{"paper_id":"0cca906b-6a68-4452-884b-e22e62129c11","body_text":"Successful treatment with doxycycline monotherapy for human infection with Babesia venatorum (Babesiidae, Sporozoa) in China: a case report and clinic regimen | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Successful treatment with doxycycline monotherapy for human infection with Babesia venatorum (Babesiidae, Sporozoa) in China: a case report and clinic regimen Lei Huang, Dan-Dan Huo, Ming Xu, Luo-Yuan Xia, Ning Yang, Hong Wei, and 15 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2735617/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 12 Jul, 2023 Read the published version in Infectious Diseases of Poverty → Version 1 posted 5 You are reading this latest preprint version Abstract Background: Human babesiosis is a worldwide disease caused by intraerythrocytic protozoa of the genus Babesia , which are transmitted by bites from ixodid ticks but also mechanically transmitted by blood transfusion. This disease is primarily treated with quinine and/or atovaquone, which are not readily available in China. A novel treatment regimen with doxycycline monotherapy in one severe patient with Babesia venatorum infection was achieved as an alternative therapeutic medication. Case presentation: A 73-year-old male who underwent splenectomy and blood transfusion 8 years previously had unexplained fever, headache and thrombocytopenia and was admitted to the Fifth Medical Center of the PLA General Hospital. The cases were confirmed to be infected with B. venatorum by morphological observations on thin peripheral blood smears, multi-gene PCR, and sequencing of the entire 18s-rRNA and partial β-tubulin encoding genes, as well as isolation by animal inoculation. The doxycycline monotherapy regimen was administered following pharmacological guidance and an effective outcome was observed. The patient recovered rapidly following doxycycline monotherapy. The Babesia protozoan load in peripheral blood samples decreased by 88% in hematocrit counts 8 days later, and negative PCR results were achieved in 90 days when he was examined in our hospital. The treatment course of the patient lasted 3 months without side effects or sequelae. The 9-month follow-up survey of the patient did not show signs of recrudescence or anti-babesial tolerance. Conclusions: We first reported an interesting clinical practice of successful doxycycline monotherapy for human babesiosis caused by B. venatorum , which provides an optional medical intervention for human babesiosis. Human babesiosis Babesia venatorum Doxycycline monotherapy China Figures Figure 1 Figure 2 Figure 3 Figure 4 Background Human babesiosis is a zoonotic disease caused by an intraerythrocytic protozoan of the genus Babesia, parasitic in the red blood cells of mammals, and is transmitted mainly by tick bites and blood transfusions [1] . Currently, more than 100 species of Babesia are recognized as pathogenic to various wild and domestic animal hosts, including humans [2] . Since the first case of human babesiosis was reported in 1957in a Croatian farmer who underwent splenectomy (formerly Yugoslavia) [1] , cases of human babesiosis have increased dramatically, especially in the Northern Hemisphere. In the United States alone, the annual cumulative number of cases of human babesiosis was estimated to range from 20,000 to 24,000 between 2006 and 2018 and is recommended as a notifiable infectious disease secondary to Lyme disease [3,4] . In China, several Babesia species have been recorded in more than 125 human victims [5] , including Babesia divergens [6] , Babesia venatorum [7] , Babesia microti [8] , and Babesia crassa- like pathogens [9] . B. venatorum , also known as Babesia sp. EU1 [10] , was named after the Latin word for Austrian and Italian asplenic hunters, who had a history of exposure to positive infected ticks and acquired infections of Babesia species during their hunts. Since then, protozoan species have been documented to naturally infect the host roe deer Capreolus capreolus and the vector species Ixodes ricinus and I. persulcatus [11, 12] . In an epidemiological survey of Chinese victims, 48 human cases of B. venatorum have also been reported in endemic areas of northeast China, most of which were underestimated due to their asymptotic appearance [7] . Therefore, human infections with B. venatorum tend to be ignored. More etiological characteristics and perfect regimens against infections are urgently needed for clinical development and practice. In this study, a patient who experienced unexplained febrile symptoms sought medical services at our hospital. Through morphological microscopic examination and multi-gene PCR amplification, it was determined that the patient was infected with B. venatorum, and proper treatment with sensitive doxycycline was performed. Currently, three generations of anti-babesial drugs have been approved for clinical administration. Quinine, a traditional drug against Babesia and Plasmodium species, inhibits hemozoin biocrystallization in the heme detoxification pathway, which facilitates the aggregation of cytotoxic heme and results in parasite death [13,14] . As a unique naphthoquinone with broad-spectrum antiprotozoal activity, atovaquone has activity against susceptible parasites, inhibiting the mitochondrial electron-transport chain at the site of the cytochrome bc1 complex (complex III) and ultimately blocking the synthesis of nucleic acids and ATP [15-17] . According to the 2020 Guidelines on Diagnosis and Management of Babesiosis sponsored by the United States CDC [2] , it is commonly recommended for human babesiosis to be treated with quinine plus clindamycin, atovaquone plus azithromycin, or a combination of quinine, clindamycin, and atovaquone, since azithromycin and its relevant clindamycin are protein synthesis inhibitors of apicoplast in apicomplexan parasites [18-20] . Furthermore, doxycycline, a broad-spectrum tetracycline-class antibiotic, is used to treat malaria in combination with quinine by killing erythrocytic-stage parasites that target the apicoplast, a plastid organelle [21] . Few attempts have been made to achieve the anti-babesial effects of doxycycline in limited experiment animals [22] . However, to date, no trials have been conducted on human victims suffering from Babesia infection. Case Presentation A 73-year-old male underwent a splenectomy from a traffic accident in 2014, and a blood transfusion was performed during the surgery. He had no chronic diseases, and no drug, alcohol abuse, or food allergies were recorded. The patient had quit smoking 10 years ago and lived with his family in an urban area of Hulunbuir Grassland (E115°31’–126°04’, and N 47°05’-53°20’) Inner Mongolia Autonomous Region, China, without a positive family medical history. The patient developed fever with a maximum body temperature of 39 °C on October 22, 2021, defined as the first day of the onset of the disease (Figure 1). Headaches, nausea, and vomiting remained for several days. On 26 October, the patient was admitted to the local hospital, where he received a systematic examination and standard laboratory tests, including blood cultures (repeated five times) and bone marrow tests and culture, while administered antibacterial treatment, including cefoperazone sodium, ornidazole meropenem, etc. over the following time (Supplementary Figure S1). No relevant signs were found, except for a few abnormal biochemical tests, including thrombocytopenia (34 × 10 9 /L), increased C-reactive protein (88.1 mg/L), and weakly positive tuberculosis-interferon gamma release assay (TB-SPOT). However, the patient’s condition did not improve. On November 9, 2021, the patient was transferred to the Fifth Medical Center of the PLA General Hospital in Beijing due to uncontrolled body temperature (previous statement: loss of fever remission and reliance on indometacin suppository twice daily to control). After admission, a detailed physical examination revealed no positive signs, except for abdominal surgical scars. Assays for 11 pathogenic bacteria and two viruses (Supplementary Table S1) were performed in the hospital and all results were negative. Therefore, we ruled out common bacterial and viral infections in this patient. Meanwhile, the erythrocyte sedimentation rate, pure protein derivative test, and computed tomography (CT) of the lung also did not indicate TB infection in the patient. Fortunately, thrombocytopenia (31 × 10 9 /L) and extremely high ferritin levels (>2000 ng/ml) were observed and a tentative suspicion of hematological disorder or malignant tumor bone metastases was made. To validate our suspicion, a thin smear of the peripheral blood sample was made and observed under a microscope with an oil-immersed lens on November 11, 2021. However, the clinical laboratory in our hospital did not report definitive positive results. We empirically used