{"paper_id":"0d1c3552-6b79-49b8-9ce5-027cc8d7a5e9","body_text":"BK Channels Are Indispensable for Endothelial Function in Small Pulmonary Arteries | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article BK Channels Are Indispensable for Endothelial Function in Small Pulmonary Arteries Divya Guntur, Dusan Jeremic, Reka Csaki, Oleh Myronenko, Valentina Biasin, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6506992/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 21 Oct, 2025 Read the published version in Cell Communication and Signaling → Version 1 posted 9 You are reading this latest preprint version Abstract Background Pulmonary hypertension (PH) is a progressive vascular disease that severely compromises quality of life and survival. The pulmonary endothelium plays a pivotal role in vascular homeostasis through complex signalling networks involving ion channels that respond to ionic imbalance (e.g. Na+, K+, Ca2+) and mechanical stimuli (e.g. via Piezo, TRPC, TRPV channels). While large-conductance calcium-activated potassium channels (BK channels) in pulmonary artery smooth muscle cells promote vasorelaxation and attenuate PH, their role in endothelial function is poorly defined. This study investigates the contribution of endothelial BK channels to pulmonary vascular signalling and their potential as therapeutic targets in PH. Methods Human lung tissue samples from patients with idiopathic pulmonary arterial hypertension (IPAH) and healthy donors were assessed for BK channel expression by qPCR, Western blot and immunofluorescence staining. BK channel activity in human pulmonary artery endothelial cells was evaluated through patch-clamp recordings. In vivo, BK knockout (BK KO) mice and hypoxia-exposed wild-type mice were used to study endothelial dysfunction and vascular remodelling. Cellular metabolism was analysed using oxygen consumption rate (OCR) and extracellular acidification rate (ECAR), while ex vivo vasoreactivity was assessed via wire myography. Results Wild type mice exposed to hypoxia (7 and 28 days) exhibited increased right ventricular systolic pressure (RVSP) and endothelial dysfunction with reduced BK channel function. BK KO mice showed impaired acetylcholine-induced vasodilation of pulmonary arteries, a sign of endothelial dysfunction, similar to mice exposed to hypoxia. BK KO endothelial cells displayed increased mitochondrial respiration. In human PAECs (hPAECs), functional BK channels were identified and in IPAH patients, they were significantly downregulated. Pharmacological BK inhibition in hPAECs resulted in impaired nitric oxide (NO) production and uncontrolled angiogenesis. Furthermore, BK channels colocalised with Piezo-1, and their absence impaired Piezo-1-mediated calcium influx, suggesting a pivotal role in endothelial calcium signaling. Conclusions BK channels are integral to pulmonary endothelial signalling, regulating vasodilation, angiogenesis, calcium dynamics, and metabolic homeostasis. Their dysfunction contributes to endothelial impairment in PH, and their downregulation in IPAH highlights a novel pathogenic mechanism. Restoration of BK channel function may offer a promising therapeutic strategy to preserve endothelial function and counteract pulmonary vascular remodelling. BK channels Piezo-1 channels endothelial dysfunction hyperpolarization pulmonary hypertension Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Pulmonary hypertension (PH) is a chronic, progressive clinical condition that limits patients' quality of life and drastically reduces their life expectancy [ 1 – 3 ]. Left-sided heart disease and chronic obstructive pulmonary disease (COPD) represent a significant lifetime risk for PH and drive the overall number of PH patients [ 4 , 5 ]. This explains why the global prevalence of PH is around 1% of the worldwide population [ 6 ] and the steadily increasing prevalence of heart failure and COPD also suggests increasing numbers of PH. Treatment options are only available for a small subset of PH patients with pulmonary arterial hypertension (PAH and chronic thromboembolic pulmonary hypertension (CTEPH)) [ 7 , 8 ]. The pathogenesis of the disease is multifactorial but pulmonary vascular remodelling is the hallmark of the disease and endothelial dysfunction appears to play a major role [ 9 – 13 ]. However, little is known about the role of ion channels in endothelial dysfunction. The large conductance calcium-activated potassium channels (BK) and its subunits play an important role in the lung vasculature [ 14 ]. BK are activated by changes in both voltage and intracellular calcium concentration ([Ca 2+ ] i ). As a result of BK activity, the cells tend to repolarise / hyperpolarise. The apparent Ca 2+ - and/or voltage-sensitivity is directly regulated via various kinases including cAMP-dependent protein kinase (PKA), cGMP-dependent (PKG). BK channels mediate the effects of prostacyclin receptor agonists and NO in the arterial smooth muscle cells [ 15 ]. This, along with KCNK3/TASK-1 channel [ 16 ] represents the most important mechanism of prostacyclin-induced vasodilatation. Nearly all mechanistic investigations on BK channels were performed in smooth muscle cells and not in PA endothelial cells (PAEC). It has even been assumed that BK channels are not present in endothelial cells. However, Piezo-1 channels play an important role in endothelial cells. Previous studies indicate a functional interaction between Piezo-1 and Ca2+-activated K + channels. For example, shear stress-induced activation of Piezo-1 channel triggers Ca2 + entry, which activates medium conductance Ca2+-activated K + channels and low conductance Ca2+-activated K + channels in other cell types. In this study, we show BK expression and function in human and mouse PA endothelium and a critical role of BK for piezo-1 function, suggesting that endothelial BK loss or dysfunction is highly relevant for endothelial dysfunction. Methods Human lung samples Human lung tissue samples were obtained from patients with idiopathic pulmonary arterial hypertension (IPAH) who underwent lung transplantation at the Medical University of Vienna, Department of Thoracic Surgery. The study protocol for obtaining the human tissue at the Medical University of Vienna was approved by the Institutional Review Board (approval number 976/2010) and written informed consent was obtained from each participant prior to transplantation. The human cells and tissues used at Stanford were obtained through the Pulmonary Hypertension Breakthrough Initiative (PHBI), funded by the NIH (R24 HL123767) and the Cardiovascular Medical Research and Education Fund (CMREF; UL 1RR024986. The demographics of these samples have been previously described [ 17 , 18 ]. The diagnosis was confirmed by experienced pathologists and pulmonologists who reviewed chest CT scans and right heart catheterisation results. Lung tissue from healthy donors who also came from the same institution was included as controls. Cell culture and handling Human pulmonary artery endothelial cells (PAECs) PAECs from donors and IPAH samples were isolated and harvested from PAs less than 2 mm in diameter. The endothelial layer was treated with a mixture of collagenase, DNase and dispase in Hank's Balanced Salt Solution (HBSS) at room temperature. After enzymatic digestion, the cell suspension was collected, resuspended in complete endothelial medium (Lonza, Basel, Switzerland and ScienCell, CA, USA) and cultured in gelatin-coated T25 flasks at 37°C and 5% CO₂. Once the cells reached 70–80% confluence, they were trypsinised and subjected to three rounds of CD31-selective magnetically activated cell sorting to enrich the endothelial cell population. Cell identity was verified by morphology and marker analysis (smooth muscle actin, fibronectin, vimentin, von Willebrand factor, smooth muscle myosin heavy chain and CD31). Extra PAECs were cryopreserved in endothelial cell complete medium with 10% foetal calf serum (FCS) and 10% dimethyl sulphoxide (DMSO) and stored in liquid nitrogen for later use. The experiments were performed with cells from passages 3 to 9. Human PAECs (hPAECs), whether purchased (Lonza, Basel, Switzerland or PromoCell, MO, USA) or isolated as described, were cultured in gelatin-coated flasks (0.1% gelatin solution in PBS) with endothelial cell complete medium containing antibiotics (penicillin and streptomycin). Isolation of mouse lung endothelial cells: Mice lungs were placed on a perti dish and minced with scalpel to as small pieces as possible. The tissue was then added into a 50 mL centrifuge tube containing 4 mL digestion solution: 3 mg/ml collagenase I (Gibco, Carlsbad, CA, USA) and 0.1 mg/ml DNase (Serva electrophoresis, Heidelberg, Germany) in DMEM F12 basal medium. The falcon was then placed on a shaker at 37°C for 45 minutes for tissue digestion. The digested tissue suspension was then filtered through a 100 µm cell sieve. To stop digestion, an equal volume of DMEM F12 complete medium with fetal calf serum (FCS) was added. The suspension was centrifuged at 1200 rpm and 4°C for 8 minutes. The supernatant was discarded and the pellet was resuspended in CD31 coated dynabeads (For a pair of mouse lungs, 15µL dynabeads (Invitrogen, Waltham, MA, USA) were coated with 1.5µL CD31 antibody (BD Pharmigen, NJ, USA) overnight on a shaker at 4°C and washed the following day with sterile PBS to remove any unbound antibody and resuspended in 100µL PBS) in a microcentrifuge tube. This tube was placed on a shaker for 15 minutes at room temperature. The tube containing the beads was then placed on a magnetic stand and the supernatant was discarded. The tube was removed from the magnetic stand, the beads were re-suspended in 1mL medium and the procedure was repeated approximately six times to remove all non-CD31-specific cells. After the last wash, the beads were resuspended in endothelial growth medium (Lonza EBM with microvascular endothelial growth supplements) and seeded on a gelatin-coated T25 cell culture flask. After 48 hours, the unattached cells were removed by washing once with PBS, and fresh medium was then added every day until the cells were confluent. For experiments, each sample represent the results obtained from isolation of ECs from 2–3 mice lungs pooled. Evaluation of pulmonary arterial vasoreactivity Mice aged 12–16 weeks were euthanized by cervical dislocation and their lungs were harvested for isolation of PAs. For those experiments without endothelium, the cell layer was denuded mechanically by rubbing the lumen of the pulmonary artery with a strand of human hair. The denuded artery was checked for intact endothelium-dependent vasodilation as demonstrated by more than a 50% vasodilatory response with acetylcholine. The PAs were then mounted on a wire myograph (Danish Myo Technology 620M, Aarhus, Denmark) using tungsten wires for mouse PAs and pins for human PAs. The mounted vessels were equilibrated for 30 minutes in a physiological saline solution (PSS) at a pH of 7.4, under full oxygenation and at 37°C. Baseline tension was gradually adjusted to 2 mN and stabilised for a further 30 minutes. As a quality control, vessel viability was assessed by three consecutive 15-minute depolarisations with high potassium PSS (KPSS; 120 mM KCl instead of NaCl to maintain isotonicity). Vessels with a mean KPSS response of less than 2 mN were excluded from further experiments. Isometric tension recordings were collected using force transducers connected to the myograph system (PowerLab, ADInstrument, Oxford, UK). Experimental protocols included initial exposure of vessels to a vasoconstrictor in the bath solution, followed by application of increasing concentrations of vasodilators. Vasorelaxation was expressed as a percentage of the maximal response to the vasoconstrictor. Detection of mRNA expression levels hPAECs were cultured until they reached confluence. RNA was isolated either by Trisol reagent or by an RNA isolation kit (Zymo research, CA, USA) according to the manufacturer’s protocol. Complementary DNA (cDNA) synthesis was performed using a cDNA synthesis kit (iScript, Bio-Rad, Hercules CA, USA or Takara, Shiga, Japan) according to the manufacturer’s instructions. The expression levels of the target genes were then analysed by quantitative real-time PCR (qRT-PCR). The qRT-PCR was performed using Applied Biosystems PowerTrack SYBR Green Master Mix (ThermoFisher Scientific, MA, USA) in a standard thermocycler. The SYBR Green dye intercalates with the double-stranded DNA during amplification, enabling quantification of gene expression based on fluorescence intensity. The used primer sequences are given below (5' to 3') human KCNMA1 Fwd ATGGTGACTTTCTTCGGGGG Rev TTCTGGGCCTCCTTCGTCT human B2M Fwd CCTGGAGGCTATCCAGCGTACTCC Rev TGTCGGATGGATGAAACCCAGACA mouse PIEZO1 Fwd CCCTGTCCAACTGGATGTGT Rev GGGCTGGGGGTATTTCTTCTC mouse PIEZO2 Fwd GCACTCTACCTCAGGAAGACTG Rev CAAAGCTGTGCCACCAGGTTCT mouse ORAI1 Fwd CCTGGCGCAAGCTCTACTTA Rev CATCGCTACCATGGCGAAGC mouse STIM1 Fwd ATTGTGTCGCCCTTGTCCAT Rev GGGTCAAATCCCTCTGAGATCC mouse B2M Fwd ATACGCCTGCAGAGTTAAGCA Rev TCACATGTCTCGATCCCAGTAG siRNA silencing hPAECs were plated in 6-well plates. After 24 hours, the medium was removed and 900 µl was added per well. The jetPRIME treatment solution was prepared by adding jetPRIME buffer (96.75 µL/well) (Polyplus, NY, USA) and siRNA/ siControl (1.25 µL/well of 20 µM) (Smartpool, Dharmacon, Horizon Discovery Limited). The mixture was shaken and centrifuged. To this, 2 µL/well of jetPRIME reagent was added, then vortexed, centrifuged and incubated for 15 minutes at room temperature. This is the treatment solution. The treatment solution (100 µL) was added dropwise per well containing 900µL medium and the plate was placed back in incubator at 37°C. The medium was changed 24 hours after treatment. The cells for RNA isolation were lysed after 48 hours of treatment. Protein isolation and Western blot analysis Once the seeded hPAECs on the plates reached confluency, they were washed twice with Dulbecco’s phosphate buffered saline (DPBS) to remove any residual media or non-adherent cells. Subsequently, 200 µL of RIPA with protease and phosphatase inhibitors was added to each well to lyse the cells and extract proteins. The cell lysates were collected and centrifuged at 10,000 g for 15 minutes at 4°C to separate the supernatant containing the soluble proteins. The supernatant was transferred to fresh tubes for further analysis. The total protein concentration of each sample was determined using the bicinchoninic acid (BCA) assay. The protein samples were prepared by mixing with 4X loading dye containing betamercaptoethanol in a 1:4 ratio and heating at 95°C for 5 minutes to denature the proteins. The proteins (20 µg per sample) were loaded onto a 10% agarose gel and electrophoresed with Tris-glycine running buffer to separate the proteins by molecular weight. After gel electrophoresis, the proteins were transferred to a nitrocellulose membrane using 1X transfer buffer with 10% methanol to ensure efficient transfer of proteins from the gel to the membrane. An alternative procedure included the use of 1% sodium dodecyl sulphate (SDS) in Tris-HCl buffer instead of RIPA, TCEP instead of betamercaptoethanol, a pre-made 4–6% Bis-Tris gel (Thermofisher Scientific, USA) instead of a 10% agarose gel, MOPS running buffer (Thermofisher Scientific, USA), a polyvinylidene difluoride (PVDF) membrane, Immobilon-E (Merck, Germany) instead of a nitrocellulose membrane and Nupage transfer buffer (Thermofisher Scientific, USA). After transfer, the membranes were blocked with 5% bovine serum albumin (BSA) to prevent non-specific antibody binding. The membranes were then incubated overnight with the primary antibodies specific for the proteins of interest (anti-BK: APC-021, Alomone, Isreal, anti- GAPDH: ab9485, Abcam, Cambridge, UK, anti-B-Actin: sc4778, Santa Cruz, TX, USA). After overnight incubation with the primary antibodies, the membranes were washed three times with TBST (Tris-buffered saline with 0.1% Tween 20) for 5 minutes each time to remove unbound antibodies. The membranes were then incubated with the corresponding secondary antibodies for 1 hour at room temperature. After washing, the membranes were developed with enhanced chemiluminescence (ECL) or ECL Femto Substrate (Bio-Rad, USA) to visualise the protein bands. The densitometries were calculated using Image lab software (Bio-Rad, USA). Signal density was normalised to either B-actin or GAPDH, which served as housekeeping genes. Proximity ligation assay hPAECs were plated on chamber slides and left overnight. The next day, the wells were washed with DPBS and fixed with 4% paraformaldehyde (PFA) for 15 minutes. The PFA was removed and the wells were washed three times with DPBS and stored at 4°C until staining. DPBS was removed and 5% donkey serum without Triton was used as blocking buffer. The slide was incubated for 1 hour at room temperature. Primary antibodies against BKCa (L6/60, NeuroMab UC Davis, CA, USA) mouse antibody and Piezo-1 (15939, Proteintech, CA, USA) rabbit antibody were added at a dilution of 1:200 and incubated overnight at 4°C. The primary antibodies were removed and the wells were then washed with TBST. For the further steps, the Duolink PLA kit (Merck, Germany) was used according to the manufacturer’s protocol. When the two target proteins are in close proximity, a long single-stranded DNA product with fluorescence is formed, which was then detected with a fluorescence microscope. Immunofluorescence staining hPAECs were plated on chamber slides and incubated at 37°C for 24 hours. Cells were then quickly washed with 1X PBS and fixed with 4% formalin for 20 minutes at room temperature. Formalin was removed and slides were washed three times with 1X PBS and stored in PBS at 4°C until use. Blocking buffer, 3% BSA with 0.1% Triton X-100 was added on the slides and stored at room temperature for 1 hour. Human lung sections containing PAs which were paraffin embedded were deparaffinised, rehydrated and treated with heat induced antigen retrieval in pH 6 buffer. Blocking buffer with 10% BSA was added on the tissue slide and