder D, Zhang S, Gro\\u0026szlig; O, Dichgans M, Hornung V, Liesz A (2021) Post-injury immunosuppression and secondary infections are caused by an AIM2 inflammasome-driven signaling cascade. Immunity 54(4):648\\u0026ndash;659e8\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRue CA, Susta L, Cornax I, Brown CC, Kapczynski DR, Suarez DL, King DJ, Miller PJ, Afonso CL (2011) Virulent Newcastle disease virus elicits a strong innate immune response in chickens, The Journal of general virology 92(Pt 4) 931-9\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHu Z, Hu J, Hu S, Song Q, Ding P, Zhu J, Liu X, Wang X, Liu X (2015) High levels of virus replication and an intense inflammatory response contribute to the severe pathology in lymphoid tissues caused by Newcastle disease virus genotype VIId. Arch Virol 160(3):639\\u0026ndash;648\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKim KD, Zhao J, Auh S, Yang X, Du P, Tang H, Fu YX (2007) Adaptive immune cells temper initial innate responses. Nat Med 13(10):1248\\u0026ndash;1252\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMascarau R, Woottum M, Fromont L, Gence R, Cantaloube-Ferrieu V, Vahlas Z, L\\u0026eacute;v\\u0026ecirc;que K, Bertrand F, Beunon T, M\\u0026eacute;tais A, El Costa H, Jabrane-Ferrat N, Gallois Y, Guibert N, Davignon JL, Favre G, Maridonneau-Parini I, Poincloux R, Lagane B, B\\u0026eacute;nichou S, Raynaud-Messina B, V\\u0026eacute;rollet C (2023) Productive HIV-1 infection of tissue macrophages by fusion with infected CD4\\u0026thinsp;+\\u0026thinsp;T cells. J Cell Biol 222(5)\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen Y, Zhu S, Liao T, Wang C, Han J, Yang Z, Lu X, Hu Z, Hu J, Wang X, Gu M, Gao R, Liu K, Liu X, Ding C, Hu S, Liu X (2024) The HN protein of Newcastle disease virus induces cell apoptosis through the induction of lysosomal membrane permeabilization. PLoS Pathog 20(2):e1011981\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKoks CA, Garg AD, Ehrhardt M, Riva M, Vandenberk L, Boon L, De Vleeschouwer S, Agostinis P, Graf N, Van Gool SW (2015) Newcastle disease virotherapy induces long-term survival and tumor-specific immune memory in orthotopic glioma through the induction of immunogenic cell death. Int J Cancer 136(5):E313\\u0026ndash;E325\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSun Y, Tang L, Kan X, Tan L, Song C, Qiu X, Liao Y, Nair V, Ding C, Liu X, Sun Y (2024) Oncolytic Newcastle disease virus induced degradation of YAP through E3 ubiquitin ligase PRKN to exacerbate ferroptosis in tumor cells. J Virol 98(3):e0189723\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGao P, Chen L, Fan L, Ren J, Du H, Sun M, Li Y, Xie P, Lin Q, Liao M, Xu C, Ning Z, Ding C, Xiang B, Ren T (2020) Newcastle disease virus RNA-induced IL-1β expression via the NLRP3/caspase-1 inflammasome. Vet Res 51(1):53\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang D, Ding Z, Xu X (2023) Pathologic Mech Newctle Disease Virus Viruses 15(4)\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKang Y, Yuan R, Zhao X, Xiang B, Gao S, Gao P, Dai X, Feng M, Li Y, Xie P, Li Y, Gao X, Ren T (2017) Transient activation of the PI3K/Akt pathway promotes Newcastle disease virus replication and enhances anti-apoptotic signaling responses. Oncotarget 8(14):23551\\u0026ndash;23563\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Newcastle disease virus, Flow cytometry analysis, Lymphocytes, Macrophages, T cells, Apoptosis\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6627962/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6627962/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eInfection with genotype VII Newcastle disease virus (NDV) poses a significant threat to poultry health, characterized by severe damage to immune organs such as lymphocyte depletion. However, the precise mechanisms underlying this phenomenon remain unclear. Our present investigation focused on the dynamic changes of macrophages, T cells, and B cells in the spleen of chickens infected with genotype VII NDV by using multicolor flow cytometry. We found that NDV selectively infected chicken splenic macrophages and significantly increased the number of macrophages at 4 days post-infection. In contrast, T and B cells became progressively depleted. In vitro experiment revealed that following genotype VII NDV infection, T cells underwent apoptosis more potently when co-cultured with macrophages than that without macrophages. Overall, our findings highlight the changes in chicken splenic immune cell populations triggered by genotype VII NDV and illuminate the role of macrophages in T cell depletion.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Macrophages are the target cells for genotype VII Newcastle disease virus and promote the infection and apoptosis of chicken splenic T cells\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-05-16 16:55:19\",\"doi\":\"10.21203/rs.3.rs-6627962/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"01e9df5c-a715-443f-b80b-4a047196be72\",\"owner\":[],\"postedDate\":\"May 16th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-11-03T16:06:53+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-6627962\",\"link\":\"https://doi.org/10.1186/s13567-025-01631-8\",\"journal\":{\"identity\":\"veterinary-research\",\"isVorOnly\":false,\"title\":\"Veterinary Research\"},\"publishedOn\":\"2025-10-30 15:57:58\",\"publishedOnDateReadable\":\"October 30th, 2025\"},\"versionCreatedAt\":\"2025-05-16 16:55:19\",\"video\":\"\",\"vorDoi\":\"10.1186/s13567-025-01631-8\",\"vorDoiUrl\":\"https://doi.org/10.1186/s13567-025-01631-8\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6627962\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6627962\",\"identity\":\"rs-6627962\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}