doxycycline monotherapy (po 0.1 g Bid) to treat some undetectable pathogens, as the patient’s symptoms were persistently unrelieved, and conventional anti-infective therapy was ineffective. During the first 2 days of doxycycline administration, the patient’s body temperature gradually decreased, and the symptoms resolved. We delivered the blood sample on November 11 to the Beijing Institute of Microbiology and Epidemiology for further pathogen detection. On November 17, a laboratory specialist reported that Babesia was found in blood smears on November 11 (Figure 2). To confirm the result, we collected the blood again on November 17 for smear observation and submitted it for PCR testing and sequencing. Babesia was also found in blood smears, and Babesia venatrum was identified. Additionally, PET-CT did not indicate any high metabolic lesions on November 13, and two bone marrow aspirations did not reveal any special abnormalities on November 11 and 23. Therefore, the patient was diagnosed with babesiosis. According to the recommendations of the United States CDC, we were engaged to treat the patient with atovaquone and quinine. However, emergency conscription for quinine and atovaquone is not available in China. As an alternative chemical, doxycycline has been shown to have sensitive antiparasitic activities by inhibiting the synthesis of apicoplast protein in Plasmodium species and successfully treating Babesia canis and Babesia gibsoni infection in dogs [23, 24] . Moreover, due to the use of doxycycline, the patient's clinical symptoms have gradually eased. Therefore, we continued the monotherapy practice of doxycycline (po, 0.1 g Bid), followed by strict supervision and regular monitoring of parasite loads. As expected, the patient recovered rapidly after doxycycline monotherapy; the babesia protozoan burden decreased dramatically from pretreated 12000/μL to 3840/μL (3 days, dpt), 2400/μL (5 dpt), and 1440/μL (8 dpt). Broken or fragmented merozoites were frequently recorded during the procedure of the regimen. Body temperature decreased after 2-day therapy, returned to normal after 7-day therapy, and then remained normal thereafter (Figure 4). However, the relevant manifestations disappeared (Supplementary Table S2). The patient was discharged on day 35 of the onset of the disease. Since then, a consecutive follow-up survey of the patient with a continuing course of doxycycline treatment was performed for 90 days. The patient was readmitted to the hospital for follow-up on February 11, 2022 and had no complaints. We performed a detailed systematic examination of the patient, but did not find abnormal signs. The same protocol was used to monitor the babesia burden on the patient. Both morphological observations and PCR were negative for whole blood collected at 117 days (Figure 1). Doxycycline-related side effects and sequelae, including erythema and hepatic inadequacy, have not been documented. In this case, the patient maintained his normal body temperature and health status from the time chemical therapy was stopped until the final follow-up visit on August 19, 2022 (Figure 1 and Supplementary Table S3). Confirmation on the infected patient Morphological examination, PCR test and sequencing as well as parasitemia surveillance were used for the determination of the patient. A thin smear of the peripheral blood sample was made according to the conventional method, fixed with methanol solution, stained with 1% Gimsa solution for 30 min, and observed under a microscope with an oil-immersed lens. The number of protozoa and red blood cells was counted in each field. The density of protozoa was calculated as the number of protozoa per microliter of blood. Whole blood was screened by PCR for Babesia and other tick-borne pathogens with primers for the Babesia -specific 18S rRNA gene [7] , Anaplasma -specific partial 16S rRNA gene [18] , Rickettsia -specific ompA gene [19] , Borrelia miyamotoi -specific 16S rRNA gene19 [20] ,and Borrelia burgdorferi -specific 5S-23S rRNA gene [21] . PCR products were detected by 1% agarose gel electrophoresis. The target amplicons were sent to Beijing Tianyi Huiyuan Biotechnology Co., LTD, for sequencing. The sequences obtained were compared using the online BLAST software in NCBI. The β -tubulin gene of B. venatorum was also amplified with the primers BabtubF 5'- ACTGGAGCGCGTTGATGTGTTCT -3' and BabtubR 5'- GCCTTCGGTGTAGTG TCCCTTGG -3', designed according to the reference gene (KX827595). Meanwhile, the full-length 18S rRNA gene of B. venatorum was amplified with semi-nested PCR by the out primers babe16s-1F (5'- GCCA GTAGTCATATGCTTGTCTTAA -3') and babe16s-1666R (5'- CTCCTTC CTTTAAGTGATAAGGTTC-3'), and the inner primers babe16s-916R (5'- GGTATCTGATCG TCTTCGATCCCCT -3') and babe16s-730F (5'- TTTGGTTCTATTTTGTT GGTTTTTG -3'), respectively, designed according to the reference genes LC005775 and KU204792. The sequence of the two amplicons obtained from the second PCR was spliced using CLC software. The patient’s blood was then inoculated into six mice with severe combined immunodeficiency (SCID) through the caudal vein and the intraperitoneal cavity. Tail blood was collected every 3 days for blood smear Giemsa staining until the observation period of 27 days. Results Under the microscope with an oil-immersed lens, typical intraerythrocytic ring-form trophozoites, pyriform tetrads, and paired merozoites (Figure 2A-D) were discovered without any pigments, and the parasitemia level was calculated to be as high as 12000 parasites/μL in a blood smear on November 11, 2021. The PCR results were negative for tick-borne agents, except Babesia spp. (Figure 3A). The 373 bp sequences obtained preliminarily determined that the patient was infected with B. venatorum . A 199 bp β-tubulin gene amplicon was also obtained (Figure 3B). Two expected amplicons for the entire 18s-rRNA gene were also obtained (Figure 3C), and the nearly full-length 18S rRNA gene (1665bp, GenBank No. OP559478) was also recovered from humans infected with B.venatorum and had 99.82% similarity to those of B. venatorum isolated from ticks (GenBank No. LC005775) in Mongolia and human patients in Europe (AY046575) within the same clade after phylogenetic analysis (Figure 3D). Sequences of the β-tubulin gene (GenBank No. OP 522105) were first recovered from humans and were identical to those of B. venatorum isolated from ticks ( Ixodes persulcatus ) (GenBank No. KX827595) (Figure 3E). Red blood cells infected with Babesia were observed in blood smears from inoculated SCID mice on days 3, 6, and 12 (Figure 2E, F). Finally, human babesiosis was diagnosed according to the recommended laboratory criteria sponsored by the United States CDC [9] . Discussion And Conclusion We confirmed a case of human babesiosis from Inner Mongolia according to the guidelines on the diagnosis and management of babesiosis [9] , and the first obtained entire 18s-rRNA and β-tubulin protein genes from a patient infected with B. venatorum in China . Moreover, to our knowledge, this is the first successful practice of doxycycline monotherapy in human babesiosis, providing an alternative therapeutic strategy with clinical trials and useful anti-babesial chemicals. Doxycycline has previously been reported to have satisfactory prophylactic effects against experimental infection with a highly pathogenic strain of B. canis . However, it is not recommended for the initial treatment of Babesia infection, even when the parasite is doxycycline-sensitive, because the antiparasite effect of doxycycline is delayed [22] . It is typically combined with other drugs for the treatment of babesiosis. In the present case of human babesiosis, the patient maintained a normal body temperature and health status from the time that chemical therapy was stopped until the final follow-up visit. An epidemiological survey on possible infection routes did not produce definitive results, similar to previous cases of human babesiosis. As we know, Babesia spp. are transmitted most frequently by Ixodes spp. ticks. Babesia protozoan infections may also occur mechanically by blood transfusion [25] . As no definitive tick bites were recorded, the possible infection caused by his previous blood transfusion surgery should not be expelled. Cases of human babesiosis relevant to blood transfusion have been documented since the 1980s for Babesia microti and in 1994 for B. duncanci [25] . The incubation period of the Babesia species ranged from 23 to 384 days when transmitted by blood transfusion way [26] . Notably, B. venatorum human babesiosis case had never been reported caused by blood transfusions or other relevant operations. Our human babesiosis case remained undiagnosed till to 8 years since his splenectomy surgery and blood transfusions had to be implemented due to traffic accident. B. venatorum exceeds beyond the limitation of incubation period, as possible recrudescence might occur, especially