incubated at room temperature for 1 hour. Subsequent staining steps for both cells and tissue slides remained the same after this. 200 µl/well of the primary antibody (anti-BK: APC-021, Alomone, Isreal, anti- vWf: A0082, Dako, Glosturp, Denmark) diluted in blocking buffer was added and incubated overnight at 4°C. The slides were then washed three times with PBS and a fluorophore-conjugated secondary antibody diluted in blocking buffer was added and incubated for one hour at room temperature. The secondary antibody solution was removed and the slides were washed three times with PBS. 10uL of Vectashield mounting medium with DAPI (Vector Laboratories, Peterborough, UK) was added per well, the coverslip was placed on the slide and stored in the dark at 4°C until imaging. Images were taken with the Nikon A1 + confocal microscope or Zeiss LMS 510 META. Images of chambers with duplicates without primary antibodies were used as negative controls. Nitric oxide assay hPAECs were plated in gelatin-coated black 96-well plates and starved in Ringer’s solution for 1 hour. Cells were then loaded with 10 µM 4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate (DAF-FM, Thermo Fisher Scientific, MA. USA ) for 30 minutes at 37°C. After loading, the cells were washed twice with Ringer’s solution and treated with drugs dissolved in Ringer’s solution, followed by incubation at 37°C for 10 min. Cells were then stimulated with 5 µM acetylcholine (Ach) and fluorescence was immediately measured using a CLARIOstar Plus plate reader (BMG Labtech, Ortenberg, Germany) with excitation/emission wavelengths set to 495/515 nm. Assessment of ion channel activity Whole-cell patch-clamp experiments were performed as previously described (Lengyel et al., 2019) using human Lonza PAECs. The bath solution contained (in mM): KCl 4, NaCl 140, CaCl 2 2, MgCl 2 1, HEPES 10 (pH 7.4, adjusted by NaOH). The pipette solution contained (in mM): KCl 135, NaCl 10, EGTA 1, CaCl 2 0.379, HEPES 10 (pH 7.2, adjusted by NaOH), with free calcium concentration set to 100 nM. Whole-cell currents were recorded in voltage-clamp mode, with a holding potential of -60 mV. BK current was evoked by applying 200-ms voltage steps ranging from − 60 mV to + 100 mV in 20 mV increments, currents were measured at the end of each voltage step. After measuring the control current traces, paxilline (2 µM) or iberiotoxin (100 nM) were applied by direct perfusion for 2–3 minutes, before measuring the inhibited current. The effect of the drugs was tested on a separate set of cells. Capacitive transients and series resistance were carefully compensated to ensure accurate current measurements and minimize artifacts. Data were analyzed using pCLAMP 10.7 software (Molecular Devices, Sunnyvale, CA, USA), and all currents were leak-subtracted Angiogenesis assay A Matrigel tube formation test kit (Merck Millipore, Burlington, MA, USA) was used. ECMatrix was diluted on ice according to the manufacturer’s instructions and 50 µl was applied to a 96-well tissue culture plate. The ECMatrix was then incubated at 37 0°C to polymerise and solidify. This provides the surface for the formation of tubes by the cells. 50 x 10^3 hPAECs were then seeded on the surface of the gel and returned to the incubator. The media contained paxilline and iberiotoxin as treatment, while the control wells were left untreated. The wells in which the cells grew on the ECM matrix and formed tubes were imaged every hour for 6 hours using an Olympus CKX41 light microscope. The images were then analysed with the macro angiogenesis analyzer of the ImageJ software to calculate the values of the network parameters. Animal studies All experimental procedures were performed after the permission of the local authorities in accordance with national animal testing regulations (Austrian Ministry of Education, Science and Culture, 2022 − 0.619.415). The animals were kept under standard conditions, with a 12-hour light/dark cycle, room temperature and unrestricted access to food and water. For the chronic hypoxia-induced PH model, 12- to 16 -week-old male C57BL/6J mice were obtained from Charles River Laboratories and randomly assigned to one of two groups. The control mice were housed under normobaric, normoxic conditions (21% O₂), while the hypoxic mice were housed in normobaric, hypoxic chambers (10% O₂) for 7 days or 28 days. Oxygen concentration was continuously monitored and regulated by an automated OxyCycler system (BioSpherix, Lacona, NY) with constant nitrogen gas buffering. The chambers were briefly opened twice a week to change feed and bedding. The animals were sacrificed after 7days or 28 days, the lungs were removed and the PAs were isolated and used for wire myography. Haemodynamic measurements were performed using the closed chest technique through a small incision in the submandibular region. Throughout the procedure, the animals inhaled 2% isoflurane oxygen to maintain anaesthesia. Body temperature was monitored and maintained at 38 ± 1°C, while ECG recordings ensured a stable heart rate during the experiment. Right ventricular pressure was measured using a 1.4-Fr Millar catheter (SPR-671; Millar, Houston, TX) inserted via the right jugular vein. In addition, systemic blood pressure was measured by inserting a 1.4 Fr Millar catheter into the left carotid artery. Assessment of cytosolic Ca 2+ Cells were incubated with 2 µM Fura-2-acetoxymethyl ester (Fura-2AM) at 37°C for 45 minutes. A single glass coverslip was placed on the stage of a Zeiss 200 M inverted epifluorescence microscope with a PolyChrome V monochromator light source (Till Photonics, Kaufbeuren, Germany) in a sealed, temperature-controlled RC-21B imaging chamber (Warner Instruments, Hamden, CT, USA). Fluorescence images were acquired every 3 seconds with alternating excitation wavelengths of 340 nm and 380 nm, with emission at 510 nm recorded via an air-cooled Andor Ixon camera (Andor Technology, Belfast, Ireland). The background fluorescence of each coverslip was measured and subtracted before performing the calculations. Images were stored and analysed offline using TillVision software (Till Photonics, Germany). At 75 images when the baseline was stable, cells were treated with Yoda1. At the end of each experiment, the maximum and minimum ratio values were determined by treating the cells with 5 µM ionomycin to determine the maximum ratio, followed by chelation of total free Ca²⁺ with 20 mM EGTA to determine the minimum ratio. Cells that did not respond to ionomycin were excluded from the analysis.. Ultrastructure analysis Mouse PAs were fixed for 3 hours in 2.5% (w/v) glutaraldehyde and 2% paraformaldehyde (w/v) in 0.1 M cacodylate buffer, pH 7.4, and then post-fixed for 2 hours at room temperature (RT) in 2% (w/v) osmium tetroxide. After dehydration (in graded ethanol series), tissues were infiltrated overnight in propylene oxide (Sigma Aldrich, USA) and TAAB embedding resin, then transferred to embedding moulds in pure TAAB embedding resin (3 h) (TAAB Laboratories Equipment Ltd., UK)] and polymerised (48 h, 60°C). Ultrathin sections (70 nm) were cut with a UC 7 ultramicrotome (Leica Microsystems, Austria) and stained with platinum blue (EMS, USA) for 15 min and lead citrate (Leica Ultrostain 2) for 5 min. Electron micrographs were taken using a Tecnai G2 transmission electron microscope (Thermo Fisher Scientific, Netherlands) with a Gatan Ultrascan 1000 Charge Coupled Device (CCD) camera (-20°C, Digital Micrograph acquisition software, Ametek Gatan, Germany and Serial EM) at an acceleration voltage of 120 kV. Assessment of mitochondrial respiration Mitochondrial function and glycolysis of BK-WT and BK-KO lung endothelial cells were assessed using the Seahorse XF Pro instrument (Agilent, Santa Clara, CA, USA) by measuring oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) respectively. Sensor cartridges were hydrated overnight with Seahorse XF calibrant at 37 0 C. 20,000 mL ECs were seeded per well on 96 well seahorse plate (XFe96/XF Pro, 103794-100) one day prior and incubated at 37 ° C. Cells were serum starved for 6 hours before cell medium was replaced with seahorse assay media and incubated for 45 minutes in a non-CO 2 incubator at 37 0 C prior to measurement. Seahorse Assay media for glycolysis stress test was supplemented with 2mM L-glutamine (Gibco, NY, USA) and assay media for cell mitochondrial stress was supplemented with 2mM L-glutamine, 1mM sodium pyruvate (Gibco, NY, USA) and 10mM D-glucose (Sigma Aldrich, MO, USA). Glycolysis stress test and cell mitochondrial stress test protocols were carried out according to manufacturer instructions using the following compounds: glycolysis stress test: 10mM D-glucose, 1µM oligomycin, 50mM 2-deoxy glucose; Cell mito stress: 1.5 µM oligomycin, 0.5µM FCCP and 0.5µM antimycin. Glucose, oligomycin, carbonyl cyanide-p-(trifluoromethoxy)phenylhydrazone (FCCP) and antimycinA were purchased from Sigma Aldrich, MO, USA and 2 Diacylglycerol from Thermofisher, MA, USA. OCR and ECAR values are normalized to protein content using BCA assay (Merck, Rahway, NJ, USA) and presented as pmolO 2 /min/µg protein and mpH/min/µg protein. Statistics Data are presented as individual data points alongside the mean. Results are expressed as mean ± standard error of the mean (S.E.M.), with sample sizes (n) detailed in the respective figure legends. Statistical analyses were conducted using GraphPad Prism (version 10.2.3; GraphPad Software, La Jolla, CA). Appropriate statistical tests (Mann whitney U- test, two- way ANOVA with Bonferroni post-hoc test, Unpaired and paired t-tests, Spearman correlation) were selected based on the dataset, as noted in the figure legends. Assumptions for all tests were met, and group variances were comparable. Statistical significance was defined as p < 0.05, with p-values indicated as follows: *p ≤ 0.05, **p ≤ 0.01, and ***p ≤ 0.001. Results Mice were exposed to chronic hypoxia for 7 and 28 days (Figs. 1a and 2a). As expected, at both time points, hypoxic mice exhibited a significant increase in right ventricular systolic pressure (RVSP) compared to normoxic controls, which was associated with increased pulmonary arterial pressure (Figs. 1b and 2b). The Fulton index, a measure of right ventricular hypertrophy, was elevated, confirming early structural changes in the right ventricle indicative of the development of PH (Figs. 1c and 2c). Impairment of endothelial BK function and concomitant endothelial dysfunction under hypoxia The functional status of pulmonary endothelium was assessed by evaluating endothelium-dependent vasodilation of 1 µM phenylephrine pre-constricted PAs. Mice exposed to hypoxia showed significantly impaired vasodilation as early as day 7 in response to increasing doses of Ach, compared to normoxic controls (Fig. 1d). This endothelial dysfunction persisted until day 28 (Fig. 2d), suggesting that the impairment of endothelial function in chronic hypoxia occurs early and persists with prolonged exposure. Since large-conductance calcium-activated potassium (BK) channels are known to decrease vascular tone, we administered NS1619, a BK channel activator. NS1619 induced dose-dependent vasodilation in U46619 preconstricted PAs. This vasodilator response was significantly reduced in hypoxic mice as early as day 7 and persisted until day 28 (Figs. 1e and 2e). A positive correlation between Ach -induced vasodilation and NS1619-induced vasodilation was observed at both time points (Figs. 1f and 2f). This suggests an interplay between BK channel activation and overall endothelial function. Despite the impairment of BK channel-mediated vasodilation, sodium nitroprusside (SNP)-induced vasodilation, which directly measures nitric oxide (NO)-mediated smooth muscle relaxation, remained comparable in chronic hypoxic and normoxic mice at both time points (Supplementary Figure S1a and S1b). This suggests that smooth muscle responsiveness to NO is preserved under hypoxic conditions, whereas endothelial function is impaired at least from day 7 of hypoxia. BK channel is present in human pulmonary arterial endothelial cells (hPAECs) Next, we investigated the presence of BK channels in non-excitable hPAECs. Gene expression analysis by qPCR demonstrated that the BK channel gene KCNMA1 is expressed in hPAECs at levels comparable to those in human pulmonary artery smooth muscle cells (hPASMCs) and lung homogenate (Fig. 3a). Protein expression was confirmed by Western blot analysis (Fig. 3b) and immunofluorescence staining of hPAECs (Fig. 3c). Electrophysiological recordings from hPAECs revealed a dominant outward current that appeared at positive membrane potentials (with 100 nM [Ca 2+ ] i ) with no significant contribution from other ion conductances at negative membrane potentials. Application of the known BK inhibitors paxilline (PAX, 2 µM) or iberiotoxin (ITX, 100 nM), significantly reduced the total current by 77.83 ± 10% and 54.38 ± 11% at + 100 mV, respectively, indicating that BK channels were responsible for the majority of the current (Figs. 3d and 3f). The current-voltage (I-V) relationships further highlighted the PAX and ITX-sensitive currents (Figs. 3e and 3g). This suggests that the detected BK channels in hPAECs are functional. Reduced expression of BK channels in hPAECs of IPAH patients Immunofluorescence stainings were performed on paraffin embedded donor and IPAH lung sections containing PAs. BK channel was found to be expressed in PA endothelium of both donor and IPAH lungs (Fig. 4a) (negative control is shown in Supplementary Figure S2). To investigate the possible role of BK channels in endothelial dysfunction, their expression was analysed in hPAECs derived from patients with IPAH. First, we detected reduced mRNA expression of KCNMA1 in hPAECs from IPAH patients of the Graz cohort, compared to controls (Fig. 4b). Next, we performed protein detection on independent samples obtained from the Pulmonary Hypertension Breakthrough Initiative at Stanford (Fig. 4c). Our finding suggests that BK channels are downregulated in hPAECs from IPAH patients, possibly contributing to endothelial dysfunction. Unfortunately, the availability of these cells was severely limited. To overcome this limitation and further investigate the role of BK channels in lung endothelium, we have used pharmacological agents and genetically modified animal models. Mice lacking BK channels develop pulmonary endothelial dysfunction To investigate whether the absence of BK channels directly causes endothelial dysfunction, BK knockout (BK KO) mice were investigated. The genetically modified model was generated as previously described [19], and the PAs of these mice were analysed for structural and functional indicators of endothelial dysfunction (Fig. 5a). Functional assessment of PAs using isometric tension measurements showed that Ach-induced vasodilation was significantly impaired in phenylephrine-preconstricted PAs with intact endothelium from BK KO mice, compared to WT mice (Fig. 5b). PA rings from BK WT and BK KO mice whose endothelium was denuded, were used as experimental controls. Vasodilation in response to sodium nitroprusside (SNP) remained unchanged among the four groups after the arteries were washed and pre-constricted with 1 µM phenylephrine (Supplementary Figure S3). Ultrastructural analysis using electron microscopy revealed a significant reduction in endothelial surface caveolae - membrane invaginations critical for the housing of proteins such as endothelial nitric oxide synthase (eNOS) and various ion channels — in the PAs of BK KO mice compared to wild-type mice (Fig. 5c and d). This suggests that BK is essential for caveolae formation and the associated eNOS activity. Impaired bioenergetics in lung endothelial cells of mice lacking BK channels To assess the metabolic function, two key parameters of cellular metabolism were analysed in endothelial cells of BK WT and BK KO mice: the oxygen consumption rate (OCR), reflecting mitochondrial respiration, and the extracellular acidification rate (ECAR), indicative of glycolytic activity. Under mitochondrial stress conditions (Fig. 6a), both groups showed a similar reduction in OCR after treatment with oligomycin, indicating comparable inhibition of ATP synthase. Baseline OCR values did not differ significantly between groups (Fig. 6c); however, BK KO endothelial cells showed significantly higher maximal respiration after FCCP injection (Fig. 6d). As a result, total respiratory capacity, measured as area under the OCR curve (AUC), was significantly increased in BK KO cells (Fig. 6e). To complement these observations, ECAR profiles were analysed under both mitochondrial (Supplementary Figure S4a) and glycolytic (Fig. 6f) stress. ECAR responses were broadly similar between BK WT and BK KO cells, although BK KO cells showed a subtle trend towards increased glycolytic activity. The OCR measurements under glycolytic stress are shown in Supplementary Figure S4b. Integrated analysis of ECAR and OCR under both conditions (Figs. 6b and 6g) revealed distinct bioenergetic profiles: While BK WT endothelial cells showed a predominantly quiescent metabolic phenotype, BK KO cells developed at least a tendency towards increased oxygen consumption (Fig. 6b) and glycolytic activity (Fig. 6g). BK channels influence angiogenesis and NO production in endothelial cells In angiogenesis assays, the inhibition of BK channels in donor hPAECs using PAX or ITX resulted in higher mesh area, fewer isolated segments and shorter isolated branches (Figs. 7a–d). This suggest that there is no greater angiogenic potential of hPAEC under inhibition of BK channels, but a less orderly tube formation, compared with control hPAEC. Silencing BK channel expression (Supplementary Figure S5) significantly reduced NO production in response to Ach (Fig. 7e), suggesting that BK channels are essential for the Ach-induced NO production in endothelial cells. In summary, these findings underscore the important role of BK channels in maintaining endothelial function, particularly through their effects on angiogenesis and NO production. Lack of BK channels disrupts Piezo-1-induced [Ca 2+ ] i increase in ECs Using the proximity ligation assay (PLA), we confirmed the co-localisation of BK and Piezo-1 channels in hPAECs, as evidenced by a strong fluorescent proximity ligation signal (Fig. 8a). Therefore, we hypothesised that the two channels might be functionally linked and performed live cell calcium imaging on ECs from BK wild-type (WT) and BK knockout (KO) mice (Fig. 8b). Lung ECs from BK KO mice had higher basal calcium levels compared to those from BK WT mice (Fig. 8c). No differences in mRNA expression of calcium influx channels such as Piezo-1, Piezo-2, STIM1 or ORAI1 were observed in the lungs of BK KO vs. BK WT mice (Supplementary Fig. S6). After treatment with the piezo-1 activator Yoda 1 (10 µM), an increase in [Ca2+]i was observed in ECs from BK WT animals compared to BK KO mice (Fig. 8d). This suggests a functional role of BK channels for the Piezo-1 function in endothelial calcium signalling. Indeed, loss of BK channels disrupts Piezo-1-mediated calcium influx, highlighting their role in endothelial function and dysfunction. Discussion This study provides comprehensive evidence for the crucial role of large-conductance calcium-activated potassium (BK) channels in lung endothelial cell function and their importance in the pathophysiology of pulmonary hypertension (PH). The main findings are the following: 1) Functional BK channels are expressed in human pulmonary artery endothelial cells (hPAECs) and are downregulated in hPAECs from patients with idiopathic pulmonary arterial hypertension (IPAH). 