in his asymptomatic period. Fortunately, our clinical practice on the monotherapy of human babesiosis was achieved successfully. The reasonable explanations attributed to the inhibition activities of doxycycline on the protein synthesis of apicoplast of the parasites. Since both Babesia and Plasmodium parasites replicate inside the erythrocytes of the mammalian host, the apicoplast, a special organelle required to invade host erythrocytes, might serve as a candidate target for anti-parasites chemicals. To inhibit protein synthesis in apicoplasts, future trials should address potential anti-babesial chemicals, such as tetracyclines (tetracycline, doxycycline, and minocycline), macrolides (spiramycin, azithromycin), and lincosamides (lincomycin, clindamycin, pirlimycin, and chloramphenicol) [27] . In 1996, the prophylactic treatment of experimental canine babesiosis ( B. canis ) with doxycycline was achieved with satisfied efficacy [23] . Another option is an alternative combination therapy regime that works well with metronidazole, clindamycin, and doxycycline for B. gibsoni (Asian genotype) infection in dogs in Hong Kong [24] . Doxycycline, a tetracycline antibiotic, is widely used to treat various pathogens, such as a 10-day course of oral doxycycline for the treatment of human granulocytic anaplasmosis, 14-day course of oral doxycycline for the treatment of early neurologic Lyme disease, and 6-week course of oral doxycycline plus rifampicin for the treatment of acute brucellosis [28, 29] . Currently, there is no standard course of treatment due to the lack of medical records of doxycycline monotherapy for Babesia infection. During the treatment of this case, we used doxycycline monotherapy for a total of 90 days to prevent recrudescence and found no adverse reactions related to doxycycline based on the patient’s health status and laboratory tests. This implies that doxycycline monotherapy for human infection with B. venatorum is safe for up to 90 days. Human babesiosis is rarely reported in China. However, the actual number of infected individuals may be significantly higher. Meanwhile, many infected individuals may be asymptomatic, such as blood product donors for this patient. However, most doctors and laboratory personnel in China do not understand human babesiosis, making it easy to miss the diagnosis. Similarly to the diagnosis in this patient, laboratory personnel missed the protozoa when they checked the blood smear on November 11. Furthermore, due to insufficient awareness of the disease, first-line drugs for human babesiosis are scarce in China; therefore, doxycycline monotherapy should continue. In summary, our clinical practice on human babesiosis caused by B. venatorum strongly suggests that doxycycline could be an alternative chemical to combat natural Babesia protozoan infection in the future. However, it is necessary to expand the sample size and set up controls in future studies to further clarify the efficacy and duration of doxycycline monotherapy. Declarations Ethics approval and consent to participate This research was carried out according to the principles of the Declaration of Helsinki and was approved by the Ethics Committees of the Fifth Medical Center of Chinese PLA General Hospital (No.KY-2022-6-44-2). Written informed consent was obtained from the patient. Consent for publication Written informed consent for publication of the clinical details was obtained from the patient. Availability of data and material All data generated or analysed relating to this study are presented within this published article. Competing interests The authors declare that they have no competing interests. Funding This study was funded by the State Key Research Development Program of China (2019YFC1200501), National Natural Science Foundation of China(81772185), and National Key R&D Program of China（2021YFC2301801, 2022YFC2304405）. Authors’ contributors J-FJ, F-SW, W-CC and LH designed the study. LH, D-DH, J-F J, YS and MX did the main statistical analysis, and wrote the paper. D-DH, NY, WH, W-MN, YL, H-CM, XZ and Y-GL, recruited the patients and gathered the data. MX, L-YX, NY, WH, LH, M-ZZ, D-YZ and YL did the laboratory tests. D-DH, R-HL, X-AH and J-YW did the statistical analysis. All authors contributed to the review and revision of the paper. Acknowledgements The authors would like to acknowledge all staffs of the Senior Department of Infectious Diseases, The Fifth Medical Center of Chinese PLA General Hospital. References Vannier E, Krause PJ. Human babesiosis. N Engl J Med 2012; 366:2397–407. Krause PJ, Auwaerter PG, Bannuru RR, et al. Clinical Practice Guidelines by the Infectious Diseases Society of America (IDSA): 2020 Guideline on Diagnosis and Management of Babesiosis. Clin Infect Dis 2021; 27;72(2):e49-e64. Babesiosis surveillance - 18 States, 2011. MMWR Morbidity and mortality weekly report. 2012; 61(27); 505–9. Gray EB, Herwaldt BL. Babesiosis surveillance - United States, 2011–2015. MMWR Surveill Summ 2019; 68:1–11. Bajer A, Dwużnik-Szarek D. The specificity of Babesia-tick vector interactions: recent advances and pitfalls in molecular and field studies. Parasit Vectors 2021; 14: 507. Zintl A, Mulcahy G, Skerrett HE, Taylor SM, Gray JS. Babesia divergens, a bovine blood parasite of veterinary and zoonotic importance. Clin Microbiol Rev 2003; 16:622–36. Jiang JF, Zheng YC, Jiang RR, et al. Epidemiological, clinical, and laboratory characteristics of 48 cases of “Babesia venatorum” infection in China: a descriptive study. Lancet Infect Dis 2015; 15:196–203. Shih CM, Liu LP, Chung WC, Ong SJ, Wang CC. Human babesiosis in Taiwan: asymptomatic infection with a Babesia microti-like organism in a Taiwanese woman. J Clin Microbiol 1997; 35:450–4. Jia N, Zheng YC, Jiang JF, et al. Human babesiosis caused by a Babesia crassa-like pathogen: a case series. Clin Infect Dis 2018; 67:1110–9. Herwaldt BL, Cacciò S, Gherlinzoni F, et al. Molecular characterization of a non-Babesia divergens organism causing zoonotic babesiosis in Europe. Emerg Infect Dis 2003, 9: 942-8. Bajer A, Dwużnik-Szarek D. The specificity of Babesia-tick vector interactions: recent advances and pitfalls in molecular and field studies. Parasit Vectors 2021; 14: 507. Kumar A, O'Bryan J, Krause PJ. The Global Emergence of Human Babesiosis. Pathogens 2021;10:1447. Woodland J G, Hunter R, Smith PJ, et al. Shining new light on ancient drugs: Preparation and subcellular localisation of novel flfluorescent analogues of Cinchona alkaloids in intraerythrocytic Plasmodium falciparum. Org Biomol Chem 2017; 15: 589–597. Woodland J G, Hunter R, Smith P J, et al. Chemical Proteomics and Super-resolution Imaging Reveal That Chloroquine Interacts with Plasmodium falciparum Multidrug Resistance-Associated Protein and Lipids. ACS Chem Biol 2018; 13: 2939–2948 Lawres LA, Garg A, Kumar V, et al. Radical cure of experimental babesiosis in immunodefificient mice using a combination of an endochin-like quinolone and atovaquone. J Exp Med 2016; 213: 1307–1318. Montazeri M, Mehrzadi S, Sharif M, , et al. Activities of anti-Toxoplasma drugs and compounds against tissue cysts in the last three decades (1987 to 2017), a systematic review. Parasitol Res 2018; 117: 3045–3057. Vaidya AB, Mather MW. Atovaquone resistance in malaria parasites. Drug Resist Updates 2000; 3: 283–287. Wen B, Jian R, Zhang Y, et al. Simultaneous detection of Anaplasma marginale and a new Ehrlichia species closely related to Ehrlichia chaffeensis by sequence analyses of 16S ribosomal DNA in Boophilus microplus ticks from Tibet. J Clin Microbiol 2002; 40: 3286-90. Parola P, Paddock C D, Socolovschi C, et al. Update on tick-borne rickettsioses around the world: a geographic approach. Clin Microbiol Rev 2013; 26(4): 657-702. Platonov A E, Karan L S, Kolyasnikova N M, et al. Humans infected with relapsing fever spirochete Borrelia miyamotoi, Russia. Emerg Infect Dis 2011;17: 1816-23. Chu C Y, Jiang B G, Liu W, et al. Presence of pathogenic Borrelia burgdorferi sensu lato in ticks and rodents in Zhejiang, south-east China. J Med Microbiol 2008; 57: 980-5. Dahl E L, Shock J L, Shenai B R, et al. Tetracyclines specifically target the apicoplast of the malaria parasite Plasmodium falciparum. Antimicrob Agents Chemother 2006; 50:3124-31. Vercammen F, De Deken R, Maes L. Prophylactic treatment of experimental canine babesiosis (Babesia canis) with doxycycline. Vet Parasitol 1996;66:251-55. Almendros A, Burchell R, Wierenga J. An alternative combination therapy with metronidazole, clindamycin and doxycycline for Babesia gibsoni (Asian genotype) in dogs in Hong Kong. J Vet Med Sci 2020;82:1334-40. Herwaldt BL, Linden JV, Bosserman E, Young C, Olkowska D, Wilson M. transfusion-associated babesiosis in the United States: a description of cases. Ann Intern Med 2011; 155:509–19. Tonnetti L, Eder AF, Dy B, et al. Transfusion-transmitted Babesia microti identified through hemovigilance. Transfusion 2009; 49:2557–63. Wiesner J, Seeber F. The plastid-derived organelle of protozoan human parasites as a target of established and emerging drugs. Expert Opin Ther Targets 2005; 9: 23-44. Sanchez E, Vannier E, Wormser GP, Hu LT. Diagnosis, Treatment, and Prevention of Lyme Disease, Human Granulocytic Anaplasmosis, and Babesiosis: A Review. JAMA 2016 Apr 26;315(16):1767-77. Al-Tawfiq JA, Memish ZA. Antibiotic susceptibility and treatment of brucellosis. Recent Pat Antiinfect Drug Discov 2013 Apr;8(1):51-54. Supplementary Files SupplementaryFigureS1TableS1S2S3.docx graphicabstract.jpg Cite Share Download PDF Status: Published Journal Publication published 12 Jul, 2023 Read the published version in Infectious Diseases of Poverty → Version 1 posted Editorial decision: Major revision 15 Apr, 2023 Reviewers invited by journal 06 Apr, 2023 Reviewers agreed at journal 30 Mar, 2023 Editor assigned by journal 29 Mar, 2023 First submitted to journal 28 Mar, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-2735617\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":187962538,\"identity\":\"4225baa0-832a-40d5-b5d7-f02ee89d70e3\",\"order_by\":0,\"name\":\"Lei Huang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Senior Department of Infectious Diseases, The Fifth Medical Center of Chinese PLA General Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Lei\",\"middleName\":\"\",\"lastName\":\"Huang\",\"suffix\":\"\"},{\"id\":187962539,\"identity\":\"67b4bf0e-3391-45cf-a058-26dda2166592\",\"order_by\":1,\"name\":\"Dan-Dan Huo\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Senior Department of Infectious Diseases, The Fifth Medical Center of Chinese PLA General Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dan-Dan\",\"middleName\":\"\",\"lastName\":\"Huo\",\"suffix\":\"\"},{\"id\":187962540,\"identity\":\"a526ac80-f0e6-4091-a97e-aa3e5987ab3d\",\"order_by\":2,\"name\":\"Ming Xu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ming\",\"middleName\":\"\",\"lastName\":\"Xu\",\"suffix\":\"\"},{\"id\":187962541,\"identity\":\"953f3180-4678-44bc-b4a5-87bc49dec7ab\",\"order_by\":3,\"name\":\"Luo-Yuan Xia\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Luo-Yuan\",\"middleName\":\"\",\"lastName\":\"Xia\",\"suffix\":\"\"},{\"id\":187962542,\"identity\":\"58ad9d1e-32df-499e-af5c-60c00efbb686\",\"order_by\":4,\"name\":\"Ning Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Center for Clinical Laboratory, The Fifth Medical Center of Chinese PLA General Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ning\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":187962543,\"identity\":\"a4f5d28d-4666-4d07-a74e-e6221a3621d7\",\"order_by\":5,\"name\":\"Hong Wei\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Center for Clinical Laboratory, The Fifth Medical Center of Chinese PLA General Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hong\",\"middleName\":\"\",\"lastName\":\"Wei\",\"suffix\":\"\"},{\"id\":187962544,\"identity\":\"76d2e4d3-a86c-4c9a-aa71-25c1318ce48b\",\"order_by\":6,\"name\":\"Ling Huang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ling\",\"middleName\":\"\",\"lastName\":\"Huang\",\"suffix\":\"\"},{\"id\":187962545,\"identity\":\"8732ef46-6e73-4254-b569-f3db9abbc796\",\"order_by\":7,\"name\":\"Wei-Min Nie\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Senior Department of Infectious Diseases, The Fifth Medical Center of Chinese PLA General Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Wei-Min\",\"middleName\":\"\",\"lastName\":\"Nie\",\"suffix\":\"\"},{\"id\":187962546,\"identity\":\"efabef0e-fec6-4299-8e74-a2bf88755f41\",\"order_by\":8,\"name\":\"Ru-He Liao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ru-He\",\"middleName\":\"\",\"lastName\":\"Liao\",\"suffix\":\"\"},{\"id\":187962547,\"identity\":\"dfb2f251-8c56-4a14-9153-024e07cbab65\",\"order_by\":9,\"name\":\"Ming-Zhu Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ming-Zhu\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":187962548,\"identity\":\"5c3d2555-8e20-4140-a6fb-bfb3c5390269\",\"order_by\":10,\"name\":\"Dai-Yun Zhu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dai-Yun\",\"middleName\":\"\",\"lastName\":\"Zhu\",\"suffix\":\"\"},{\"id\":187962549,\"identity\":\"1c54e5ff-e89c-4e07-965c-d5d5e4ca1a38\",\"order_by\":11,\"name\":\"Yan Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Center for Clinical Laboratory, The Fifth Medical Center of Chinese PLA General Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yan\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":187962550,\"identity\":\"15e1d89c-3b53-4cff-9f6b-6476cd0bf1e6\",\"order_by\":12,\"name\":\"He-Cheng Ma\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Senior Department of Infectious Diseases, The Fifth Medical Center of Chinese PLA General Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"He-Cheng\",\"middleName\":\"\",\"lastName\":\"Ma\",\"suffix\":\"\"},{\"id\":187962551,\"identity\":\"eca399e4-35e7-41c5-8aa2-8fe3aab15f31\",\"order_by\":13,\"name\":\"Xin Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Senior Department of Infectious Diseases, The Fifth Medical Center of Chinese PLA General Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xin\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":187962552,\"identity\":\"be11bfa5-5592-485f-82e6-20286b4a78c4\",\"order_by\":14,\"name\":\"Yong-Gang Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Senior Department of Infectious Diseases, The Fifth Medical Center of Chinese PLA General Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yong-Gang\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":187962553,\"identity\":\"c82b747b-a59b-4c2c-8f3f-d70e4cfef3da\",\"order_by\":15,\"name\":\"Xin-An Huang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Artemisinin Research Center, Guangzhou University of Chinese Medicine\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xin-An\",\"middleName\":\"\",\"lastName\":\"Huang\",\"suffix\":\"\"},{\"id\":187962554,\"identity\":\"98e38da5-d8e0-4cfc-ba01-94c4964263d1\",\"order_by\":16,\"name\":\"Jing-Yuan Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Inner Mongolia Medical University, Hohhot\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jing-Yuan\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":187962555,\"identity\":\"1329f5a1-e7ac-40ac-b9fb-7571280a2bf7\",\"order_by\":17,\"name\":\"Wu-Chun Cao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Wu-Chun\",\"middleName\":\"\",\"lastName\":\"Cao\",\"suffix\":\"\"},{\"id\":187962556,\"identity\":\"b2a22532-f57b-411b-9663-3da0eb92cd6f\",\"order_by\":18,\"name\":\"Yi Sun\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yi\",\"middleName\":\"\",\"lastName\":\"Sun\",\"suffix\":\"\"},{\"id\":187962557,\"identity\":\"5a51f658-90d3-4900-a23f-bd0346e9d494\",\"order_by\":19,\"name\":\"Fu-Sheng Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Senior Department of Infectious Diseases, The Fifth Medical Center of Chinese PLA General Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Fu-Sheng\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":187962558,\"identity\":\"5515d825-464e-411a-8b4d-b1aeece09db6\",\"order_by\":20,\"name\":\"Jia-Fu Jiang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIiWNgGAWjYBACxmYQySMnx8bMfPBBwg8borUYG/OztyUbPOxJI9oy48SZPWfMJB+wHSaslrmd+dnDLzIGjBtupKVVJPAcZuBv704g4DA2c2MZHgNmgxvJx24kWKQzSJw5u4GQX8ykJXj+sBkAbbmRwGPNYCCRS0gL+zegFgMegxs5ZgUJbMzEaOExk/zAYyAhCfQ+QwKbM1FayqQZeAwMQIEskdiTxkPQL4b9x7dJ/uwxqG8DRuXHHz9s5PjbewloaQAGNG8PQoAHr3IQkAc57scPgupGwSgYBaNgJAMADaJEbfFXvOcAAAAASUVORK5CYII=\",\"orcid\":\"https://orcid.org/0000-0003-2624-7450\",\"institution\":\"Academy of Military Medical Sciences Institute of Microbiology and Epidemiology\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jia-Fu\",\"middleName\":\"\",\"lastName\":\"Jiang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2023-03-25 13:25:30\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-2735617/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-2735617/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1186/s40249-023-01111-1\",\"type\":\"published\",\"date\":\"2023-07-13T01:08:20+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":35229708,\"identity\":\"11092e52-8231-42d7-936a-6e5f9b4e9c2d\",\"added_by\":\"auto\",\"created_at\":\"2023-04-03 20:40:47\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":525961,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eTimeline of doxycycline monotherapy for the patient infected with \\u003cem\\u003eBabesia venatorum\\u003c/em\\u003e (Babesiidae, Sporozoa)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2735617/v1/7c082ce36bafb477301a54ff.png\"},{\"id\":35229713,\"identity\":\"f5e7bff7-0024-4052-8334-7eabd25f90cb\",\"added_by\":\"auto\",\"created_at\":\"2023-04-03 20:40:48\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":13141989,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePhotomicrographs of red cells infected with babesia on a thin peripheral blood smear of the patient and inoculated with severe combined immunodeficiency (SCID) mice\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Giemsa-stained blood smear of the patient on day 21 after the onset of the disease showing the characteristic \\u003cem\\u003eBabesia \\u003c/em\\u003etetrads (short triangular arrow). (B) The Giemsa-stained blood smear of the patient shows an intracellular ring-shaped form suggestive of \\u003cem\\u003eBabesia\\u003c/em\\u003e (long arrow). (C) Giemsa-stained blood smear of the patient showing the \\u003cem\\u003eBabesia \\u003c/em\\u003eparasites free from the red cell (short triangular arrow). (D) Giemsa-stained blood smear of the patient showing the schizont form of \\u003cem\\u003eB. venatorum\\u003c/em\\u003e (tail pinnate arrow). (E) Giemsa-stained blood smear of SCID mice 3 days after caudal vein inoculation of infected blood from the patient. (F) Giemsa-stained blood smear from SCID mice6 days after caudal vein inoculation of infected blood from the patient (long arrow).