2) Endothelial dysfunction and impaired BK activation are observed in PAs from mice exposed to hypoxia for 7 and 28 days. 3) Pharmacological inhibition or siRNA-mediated silencing of BK channels in hPAECs disrupts acetylcholine-induced nitric oxide (NO) production and leads to impaired angiogenesis. 4) BK KO mice show impaired endothelium-dependent vasodilation, decreased endothelial caveolae and increased basal intracellular calcium [Ca2+]i. 5) ECs from BK KO mice show a bioenergetic shift towards increased mitochondrial respiration and glycolytic activity. 6) Finally, BK channels are co-localised with Piezo-1 channels in endothelial cells, and their absence blunts the Piezo-1-mediated increase in [Ca2+]i. We observed significant endothelial dysfunction in the PAs of mice under hypoxia, as early as 7 days, as evidenced by an attenuated Ach response and an intact response to SNP. Importantly, vasodilation induced by the BK channel activator NS1619 was significantly reduced under hypoxia. These changes may strongly contribute to the progressive vascular remodelling and sustained PH during prolonged hypoxia exposure and in IPAH. A previous study reported that overexpression of miR-29b, a microRNA that is elevated in IPAH-PASMCs, decreased BK current and downregulated the BK channel β1 subunit in donor PAMSCs [ 20 ]. In contrast, a transcriptomic study showed increased mRNA expression of the BK channel in PAH lungs [ 21 ]. However, this finding was not cell type specific and could be due to alterations in other structural or in immune cells. Our results agree to three studies, showing that targeted activation of BK channels attenuated the development of PH in the MCT-PH rat model [ 22 – 24 ]. However, our finding that the attenuated vasodilation in response to Ach was due to a reduced BK channel function in PA endothelial cells, suggests that these beneficial effects in the MCT rat model are mediated by endothelial rather than smooth muscular mechanisms. Our study provides compelling evidence for the expression of BK channels in hPAECs, resolving a long-standing debate in the literature [ 25 – 28 ]. We demonstrate their expression at both the gene and protein level in hPAECs. Patch-clamp recordings confirm the functional activity of these channels, as evidenced by a significant reduction in currents upon treatment with BK channel inhibitors. Our results indicate downregulation of BK channel at both gene and protein levels in hPAECs from IPAH patients compared to healthy controls. Such downregulation may strongly contribute to their endothelial dysfunction. We observed that ECs from BK KO mice exhibit a higher rate of FCCP-induced oxygen consumption compared to BK WT cells. This metabolic shift suggests that BK channel deficiency disturbs the tightly regulated bioenergetic balance in lung endothelial cells, potentially increasing energy expenditure. Such disruption of homeostatic metabolism may contribute to impaired endothelial function as observed in previous studies using PH models [ 29 , 30 ]. Our study also demonstrates that the absence of BK channels disrupts pulmonary endothelial function, as evidenced by reduced Ach -induced vasorelaxation in PA rings from BK KO mice compared to that of BK WT mice. We showed for the first time that this may be due to a significant reduction of endothelial caveolae. This provides new insights into the mechanistic links between BK channel activity and endothelial structural integrity. Pulmonary hypertension is strongly associated with endothelial dysfunction [ 9 – 13 , 31 , 32 ]. Our data show that silencing BK in hPAECs, significantly impairs Ach -induced NO production mimicking the decreased NO production by IPAH PAECs [ 33 – 35 ]. Pharmacological inhibition of BK channels in hPAECs causes disordered angiogenesis, that might underly some features of the pulmonary vascular lesions in IPAH [ 36 , 37 ]. Piezo-1 channels in ECs are activated by mechanical stimuli such as shear stress and stretch. Once activated, these channels facilitate Ca 2+ influx. This increase in [Ca 2+ ] i is crucial for shear-induced endothelial responses, including nitric oxide (NO) production and regulation of transcription factors that respond to flow. Ca 2+ -activated K + channels are often co-expressed with Piezo-1 channels in other cell types [ 38 – 40 ]. Our study demonstrates that BK channels are essential for Piezo-1 channel function in the pulmonary endothelium. Disruption of this interaction in BK KO cells virtually blunts Piezo-1 function. This may be even more important as Piezo-1 channels are upregulated in IPAH [ 41 ]. Our study has a few limitations. Since the PAECs were obtained from end-stage IPAH patients, our findings may not be relevant for the early disease. However, our hypoxia experiments showed that BK dysfunction starts already at day 7, which is considered an early phase of hypoxic PA remodeling. We used primary cultured endothelial cells for our study, but they were directly derived from IPAH patients undergoing lung transplantation. Conclusion Our findings demonstrate that BK channels are critical regulators of pulmonary endothelial function and that their impairment causes important pathological features of PH, including reduced nitric oxide secretion, dysfunctional angiogenesis, and metabolic changes (Fig. 9). The downregulation of BK channels in IPAH suggests that BK channels may represent an important therapeutic target. Mechanistically, BK channels are co-localised with Piezo-1 channels and are critical for the Piezo-1-mediated calcium increase. Restoring the loss of BK channels, or their function might represent the right pathway to maintain vascular integrity and prevent the progression of PH. Abbreviations Ach, acetylcholine ANOVA, analysis of variance AUC, area under curve BCA, biscinchoninic acid BK, large conducatance calcium-actiavted potassium channel Ca2+, calcium ion [Ca2+]i, intracellular free calcium ion concentration CaCl2, calcium chloride cDNA, complementary deoxyribo nucleic acid COPD, chronic obstructive pulmonary disease DAPI, 4',6-diamidino-2-phenylindole DMSO, dimethyl sulphoxide ECAR, extracellular acidification rate ECL, enhanced chemiluminescence EDTA, ethylenediaminetetraacetic acid eNOS, endothelial nitric oxide synthase FCCP, Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone FCS, fetal calf serum GAPDH, glyceraldehyde-3-phosphate dehydrogenase HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HOX, hypoxia hPAEC, human pulmonary arterial endothelial cell IPAH, idiopathic pulmonary arterial hypertension ITX, iberiotoxin KC a -Calcium activated potassium channel KCl, potassium chloride KCNK3, potassium two pore domain channel subfamily member 3 KO, knock out MgCl2, magnesium chloride MOPS, 3-(N-morpholino)propanesulfonic acid, 4-Morpholino Propanesulfonic Acid mPAP, mean pulmonary arterial pressure NaCl, sodium chloride NaOH, sodium hydroxide NOX, normoxia OCR, oxygen consumption rate PA, pulmonary artery PAEC, pulmonary arterial endothelial cell PAH, pulmonary arterial hypertension PASMC, pulmonary arterial smooth muscle cell PAX, paxilline PBS, phosphate buffer saline PH, pulmonary hypertension PLA, proximity ligation assay PVDF, polyvinylidene difluoride PVR, pulmonary vascular resistance qRT-PCR, quantitative real time polymerase chain reaction RIPA, radioimmunoprecipitation assay RNA, ribo nucleic acid RVSP, right ventricular systolic pressure SDS, sodium dodecyl sulphate SEM, standard error of mean SNP, sodium nitroprusside TCEP, tris(2-carboxyethyl)phosphine WT, wild type WU, wood units 2-DG, 2-deoxy-D-glucose Declarations Acknowledgements We are very grateful for the excellent technical assistance from Elisabeth Hebenstreit, Sabine Halsegger, Martina Huber and Thomas Fuchs. We express our heartfelt gratitude to Prof. Marlene Rabinovitch and Dr. Mauro Lago Docampo for their valuable discussions and helpful scientific advices. We are very thankful for the technical and scientific support from Dr. Aqin Cao and Dr. Chongyang Zhang. Declaration of interests HO reports grants from Bayer, and Boehringer Ingelheim. HO reports personal fees and non-financial support from Medupdate and Mondial, Aerovate, Astra Zeneca, Bayer, Ferrer, Menarini, MSD, Iqvia, Janssen, and Liquidia outside the submitted work. AO received honoraria for presentations and support for attending meetings, and/or travel from MSD outside the submitted work. Funding Declaration DG was supported Medical University of Graz, Graz, Austria through the PhD Program Molecular Medicine (MOLMED), the OEAD Marietta Blau fellowship and Austrian Marshall Plan scholarship. This research was funded in part by the Austrian Science Fund (FWF), Grant-DOI 10.55776/I6299 to AO and by the grants of the Hungarian National Research, Development and Innovation Office (NKFIH) ANN142950 and TKP2021-EGA-24 to PE. CN was supported by an ERS Long Term Fellowship. WMK is supported by the Deutsche Forschungsgemeinschaft (German Research Foundation) project ID 431232613 SFB-1449 subproject B01; project ID 437531118 SFB-1470 subproject A04; operational grants 1218/11-1, 1218/12-1, 1218/14-1; Bundesministerium für Bildung und Forschung in the framework of e:Med SYMPATH (01ZX1906A); and the German Center for Cardiovascular Research (DZHK) partner site Berlin. All the other authors have no fundings to declare pertaining to the submitted work. References Guignabert, C., et al., Pathology and pathobiology of pulmonary hypertension: current insights and future directions. Eur Respir J, 2024. 64 (4). Kovacs, G., et al., Definition, classification and diagnosis of pulmonary hypertension. Eur Respir J, 2024. 64 (4). Ford, H.J., et al., Exploring the patient perspective in pulmonary hypertension. Eur Respir J, 2024. 64 (4). Maron, B.A., et al., Pulmonary hypertension associated with left heart disease. Eur Respir J, 2024. 64 (4). Shlobin, O.A., et al., Pulmonary hypertension associated with lung diseases. Eur Respir J, 2024. 64 (4). Hoeper, M.M., et al., A global view of pulmonary hypertension. Lancet Respir Med, 2016. 4 (4): p. 306-22. Dardi, F., et al., Risk stratification and treatment goals in pulmonary arterial hypertension. Eur Respir J, 2024. 64 (4). Chin, K.M., et al., Treatment algorithm for pulmonary arterial hypertension. Eur Respir J, 2024. 64 (4). Jonigk, D., et al., Plexiform lesions in pulmonary arterial hypertension composition, architecture, and microenvironment. Am J Pathol, 2011. 179 (1): p. 167-79. Voelkel, N.F., et al., Vascular endothelial growth factor in pulmonary hypertension. Ann N Y Acad Sci, 1996. 796 : p. 186-93. Tuder, R.M., B.E. Flook, and N.F. Voelkel, Increased gene expression for VEGF and the VEGF receptors KDR/Flk and Flt in lungs exposed to acute or to chronic hypoxia. Modulation of gene expression by nitric oxide. J Clin Invest, 1995. 95 (4): p. 1798-807. Christou, H., et al., Increased vascular endothelial growth factor production in the lungs of rats with hypoxia-induced pulmonary hypertension. Am J Respir Cell Mol Biol, 1998. 18 (6): p. 768-76. Klinger, J.R., S.H. Abman, and M.T. Gladwin, Nitric oxide deficiency and endothelial dysfunction in pulmonary arterial hypertension. Am J Respir Crit Care Med, 2013. 188 (6): p. 639-46. Guntur, D., et al., Revisiting the Large-Conductance Calcium-Activated Potassium (BKCa) Channels in the Pulmonary Circulation. Biomolecules, 2021. 11 (11). Schubert, R. and M.T. Nelson, Protein kinases: tuners of the BKCa channel in smooth muscle. Trends Pharmacol Sci, 2001. 22 (10): p. 505-12. Li, Y., et al., Peroxisome proliferator-activated receptor-beta/delta, the acute signaling factor in prostacyclin-induced pulmonary vasodilation. Am J Respir Cell Mol Biol, 2012. 46 (3): p. 372-9. Skofic Maurer, D., et al., Endothelial Dysfunction Following Enhanced TMEM16A Activity in Human Pulmonary Arteries. Cells, 2020. 9 (9). Nagy, B.M., et al., Importance of kynurenine in pulmonary hypertension. Am J Physiol Lung Cell Mol Physiol, 2017. 313 (5): p. L741-L751. Meredith, A.L., et al., Overactive bladder and incontinence in the absence of the BK large conductance Ca2+-activated K+ channel. J Biol Chem, 2004. 279 (35): p. 36746-52. Babicheva, A., et al., MicroRNA-mediated downregulation of K(+) channels in pulmonary arterial hypertension. Am J Physiol Lung Cell Mol Physiol, 2020. 318 (1): p. L10-L26. Perez-Vizcaino, F., A. Cogolludo, and G. Mondejar-Parreno, Transcriptomic profile of cationic channels in human pulmonary arterial hypertension. Sci Rep, 2021. 11 (1): p. 15829. Ferraz, A.P., et al., BKCa Channel Activation Attenuates the Pathophysiological Progression of Monocrotaline-Induced Pulmonary Arterial Hypertension in Wistar Rats. Cardiovasc Drugs Ther, 2021. 35 (4): p. 719-732. Revermann, M., et al., Inhalation of the BK(Ca)-opener NS1619 attenuates right ventricular pressure and improves oxygenation in the rat monocrotaline model of pulmonary hypertension. PLoS One, 2014. 9 (1): p. e86636. Bonnet, S., et al., Dehydroepiandrosterone (DHEA) prevents and reverses chronic hypoxic pulmonary hypertension. Proc Natl Acad Sci U S A, 2003. 100 (16): p. 9488-93. Gauthier, K.M., et al., Freshly isolated bovine coronary endothelial cells do not express the BK Ca channel gene. J Physiol, 2002. 545 (3): p. 829-36. Vang, A., et al., Activation of endothelial BKCa channels causes pulmonary vasodilation. Vascul Pharmacol, 2010. 53 (3-4): p. 122-9. Sandow, S.L. and T.H. Grayson, Limits of isolation and culture: intact vascular endothelium and BKCa. Am J Physiol Heart Circ Physiol, 2009. 297 (1): p. H1-7. Naik, J.S. and B.R. Walker, Endothelial-dependent dilation following chronic hypoxia involves TRPV4-mediated activation of endothelial BK channels. Pflugers Arch, 2018. 470 (4): p. 633-648. Rafikov, R., et al., Complex I dysfunction underlies the glycolytic switch in pulmonary hypertensive smooth muscle cells. Redox Biol, 2015. 6 : p. 278-286. Akagi, S., et al., Evidence for Hypoxia-Induced Shift in ATP Production from Glycolysis to Mitochondrial Respiration in Pulmonary Artery Smooth Muscle Cells in Pulmonary Arterial Hypertension. J Clin Med, 2023. 12 (15). Tuder, R.M. and N.F. Voelkel, Angiogenesis and pulmonary hypertension: a unique process in a unique disease. Antioxid Redox Signal, 2002. 4 (5): p. 833-43. Voelkel, N.F. and J. Gomez-Arroyo, The role of vascular endothelial growth factor in pulmonary arterial hypertension. The angiogenesis paradox. Am J Respir Cell Mol Biol, 2014. 51 (4): p. 474-84. Xu, W., et al., Increased arginase II and decreased NO synthesis in endothelial cells of patients with pulmonary arterial hypertension. FASEB J, 2004. 18 (14): p. 1746-8. Ghosh, S., et al., Phosphorylation inactivation of endothelial nitric oxide synthesis in pulmonary arterial hypertension. Am J Physiol Lung Cell Mol Physiol, 2016. 310 (11): p. L1199-205. Basehore, S.E. and A.M. Clyne, Human Pulmonary Artery Endothelial Cells Increased Glycolysis and Decreased Nitric Oxide Synthase O-GlcNAcylation in Pulmonary Arterial Hypertension. International Journal of Translational Medicine, 2024. 4 (1): p. 140-151. Masri, F.A., et al., Hyperproliferative apoptosis-resistant endothelial cells in idiopathic pulmonary arterial hypertension. Am J Physiol Lung Cell Mol Physiol, 2007. 293 (3): p. L548-54. Tuder, R.M., et al., Expression of angiogenesis-related molecules in plexiform lesions in severe pulmonary hypertension: evidence for a process of disordered angiogenesis. J Pathol, 2001. 195 (3): p. 367-74. Michelucci, A. and L. Catacuzzeno, Piezo1, the new actor in cell volume regulation. Pflugers Arch, 2024. 476 (7): p. 1023-1039. Haam, C.E., et al., Alteration of Piezo1 signaling in type 2 diabetic mice: focus on endothelium and BK(Ca) channel. Pflugers Arch, 2024. 476 (10): p. 1479-1492. Jakob, D., et al., Piezo1 and BK(Ca) channels in human atrial fibroblasts: Interplay and remodelling in atrial fibrillation. J Mol Cell Cardiol, 2021. 158 : p. 49-62. Wang, Z., et al., Endothelial upregulation of mechanosensitive channel Piezo1 in pulmonary hypertension. Am J Physiol Cell Physiol, 2021. 321 (6): p. C1010-C1027. Additional Declarations No competing interests reported. Supplementary Files Supplementarydata.docx SupplementaryUncroppedblots.docx floatimage1.png Graphical Abstract Cite Share Download PDF Status: Published Journal Publication published 21 Oct, 2025 Read the published version in Cell Communication and Signaling → Version 1 posted Editorial decision: Revision requested 10 Jun, 2025 Reviews received at journal 10 Jun, 2025 Reviewers agreed at journal 26 May, 2025 Reviews received at journal 06 May, 2025 Reviewers agreed at journal 28 Apr, 2025 Reviewers invited by journal 28 Apr, 2025 Editor assigned by journal 24 Apr, 2025 Submission checks completed at journal 24 Apr, 2025 First submitted to journal 22 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6506992\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":448868540,\"identity\":\"38dc5d7b-0443-4906-8b6d-d60e7f654dd8\",\"order_by\":0,\"name\":\"Divya Guntur\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Experimental Anaesthesiology, Department of Anaesthesiology and Intensive Care Medicine, Medical University of Graz, Graz\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Divya\",\"middleName\":\"\",\"lastName\":\"Guntur\",\"suffix\":\"\"},{\"id\":448868541,\"identity\":\"f4436be2-511a-4d95-9215-c40586834d90\",\"order_by\":1,\"name\":\"Dusan Jeremic\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Experimental Anaesthesiology, Department of Anaesthesiology and Intensive Care Medicine, Medical University of Graz, Graz\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dusan\",\"middleName\":\"\",\"lastName\":\"Jeremic\",\"suffix\":\"\"},{\"id\":448868542,\"identity\":\"eca229b8-eb7a-4b52-be70-f29a1732a27e\",\"order_by\":2,\"name\":\"Reka Csaki\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Physiology, Faculty of Medicine, Semmelweis University, Budapest\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Reka\",\"middleName\":\"\",\"lastName\":\"Csaki\",\"suffix\":\"\"},{\"id\":448868543,\"identity\":\"c05829c7-f6e6-4574-a704-1ad87665738e\",\"order_by\":3,\"name\":\"Oleh Myronenko\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Division of Pulmonology, Department of Internal Medicine, Medical University of Graz, Graz\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Oleh\",\"middleName\":\"\",\"lastName\":\"Myronenko\",\"suffix\":\"\"},{\"id\":448868544,\"identity\":\"232fb767-a032-4292-9c4a-d50c6c72b71c\",\"order_by\":4,\"name\":\"Valentina Biasin\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Division of Physiology and Pathophysiology, Otto Loewi Research Center, Medical University of Graz, Graz\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Valentina\",\"middleName\":\"\",\"lastName\":\"Biasin\",\"suffix\":\"\"},{\"id\":448868545,\"identity\":\"d0fc366f-f66b-4c26-b1d9-aff44f13b868\",\"order_by\":5,\"name\":\"Dagmar Kolb\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Core Facility Ultrastructure Analysis, Medical University of Graz, Graz\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dagmar\",\"middleName\":\"\",\"lastName\":\"Kolb\",\"suffix\":\"\"},{\"id\":448868546,\"identity\":\"03768aeb-86d4-4385-9686-d9beb629429e\",\"order_by\":6,\"name\":\"Laura Michalick\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute for Physiology, Charité - Universitätsmedizin Berlin\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Laura\",\"middleName\":\"\",\"lastName\":\"Michalick\",\"suffix\":\"\"},{\"id\":448868547,\"identity\":\"f90e2e46-58ac-4d9c-90e0-0f8ee8ecee34\",\"order_by\":7,\"name\":\"Wolfgang Kuebler\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute for Physiology, Charité - Universitätsmedizin Berlin\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Wolfgang\",\"middleName\":\"\",\"lastName\":\"Kuebler\",\"suffix\":\"\"},{\"id\":448868548,\"identity\":\"01680862-2f7d-4c37-b50b-2bdbd75b8445\",\"order_by\":8,\"name\":\"Peter Enyedi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Physiology, Faculty of Medicine, Semmelweis University, Budapest\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Peter\",\"middleName\":\"\",\"lastName\":\"Enyedi\",\"suffix\":\"\"},{\"id\":448868549,\"identity\":\"381f49bf-a4c0-44c7-a12e-59bd13b3ba4b\",\"order_by\":9,\"name\":\"Horst Olschewski\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Faculty of Medicine, Sigmund Freud University, Vienna\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Horst\",\"middleName\":\"\",\"lastName\":\"Olschewski\",\"suffix\":\"\"},{\"id\":448868550,\"identity\":\"39693ee1-6ca7-4d26-acbd-7e91c70c7b22\",\"order_by\":10,\"name\":\"Andrea Olschewski\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABP0lEQVRIie3QMWvCQBTA8ReE53Ka9UJK8hXuCNhF6AfpohScdAp0khAoXBd1rrSln6EE0jVw4KTOGRyEgktbuC4i1EqTtBQ0FulWSv6Eg4T8uHsHUFT0N2PZWgXA7A3LPgDJngMEvwmJtgg7TIA2trbIEf36IlSqCxbqcjF/FZ5TNZ6a8xcxO7JP5aOC7nqX0NnIHV6NwEHaOuZDIWtodgJ+KxaET1uMwSh/sLjtlAhCU1CCZiWM6gkJzYqQhPeANQBzxE7JepMQfYzme+jV0Zg8vH2SsopgkyMsJZpICLTR1MJSDWklLKXEJoT7msgRHrdcrT+g6Sw1o7+RDpJOYNxMJWGEuNAcOLvEis8CWC3rlp7cGF2NPX53OblXz+fyxO6VA6WWVm78r4vb841FydL4AezP9n/1e1FRUdH/7QOSr2V8gYA2HAAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"Experimental Anaesthesiology, Department of Anaesthesiology and Intensive Care Medicine, Medical University of Graz, Graz\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Andrea\",\"middleName\":\"\",\"lastName\":\"Olschewski\",\"suffix\":\"\"},{\"id\":448868551,\"identity\":\"aea5bc89-3f56-4f03-908f-889584f64b6d\",\"order_by\":11,\"name\":\"Chandran Nagaraj\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Division of Pulmonology, Department of Internal Medicine, Medical University of Graz, Graz\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Chandran\",\"middleName\":\"\",\"lastName\":\"Nagaraj\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-04-22 19:38:12\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6506992/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6506992/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1186/s12964-025-02436-0\",\"type\":\"published\",\"date\":\"2025-10-21T16:17:18+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":82138177,\"identity\":\"27f86472-f473-4317-98c0-62e60c375511\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 06:22:39\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":123679,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eImpairment of endothelial BK function in pulmonary arteries of mice exposed to hypoxia on day 7\\u003c/strong\\u003e. \\u003cstrong\\u003ea)\\u003c/strong\\u003e Schematic representation of the experimental protocol. The mice were randomised into two groups. The mice in the experimental group were exposed to hypoxia for 7 days, while the mice in the control group were kept under normoxic conditions (n=5 in each group). On day 8, haemodynamic analyses, pulmonary artery dissection and organ harvesting were performed in all mice as indicated. \\u003cstrong\\u003eb)\\u003c/strong\\u003e Assessment of right ventricular systolic pressure (RVSP) with in vivo haemodynamic analysis and \\u003cstrong\\u003ec)\\u003c/strong\\u003eEstimation of right ventricular hypertrophy (Fulton index; the weight ratio of the right ventricle (RV) to the left ventricle (LV) plus septum (S)). Blue are the results from mice kept under hypoxia and grey are the results from mice kept under normoxic conditions. \\u003cstrong\\u003ed)\\u003c/strong\\u003e Effect of acetylcholine (Ach) at cumulative doses on Phenylephrine (PE) (1µM) preconstricted mouse pulmonary artery rings (n=19 rings in NOX and n=18 rings in HOX) and \\u003cstrong\\u003ee)\\u003c/strong\\u003e NS1619 at cumulative doses on U-46619 (30 nM) preconstricted mouse pulmonary artery rings (n=12 rings in each group) ex vivo. \\u003cstrong\\u003ef)\\u003c/strong\\u003e Plot of Ach-induced (10 µM) and NS1619-induced (30µM) dilatation in isolated pulmonary arteries. The black solid line shows correlation between the two in pulmonary arteries obtained from mice kept in normoxia (grey) and in hypoxia (blue) for 7 days with r=0.63, p=0.001. Spearman’s correlation coefficient, *p \\u0026lt; 0.05 ** p \\u0026lt; 0.01, *** p \\u0026lt; 0.001, ANOVA with Bonferroni post-hoc test, Mann- Whitney test, data are presented as mean ± SEM\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6506992/v1/546c52091d270f04764e7c60.png\"},{\"id\":82138179,\"identity\":\"4b04f148-9881-41fd-8cdc-d1b6fcd0097e\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 06:22:39\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":126943,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eImpairment of endothelial BK function in hypoxic mouse model for pulmonary hypertension on day 28.\\u003c/strong\\u003e \\u003cstrong\\u003ea)\\u003c/strong\\u003e Schematic representation of the experimental protocol. The mice were randomised into two groups. The mice in the experimental group were exposed to hypoxia for 4 weeks, while the mice in the control group were kept under normoxic conditions (n=5 in each group). At week 4, haemodynamic analyses, pulmonary artery dissection and organ harvesting were performed in all mice as indicated. \\u003cstrong\\u003eb)\\u003c/strong\\u003e Assessment of right ventricular systolic pressure (RVSP) with in vivo haemodynamic analysis and \\u003cstrong\\u003ec)\\u003c/strong\\u003eestimation of right ventricular hypertrophy (Fulton index; the weight ratio of the right ventricle (RV) to the left ventricle (LV) plus septum (S)). Blue are the results from mice kept under hypoxia and grey are the results from mice kept under normoxic conditions. \\u003cstrong\\u003ed)\\u003c/strong\\u003e Effect of acetylcholine (Ach) at cumulative doses on Phenylephrine (PE) (1µM) preconstricted mouse pulmonary artery rings (n=17 rings in each group) and \\u003cstrong\\u003ee)\\u003c/strong\\u003e NS1619 at cumulative doses on U-46619 (30 nM) preconstricted mouse pulmonary artery rings (n=17 rings in each group) ex vivo. \\u003cstrong\\u003ef)\\u003c/strong\\u003e Plot of Ach-induced (10 µM) and NS1619-induced (30 µM) dilatation in isolated pulmonary arteries. The black solid line shows correlation between the two in pulmonary arteries obtained from mice kept in normoxia (grey) and in hypoxia (blue) for 28 days with r=0.75, p=0.0001. Spearman’s correlation coefficient, *p \\u0026lt; 0.05, ** p \\u0026lt; 0.01, *** p \\u0026lt; 0.001, ANOVA with Bonferroni post-hoc test, Mann- Whitney test, data are presented as mean ± SEM\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6506992/v1/45b276822f1bd04085805858.png\"},{\"id\":82138180,\"identity\":\"75ef46d7-1854-48a8-b539-caff6bcb92c4\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 06:22:39\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":228714,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eFunctional BK channels in human pulmonary arterial ECs (hPAECs). a)\\u003c/strong\\u003e qPCR analysis of expression levels of \\u003cem\\u003eKCNMA1\\u003c/em\\u003e gene that encodes BK channel in whole human lung homogenate, hPASMCs and in hPAECs (n=5). \\u003cstrong\\u003eb) \\u003c/strong\\u003eWestern blot analysis of expression of BK channel protein in donor hPAECs (n=3). \\u003cstrong\\u003ec) \\u003c/strong\\u003eImmunofluorescence staining of fixed hPAECs with anti-BK antibody and DAPI. Scale bar: 50µm. \\u003cstrong\\u003ed \\u003c/strong\\u003e- \\u003cstrong\\u003eg)\\u003c/strong\\u003e Representative whole-cell current traces from hPAECs in the absence (control) or presence of \\u003cstrong\\u003ed)\\u003c/strong\\u003e paxilline (2 µM ) or \\u003cstrong\\u003ef)\\u003c/strong\\u003e iberiotoxin (100 nM, lower traces). The corresponding current-voltage (I-V) curves are shown (\\u003cstrong\\u003ee, g\\u003c/strong\\u003e) as mean +/- standard error of the mean (SEM) (n=5-6 per group). Currents values were normalized to the maximal current observed in the control group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6506992/v1/cafb63a922a6b0160e2290a5.png\"},{\"id\":82144567,\"identity\":\"2bce713b-266e-47a7-a43d-baecc8e8ac9d\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 06:46:39\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":255987,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eBK channel expression in IPAH hPAECs. a)\\u003c/strong\\u003e Immunofluorescence staining of donor and IPAH lung sections. Scale bar: 50µm. \\u003cstrong\\u003eb) \\u003c/strong\\u003eqPCR analysis of expression levels of \\u003cem\\u003eKCNMA1\\u003c/em\\u003e gene that encodes BK channel in donor and IPAH hPAECs (n=3). \\u003cstrong\\u003ec) \\u003c/strong\\u003eWestern blot analysis of expression of BK channel protein in donor and IPAH hPAECs (n=4).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6506992/v1/f04bc3017daebc3bd632e807.png\"},{\"id\":82138195,\"identity\":\"c836e134-66e0-4cca-928b-dc278ebded13\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 06:22:39\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":269528,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eLack of BK channel leads to attenuated vasodilation of mice pulmonary arteries. a)\\u003c/strong\\u003e Effect of acetylcholine (Ach) in cumulative doses on phenylephrine (1 µM) pre-constricted mouse pulmonary artery rings with intact endothelium (n=8 for WT and n=7 for KO) and with denuded endothelium (n=11 for WT and n=15 for KO) \\u003cstrong\\u003eb)\\u003c/strong\\u003e The bar graph shows the difference of Ach induced vasodilation between BK WT and BK KO PA rings with intact endothelium at increasing concentrations. \\u003cstrong\\u003ec)\\u003c/strong\\u003e Ultrastructural analysis of BK wild-type (WT) and BK-KO PAs by electron microscopy. Scale bar: 500nm. \\u003cstrong\\u003ed)\\u003c/strong\\u003eEndothelial surface caveolae (black arrows) were counted as omega-shaped membrane invaginations open at the lumen surface and normalised per micrometre (n=24 WT PAECs and n=36 KO PAECs). Mann-Whitney t-test. * p \\u0026lt; 0.05, ** p \\u0026lt; 0.01, ANOVA with Bonferroni post-hoc test, data are presented as mean ± SEM\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6506992/v1/ce1ad5d2c422d1b69787b201.png\"},{\"id\":82138187,\"identity\":\"79fb5890-3da6-4360-8ffc-d0da3b86e29b\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 06:22:39\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":230101,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe absence of BK channel changes the metabolic function of \\u0026nbsp;lung endothelial cells in mice.\\u003c/strong\\u003e \\u003cstrong\\u003ea)\\u003c/strong\\u003eMitochondrial respiration of BK WT and BK KO ECs, represented by OCR curve. (n=6). \\u003cstrong\\u003eb) \\u003c/strong\\u003eEnergy map (ECAR/ OCAR plot) under basal mitochondrial stress conditions (in the presence of glucose, pyruvate and glutamine in seahorse medium). \\u003cstrong\\u003ec)- e) \\u003c/strong\\u003eBar graphs of bioenergetics parameters calculated from OCR curve between BK WT and BK KO ECs such as \\u003cstrong\\u003ec)\\u003c/strong\\u003e Basal respiration \\u003cstrong\\u003ed) \\u003c/strong\\u003eMaximal respiration and\\u003cstrong\\u003e e) \\u003c/strong\\u003eArea under the curve\\u003cstrong\\u003e. f) \\u003c/strong\\u003eGlycolytic ability of BK WT and BK KO ECs represented by the ECAR curve. (n=6). \\u003cstrong\\u003eg) \\u003c/strong\\u003eEnergy map (ECAR/ OCAR diagram) under basal glycolytic stress conditions (in the presence of glutamine but in the absence of glucose and pyruvate in seahorse medium). * p \\u0026lt; 0.05, Unpaired t- test, paired t-test, data are presented as mean ± SEM.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6506992/v1/515ac20be948306c8707200c.png\"},{\"id\":82138193,\"identity\":\"db38da8a-7d44-4279-94a0-cf796aa06ed9\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 06:22:39\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":204279,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eEffects of BK inhibition on hPAECs function. a)\\u003c/strong\\u003e Representative images of in vitro tubulogenesis. Row 1- light micrographs, row 2- analysed light micrographs row 3- skeleton of analysis and row 4- meshes indicating closed tubes. \\u003cstrong\\u003eb-d)\\u003c/strong\\u003e Analysis of the corresponding network parameters \\u003cstrong\\u003eb)\\u003c/strong\\u003e total mesh area divided by the number of meshes, \\u003cstrong\\u003ec)\\u003c/strong\\u003e number of isolated segments and \\u003cstrong\\u003ed)\\u003c/strong\\u003e total isolated branch length in control and after treatment with paxilline (100 nM) or ITX (100 nM). \\u003cstrong\\u003ee)\\u003c/strong\\u003e Quantitative analysis of acetylcholine (Ach)-induced NO secretion in response to BK channel silencing on Ach-induced NO production. * p \\u0026lt; 0.05, ** p \\u0026lt; 0.01, Mann whitney test, Paired ratio t-test, data are presented as mean ± SEM.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6506992/v1/09dbc6b87f338686b057de8f.png\"},{\"id\":82144568,\"identity\":\"232a17ad-afdd-45cc-9f02-8f5f5485b0a0\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 06:46:39\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":372155,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eFunctional link between BK and Piezo-1 channels in PA endothelium. a) \\u003c/strong\\u003eFluorescence image of positive proximity ligation assay (PLA) signal for BK and Piezo-1 channels. Scale bar: 200µm. \\u003cstrong\\u003eb)\\u003c/strong\\u003e Live cell calcium imaging curve of BK WT and BK KO lung endothelial cells (n=47 BK WT and n= 22 BK KO). \\u003cstrong\\u003ec)\\u003c/strong\\u003eCalcium signal at baseline. \\u003cstrong\\u003ed)\\u003c/strong\\u003e Calcium signal upon treatment with 10µM Yoda1 (Piezo-1 activator). * p \\u0026lt; 0.05, ** p \\u0026lt; 0.01, unpaired Student t-test, data are presented as means ± SEM.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage9.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6506992/v1/f2bfa9945aca5ef2a5ae5f18.png\"},{\"id\":82142837,\"identity\":\"ef70993c-5899-408d-ac44-7ce3d7e6642f\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 06:38:39\",\"extension\":\"png\",\"order_by\":9,\"title\":\"Figure 9\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":98347,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eLegend not included with this version\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage10.