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2735617/v1/e3b326ef572846f6cbc03934.png\"},{\"id\":35229711,\"identity\":\"48b9f9ab-1304-4e5f-b0b7-9f3ddd223469\",\"added_by\":\"auto\",\"created_at\":\"2023-04-03 20:40:48\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":968154,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eMolecular biological identification for the patient from Inner Mongolia, China\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Electrophoresis of the partial18S rRNA target gene of Babesia from human whole blood (Lanes 1-3); (B) Electrophoresis of the amplicon of a β-tubulin gene of \\u003cem\\u003eBabesia venatorum\\u003c/em\\u003e from human whole blood (Lanes 1-2); (C) Electrophoresis of two amplicons for splicing of entire 18S rRNA gene from \\u003cem\\u003eBabesia venatorum\\u003c/em\\u003e; (D) Phylogenetic analysis of NM01 strain and other members of the family Piroplasma based on nearly entire 18S rRNA gene sequences, inferred using the use of the maximum likelihood method and bootstrap analysis of 1000 replicates to assess the reliability of the reconstructed phylogenies. (E) Comparison analysis of the 199 base-pair nucleotide sequence alignment of babesia β-tubulin gene.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2735617/v1/b561f6d019d055097f701e0d.png\"},{\"id\":35230566,\"identity\":\"18773283-9441-4cec-a9b4-716784dfd708\",\"added_by\":\"auto\",\"created_at\":\"2023-04-03 20:48:48\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":298100,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe dynamic change of the patient’s temperature and Babesia spp. protozoa count with the administration of doxycycline monotherapy\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2735617/v1/f53189b9146507981a1985d1.png\"},{\"id\":41736824,\"identity\":\"6b382f06-9bab-4ce0-8ba5-15627a8e7b47\",\"added_by\":\"auto\",\"created_at\":\"2023-08-18 04:13:02\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":3521345,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2735617/v1/21082531-6084-4d0a-b190-31b2c393823f.pdf\"},{\"id\":35229709,\"identity\":\"a97abe79-59a5-440e-8d58-a33fed59e9e4\",\"added_by\":\"auto\",\"created_at\":\"2023-04-03 20:40:47\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":54102,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryFigureS1TableS1S2S3.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2735617/v1/a1e0639be7907d5dff7e1fde.docx\"},{\"id\":35229710,\"identity\":\"092d7844-5b24-498f-8f06-86f08f4b5092\",\"added_by\":\"auto\",\"created_at\":\"2023-04-03 20:40:47\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":625078,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"graphicabstract.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2735617/v1/7a2850c7c2748a3daed3c219.jpg\"}],\"financialInterests\":\"\",\"formattedTitle\":\"Successful treatment with doxycycline monotherapy for human infection with Babesia venatorum (Babesiidae, Sporozoa) in China: a case report and clinic regimen\",\"fulltext\":[{\"header\":\"Background\",\"content\":\"\\u003cp\\u003eHuman babesiosis is a zoonotic disease caused by\\u0026nbsp;an intraerythrocytic protozoan of the genus \\u003cem\\u003eBabesia,\\u003c/em\\u003e parasitic in the red blood cells of mammals,\\u0026nbsp;and\\u0026nbsp;is\\u0026nbsp;transmitted mainly by tick bites and blood transfusions\\u0026nbsp;\\u003csup\\u003e[1]\\u003c/sup\\u003e. Currently, more than 100 species of \\u003cem\\u003eBabesia\\u003c/em\\u003e are recognized\\u0026nbsp;as pathogenic to various wild and domestic animal\\u0026nbsp;hosts, including humans\\u003csup\\u003e\\u0026nbsp;[2]\\u003c/sup\\u003e. Since the first case of human babesiosis\\u0026nbsp;was reported in 1957in a Croatian farmer\\u0026nbsp;who underwent splenectomy (formerly Yugoslavia)\\u0026nbsp;\\u003csup\\u003e[1]\\u003c/sup\\u003e, cases of human babesiosis\\u0026nbsp;have increased dramatically, especially in the\\u0026nbsp;Northern Hemisphere. In the United States alone, the annual cumulative number of\\u0026nbsp;cases of\\u0026nbsp;human babesiosis\\u0026nbsp;was estimated to range from 20,000 to 24,000 between 2006 and 2018 and\\u0026nbsp;is recommended as a notifiable infectious disease\\u0026nbsp;secondary to Lyme disease \\u003csup\\u003e[3,4]\\u003c/sup\\u003e. In China, several\\u0026nbsp;\\u003cem\\u003eBabesia\\u0026nbsp;\\u003c/em\\u003especies\\u0026nbsp;have been recorded in more than 125 human victims\\u0026nbsp;\\u003csup\\u003e[5]\\u003c/sup\\u003e,\\u0026nbsp;including\\u0026nbsp;\\u003cem\\u003eBabesia\\u003c/em\\u003e\\u003cem\\u003e\\u0026nbsp;divergens\\u0026nbsp;\\u003c/em\\u003e\\u003csup\\u003e[6]\\u003c/sup\\u003e\\u003cem\\u003e,\\u003c/em\\u003e \\u003cem\\u003eBabesia\\u003c/em\\u003e\\u003cem\\u003e\\u0026nbsp;venatorum\\u0026nbsp;\\u003c/em\\u003e\\u003csup\\u003e[7]\\u003c/sup\\u003e\\u003cem\\u003e,\\u003c/em\\u003e\\u003cem\\u003eBabesia\\u003c/em\\u003e\\u003cem\\u003e\\u0026nbsp;microti\\u0026nbsp;\\u003c/em\\u003e\\u003csup\\u003e[8]\\u003c/sup\\u003e, and\\u0026nbsp;\\u003cem\\u003eBabesia\\u003c/em\\u003e\\u003cem\\u003e\\u0026nbsp;crassa-\\u003c/em\\u003elike pathogens\\u003csup\\u003e[9]\\u003c/sup\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eB. venatorum\\u003c/em\\u003e, also known\\u0026nbsp;as \\u003cem\\u003eBabesia\\u003c/em\\u003e sp.\\u0026nbsp;EU1\\u0026nbsp;\\u003csup\\u003e[10]\\u003c/sup\\u003e,\\u0026nbsp;was named after the Latin word for Austrian and Italian\\u0026nbsp;asplenic\\u0026nbsp;hunters,\\u0026nbsp;who had a history of exposure to positive infected ticks and\\u0026nbsp;acquired infections of \\u003cem\\u003eBabesia\\u003c/em\\u003e species during their hunts. Since then, protozoan species\\u0026nbsp;have been documented to naturally infect the host roe deer\\u0026nbsp;\\u003cem\\u003eCapreolus capreolus\\u0026nbsp;\\u003c/em\\u003eand\\u0026nbsp;the vector species\\u0026nbsp;\\u003cem\\u003eIxodes ricinus\\u003c/em\\u003eand \\u003cem\\u003eI. persulcatus\\u003c/em\\u003e\\u003csup\\u003e\\u0026nbsp;[11, 12]\\u003c/sup\\u003e. In an epidemiological survey of Chinese victims, 48 human cases of \\u003cem\\u003eB. venatorum\\u003c/em\\u003e have also been reported in endemic areas of northeast China, most of which were underestimated due to\\u0026nbsp;their asymptotic appearance\\u003csup\\u003e\\u0026nbsp;[7]\\u003c/sup\\u003e. Therefore, human infections with \\u003cem\\u003eB. venatorum\\u003c/em\\u003e tend to be ignored. More etiological characteristics and perfect regimens against infections are urgently\\u0026nbsp;needed for clinical development and practice. \\u0026nbsp;\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eIn this study, a patient who experienced unexplained febrile symptoms sought\\u0026nbsp;medical services at our hospital. Through morphological microscopic examination and\\u0026nbsp;multi-gene PCR amplification, it was determined that the patient was infected with \\u003cem\\u003eB. venatorum,\\u0026nbsp;\\u003c/em\\u003eand proper treatment with sensitive doxycycline was performed.\\u003c/p\\u003e\\n\\u003cp\\u003eCurrently, three generations of anti-babesial drugs\\u0026nbsp;have been approved for clinical administration.