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6506992/v1/94b917a63cef6f182e5dd559.png\"},{\"id\":94490451,\"identity\":\"c9e85aad-6207-48ec-8cbf-d5df26e199a5\",\"added_by\":\"auto\",\"created_at\":\"2025-10-27 17:10:13\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":3361818,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6506992/v1/fcdfa302-e9e0-4130-8405-69a0dd1c186a.pdf\"},{\"id\":82140529,\"identity\":\"8a19dcd6-ccb3-463a-be16-8355660520fe\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 06:30:39\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":453274,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supplementarydata.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6506992/v1/a0bbb2dfcb0078210fbb9d55.docx\"},{\"id\":82140559,\"identity\":\"a76023b2-81ba-41d3-a2a1-ff731a17dd53\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 06:30:39\",\"extension\":\"docx\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":6926926,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryUncroppedblots.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6506992/v1/bfbeccb41188ad66b44c0016.docx\"},{\"id\":82140525,\"identity\":\"084f0755-686e-464a-b42f-add22fd7086c\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 06:30:39\",\"extension\":\"png\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":712382,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eGraphical Abstract\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6506992/v1/c52e386d8cb421b2090b3665.png\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"BK Channels Are Indispensable for Endothelial Function in Small Pulmonary Arteries\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003ePulmonary hypertension (PH) is a chronic, progressive clinical condition that limits patients' quality of life and drastically reduces their life expectancy [\\u003cspan additionalcitationids=\\\"CR2\\\" citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. Left-sided heart disease and chronic obstructive pulmonary disease (COPD) represent a significant lifetime risk for PH and drive the overall number of PH patients [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. This explains why the global prevalence of PH is around 1% of the worldwide population [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e] and the steadily increasing prevalence of heart failure and COPD also suggests increasing numbers of PH. Treatment options are only available for a small subset of PH patients with pulmonary arterial hypertension (PAH and chronic thromboembolic pulmonary hypertension (CTEPH)) [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. The pathogenesis of the disease is multifactorial but pulmonary vascular remodelling is the hallmark of the disease and endothelial dysfunction appears to play a major role [\\u003cspan additionalcitationids=\\\"CR10 CR11 CR12\\\" citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. However, little is known about the role of ion channels in endothelial dysfunction.\\u003c/p\\u003e \\u003cp\\u003eThe large conductance calcium-activated potassium channels (BK) and its subunits play an important role in the lung vasculature [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. BK are activated by changes in both voltage and intracellular calcium concentration ([Ca\\u003csup\\u003e2+\\u003c/sup\\u003e]\\u003csub\\u003ei\\u003c/sub\\u003e). As a result of BK activity, the cells tend to repolarise / hyperpolarise. The apparent Ca\\u003csup\\u003e2+\\u003c/sup\\u003e- and/or voltage-sensitivity is directly regulated via various kinases including cAMP-dependent protein kinase (PKA), cGMP-dependent (PKG). BK channels mediate the effects of prostacyclin receptor agonists and NO in the arterial smooth muscle cells [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. This, along with KCNK3/TASK-1 channel [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e] represents the most important mechanism of prostacyclin-induced vasodilatation.\\u003c/p\\u003e \\u003cp\\u003eNearly all mechanistic investigations on BK channels were performed in smooth muscle cells and not in PA endothelial cells (PAEC). It has even been assumed that BK channels are not present in endothelial cells. However, Piezo-1 channels play an important role in endothelial cells. Previous studies indicate a functional interaction between Piezo-1 and Ca2+-activated K\\u0026thinsp;+\\u0026thinsp;channels. For example, shear stress-induced activation of Piezo-1 channel triggers Ca2\\u0026thinsp;+\\u0026thinsp;entry, which activates medium conductance Ca2+-activated K\\u0026thinsp;+\\u0026thinsp;channels and low conductance Ca2+-activated K\\u0026thinsp;+\\u0026thinsp;channels in other cell types. In this study, we show BK expression and function in human and mouse PA endothelium and a critical role of BK for piezo-1 function, suggesting that endothelial BK loss or dysfunction is highly relevant for endothelial dysfunction.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eHuman lung samples\\u003c/h2\\u003e \\u003cp\\u003eHuman lung tissue samples were obtained from patients with idiopathic pulmonary arterial hypertension (IPAH) who underwent lung transplantation at the Medical University of Vienna, Department of Thoracic Surgery. The study protocol for obtaining the human tissue at the Medical University of Vienna was approved by the Institutional Review Board (approval number 976/2010) and written informed consent was obtained from each participant prior to transplantation. The human cells and tissues used at Stanford were obtained through the Pulmonary Hypertension Breakthrough Initiative (PHBI), funded by the NIH (R24 HL123767) and the Cardiovascular Medical Research and Education Fund (CMREF; UL 1RR024986. The demographics of these samples have been previously described [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. The diagnosis was confirmed by experienced pathologists and pulmonologists who reviewed chest CT scans and right heart catheterisation results. Lung tissue from healthy donors who also came from the same institution was included as controls.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eCell culture and handling\\u003c/h3\\u003e\\n\\u003cp\\u003e \\u003cstrong\\u003eHuman pulmonary artery endothelial cells (PAECs)\\u003c/strong\\u003e \\u003cp\\u003ePAECs from donors and IPAH samples were isolated and harvested from PAs less than 2 mm in diameter. The endothelial layer was treated with a mixture of collagenase, DNase and dispase in Hank's Balanced Salt Solution (HBSS) at room temperature. After enzymatic digestion, the cell suspension was collected, resuspended in complete endothelial medium (Lonza, Basel, Switzerland and ScienCell, CA, USA) and cultured in gelatin-coated T25 flasks at 37\\u0026deg;C and 5% CO₂. Once the cells reached 70\\u0026ndash;80% confluence, they were trypsinised and subjected to three rounds of CD31-selective magnetically activated cell sorting to enrich the endothelial cell population. Cell identity was verified by morphology and marker analysis (smooth muscle actin, fibronectin, vimentin, von Willebrand factor, smooth muscle myosin heavy chain and CD31). Extra PAECs were cryopreserved in endothelial cell complete medium with 10% foetal calf serum (FCS) and 10% dimethyl sulphoxide (DMSO) and stored in liquid nitrogen for later use. The experiments were performed with cells from passages 3 to 9. Human PAECs (hPAECs), whether purchased (Lonza, Basel, Switzerland or PromoCell, MO, USA) or isolated as described, were cultured in gelatin-coated flasks (0.1% gelatin solution in PBS) with endothelial cell complete medium containing antibiotics (penicillin and streptomycin).\\u003c/p\\u003e \\u003c/p\\u003e\\n\\u003ch3\\u003eIsolation of mouse lung endothelial cells:\\u003c/h3\\u003e\\n\\u003cp\\u003eMice lungs were placed on a perti dish and minced with scalpel to as small pieces as possible. The tissue was then added into a 50 mL centrifuge tube containing 4 mL digestion solution: 3 mg/ml collagenase I (Gibco, Carlsbad, CA, USA) and 0.1 mg/ml DNase (Serva electrophoresis, Heidelberg, Germany) in DMEM F12 basal medium. The falcon was then placed on a shaker at 37\\u0026deg;C for 45 minutes for tissue digestion. The digested tissue suspension was then filtered through a 100 \\u0026micro;m cell sieve. To stop digestion, an equal volume of DMEM F12 complete medium with fetal calf serum (FCS) was added. The suspension was centrifuged at 1200 rpm and 4\\u0026deg;C for 8 minutes. The supernatant was discarded and the pellet was resuspended in CD31 coated dynabeads (For a pair of mouse lungs, 15\\u0026micro;L dynabeads (Invitrogen, Waltham, MA, USA) were coated with 1.5\\u0026micro;L CD31 antibody (BD Pharmigen, NJ, USA) overnight on a shaker at 4\\u0026deg;C and washed the following day with sterile PBS to remove any unbound antibody and resuspended in 100\\u0026micro;L PBS) in a microcentrifuge tube. This tube was placed on a shaker for 15 minutes at room temperature. The tube containing the beads was then placed on a magnetic stand and the supernatant was discarded. The tube was removed from the magnetic stand, the beads were re-suspended in 1mL medium and the procedure was repeated approximately six times to remove all non-CD31-specific cells. After the last wash, the beads were resuspended in endothelial growth medium (Lonza EBM with microvascular endothelial growth supplements) and seeded on a gelatin-coated T25 cell culture flask. After 48 hours, the unattached cells were removed by washing once with PBS, and fresh medium was then added every day until the cells were confluent. For experiments, each sample represent the results obtained from isolation of ECs from 2\\u0026ndash;3 mice lungs pooled.\\u003c/p\\u003e\\n\\u003ch3\\u003eEvaluation of pulmonary arterial vasoreactivity\\u003c/h3\\u003e\\n\\u003cp\\u003eMice aged 12\\u0026ndash;16 weeks were euthanized by cervical dislocation and their lungs were harvested for isolation of PAs. For those experiments without endothelium, the cell layer was denuded mechanically by rubbing the lumen of the pulmonary artery with a strand of human hair. The denuded artery was checked for intact endothelium-dependent vasodilation as demonstrated by more than a 50% vasodilatory response with acetylcholine. The PAs were then mounted on a wire myograph (Danish Myo Technology 620M, Aarhus, Denmark) using tungsten wires for mouse PAs and pins for human PAs. The mounted vessels were equilibrated for 30 minutes in a physiological saline solution (PSS) at a pH of 7.4, under full oxygenation and at 37\\u0026deg;C. Baseline tension was gradually adjusted to 2 mN and stabilised for a further 30 minutes. As a quality control, vessel viability was assessed by three consecutive 15-minute depolarisations with high potassium PSS (KPSS; 120 mM KCl instead of NaCl to maintain isotonicity). Vessels with a mean KPSS response of less than 2 mN were excluded from further experiments. Isometric tension recordings were collected using force transducers connected to the myograph system (PowerLab, ADInstrument, Oxford, UK). Experimental protocols included initial exposure of vessels to a vasoconstrictor in the bath solution, followed by application of increasing concentrations of vasodilators. Vasorelaxation was expressed as a percentage of the maximal response to the vasoconstrictor.\\u003c/p\\u003e\\n\\u003ch3\\u003eDetection of mRNA expression levels\\u003c/h3\\u003e\\n\\u003cp\\u003ehPAECs were cultured until they reached confluence. RNA was isolated either by Trisol reagent or by an RNA isolation kit (Zymo research, CA, USA) according to the manufacturer\\u0026rsquo;s protocol. Complementary DNA (cDNA) synthesis was performed using a cDNA synthesis kit (iScript, Bio-Rad, Hercules CA, USA or Takara, Shiga, Japan) according to the manufacturer\\u0026rsquo;s instructions. The expression levels of the target genes were then analysed by quantitative real-time PCR (qRT-PCR). The qRT-PCR was performed using Applied Biosystems PowerTrack SYBR Green Master Mix (ThermoFisher Scientific, MA, USA) in a standard thermocycler. The SYBR Green dye intercalates with the double-stranded DNA during amplification, enabling quantification of gene expression based on fluorescence intensity.\\u003c/p\\u003e \\u003cp\\u003eThe used primer sequences are given below (5' to 3')\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Taba\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003ehuman KCNMA1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eFwd\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eATGGTGACTTTCTTCGGGGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRev\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTTCTGGGCCTCCTTCGTCT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003ehuman B2M\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eFwd\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCCTGGAGGCTATCCAGCGTACTCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRev\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTGTCGGATGGATGAAACCCAGACA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003emouse PIEZO1\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eFwd\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCCCTGTCCAACTGGATGTGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRev\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGGGCTGGGGGTATTTCTTCTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003emouse PIEZO2\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eFwd\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGCACTCTACCTCAGGAAGACTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRev\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCAAAGCTGTGCCACCAGGTTCT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003emouse ORAI1\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eFwd\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCCTGGCGCAAGCTCTACTTA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRev\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCATCGCTACCATGGCGAAGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003emouse STIM1\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eFwd\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eATTGTGTCGCCCTTGTCCAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRev\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGGGTCAAATCCCTCTGAGATCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003emouse B2M\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eFwd\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eATACGCCTGCAGAGTTAAGCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRev\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTCACATGTCTCGATCCCAGTAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003esiRNA silencing\\u003c/h2\\u003e \\u003cp\\u003ehPAECs were plated in 6-well plates. After 24 hours, the medium was removed and 900 \\u0026micro;l was added per well. The jetPRIME treatment solution was prepared by adding jetPRIME buffer (96.75 \\u0026micro;L/well) (Polyplus, NY, USA) and siRNA/ siControl (1.25 \\u0026micro;L/well of 20 \\u0026micro;M) (Smartpool, Dharmacon, Horizon Discovery Limited). The mixture was shaken and centrifuged. To this, 2 \\u0026micro;L/well of jetPRIME reagent was added, then vortexed, centrifuged and incubated for 15 minutes at room temperature. This is the treatment solution. The treatment solution (100 \\u0026micro;L) was added dropwise per well containing 900\\u0026micro;L medium and the plate was placed back in incubator at 37\\u0026deg;C. The medium was changed 24 hours after treatment. The cells for RNA isolation were lysed after 48 hours of treatment.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eProtein isolation and Western blot analysis\\u003c/h3\\u003e\\n\\u003cp\\u003eOnce the seeded hPAECs on the plates reached confluency, they were washed twice with Dulbecco\\u0026rsquo;s phosphate buffered saline (DPBS) to remove any residual media or non-adherent cells. Subsequently, 200 \\u0026micro;L of RIPA with protease and phosphatase inhibitors was added to each well to lyse the cells and extract proteins. The cell lysates were collected and centrifuged at 10,000 g for 15 minutes at 4\\u0026deg;C to separate the supernatant containing the soluble proteins. The supernatant was transferred to fresh tubes for further analysis. The total protein concentration of each sample was determined using the bicinchoninic acid (BCA) assay. The protein samples were prepared by mixing with 4X loading dye containing betamercaptoethanol in a 1:4 ratio and heating at 95\\u0026deg;C for 5 minutes to denature the proteins. The proteins (20 \\u0026micro;g per sample) were loaded onto a 10% agarose gel and electrophoresed with Tris-glycine running buffer to separate the proteins by molecular weight. After gel electrophoresis, the proteins were transferred to a nitrocellulose membrane using 1X transfer buffer with 10% methanol to ensure efficient transfer of proteins from the gel to the membrane. An alternative procedure included the use of 1% sodium dodecyl sulphate (SDS) in Tris-HCl buffer instead of RIPA, TCEP instead of betamercaptoethanol, a pre-made 4\\u0026ndash;6% Bis-Tris gel (Thermofisher Scientific, USA) instead of a 10% agarose gel, MOPS running buffer (Thermofisher Scientific, USA), a polyvinylidene difluoride (PVDF) membrane, Immobilon-E (Merck, Germany) instead of a nitrocellulose membrane and Nupage transfer buffer (Thermofisher Scientific, USA). After transfer, the membranes were blocked with 5% bovine serum albumin (BSA) to prevent non-specific antibody binding. The membranes were then incubated overnight with the primary antibodies specific for the proteins of interest (anti-BK: APC-021, Alomone, Isreal, anti- GAPDH: ab9485, Abcam, Cambridge, UK, anti-B-Actin: sc4778, Santa Cruz, TX, USA). After overnight incubation with the primary antibodies, the membranes were washed three times with TBST (Tris-buffered saline with 0.1% Tween 20) for 5 minutes each time to remove unbound antibodies. The membranes were then incubated with the corresponding secondary antibodies for 1 hour at room temperature. After washing, the membranes were developed with enhanced chemiluminescence (ECL) or ECL Femto Substrate (Bio-Rad, USA) to visualise the protein bands. The densitometries were calculated using Image lab software (Bio-Rad, USA). Signal density was normalised to either B-actin or GAPDH, which served as housekeeping genes.\\u003c/p\\u003e\\n\\u003ch3\\u003eProximity ligation assay\\u003c/h3\\u003e\\n\\u003cp\\u003ehPAECs were plated on chamber slides and left overnight. The next day, the wells were washed with DPBS and fixed with 4% paraformaldehyde (PFA) for 15 minutes. The PFA was removed and the wells were washed three times with DPBS and stored at 4\\u0026deg;C until staining. DPBS was removed and 5% donkey serum without Triton was used as blocking buffer. The slide was incubated for 1 hour at room temperature. Primary antibodies against BKCa (L6/60, NeuroMab UC Davis, CA, USA) mouse antibody and Piezo-1 (15939, Proteintech, CA, USA) rabbit antibody were added at a dilution of 1:200 and incubated overnight at 4\\u0026deg;C. The primary antibodies were removed and the wells were then washed with TBST. For the further steps, the Duolink PLA kit (Merck, Germany) was used according to the manufacturer\\u0026rsquo;s protocol. When the two target proteins are in close proximity, a long single-stranded DNA product with fluorescence is formed, which was then detected with a fluorescence microscope.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eImmunofluorescence staining\\u003c/h2\\u003e \\u003cp\\u003ehPAECs were plated on chamber slides and incubated at 37\\u0026deg;C for 24 hours. Cells were then quickly washed with 1X PBS and fixed with 4% formalin for 20 minutes at room temperature. Formalin was removed and slides were washed three times with 1X PBS and stored in PBS at 4\\u0026deg;C until use. Blocking buffer, 3% BSA with 0.1% Triton X-100 was added on the slides and stored at room temperature for 1 hour. Human lung sections containing PAs which were paraffin embedded were deparaffinised, rehydrated and treated with heat induced antigen retrieval in pH 6 buffer. Blocking buffer with 10% BSA was added on the tissue slide and incubated at room temperature for 1 hour. Subsequent staining steps for both cells and tissue slides remained the same after this. 200 \\u0026micro;l/well of the primary antibody (anti-BK: APC-021, Alomone, Isreal, anti- vWf: A0082, Dako, Glosturp, Denmark) diluted in blocking buffer was added and incubated overnight at 4\\u0026deg;C. The slides were then washed three times with PBS and a fluorophore-conjugated secondary antibody diluted in blocking buffer was added and incubated for one hour at room temperature. The secondary antibody solution was removed and the slides were washed three times with PBS. 10uL of Vectashield mounting medium with DAPI (Vector Laboratories, Peterborough, UK) was added per well, the coverslip was placed on the slide and stored in the dark at 4\\u0026deg;C until imaging. Images were taken with the Nikon A1\\u0026thinsp;+\\u0026thinsp;confocal microscope or Zeiss LMS 510 META. Images of chambers with duplicates without primary antibodies were used as negative controls.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eNitric oxide assay\\u003c/h2\\u003e \\u003cp\\u003ehPAECs were plated in gelatin-coated black 96-well plates and starved in Ringer\\u0026rsquo;s solution for 1 hour. Cells were then loaded with 10 \\u0026micro;M 4-amino-5-methylamino-2\\u0026prime;,7\\u0026prime;-difluorofluorescein diacetate (DAF-FM, Thermo Fisher Scientific, MA. USA ) for 30 minutes at 37\\u0026deg;C. After loading, the cells were washed twice with Ringer\\u0026rsquo;s solution and treated with drugs dissolved in Ringer\\u0026rsquo;s solution, followed by incubation at 37\\u0026deg;C for 10 min. Cells were then stimulated with 5 \\u0026micro;M acetylcholine (Ach) and fluorescence was immediately measured using a CLARIOstar Plus plate reader (BMG Labtech, Ortenberg, Germany) with excitation/emission wavelengths set to 495/515 nm.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAssessment of ion channel activity\\u003c/h2\\u003e \\u003cp\\u003eWhole-cell patch-clamp experiments were performed as previously described (Lengyel et al., 2019) using human Lonza PAECs. The bath solution contained (in mM): KCl 4, NaCl 140, CaCl\\u003csub\\u003e2\\u003c/sub\\u003e 2, MgCl\\u003csub\\u003e2\\u003c/sub\\u003e 1, HEPES 10 (pH 7.4, adjusted by NaOH). The pipette solution contained (in mM): KCl 135, NaCl 10, EGTA 1, CaCl\\u003csub\\u003e2\\u003c/sub\\u003e 0.379, HEPES 10 (pH 7.2, adjusted by NaOH), with free calcium concentration set to 100 nM. Whole-cell currents were recorded in voltage-clamp mode, with a holding potential of -60 mV. BK current was evoked by applying 200-ms voltage steps ranging from \\u0026minus;\\u0026thinsp;60 mV to +\\u0026thinsp;100 mV in 20 mV increments, currents were measured at the end of each voltage step. After measuring the control current traces, paxilline (2 \\u0026micro;M) or iberiotoxin (100 nM) were applied by direct perfusion for 2\\u0026ndash;3 minutes, before measuring the inhibited current. The effect of the drugs was tested on a separate set of cells. Capacitive transients and series resistance were carefully compensated to ensure accurate current measurements and minimize artifacts. Data were analyzed using pCLAMP 10.7 software (Molecular Devices, Sunnyvale, CA, USA), and all currents were leak-subtracted\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAngiogenesis assay\\u003c/h2\\u003e \\u003cp\\u003eA Matrigel tube formation test kit (Merck Millipore, Burlington, MA, USA) was used. ECMatrix was diluted on ice according to the manufacturer\\u0026rsquo;s instructions and 50 \\u0026micro;l was applied to a 96-well tissue culture plate. The ECMatrix was then incubated at 37 0\\u0026deg;C to polymerise and solidify. This provides the surface for the formation of tubes by the cells. 50 x 10^3 hPAECs were then seeded on the surface of the gel and returned to the incubator. The media contained paxilline and iberiotoxin as treatment, while the control wells were left untreated. The wells in which the cells grew on the ECM matrix and formed tubes were imaged every hour for 6 hours using an Olympus CKX41 light microscope. The images were then analysed with the macro angiogenesis analyzer of the ImageJ software to calculate the values of the network parameters.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAnimal studies\\u003c/h2\\u003e \\u003cp\\u003e All experimental procedures were performed after the permission of the local authorities in accordance with national animal testing regulations (Austrian Ministry of Education, Science and Culture, 2022\\u0026thinsp;\\u0026minus;\\u0026thinsp;0.619.415). The animals were kept under standard conditions, with a 12-hour light/dark cycle, room temperature and unrestricted access to food and water. For the chronic hypoxia-induced PH model, 12- to 16 -week-old male C57BL/6J mice were obtained from Charles River Laboratories and randomly assigned to one of two groups. The control mice were housed under normobaric, normoxic conditions (21% O₂), while the hypoxic mice were housed in normobaric, hypoxic chambers (10% O₂) for 7 days or 28 days. Oxygen concentration was continuously monitored and regulated by an automated OxyCycler system (BioSpherix, Lacona, NY) with constant nitrogen gas buffering. The chambers were briefly opened twice a week to change feed and bedding. The animals were sacrificed after 7days or 28 days, the lungs were removed and the PAs were isolated and used for wire myography.\\u003c/p\\u003e \\u003cp\\u003eHaemodynamic measurements were performed using the closed chest technique through a small incision in the submandibular region. Throughout the procedure, the animals inhaled 2% isoflurane oxygen to maintain anaesthesia. Body temperature was monitored and maintained at 38\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1\\u0026deg;C, while ECG recordings ensured a stable heart rate during the experiment. Right ventricular pressure was measured using a 1.4-Fr Millar catheter (SPR-671; Millar, Houston, TX) inserted via the right jugular vein. In addition, systemic blood pressure was measured by inserting a 1.4 Fr Millar catheter into the left carotid artery.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAssessment of cytosolic Ca\\u003csup\\u003e2+\\u003c/sup\\u003e\\u003c/h2\\u003e \\u003cp\\u003eCells were incubated with 2 \\u0026micro;M Fura-2-acetoxymethyl ester (Fura-2AM) at 37\\u0026deg;C for 45 minutes. A single glass coverslip was placed on the stage of a Zeiss 200 M inverted epifluorescence microscope with a PolyChrome V monochromator light source (Till Photonics, Kaufbeuren, Germany) in a sealed, temperature-controlled RC-21B imaging chamber (Warner Instruments, Hamden, CT, USA). Fluorescence images were acquired every 3 seconds with alternating excitation wavelengths of 340 nm and 380 nm, with emission at 510 nm recorded via an air-cooled Andor Ixon camera (Andor Technology, Belfast, Ireland). The background fluorescence of each coverslip was measured and subtracted before performing the calculations. Images were stored and analysed offline using TillVision software (Till Photonics, Germany).\\u003c/p\\u003e \\u003cp\\u003eAt 75 images when the baseline was stable, cells were treated with Yoda1. At the end of each experiment, the maximum and minimum ratio values were determined by treating the cells with 5 \\u0026micro;M ionomycin to determine the maximum ratio, followed by chelation of total free Ca\\u0026sup2;⁺ with 20 mM EGTA to determine the minimum ratio. Cells that did not respond to ionomycin were excluded from the analysis..\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eUltrastructure analysis\\u003c/h2\\u003e \\u003cp\\u003eMouse PAs were fixed for 3 hours in 2.5% (w/v) glutaraldehyde and 2% paraformaldehyde (w/v) in 0.1 M cacodylate buffer, pH 7.4, and then post-fixed for 2 hours at room temperature (RT) in 2% (w/v) osmium tetroxide. After dehydration (in graded ethanol series), tissues were infiltrated overnight in propylene oxide (Sigma Aldrich, USA) and TAAB embedding resin, then transferred to embedding moulds in pure TAAB embedding resin (3 h) (TAAB Laboratories Equipment Ltd., UK)] and polymerised (48 h, 60\\u0026deg;C). Ultrathin sections (70 nm) were cut with a UC 7 ultramicrotome (Leica Microsystems, Austria) and stained with platinum blue (EMS, USA) for 15 min and lead citrate (Leica Ultrostain 2) for 5 min. Electron micrographs were taken using a Tecnai G2 transmission electron microscope (Thermo Fisher Scientific, Netherlands) with a Gatan Ultrascan 1000 Charge Coupled Device (CCD) camera (-20\\u0026deg;C, Digital Micrograph acquisition software, Ametek Gatan, Germany and Serial EM) at an acceleration voltage of 120 kV.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAssessment of mitochondrial respiration\\u003c/h2\\u003e \\u003cp\\u003eMitochondrial function and glycolysis of BK-WT and BK-KO lung endothelial cells were assessed using the Seahorse XF Pro instrument (Agilent, Santa Clara, CA, USA) by measuring oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) respectively. Sensor cartridges were hydrated overnight with Seahorse XF calibrant at 37\\u003csup\\u003e0\\u003c/sup\\u003eC. 20,000 mL ECs were seeded per well on 96 well seahorse plate (XFe96/XF Pro, 103794-100) one day prior and incubated at 37\\u003csup\\u003e\\u0026deg;\\u003c/sup\\u003eC. Cells were serum starved for 6 hours before cell medium was replaced with seahorse assay media and incubated for 45 minutes in a non-CO\\u003csub\\u003e2\\u003c/sub\\u003e incubator at 37\\u003csup\\u003e0\\u003c/sup\\u003eC prior to measurement. Seahorse Assay media for glycolysis stress test was supplemented with 2mM L-glutamine (Gibco, NY, USA) and assay media for cell mitochondrial stress was supplemented with 2mM L-glutamine, 1mM sodium pyruvate (Gibco, NY, USA) and 10mM D-glucose (Sigma Aldrich, MO, USA). Glycolysis stress test and cell mitochondrial stress test protocols were carried out according to manufacturer instructions using the following compounds: glycolysis stress test: 10mM D-glucose, 1\\u0026micro;M oligomycin, 50mM 2-deoxy glucose; Cell mito stress: 1.5 \\u0026micro;M oligomycin, 0.5\\u0026micro;M FCCP and 0.5\\u0026micro;M antimycin. Glucose, oligomycin, carbonyl cyanide-p-(trifluoromethoxy)phenylhydrazone (FCCP) and antimycinA were purchased from Sigma Aldrich, MO, USA and 2 Diacylglycerol from Thermofisher, MA, USA. OCR and ECAR values are normalized to protein content using BCA assay (Merck, Rahway, NJ, USA) and presented as pmolO\\u003csub\\u003e2\\u003c/sub\\u003e/min/\\u0026micro;g protein and mpH/min/\\u0026micro;g protein.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistics\\u003c/h2\\u003e \\u003cp\\u003eData are presented as individual data points alongside the mean. Results are expressed as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard error of the mean (S.E.M.), with sample sizes (n) detailed in the respective figure legends. Statistical analyses were conducted using GraphPad Prism (version 10.2.3; GraphPad Software, La Jolla, CA). Appropriate statistical tests (Mann whitney U- test, two- way ANOVA with Bonferroni post-hoc test, Unpaired and paired t-tests, Spearman correlation) were selected based on the dataset, as noted in the figure legends. Assumptions for all tests were met, and group variances were comparable. Statistical significance was defined as p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, with p-values indicated as follows: *p\\u0026thinsp;\\u0026le;\\u0026thinsp;0.05, **p\\u0026thinsp;\\u0026le;\\u0026thinsp;0.01, and ***p\\u0026thinsp;\\u0026le;\\u0026thinsp;0.001.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003eMice were exposed to chronic hypoxia for 7 and 28 days (Figs. 1a and 2a). As expected, at both time points, hypoxic mice exhibited a significant increase in right ventricular systolic pressure (RVSP) compared to normoxic controls, which was associated with increased pulmonary arterial pressure (Figs. 1b and 2b). The Fulton index, a measure of right ventricular hypertrophy, was elevated, confirming early structural changes in the right ventricle indicative of the development of PH (Figs. 1c and 2c).\\u003c/p\\u003e\\n\\u003cdiv id=\\\"Sec21\\\"\\u003e\\n \\u003ch2\\u003eImpairment of endothelial BK function and concomitant endothelial dysfunction under hypoxia\\u003c/h2\\u003e\\n \\u003cp\\u003eThe functional status of pulmonary endothelium was assessed by evaluating endothelium-dependent vasodilation of 1 µM phenylephrine pre-constricted PAs. Mice exposed to hypoxia showed significantly impaired vasodilation as early as day 7 in response to increasing doses of Ach, compared to normoxic controls (Fig. 1d). This endothelial dysfunction persisted until day 28 (Fig. 2d), suggesting that the impairment of endothelial function in chronic hypoxia occurs early and persists with prolonged exposure. Since large-conductance calcium-activated potassium (BK) channels are known to decrease vascular tone, we administered NS1619, a BK channel activator. NS1619 induced dose-dependent vasodilation in U46619 preconstricted PAs. This vasodilator response was significantly reduced in hypoxic mice as early as day 7 and persisted until day 28 (Figs. 1e and 2e). A positive correlation between Ach -induced vasodilation and NS1619-induced vasodilation was observed at both time points (Figs. 1f and 2f). This suggests an interplay between BK channel activation and overall endothelial function. Despite the impairment of BK channel-mediated vasodilation, sodium nitroprusside (SNP)-induced vasodilation, which directly measures nitric oxide (NO)-mediated smooth muscle relaxation, remained comparable in chronic hypoxic and normoxic mice at both time points (Supplementary Figure S1a and S1b). This suggests that smooth muscle responsiveness to NO is preserved under hypoxic conditions, whereas endothelial function is impaired at least from day 7 of hypoxia.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec22\\\"\\u003e\\n \\u003ch2\\u003eBK channel is present in human pulmonary arterial endothelial cells (hPAECs)\\u003c/h2\\u003e\\n \\u003cp\\u003eNext, we investigated the presence of BK channels in non-excitable hPAECs. Gene expression analysis by qPCR demonstrated that the BK channel gene \\u003cem\\u003eKCNMA1\\u003c/em\\u003e is expressed in hPAECs at levels comparable to those in human pulmonary artery smooth muscle cells (hPASMCs) and lung homogenate (Fig. 3a). Protein expression was confirmed by Western blot analysis (Fig. 3b) and immunofluorescence staining of hPAECs (Fig. 3c). Electrophysiological recordings from hPAECs revealed a dominant outward current that appeared at positive membrane potentials (with 100 nM [Ca\\u003csup\\u003e2+\\u003c/sup\\u003e]\\u003csub\\u003ei\\u003c/sub\\u003e) with no significant contribution from other ion conductances at negative membrane potentials. Application of the known BK inhibitors paxilline (PAX, 2 µM) or iberiotoxin (ITX, 100 nM), significantly reduced the total current by 77.83 ± 10% and 54.38 ± 11% at + 100 mV, respectively, indicating that BK channels were responsible for the majority of the current (Figs. 3d and 3f). The current-voltage (I-V) relationships further highlighted the PAX and ITX-sensitive currents (Figs. 3e and 3g). This suggests that the detected BK channels in hPAECs are functional.\\u003c/p\\u003e\\n \\u003cdiv id=\\\"Sec23\\\"\\u003e\\n \\u003ch2\\u003eReduced expression of BK channels in hPAECs of IPAH patients\\u003c/h2\\u003e\\n \\u003cp\\u003eImmunofluorescence stainings were performed on paraffin embedded donor and IPAH lung sections containing PAs. BK channel was found to be expressed in PA endothelium of both donor and IPAH lungs (Fig. 4a) (negative control is shown in Supplementary Figure S2). To investigate the possible role of BK channels in endothelial dysfunction, their expression was analysed in hPAECs derived from patients with IPAH. First, we detected reduced mRNA expression of \\u003cem\\u003eKCNMA1\\u003c/em\\u003e in hPAECs from IPAH patients of the Graz cohort, compared to controls (Fig. 4b). Next, we performed protein detection on independent samples obtained from the Pulmonary Hypertension Breakthrough Initiative at Stanford (Fig. 4c). Our finding suggests that BK channels are downregulated in hPAECs from IPAH patients, possibly contributing to endothelial dysfunction. Unfortunately, the availability of these cells was severely limited. To overcome this limitation and further investigate the role of BK channels in lung endothelium, we have used pharmacological agents and genetically modified animal models.