\\u0026nbsp;Quinine, a traditional drug against \\u003cem\\u003eBabesia\\u003c/em\\u003e and \\u003cem\\u003ePlasmodium\\u003c/em\\u003e species,\\u0026nbsp;inhibits hemozoin biocrystallization in the heme detoxification pathway, which facilitates the aggregation of cytotoxic heme and results in parasite death \\u003csup\\u003e[13,14]\\u003c/sup\\u003e. As a unique naphthoquinone with broad-spectrum antiprotozoal activity, atovaquone has activity against susceptible parasites, inhibiting the mitochondrial electron-transport chain at the site of the cytochrome bc1 complex (complex III) and ultimately blocking the synthesis of nucleic acids and ATP\\u0026nbsp;\\u003csup\\u003e[15-17]\\u003c/sup\\u003e. According to the 2020 Guidelines on Diagnosis and Management of Babesiosis sponsored by\\u0026nbsp;the United States CDC \\u003csup\\u003e[2]\\u003c/sup\\u003e, it is commonly recommended for human babesiosis to\\u0026nbsp;be treated with quinine plus clindamycin, atovaquone plus azithromycin, or a combination of quinine, clindamycin, and atovaquone, since azithromycin and its relevant clindamycin are\\u0026nbsp;protein synthesis inhibitors of\\u0026nbsp;apicoplast in apicomplexan parasites\\u003csup\\u003e\\u0026nbsp;[18-20]\\u003c/sup\\u003e. Furthermore,\\u0026nbsp;doxycycline, a broad-spectrum tetracycline-class antibiotic, is used to treat malaria in combination with quinine by killing erythrocytic-stage parasites that target the apicoplast, a plastid organelle\\u003csup\\u003e\\u0026nbsp;[21]\\u003c/sup\\u003e. Few attempts have been made to achieve the anti-babesial effects of doxycycline in limited experiment animals\\u0026nbsp;\\u003csup\\u003e[22]\\u003c/sup\\u003e. However, to date, no trials have been conducted on human victims suffering from \\u003cem\\u003eBabesia\\u003c/em\\u003e infection.\\u003c/p\\u003e\"},{\"header\":\"Case Presentation\",\"content\":\"\\u003cp\\u003eA 73-year-old male underwent a splenectomy from a traffic accident in 2014, and a blood transfusion was performed during the surgery. He had no chronic diseases, and no drug, alcohol abuse, or food allergies were recorded. The patient had quit\\u0026nbsp;smoking 10 years ago and lived with his family in an urban area of Hulunbuir Grassland (E115°31’–126°04’, and N 47°05’-53°20’) Inner Mongolia Autonomous Region, China, without a positive family medical history.\\u003c/p\\u003e\\n\\u003cp\\u003eThe patient developed fever with a maximum body temperature of 39 °C on October\\u0026nbsp;22, 2021,\\u0026nbsp;defined as the first\\u0026nbsp;day of the onset of the disease (Figure 1). Headaches, nausea, and vomiting\\u0026nbsp;remained for several days. On 26 October, the patient was admitted to the local hospital, where he received a systematic examination and standard laboratory tests, including blood cultures (repeated five times) and bone marrow tests and culture, while administered antibacterial treatment, including cefoperazone sodium, ornidazole meropenem, etc. over the following time (Supplementary Figure S1). No relevant signs\\u0026nbsp;were found, except for a few abnormal biochemical tests, including thrombocytopenia (34 × 10\\u003csup\\u003e9\\u0026nbsp;\\u003c/sup\\u003e/L), increased C-reactive protein (88.1\\u0026nbsp;mg/L), and weakly positive tuberculosis-interferon gamma release assay (TB-SPOT). However, the patient’s condition did not improve. On November 9, 2021, the patient was transferred to the Fifth Medical Center of the PLA General Hospital\\u0026nbsp;in Beijing due to uncontrolled body temperature (previous statement: loss of fever remission and reliance on indometacin suppository twice daily to control). After admission, a detailed physical examination revealed no positive signs, except for abdominal surgical scars. Assays for 11 pathogenic bacteria and two viruses (Supplementary Table S1) were performed in\\u0026nbsp;the hospital\\u0026nbsp;and all results were negative. Therefore, we ruled out common bacterial and viral infections in this patient. Meanwhile, the erythrocyte sedimentation rate, pure protein derivative test, and computed tomography (CT) of\\u0026nbsp;the lung also did not indicate\\u0026nbsp;TB infection in the patient. Fortunately, thrombocytopenia (31\\u0026nbsp;×\\u0026nbsp;10\\u003csup\\u003e9\\u003c/sup\\u003e/L) and extremely high ferritin\\u0026nbsp;levels (\\u0026gt;2000 ng/ml)\\u0026nbsp;were observed\\u0026nbsp;and a tentative\\u0026nbsp;suspicion of hematological disorder or malignant tumor bone metastases was made. To validate our suspicion,\\u0026nbsp;a thin smear of the peripheral blood sample was made and observed under a microscope\\u0026nbsp;with\\u0026nbsp;an oil-immersed lens on\\u0026nbsp;November 11, 2021. However, the clinical\\u0026nbsp;laboratory in our hospital\\u0026nbsp;did not report definitive positive results. We empirically used doxycycline monotherapy (po 0.1\\u0026nbsp;g Bid) to treat some undetectable pathogens,\\u0026nbsp;as the patient’s symptoms were persistently unrelieved, and conventional anti-infective therapy was ineffective. During the first 2 days of doxycycline administration, the patient’s body temperature gradually decreased, and\\u0026nbsp;the symptoms resolved.\\u0026nbsp;We delivered the blood sample on November 11 to\\u0026nbsp;the Beijing Institute of Microbiology and Epidemiology for\\u0026nbsp;further pathogen detection. On November 17, a laboratory specialist reported that \\u003cem\\u003eBabesia\\u003c/em\\u003e was found in blood smears on November 11 (Figure 2). To confirm the result, we collected the blood again on November 17 for smear observation and submitted\\u0026nbsp;it\\u0026nbsp;for PCR testing and sequencing. \\u003cem\\u003eBabesia\\u0026nbsp;\\u003c/em\\u003ewas also found in blood smears,\\u0026nbsp;and \\u003cem\\u003eBabesia venatrum\\u0026nbsp;\\u003c/em\\u003ewas identified. Additionally, PET-CT did not indicate any high metabolic lesions on November 13, and two bone marrow aspirations did not reveal any special abnormalities on November 11 and 23. Therefore, the patient was diagnosed with babesiosis.\\u003c/p\\u003e\\n\\u003cp\\u003eAccording to the recommendations of the United States CDC, we were engaged to treat the patient with atovaquone and quinine. However,\\u0026nbsp;emergency conscription for quinine and atovaquone is not available in China. As an alternative chemical, doxycycline has been shown to have sensitive antiparasitic activities by inhibiting the synthesis of apicoplast protein in \\u003cem\\u003ePlasmodium\\u003c/em\\u003e species and successfully\\u0026nbsp;treating \\u003cem\\u003eBabesia canis\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eBabesia gibsoni\\u003c/em\\u003e infection in dogs\\u0026nbsp;\\u003csup\\u003e[23, 24]\\u003c/sup\\u003e. Moreover, due to the use of doxycycline, the patient's clinical symptoms have gradually eased. Therefore, we continued the monotherapy practice of doxycycline (po, 0.1\\u0026nbsp;g Bid),\\u0026nbsp;followed by strict supervision and regular monitoring of parasite loads.\\u003c/p\\u003e\\n\\u003cp\\u003eAs expected, the patient recovered rapidly after doxycycline monotherapy; the babesia protozoan burden decreased dramatically from pretreated 12000/μL to 3840/μL (3 days, dpt), 2400/μL (5 dpt), and 1440/μL (8 dpt). Broken or fragmented\\u0026nbsp;merozoites were frequently recorded during the\\u0026nbsp;procedure of the regimen.\\u0026nbsp;Body temperature\\u0026nbsp;decreased after 2-day therapy, returned to normal after 7-day therapy, and then remained normal thereafter (Figure 4). However, the relevant manifestations disappeared\\u0026nbsp;(Supplementary Table S2). The patient was discharged\\u0026nbsp;on day 35 of the onset of the disease. Since then, a consecutive follow-up survey of the patient with\\u0026nbsp;a continuing course of doxycycline treatment was performed for\\u0026nbsp;90 days.\\u003c/p\\u003e\\n\\u003cp\\u003eThe patient was readmitted to the hospital for follow-up on February 11, 2022 and had no complaints.\\u0026nbsp;We performed a\\u0026nbsp;detailed systematic examination\\u0026nbsp;of the patient, but did not find abnormal signs. The same protocol was used to monitor the babesia burden on the patient. Both\\u0026nbsp;morphological observations\\u0026nbsp;and PCR were negative for\\u0026nbsp;whole blood collected at 117 days (Figure 1).\\u0026nbsp;Doxycycline-related side effects and sequelae, including erythema and hepatic inadequacy, have not been documented. In this case, the patient maintained his normal body temperature and health status from the time chemical therapy was stopped\\u0026nbsp;until\\u0026nbsp;the final follow-up visit on August 19, 2022\\u0026nbsp;(Figure 1 and Supplementary Table S3).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConfirmation on the infected patient\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eMorphological examination, PCR test and sequencing as well as parasitemia surveillance were used for the determination of the patient. A\\u0026nbsp;thin smear of the peripheral blood sample was made\\u0026nbsp;according to the conventional method, fixed with methanol solution, stained with 1% Gimsa solution for 30 min, and observed under\\u0026nbsp;a\\u0026nbsp;microscope with\\u0026nbsp;an oil-immersed lens. The number of protozoa and red blood cells was counted in each field. The density of\\u0026nbsp;protozoa was calculated\\u0026nbsp;as\\u0026nbsp;the number of\\u0026nbsp;protozoa per microliter of blood.