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec24\\\"\\u003e\\n \\u003ch2\\u003eMice lacking BK channels develop pulmonary endothelial dysfunction\\u003c/h2\\u003e\\n \\u003cp\\u003eTo investigate whether the absence of BK channels directly causes endothelial dysfunction, BK knockout (BK KO) mice were investigated. The genetically modified model was generated as previously described [19], and the PAs of these mice were analysed for structural and functional indicators of endothelial dysfunction (Fig. 5a). Functional assessment of PAs using isometric tension measurements showed that Ach-induced vasodilation was significantly impaired in phenylephrine-preconstricted PAs with intact endothelium from BK KO mice, compared to WT mice (Fig. 5b). PA rings from BK WT and BK KO mice whose endothelium was denuded, were used as experimental controls. Vasodilation in response to sodium nitroprusside (SNP) remained unchanged among the four groups after the arteries were washed and pre-constricted with 1 µM phenylephrine (Supplementary Figure S3). Ultrastructural analysis using electron microscopy revealed a significant reduction in endothelial surface caveolae - membrane invaginations critical for the housing of proteins such as endothelial nitric oxide synthase (eNOS) and various ion channels — in the PAs of BK KO mice compared to wild-type mice (Fig. 5c and d). This suggests that BK is essential for caveolae formation and the associated eNOS activity.\\u003c/p\\u003e\\n \\u003cdiv id=\\\"Sec25\\\"\\u003e\\n \\u003ch2\\u003eImpaired bioenergetics in lung endothelial cells of mice lacking BK channels\\u003c/h2\\u003e\\n \\u003cp\\u003eTo assess the metabolic function, two key parameters of cellular metabolism were analysed in endothelial cells of BK WT and BK KO mice: the oxygen consumption rate (OCR), reflecting mitochondrial respiration, and the extracellular acidification rate (ECAR), indicative of glycolytic activity. Under mitochondrial stress conditions (Fig. 6a), both groups showed a similar reduction in OCR after treatment with oligomycin, indicating comparable inhibition of ATP synthase. Baseline OCR values did not differ significantly between groups (Fig. 6c); however, BK KO endothelial cells showed significantly higher maximal respiration after FCCP injection (Fig. 6d). As a result, total respiratory capacity, measured as area under the OCR curve (AUC), was significantly increased in BK KO cells (Fig. 6e). To complement these observations, ECAR profiles were analysed under both mitochondrial (Supplementary Figure S4a) and glycolytic (Fig. 6f) stress. ECAR responses were broadly similar between BK WT and BK KO cells, although BK KO cells showed a subtle trend towards increased glycolytic activity. The OCR measurements under glycolytic stress are shown in Supplementary Figure S4b. Integrated analysis of ECAR and OCR under both conditions (Figs. 6b and 6g) revealed distinct bioenergetic profiles: While BK WT endothelial cells showed a predominantly quiescent metabolic phenotype, BK KO cells developed at least a tendency towards increased oxygen consumption (Fig. 6b) and glycolytic activity (Fig. 6g).\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003cdiv id=\\\"Sec26\\\"\\u003e\\n \\u003ch2\\u003eBK channels influence angiogenesis and NO production in endothelial cells\\u003c/h2\\u003e\\n \\u003cp\\u003eIn angiogenesis assays, the inhibition of BK channels in donor hPAECs using PAX or ITX resulted in higher mesh area, fewer isolated segments and shorter isolated branches (Figs. 7a–d). This suggest that there is no greater angiogenic potential of hPAEC under inhibition of BK channels, but a less orderly tube formation, compared with control hPAEC. Silencing BK channel expression (Supplementary Figure S5) significantly reduced NO production in response to Ach (Fig. 7e), suggesting that BK channels are essential for the Ach-induced NO production in endothelial cells. In summary, these findings underscore the important role of BK channels in maintaining endothelial function, particularly through their effects on angiogenesis and NO production.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003cdiv id=\\\"Sec27\\\"\\u003e\\n \\u003ch2\\u003eLack of BK channels disrupts Piezo-1-induced [Ca\\u003csup\\u003e2+\\u003c/sup\\u003e]\\u003csub\\u003ei\\u003c/sub\\u003e increase in ECs\\u003c/h2\\u003e\\n \\u003cp\\u003eUsing the proximity ligation assay (PLA), we confirmed the co-localisation of BK and Piezo-1 channels in hPAECs, as evidenced by a strong fluorescent proximity ligation signal (Fig. 8a). Therefore, we hypothesised that the two channels might be functionally linked and performed live cell calcium imaging on ECs from BK wild-type (WT) and BK knockout (KO) mice (Fig. 8b). Lung ECs from BK KO mice had higher basal calcium levels compared to those from BK WT mice (Fig. 8c). No differences in mRNA expression of calcium influx channels such as Piezo-1, Piezo-2, STIM1 or ORAI1 were observed in the lungs of BK KO vs. BK WT mice (Supplementary Fig. S6). After treatment with the piezo-1 activator Yoda 1 (10 µM), an increase in [Ca2+]i was observed in ECs from BK WT animals compared to BK KO mice (Fig. 8d). This suggests a functional role of BK channels for the Piezo-1 function in endothelial calcium signalling. Indeed, loss of BK channels disrupts Piezo-1-mediated calcium influx, highlighting their role in endothelial function and dysfunction.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eThis study provides comprehensive evidence for the crucial role of large-conductance calcium-activated potassium (BK) channels in lung endothelial cell function and their importance in the pathophysiology of pulmonary hypertension (PH). The main findings are the following: 1) Functional BK channels are expressed in human pulmonary artery endothelial cells (hPAECs) and are downregulated in hPAECs from patients with idiopathic pulmonary arterial hypertension (IPAH). 2) Endothelial dysfunction and impaired BK activation are observed in PAs from mice exposed to hypoxia for 7 and 28 days. 3) Pharmacological inhibition or siRNA-mediated silencing of BK channels in hPAECs disrupts acetylcholine-induced nitric oxide (NO) production and leads to impaired angiogenesis. 4) BK KO mice show impaired endothelium-dependent vasodilation, decreased endothelial caveolae and increased basal intracellular calcium [Ca2+]i. 5) ECs from BK KO mice show a bioenergetic shift towards increased mitochondrial respiration and glycolytic activity. 6) Finally, BK channels are co-localised with Piezo-1 channels in endothelial cells, and their absence blunts the Piezo-1-mediated increase in [Ca2+]i.\\u003c/p\\u003e \\u003cp\\u003eWe observed significant endothelial dysfunction in the PAs of mice under hypoxia, as early as 7 days, as evidenced by an attenuated Ach response and an intact response to SNP. Importantly, vasodilation induced by the BK channel activator NS1619 was significantly reduced under hypoxia. These changes may strongly contribute to the progressive vascular remodelling and sustained PH during prolonged hypoxia exposure and in IPAH. A previous study reported that overexpression of miR-29b, a microRNA that is elevated in IPAH-PASMCs, decreased BK current and downregulated the BK channel β1 subunit in donor PAMSCs [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. In contrast, a transcriptomic study showed increased mRNA expression of the BK channel in PAH lungs [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. However, this finding was not cell type specific and could be due to alterations in other structural or in immune cells. Our results agree to three studies, showing that targeted activation of BK channels attenuated the development of PH in the MCT-PH rat model [\\u003cspan additionalcitationids=\\\"CR23\\\" citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. However, our finding that the attenuated vasodilation in response to Ach was due to a reduced BK channel function in PA endothelial cells, suggests that these beneficial effects in the MCT rat model are mediated by endothelial rather than smooth muscular mechanisms.\\u003c/p\\u003e \\u003cp\\u003eOur study provides compelling evidence for the expression of BK channels in hPAECs, resolving a long-standing debate in the literature [\\u003cspan additionalcitationids=\\\"CR26 CR27\\\" citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. We demonstrate their expression at both the gene and protein level in hPAECs. Patch-clamp recordings confirm the functional activity of these channels, as evidenced by a significant reduction in currents upon treatment with BK channel inhibitors. Our results indicate downregulation of BK channel at both gene and protein levels in hPAECs from IPAH patients compared to healthy controls. Such downregulation may strongly contribute to their endothelial dysfunction.\\u003c/p\\u003e \\u003cp\\u003eWe observed that ECs from BK KO mice exhibit a higher rate of FCCP-induced oxygen consumption compared to BK WT cells. This metabolic shift suggests that BK channel deficiency disturbs the tightly regulated bioenergetic balance in lung endothelial cells, potentially increasing energy expenditure. Such disruption of homeostatic metabolism may contribute to impaired endothelial function as observed in previous studies using PH models [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. Our study also demonstrates that the absence of BK channels disrupts pulmonary endothelial function, as evidenced by reduced Ach -induced vasorelaxation in PA rings from BK KO mice compared to that of BK WT mice. We showed for the first time that this may be due to a significant reduction of endothelial caveolae. This provides new insights into the mechanistic links between BK channel activity and endothelial structural integrity.\\u003c/p\\u003e \\u003cp\\u003ePulmonary hypertension is strongly associated with endothelial dysfunction [\\u003cspan additionalcitationids=\\\"CR10 CR11 CR12\\\" citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]. Our data show that silencing BK in hPAECs, significantly impairs Ach -induced NO production mimicking the decreased NO production by IPAH PAECs [\\u003cspan additionalcitationids=\\\"CR34\\\" citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]. Pharmacological inhibition of BK channels in hPAECs causes disordered angiogenesis, that might underly some features of the pulmonary vascular lesions in IPAH [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003ePiezo-1 channels in ECs are activated by mechanical stimuli such as shear stress and stretch. Once activated, these channels facilitate Ca\\u003csup\\u003e2+\\u003c/sup\\u003e influx. This increase in [Ca\\u003csup\\u003e2+\\u003c/sup\\u003e]\\u003csub\\u003ei\\u003c/sub\\u003e is crucial for shear-induced endothelial responses, including nitric oxide (NO) production and regulation of transcription factors that respond to flow. Ca\\u003csup\\u003e2+\\u003c/sup\\u003e-activated K\\u003csup\\u003e+\\u003c/sup\\u003e channels are often co-expressed with Piezo-1 channels in other cell types [\\u003cspan additionalcitationids=\\\"CR39\\\" citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e]. Our study demonstrates that BK channels are essential for Piezo-1 channel function in the pulmonary endothelium. Disruption of this interaction in BK KO cells virtually blunts Piezo-1 function. This may be even more important as Piezo-1 channels are upregulated in IPAH [\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003e Our study has a few limitations. Since the PAECs were obtained from end-stage IPAH patients, our findings may not be relevant for the early disease. However, our hypoxia experiments showed that BK dysfunction starts already at day 7, which is considered an early phase of hypoxic PA remodeling. We used primary cultured endothelial cells for our study, but they were directly derived from IPAH patients undergoing lung transplantation.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eOur findings demonstrate that BK channels are critical regulators of pulmonary endothelial function and that their impairment causes important pathological features of PH, including reduced nitric oxide secretion, dysfunctional angiogenesis, and metabolic changes (Fig.\\u0026nbsp;9). The downregulation of BK channels in IPAH suggests that BK channels may represent an important therapeutic target. Mechanistically, BK channels are co-localised with Piezo-1 channels and are critical for the Piezo-1-mediated calcium increase. Restoring the loss of BK channels, or their function might represent the right pathway to maintain vascular integrity and prevent the progression of PH.\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cp\\u003eAch, acetylcholine\\u003c/p\\u003e\\n\\u003cp\\u003eANOVA, analysis of variance\\u003c/p\\u003e\\n\\u003cp\\u003eAUC, area under curve\\u003c/p\\u003e\\n\\u003cp\\u003eBCA, biscinchoninic acid\\u003c/p\\u003e\\n\\u003cp\\u003eBK, large conducatance calcium-actiavted potassium channel\\u003c/p\\u003e\\n\\u003cp\\u003eCa2+, calcium ion\\u003c/p\\u003e\\n\\u003cp\\u003e[Ca2+]i, intracellular free calcium ion concentration\\u003c/p\\u003e\\n\\u003cp\\u003eCaCl2, calcium chloride\\u003c/p\\u003e\\n\\u003cp\\u003ecDNA, complementary deoxyribo nucleic acid\\u003c/p\\u003e\\n\\u003cp\\u003eCOPD, chronic obstructive pulmonary disease\\u003c/p\\u003e\\n\\u003cp\\u003eDAPI, 4\\u0026apos;,6-diamidino-2-phenylindole\\u003c/p\\u003e\\n\\u003cp\\u003eDMSO, dimethyl sulphoxide\\u003c/p\\u003e\\n\\u003cp\\u003eECAR, extracellular acidification rate\\u003c/p\\u003e\\n\\u003cp\\u003eECL, enhanced chemiluminescence\\u003c/p\\u003e\\n\\u003cp\\u003eEDTA, ethylenediaminetetraacetic acid\\u003c/p\\u003e\\n\\u003cp\\u003eeNOS, endothelial nitric oxide synthase\\u003c/p\\u003e\\n\\u003cp\\u003eFCCP, Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone\\u003c/p\\u003e\\n\\u003cp\\u003eFCS, fetal calf serum\\u003c/p\\u003e\\n\\u003cp\\u003eGAPDH, glyceraldehyde-3-phosphate dehydrogenase\\u003c/p\\u003e\\n\\u003cp\\u003eHEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid\\u003c/p\\u003e\\n\\u003cp\\u003eHOX, hypoxia\\u003c/p\\u003e\\n\\u003cp\\u003ehPAEC, human pulmonary arterial endothelial cell\\u003c/p\\u003e\\n\\u003cp\\u003eIPAH, idiopathic pulmonary arterial hypertension\\u003c/p\\u003e\\n\\u003cp\\u003eITX, iberiotoxin\\u003c/p\\u003e\\n\\u003cp\\u003eKC\\u003csub\\u003ea\\u003c/sub\\u003e-Calcium activated potassium channel\\u003c/p\\u003e\\n\\u003cp\\u003eKCl, potassium chloride\\u003c/p\\u003e\\n\\u003cp\\u003eKCNK3, potassium two pore domain channel subfamily member 3\\u003c/p\\u003e\\n\\u003cp\\u003eKO, knock out\\u003c/p\\u003e\\n\\u003cp\\u003eMgCl2, magnesium chloride\\u003c/p\\u003e\\n\\u003cp\\u003eMOPS, 3-(N-morpholino)propanesulfonic acid, 4-Morpholino Propanesulfonic Acid\\u003c/p\\u003e\\n\\u003cp\\u003emPAP, mean pulmonary arterial pressure\\u003c/p\\u003e\\n\\u003cp\\u003eNaCl, sodium chloride\\u003c/p\\u003e\\n\\u003cp\\u003eNaOH, sodium hydroxide\\u003c/p\\u003e\\n\\u003cp\\u003eNOX, normoxia\\u003c/p\\u003e\\n\\u003cp\\u003eOCR, oxygen consumption rate\\u003c/p\\u003e\\n\\u003cp\\u003ePA, pulmonary artery\\u003c/p\\u003e\\n\\u003cp\\u003ePAEC, pulmonary arterial endothelial cell\\u003c/p\\u003e\\n\\u003cp\\u003ePAH, pulmonary arterial hypertension\\u003c/p\\u003e\\n\\u003cp\\u003ePASMC, pulmonary arterial smooth muscle cell\\u003c/p\\u003e\\n\\u003cp\\u003ePAX, paxilline\\u003c/p\\u003e\\n\\u003cp\\u003ePBS, phosphate buffer saline\\u003c/p\\u003e\\n\\u003cp\\u003ePH, pulmonary hypertension\\u003c/p\\u003e\\n\\u003cp\\u003ePLA, proximity ligation assay\\u003c/p\\u003e\\n\\u003cp\\u003ePVDF, polyvinylidene difluoride\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003ePVR, pulmonary vascular resistance\\u003c/p\\u003e\\n\\u003cp\\u003eqRT-PCR, quantitative real time polymerase chain reaction\\u003c/p\\u003e\\n\\u003cp\\u003eRIPA, radioimmunoprecipitation assay\\u003c/p\\u003e\\n\\u003cp\\u003eRNA, ribo nucleic acid\\u003c/p\\u003e\\n\\u003cp\\u003eRVSP, right ventricular systolic pressure\\u003c/p\\u003e\\n\\u003cp\\u003eSDS, sodium dodecyl sulphate\\u003c/p\\u003e\\n\\u003cp\\u003eSEM, standard error of mean\\u003c/p\\u003e\\n\\u003cp\\u003eSNP, sodium nitroprusside\\u003c/p\\u003e\\n\\u003cp\\u003eTCEP, tris(2-carboxyethyl)phosphine\\u003c/p\\u003e\\n\\u003cp\\u003eWT, wild type\\u003c/p\\u003e\\n\\u003cp\\u003eWU, wood units\\u003c/p\\u003e\\n\\u003cp\\u003e2-DG, 2-deoxy-D-glucose\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe are very grateful for the excellent technical assistance from Elisabeth Hebenstreit, Sabine Halsegger, Martina Huber and Thomas Fuchs. We express our heartfelt gratitude to Prof. Marlene Rabinovitch and Dr. Mauro Lago Docampo for their valuable discussions and helpful scientific advices. We are very thankful for the technical and scientific support from Dr. Aqin Cao and Dr. Chongyang Zhang.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eDeclaration of interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eHO reports grants from Bayer, and Boehringer Ingelheim. HO reports personal fees and non-financial support from Medupdate and Mondial, Aerovate, Astra Zeneca, Bayer, Ferrer, Menarini, MSD, Iqvia, Janssen, and Liquidia outside the submitted work.\\u003c/p\\u003e\\n\\u003cp\\u003eAO received honoraria for presentations and support for attending meetings, and/or travel from MSD outside the submitted work.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding Declaration\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eDG was supported Medical University of Graz, Graz, Austria through the PhD Program Molecular Medicine (MOLMED), the OEAD Marietta Blau fellowship and Austrian Marshall Plan scholarship.