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eWhole blood was screened by PCR for \\u003cem\\u003eBabesia\\u003c/em\\u003e and other tick-borne pathogens with primers\\u0026nbsp;for the \\u003cem\\u003eBabesia\\u003c/em\\u003e-specific 18S rRNA gene \\u003csup\\u003e[7]\\u003c/sup\\u003e, \\u003cem\\u003eAnaplasma\\u003c/em\\u003e-specific partial 16S rRNA gene \\u003csup\\u003e[18]\\u003c/sup\\u003e, \\u003cem\\u003eRickettsia\\u003c/em\\u003e-specific ompA gene \\u003csup\\u003e[19]\\u003c/sup\\u003e, \\u003cem\\u003eBorrelia miyamotoi\\u003c/em\\u003e-specific 16S rRNA gene19 \\u003csup\\u003e[20]\\u003c/sup\\u003e,and \\u003cem\\u003eBorrelia burgdorferi\\u003c/em\\u003e-specific 5S-23S rRNA gene \\u003csup\\u003e[21]\\u003c/sup\\u003e.\\u0026nbsp;PCR products were\\u0026nbsp;detected by 1% agarose gel electrophoresis.\\u0026nbsp;The target amplicons were sent to Beijing Tianyi Huiyuan Biotechnology Co., LTD, for sequencing. The sequences obtained were compared using the online BLAST software in NCBI. The \\u003cem\\u003eβ -tubulin\\u003c/em\\u003e gene of \\u003cem\\u003eB. venatorum\\u003c/em\\u003e was also amplified with the primers BabtubF 5'- ACTGGAGCGCGTTGATGTGTTCT -3' and BabtubR\\u0026nbsp;5'- GCCTTCGGTGTAGTG TCCCTTGG -3', designed according to the reference gene (KX827595). Meanwhile, the full-length 18S rRNA gene of \\u003cem\\u003eB. venatorum\\u003c/em\\u003e was amplified with semi-nested PCR by the out primers babe16s-1F (5'- GCCA GTAGTCATATGCTTGTCTTAA -3') and babe16s-1666R\\u0026nbsp;(5'- CTCCTTC CTTTAAGTGATAAGGTTC-3'), and the inner primers babe16s-916R (5'- GGTATCTGATCG TCTTCGATCCCCT -3') and babe16s-730F (5'- TTTGGTTCTATTTTGTT GGTTTTTG -3'), respectively, designed according to the reference genes LC005775 and KU204792. The sequence of the two amplicons obtained from the second PCR was spliced using CLC software. The patient’s blood was then inoculated into six mice with severe combined immunodeficiency (SCID) through the caudal vein and the intraperitoneal cavity. Tail blood was collected every 3 days for blood smear Giemsa staining until the observation period of 27 days.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003eUnder the microscope with an oil-immersed lens, typical intraerythrocytic ring-form trophozoites, pyriform tetrads, and paired merozoites (Figure 2A-D) were discovered without any pigments, and the parasitemia level was calculated to be as high as 12000 parasites/\\u0026mu;L in a blood smear on November 11, 2021. The PCR results were negative for tick-borne agents, except \\u003cem\\u003eBabesia\\u0026nbsp;\\u003c/em\\u003espp. (Figure 3A). The 373 bp sequences obtained preliminarily determined that the patient was infected with \\u003cem\\u003eB. venatorum\\u003c/em\\u003e. A 199 bp \\u003cem\\u003e\\u0026beta;-tubulin\\u003c/em\\u003e gene amplicon was also obtained (Figure 3B). Two expected amplicons for the entire 18s-rRNA gene were also obtained (Figure 3C), and the nearly full-length 18S rRNA gene (1665bp, GenBank No. OP559478) was also recovered from humans infected with\\u003cem\\u003e\\u0026nbsp;B.venatorum\\u0026nbsp;\\u003c/em\\u003eand had\\u0026nbsp;99.82% similarity to those of\\u0026nbsp;\\u003cem\\u003eB. venatorum\\u0026nbsp;\\u003c/em\\u003eisolated from ticks (GenBank No. LC005775) in Mongolia and human patients in Europe (AY046575) within the same clade after phylogenetic analysis (Figure 3D). Sequences of the \\u003cem\\u003e\\u0026beta;-tubulin\\u003c/em\\u003e gene (GenBank No.\\u0026nbsp;OP 522105) were first recovered from humans and were identical to those of \\u003cem\\u003eB. venatorum\\u003c/em\\u003e isolated from ticks (\\u003cem\\u003eIxodes persulcatus\\u003c/em\\u003e) (GenBank No. KX827595) (Figure 3E). Red blood cells infected with Babesia were observed in blood smears from inoculated SCID mice on days 3, 6, and 12 (Figure 2E, F). Finally, human babesiosis was diagnosed according to the recommended laboratory criteria sponsored by the United States CDC \\u003csup\\u003e[9]\\u003c/sup\\u003e.\\u003c/p\\u003e\"},{\"header\":\"Discussion And Conclusion\",\"content\":\"\\u003cp\\u003eWe confirmed a case of\\u0026nbsp;human babesiosis\\u0026nbsp;from Inner Mongolia according to the guidelines on the diagnosis and management of\\u0026nbsp;babesiosis \\u003csup\\u003e[9]\\u003c/sup\\u003e, and the first obtained entire 18s-rRNA and\\u0026nbsp;\\u0026beta;-tubulin protein genes from a patient infected with\\u0026nbsp;\\u003cem\\u003eB. venatorum\\u0026nbsp;\\u003c/em\\u003ein China\\u003cem\\u003e.\\u0026nbsp;\\u003c/em\\u003eMoreover, to our knowledge, this is the first successful practice of doxycycline monotherapy in human babesiosis, providing\\u0026nbsp;an alternative therapeutic strategy with clinical trials and useful\\u0026nbsp;anti-babesial chemicals.\\u003c/p\\u003e\\n\\u003cp\\u003eDoxycycline has previously been reported to have satisfactory prophylactic effects against experimental infection with a highly pathogenic strain of \\u003cem\\u003eB. canis\\u003c/em\\u003e. However, it is not recommended for\\u0026nbsp;the initial treatment of\\u0026nbsp;\\u003cem\\u003eBabesia\\u003c/em\\u003e infection, even when the parasite is doxycycline-sensitive, because the\\u0026nbsp;antiparasite\\u0026nbsp;effect of doxycycline is delayed \\u003csup\\u003e[22]\\u003c/sup\\u003e. It is typically combined with other drugs for the treatment of babesiosis. In the present\\u0026nbsp;case of human babesiosis, the patient maintained a normal body temperature and health status from the time that chemical therapy was stopped\\u0026nbsp;until\\u0026nbsp;the final follow-up visit.\\u003c/p\\u003e\\n\\u003cp\\u003eAn epidemiological survey on\\u0026nbsp;possible\\u0026nbsp;infection\\u0026nbsp;routes did not produce definitive results, similar to previous cases of human babesiosis. As we know,\\u0026nbsp;\\u003cem\\u003eBabesia\\u0026nbsp;\\u003c/em\\u003espp. are transmitted most frequently by \\u003cem\\u003eIxodes\\u0026nbsp;\\u003c/em\\u003espp. ticks. \\u003cem\\u003eBabesia\\u003c/em\\u003e protozoan\\u0026nbsp;infections may also occur mechanically by blood transfusion\\u003csup\\u003e\\u0026nbsp;[25]\\u003c/sup\\u003e. As no definitive tick bites\\u0026nbsp;were recorded, the possible infection caused by his previous blood transfusion surgery should not be expelled. Cases of human babesiosis relevant to blood transfusion have been documented since\\u0026nbsp;the 1980s for\\u0026nbsp;\\u003cem\\u003eBabesia microti\\u003c/em\\u003e and in 1994 for \\u003cem\\u003eB. duncanci\\u003c/em\\u003e \\u003csup\\u003e[25]\\u003c/sup\\u003e. The incubation period of the \\u003cem\\u003eBabesia\\u003c/em\\u003e species ranged from 23 to 384 days when transmitted by blood transfusion way \\u003csup\\u003e[26]\\u003c/sup\\u003e. Notably, \\u003cem\\u003eB. venatorum\\u003c/em\\u003e human babesiosis case had never been reported\\u0026nbsp;caused by blood transfusions or other relevant\\u0026nbsp;operations. Our human babesiosis case remained undiagnosed\\u0026nbsp;till to 8 years since his splenectomy surgery and blood transfusions had to be implemented due to\\u0026nbsp;traffic accident.\\u0026nbsp;\\u003cem\\u003eB. venatorum\\u003c/em\\u003e exceeds beyond the limitation of\\u0026nbsp;incubation period,\\u0026nbsp;as possible recrudescence might occur, especially\\u0026nbsp;in\\u0026nbsp;his asymptomatic period.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eFortunately, our clinical practice on the monotherapy of human babesiosis was achieved successfully.\\u0026nbsp;The reasonable explanations attributed to the inhibition activities of doxycycline on the protein synthesis of apicoplast of the parasites. Since both \\u003cem\\u003eBabesia\\u0026nbsp;\\u003c/em\\u003eand\\u003cem\\u003e\\u0026nbsp;Plasmodium\\u0026nbsp;\\u003c/em\\u003eparasites replicate inside the erythrocytes of the mammalian host, the apicoplast, a special organelle required to invade host erythrocytes, might serve as a candidate target for anti-parasites chemicals. To inhibit protein synthesis in apicoplasts, future trials should address potential anti-babesial chemicals, such as tetracyclines (tetracycline, doxycycline,\\u0026nbsp;and minocycline), macrolides (spiramycin, azithromycin),\\u0026nbsp;and\\u0026nbsp;lincosamides (lincomycin, clindamycin, pirlimycin, and chloramphenicol)\\u0026nbsp;\\u003csup\\u003e[27]\\u003c/sup\\u003e. In 1996, the prophylactic treatment of experimental canine babesiosis (\\u003cem\\u003eB. canis\\u003c/em\\u003e) with doxycycline was achieved with satisfied efficacy \\u003csup\\u003e[23]\\u003c/sup\\u003e. Another option is an alternative combination therapy\\u0026nbsp;regime\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003ethat\\u0026nbsp;works well with metronidazole, clindamycin, and doxycycline for\\u0026nbsp;\\u003cem\\u003eB. gibsoni\\u003c/em\\u003e (Asian genotype) infection in dogs in Hong Kong\\u0026nbsp;\\u003csup\\u003e[24]\\u003c/sup\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003eDoxycycline, a tetracycline antibiotic, is widely used to treat various pathogens, such as a 10-day course of oral doxycycline for\\u0026nbsp;the treatment of\\u0026nbsp;human granulocytic anaplasmosis, 14-day course of oral doxycycline for the treatment of early neurologic Lyme disease,\\u0026nbsp;and 6-week course of oral doxycycline plus rifampicin for the treatment of acute brucellosis\\u0026nbsp;\\u003csup\\u003e[28, 29]\\u003c/sup\\u003e.