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eThis research was funded in part by the Austrian Science Fund (FWF), Grant-DOI 10.55776/I6299 to AO and by the grants of the Hungarian National Research, Development and Innovation Office (NKFIH) ANN142950 and TKP2021-EGA-24 to PE.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eCN was supported by an ERS Long Term Fellowship.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eWMK is supported by the Deutsche Forschungsgemeinschaft (German Research Foundation) project ID 431232613 SFB-1449 subproject B01; project ID 437531118 SFB-1470 subproject A04; operational grants 1218/11-1, 1218/12-1, 1218/14-1; Bundesministerium f\\u0026uuml;r Bildung und Forschung in the framework of e:Med SYMPATH (01ZX1906A); and the German Center for Cardiovascular Research (DZHK) partner site Berlin.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eAll the other authors have no fundings to declare pertaining to the submitted work.\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eGuignabert, C., et al., \\u003cem\\u003ePathology and pathobiology of pulmonary hypertension: current insights and future directions.\\u003c/em\\u003e Eur Respir J, 2024. \\u003cstrong\\u003e64\\u003c/strong\\u003e(4).\\u003c/li\\u003e\\n\\u003cli\\u003eKovacs, G., et al., \\u003cem\\u003eDefinition, classification and diagnosis of pulmonary hypertension.\\u003c/em\\u003e Eur Respir J, 2024. \\u003cstrong\\u003e64\\u003c/strong\\u003e(4).\\u003c/li\\u003e\\n\\u003cli\\u003eFord, H.J., et al., \\u003cem\\u003eExploring the patient perspective in pulmonary hypertension.\\u003c/em\\u003e Eur Respir J, 2024. \\u003cstrong\\u003e64\\u003c/strong\\u003e(4).\\u003c/li\\u003e\\n\\u003cli\\u003eMaron, B.A., et al., \\u003cem\\u003ePulmonary hypertension associated with left heart disease.\\u003c/em\\u003e Eur Respir J, 2024. \\u003cstrong\\u003e64\\u003c/strong\\u003e(4).\\u003c/li\\u003e\\n\\u003cli\\u003eShlobin, O.A., et al., \\u003cem\\u003ePulmonary hypertension associated with lung diseases.\\u003c/em\\u003e Eur Respir J, 2024. \\u003cstrong\\u003e64\\u003c/strong\\u003e(4).\\u003c/li\\u003e\\n\\u003cli\\u003eHoeper, M.M., et al., \\u003cem\\u003eA global view of pulmonary hypertension.\\u003c/em\\u003e Lancet Respir Med, 2016. \\u003cstrong\\u003e4\\u003c/strong\\u003e(4): p. 306-22.\\u003c/li\\u003e\\n\\u003cli\\u003eDardi, F., et al., \\u003cem\\u003eRisk stratification and treatment goals in pulmonary arterial hypertension.\\u003c/em\\u003e Eur Respir J, 2024. \\u003cstrong\\u003e64\\u003c/strong\\u003e(4).\\u003c/li\\u003e\\n\\u003cli\\u003eChin, K.M., et al., \\u003cem\\u003eTreatment algorithm for pulmonary arterial hypertension.\\u003c/em\\u003e Eur Respir J, 2024. \\u003cstrong\\u003e64\\u003c/strong\\u003e(4).\\u003c/li\\u003e\\n\\u003cli\\u003eJonigk, D., et al., \\u003cem\\u003ePlexiform lesions in pulmonary arterial hypertension composition, architecture, and microenvironment.\\u003c/em\\u003e Am J Pathol, 2011. \\u003cstrong\\u003e179\\u003c/strong\\u003e(1): p. 167-79.\\u003c/li\\u003e\\n\\u003cli\\u003eVoelkel, N.F., et al., \\u003cem\\u003eVascular endothelial growth factor in pulmonary hypertension.\\u003c/em\\u003e Ann N Y Acad Sci, 1996. \\u003cstrong\\u003e796\\u003c/strong\\u003e: p. 186-93.\\u003c/li\\u003e\\n\\u003cli\\u003eTuder, R.M., B.E. Flook, and N.F. Voelkel, \\u003cem\\u003eIncreased gene expression for VEGF and the VEGF receptors KDR/Flk and Flt in lungs exposed to acute or to chronic hypoxia. Modulation of gene expression by nitric oxide.\\u003c/em\\u003e J Clin Invest, 1995. \\u003cstrong\\u003e95\\u003c/strong\\u003e(4): p. 1798-807.\\u003c/li\\u003e\\n\\u003cli\\u003eChristou, H., et al., \\u003cem\\u003eIncreased vascular endothelial growth factor production in the lungs of rats with hypoxia-induced pulmonary hypertension.\\u003c/em\\u003e Am J Respir Cell Mol Biol, 1998. \\u003cstrong\\u003e18\\u003c/strong\\u003e(6): p. 768-76.\\u003c/li\\u003e\\n\\u003cli\\u003eKlinger, J.R., S.H. Abman, and M.T. Gladwin, \\u003cem\\u003eNitric oxide deficiency and endothelial dysfunction in pulmonary arterial hypertension.\\u003c/em\\u003e Am J Respir Crit Care Med, 2013. \\u003cstrong\\u003e188\\u003c/strong\\u003e(6): p. 639-46.\\u003c/li\\u003e\\n\\u003cli\\u003eGuntur, D., et al., \\u003cem\\u003eRevisiting the Large-Conductance Calcium-Activated Potassium (BKCa) Channels in the Pulmonary Circulation.\\u003c/em\\u003e Biomolecules, 2021. \\u003cstrong\\u003e11\\u003c/strong\\u003e(11).\\u003c/li\\u003e\\n\\u003cli\\u003eSchubert, R. and M.T. Nelson, \\u003cem\\u003eProtein kinases: tuners of the BKCa channel in smooth muscle.\\u003c/em\\u003e Trends Pharmacol Sci, 2001. \\u003cstrong\\u003e22\\u003c/strong\\u003e(10): p. 505-12.\\u003c/li\\u003e\\n\\u003cli\\u003eLi, Y., et al., \\u003cem\\u003ePeroxisome proliferator-activated receptor-beta/delta, the acute signaling factor in prostacyclin-induced pulmonary vasodilation.\\u003c/em\\u003e Am J Respir Cell Mol Biol, 2012. \\u003cstrong\\u003e46\\u003c/strong\\u003e(3): p. 372-9.\\u003c/li\\u003e\\n\\u003cli\\u003eSkofic Maurer, D., et al., \\u003cem\\u003eEndothelial Dysfunction Following Enhanced TMEM16A Activity in Human Pulmonary Arteries.\\u003c/em\\u003e Cells, 2020. \\u003cstrong\\u003e9\\u003c/strong\\u003e(9).\\u003c/li\\u003e\\n\\u003cli\\u003eNagy, B.M., et al., \\u003cem\\u003eImportance of kynurenine in pulmonary hypertension.\\u003c/em\\u003e Am J Physiol Lung Cell Mol Physiol, 2017. \\u003cstrong\\u003e313\\u003c/strong\\u003e(5): p. L741-L751.\\u003c/li\\u003e\\n\\u003cli\\u003eMeredith, A.L., et al., \\u003cem\\u003eOveractive bladder and incontinence in the absence of the BK large conductance Ca2+-activated K+ channel.\\u003c/em\\u003e J Biol Chem, 2004. \\u003cstrong\\u003e279\\u003c/strong\\u003e(35): p. 36746-52.\\u003c/li\\u003e\\n\\u003cli\\u003eBabicheva, A., et al., \\u003cem\\u003eMicroRNA-mediated downregulation of K(+) channels in pulmonary arterial hypertension.\\u003c/em\\u003e Am J Physiol Lung Cell Mol Physiol, 2020. \\u003cstrong\\u003e318\\u003c/strong\\u003e(1): p. L10-L26.\\u003c/li\\u003e\\n\\u003cli\\u003ePerez-Vizcaino, F., A. Cogolludo, and G. Mondejar-Parreno, \\u003cem\\u003eTranscriptomic profile of cationic channels in human pulmonary arterial hypertension.\\u003c/em\\u003e Sci Rep, 2021. \\u003cstrong\\u003e11\\u003c/strong\\u003e(1): p. 15829.\\u003c/li\\u003e\\n\\u003cli\\u003eFerraz, A.P., et al., \\u003cem\\u003eBKCa Channel Activation Attenuates the Pathophysiological Progression of Monocrotaline-Induced Pulmonary Arterial Hypertension in Wistar Rats.\\u003c/em\\u003e Cardiovasc Drugs Ther, 2021. \\u003cstrong\\u003e35\\u003c/strong\\u003e(4): p. 719-732.\\u003c/li\\u003e\\n\\u003cli\\u003eRevermann, M., et al., \\u003cem\\u003eInhalation of the BK(Ca)-opener NS1619 attenuates right ventricular pressure and improves oxygenation in the rat monocrotaline model of pulmonary hypertension.\\u003c/em\\u003e PLoS One, 2014. \\u003cstrong\\u003e9\\u003c/strong\\u003e(1): p. e86636.\\u003c/li\\u003e\\n\\u003cli\\u003eBonnet, S., et al., \\u003cem\\u003eDehydroepiandrosterone (DHEA) prevents and reverses chronic hypoxic pulmonary hypertension.\\u003c/em\\u003e Proc Natl Acad Sci U S A, 2003. \\u003cstrong\\u003e100\\u003c/strong\\u003e(16): p. 9488-93.\\u003c/li\\u003e\\n\\u003cli\\u003eGauthier, K.M., et al., \\u003cem\\u003eFreshly isolated bovine coronary endothelial cells do not express the BK Ca channel gene.\\u003c/em\\u003e J Physiol, 2002. \\u003cstrong\\u003e545\\u003c/strong\\u003e(3): p. 829-36.\\u003c/li\\u003e\\n\\u003cli\\u003eVang, A., et al., \\u003cem\\u003eActivation of endothelial BKCa channels causes pulmonary vasodilation.\\u003c/em\\u003e Vascul Pharmacol, 2010. \\u003cstrong\\u003e53\\u003c/strong\\u003e(3-4): p. 122-9.\\u003c/li\\u003e\\n\\u003cli\\u003eSandow, S.L. and T.H. Grayson, \\u003cem\\u003eLimits of isolation and culture: intact vascular endothelium and BKCa.\\u003c/em\\u003e Am J Physiol Heart Circ Physiol, 2009. \\u003cstrong\\u003e297\\u003c/strong\\u003e(1): p. H1-7.\\u003c/li\\u003e\\n\\u003cli\\u003eNaik, J.S. and B.R. Walker, \\u003cem\\u003eEndothelial-dependent dilation following chronic hypoxia involves TRPV4-mediated activation of endothelial BK channels.\\u003c/em\\u003e Pflugers Arch, 2018. \\u003cstrong\\u003e470\\u003c/strong\\u003e(4): p. 633-648.\\u003c/li\\u003e\\n\\u003cli\\u003eRafikov, R., et al., \\u003cem\\u003eComplex I dysfunction underlies the glycolytic switch in pulmonary hypertensive smooth muscle cells.\\u003c/em\\u003e Redox Biol, 2015. \\u003cstrong\\u003e6\\u003c/strong\\u003e: p. 278-286.\\u003c/li\\u003e\\n\\u003cli\\u003eAkagi, S., et al., \\u003cem\\u003eEvidence for Hypoxia-Induced Shift in ATP Production from Glycolysis to Mitochondrial Respiration in Pulmonary Artery Smooth Muscle Cells in Pulmonary Arterial Hypertension.\\u003c/em\\u003e J Clin Med, 2023. \\u003cstrong\\u003e12\\u003c/strong\\u003e(15).\\u003c/li\\u003e\\n\\u003cli\\u003eTuder, R.M. and N.F. Voelkel, \\u003cem\\u003eAngiogenesis and pulmonary hypertension: a unique process in a unique disease.\\u003c/em\\u003e Antioxid Redox Signal, 2002. \\u003cstrong\\u003e4\\u003c/strong\\u003e(5): p. 833-43.\\u003c/li\\u003e\\n\\u003cli\\u003eVoelkel, N.F. and J. Gomez-Arroyo, \\u003cem\\u003eThe role of vascular endothelial growth factor in pulmonary arterial hypertension. The angiogenesis paradox.\\u003c/em\\u003e Am J Respir Cell Mol Biol, 2014. \\u003cstrong\\u003e51\\u003c/strong\\u003e(4): p. 474-84.\\u003c/li\\u003e\\n\\u003cli\\u003eXu, W., et al., \\u003cem\\u003eIncreased arginase II and decreased NO synthesis in endothelial cells of patients with pulmonary arterial hypertension.\\u003c/em\\u003e FASEB J, 2004. \\u003cstrong\\u003e18\\u003c/strong\\u003e(14): p. 1746-8.\\u003c/li\\u003e\\n\\u003cli\\u003eGhosh, S., et al., \\u003cem\\u003ePhosphorylation inactivation of endothelial nitric oxide synthesis in pulmonary arterial hypertension.\\u003c/em\\u003e Am J Physiol Lung Cell Mol Physiol, 2016. \\u003cstrong\\u003e310\\u003c/strong\\u003e(11): p. L1199-205.\\u003c/li\\u003e\\n\\u003cli\\u003eBasehore, S.E. and A.M. Clyne, \\u003cem\\u003eHuman Pulmonary Artery Endothelial Cells Increased Glycolysis and Decreased Nitric Oxide Synthase O-GlcNAcylation in Pulmonary Arterial Hypertension.\\u003c/em\\u003e International Journal of Translational Medicine, 2024. \\u003cstrong\\u003e4\\u003c/strong\\u003e(1): p. 140-151.\\u003c/li\\u003e\\n\\u003cli\\u003eMasri, F.A., et al., \\u003cem\\u003eHyperproliferative apoptosis-resistant endothelial cells in idiopathic pulmonary arterial hypertension.\\u003c/em\\u003e Am J Physiol Lung Cell Mol Physiol, 2007. \\u003cstrong\\u003e293\\u003c/strong\\u003e(3): p. L548-54.\\u003c/li\\u003e\\n\\u003cli\\u003eTuder, R.M., et al., \\u003cem\\u003eExpression of angiogenesis-related molecules in plexiform lesions in severe pulmonary hypertension: evidence for a process of disordered angiogenesis.\\u003c/em\\u003e J Pathol, 2001. \\u003cstrong\\u003e195\\u003c/strong\\u003e(3): p. 367-74.\\u003c/li\\u003e\\n\\u003cli\\u003eMichelucci, A. and L. Catacuzzeno, \\u003cem\\u003ePiezo1, the new actor in cell volume regulation.\\u003c/em\\u003e Pflugers Arch, 2024. \\u003cstrong\\u003e476\\u003c/strong\\u003e(7): p. 1023-1039.\\u003c/li\\u003e\\n\\u003cli\\u003eHaam, C.E., et al., \\u003cem\\u003eAlteration of Piezo1 signaling in type 2 diabetic mice: focus on endothelium and BK(Ca) channel.\\u003c/em\\u003e Pflugers Arch, 2024. \\u003cstrong\\u003e476\\u003c/strong\\u003e(10): p. 1479-1492.\\u003c/li\\u003e\\n\\u003cli\\u003eJakob, D., et al., \\u003cem\\u003ePiezo1 and BK(Ca) channels in human atrial fibroblasts: Interplay and remodelling in atrial fibrillation.\\u003c/em\\u003e J Mol Cell Cardiol, 2021. \\u003cstrong\\u003e158\\u003c/strong\\u003e: p. 49-62.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, Z., et al., \\u003cem\\u003eEndothelial upregulation of mechanosensitive channel Piezo1 in pulmonary hypertension.\\u003c/em\\u003e Am J Physiol Cell Physiol, 2021. \\u003cstrong\\u003e321\\u003c/strong\\u003e(6): p. C1010-C1027.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"cell-communication-and-signaling\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"ccas\",\"sideBox\":\"Learn more about [Cell Communication and Signaling](http://biosignaling.biomedcentral.com/)\",\"snPcode\":\"12964\",\"submissionUrl\":\"https://submission.nature.com/new-submission/12964/3\",\"title\":\"Cell Communication and Signaling\",\"twitterHandle\":\"@bmc\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"BK channels, Piezo-1 channels, endothelial dysfunction, hyperpolarization, pulmonary hypertension\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6506992/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6506992/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cb\\u003eBackground\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003ePulmonary hypertension (PH) is a progressive vascular disease that severely compromises quality of life and survival. The pulmonary endothelium plays a pivotal role in vascular homeostasis through complex signalling networks involving ion channels that respond to ionic imbalance (e.g. Na+, K+, Ca2+) and mechanical stimuli (e.g. via Piezo, TRPC, TRPV channels). While large-conductance calcium-activated potassium channels (BK channels) in pulmonary artery smooth muscle cells promote vasorelaxation and attenuate PH, their role in endothelial function is poorly defined. This study investigates the contribution of endothelial BK channels to pulmonary vascular signalling and their potential as therapeutic targets in PH.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eMethods\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eHuman lung tissue samples from patients with idiopathic pulmonary arterial hypertension (IPAH) and healthy donors were assessed for BK channel expression by qPCR, Western blot and immunofluorescence staining. BK channel activity in human pulmonary artery endothelial cells was evaluated through patch-clamp recordings. In vivo, BK knockout (BK KO) mice and hypoxia-exposed wild-type mice were used to study endothelial dysfunction and vascular remodelling. Cellular metabolism was analysed using oxygen consumption rate (OCR) and extracellular acidification rate (ECAR), while ex vivo vasoreactivity was assessed via wire myography.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eResults\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eWild type mice exposed to hypoxia (7 and 28 days) exhibited increased right ventricular systolic pressure (RVSP) and endothelial dysfunction with reduced BK channel function. BK KO mice showed impaired acetylcholine-induced vasodilation of pulmonary arteries, a sign of endothelial dysfunction, similar to mice exposed to hypoxia. BK KO endothelial cells displayed increased mitochondrial respiration. In human PAECs (hPAECs), functional BK channels were identified and in IPAH patients, they were significantly downregulated. Pharmacological BK inhibition in hPAECs resulted in impaired nitric oxide (NO) production and uncontrolled angiogenesis. Furthermore, BK channels colocalised with Piezo-1, and their absence impaired Piezo-1-mediated calcium influx, suggesting a pivotal role in endothelial calcium signaling.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eConclusions\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eBK channels are integral to pulmonary endothelial signalling, regulating vasodilation, angiogenesis, calcium dynamics, and metabolic homeostasis. Their dysfunction contributes to endothelial impairment in PH, and their downregulation in IPAH highlights a novel pathogenic mechanism. Restoration of BK channel function may offer a promising therapeutic strategy to preserve endothelial function and counteract pulmonary vascular remodelling.\\u003c/p\\u003e\",\"manuscriptTitle\":\"BK Channels Are Indispensable for Endothelial Function in Small Pulmonary Arteries\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-05-07 06:22:34\",\"doi\":\"10.21203/rs.3.rs-6506992/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2025-06-11T03:29:31+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-06-11T02:14:33+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"216320386654429503730131887634354369376\",\"date\":\"2025-05-26T11:17:20+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-05-06T07:48:34+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"214529260895320524700023125502463548566\",\"date\":\"2025-04-28T06:30:08+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2025-04-28T04:08:28+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2025-04-24T08:23:44+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2025-04-24T08:22:32+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Cell Communication and Signaling\",\"date\":\"2025-04-22T19:32:57+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"cell-communication-and-signaling\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"ccas\",\"sideBox\":\"Learn more about [Cell Communication and Signaling](http://biosignaling.biomedcentral.com/)\",\"snPcode\":\"12964\",\"submissionUrl\":\"https://submission.nature.com/new-submission/12964/3\",\"title\":\"Cell Communication and Signaling\",\"twitterHandle\":\"@bmc\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"805eb3dc-540d-49d5-9eb5-9058ca249b1b\",\"owner\":[],\"postedDate\":\"May 7th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-10-27T16:28:14+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-6506992\",\"link\":\"https://doi.org/10.1186/s12964-025-02436-0\",\"journal\":{\"identity\":\"cell-communication-and-signaling\",\"isVorOnly\":false,\"title\":\"Cell Communication and Signaling\"},\"publishedOn\":\"2025-10-21 16:17:18\",\"publishedOnDateReadable\":\"October 21st, 2025\"},\"versionCreatedAt\":\"2025-05-07 06:22:34\",\"video\":\"\",\"vorDoi\":\"10.1186/s12964-025-02436-0\",\"vorDoiUrl\":\"https://doi.org/10.1186/s12964-025-02436-0\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6506992\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6506992\",\"identity\":\"rs-6506992\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}