\\u0026nbsp;Currently, there is no standard course of treatment due to the lack of medical records of doxycycline monotherapy for \\u003cem\\u003eBabesia\\u0026nbsp;\\u003c/em\\u003einfection. During the treatment of this case, we used doxycycline monotherapy for a total of 90 days to prevent recrudescence and found no adverse reactions related to doxycycline based on\\u0026nbsp;the\\u0026nbsp;patient\\u0026rsquo;s health status and laboratory tests. This implies that doxycycline monotherapy for human infection with\\u0026nbsp;\\u003cem\\u003eB. venatorum\\u0026nbsp;\\u003c/em\\u003eis\\u0026nbsp;safe for up to 90 days.\\u003c/p\\u003e\\n\\u003cp\\u003eHuman babesiosis is rarely reported in China. However, the actual number of infected individuals may be significantly higher. Meanwhile, many infected individuals may be asymptomatic, such as blood product donors for this patient. However, most doctors and laboratory personnel in China do not understand human babesiosis, making it easy to miss the diagnosis. Similarly to the diagnosis in this patient, laboratory personnel missed the protozoa when they checked the blood smear on November 11. Furthermore, due to insufficient awareness of the disease, first-line drugs for human babesiosis are scarce in China; therefore,\\u0026nbsp;doxycycline monotherapy\\u0026nbsp;should continue.\\u003c/p\\u003e\\n\\u003cp\\u003eIn summary, our clinical practice on human babesiosis caused by\\u003cem\\u003e\\u0026nbsp;B. venatorum\\u003c/em\\u003e strongly suggests that doxycycline could be\\u0026nbsp;an alternative chemical to combat\\u0026nbsp;natural \\u003cem\\u003eBabesia\\u0026nbsp;\\u003c/em\\u003eprotozoan infection in the future. However, it is necessary to expand the sample size and set up controls in future studies to further clarify the efficacy and duration of doxycycline monotherapy.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis research was carried out according to the principles of the Declaration of Helsinki and was approved by the Ethics Committees of the Fifth Medical Center of Chinese PLA General Hospital (No.KY-2022-6-44-2). Written informed consent was obtained from the patient.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWritten informed consent for publication of the clinical details was obtained from the patient.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and material\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll data generated or analysed relating to this study are presented within this published article.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no competing interests.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis study was funded by the State Key Research Development Program of China (2019YFC1200501), National Natural Science Foundation of China(81772185), and National Key R\\u0026amp;D Program of China（2021YFC2301801, 2022YFC2304405）.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors\\u0026rsquo; contributors\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eJ-FJ, F-SW, W-CC and LH designed the study. LH, D-DH, J-F J, YS and MX did the main statistical analysis, and wrote the paper. D-DH, NY, WH, W-MN, YL, H-CM, XZ and Y-GL, recruited the patients and gathered the data. MX, L-YX, NY, WH, LH, M-ZZ, D-YZ and YL did the laboratory tests. D-DH, R-HL, X-AH and J-YW did the statistical analysis. All authors contributed to the review and revision of the paper.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors would like to acknowledge all staffs of the Senior Department of Infectious Diseases, The Fifth Medical Center of Chinese PLA General Hospital.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n \\u003cli\\u003eVannier E, Krause PJ. Human babesiosis. \\u003cem\\u003eN Engl J Med\\u003c/em\\u003e 2012; 366:2397\\u0026ndash;407.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eKrause PJ, Auwaerter PG, Bannuru RR, et al. Clinical\\u0026ensp;Practice\\u0026ensp;Guidelines\\u0026ensp;by the\\u0026ensp;Infectious\\u0026ensp;Diseases\\u0026ensp;Society\\u0026ensp;of\\u0026ensp;America\\u0026ensp;(IDSA):\\u0026ensp;2020\\u0026ensp;Guideline\\u0026ensp;on\\u0026ensp;Diagnosis\\u0026ensp;and\\u0026ensp;Management\\u0026ensp;of\\u0026ensp;Babesiosis. \\u003cem\\u003eClin Infect Dis\\u003c/em\\u003e 2021; 27;72(2):e49-e64.\\u003c/li\\u003e\\n \\u003cli\\u003eBabesiosis surveillance - 18 States, 2011. MMWR Morbidity and mortality weekly report. 2012; 61(27); 505\\u0026ndash;9.\\u003c/li\\u003e\\n \\u003cli\\u003eGray EB, Herwaldt BL. Babesiosis surveillance - United States, 2011\\u0026ndash;2015. \\u003cem\\u003eMMWR Surveill Summ\\u003c/em\\u003e 2019; 68:1\\u0026ndash;11.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eBajer A, Dwużnik-Szarek D. The specificity of Babesia-tick vector interactions: recent advances and pitfalls in molecular and field studies. \\u003cem\\u003eParasit Vectors\\u003c/em\\u003e 2021; 14: 507.\\u003c/li\\u003e\\n \\u003cli\\u003eZintl A, Mulcahy G, Skerrett HE, Taylor SM, Gray JS. Babesia divergens, a bovine blood parasite of veterinary and zoonotic importance. \\u003cem\\u003eClin Microbiol Rev\\u003c/em\\u003e 2003; 16:622\\u0026ndash;36.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eJiang JF, Zheng YC, Jiang RR, et al. Epidemiological, clinical, and laboratory characteristics of 48 cases of \\u0026ldquo;Babesia venatorum\\u0026rdquo; infection in China: a descriptive study.\\u003cem\\u003e\\u0026nbsp;Lancet Infect Dis\\u003c/em\\u003e 2015; 15:196\\u0026ndash;203.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eShih CM, Liu LP, Chung WC, Ong SJ, Wang CC. Human babesiosis in Taiwan: asymptomatic infection with a Babesia microti-like organism in a Taiwanese woman. \\u003cem\\u003eJ Clin Microbiol\\u003c/em\\u003e 1997; 35:450\\u0026ndash;4.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eJia N, Zheng YC, Jiang JF, et al. Human babesiosis caused by a Babesia crassa-like pathogen: a case series. \\u003cem\\u003eClin Infect Dis\\u003c/em\\u003e 2018; 67:1110\\u0026ndash;9.\\u003c/li\\u003e\\n \\u003cli\\u003eHerwaldt BL, Cacci\\u0026ograve; S, Gherlinzoni F, et al. Molecular characterization of a non-Babesia divergens organism causing zoonotic babesiosis in Europe. \\u003cem\\u003eEmerg Infect Dis\\u003c/em\\u003e 2003, 9: 942-8.\\u003c/li\\u003e\\n \\u003cli\\u003eBajer A, Dwużnik-Szarek D. The specificity of Babesia-tick vector interactions: recent advances and pitfalls in molecular and field studies. \\u003cem\\u003eParasit Vectors\\u003c/em\\u003e 2021; 14: 507.\\u003c/li\\u003e\\n \\u003cli\\u003eKumar A, O\\u0026apos;Bryan J, Krause PJ. The Global Emergence of Human Babesiosis. \\u003cem\\u003ePathogens\\u003c/em\\u003e 2021;10:1447.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eWoodland J G, Hunter R, Smith PJ, et al. Shining new light on ancient drugs: Preparation and subcellular localisation of novel flfluorescent analogues of Cinchona alkaloids in intraerythrocytic Plasmodium falciparum. \\u003cem\\u003eOrg Biomol Chem\\u003c/em\\u003e 2017; 15: 589\\u0026ndash;597. \\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eWoodland J G, Hunter R, Smith P J, et al. Chemical Proteomics and Super-resolution Imaging Reveal That Chloroquine Interacts with Plasmodium falciparum Multidrug Resistance-Associated Protein and Lipids.\\u003cem\\u003e\\u0026nbsp;ACS Chem Biol\\u003c/em\\u003e 2018; 13: 2939\\u0026ndash;2948\\u003c/li\\u003e\\n \\u003cli\\u003eLawres LA, Garg A, Kumar V, et al. Radical cure of experimental babesiosis in immunodefificient mice using a combination of an endochin-like quinolone and atovaquone. \\u003cem\\u003eJ Exp Med\\u0026nbsp;\\u003c/em\\u003e2016; 213: 1307\\u0026ndash;1318.\\u003c/li\\u003e\\n \\u003cli\\u003eMontazeri M, Mehrzadi S, Sharif M, , et al. Activities of anti-Toxoplasma drugs and compounds against tissue cysts in the last three decades (1987 to 2017), a systematic review. \\u003cem\\u003eParasitol Res\\u003c/em\\u003e 2018; 117: 3045\\u0026ndash;3057.\\u003c/li\\u003e\\n \\u003cli\\u003eVaidya AB, Mather MW. Atovaquone resistance in malaria parasites. \\u003cem\\u003eDrug Resist Updates\\u003c/em\\u003e 2000; 3: 283\\u0026ndash;287.\\u003c/li\\u003e\\n \\u003cli\\u003eWen B, Jian R, Zhang Y, et al. Simultaneous detection of \\u003cem\\u003eAnaplasma marginale\\u003c/em\\u003e and a new \\u003cem\\u003eEhrlichia\\u003c/em\\u003e species closely related to \\u003cem\\u003eEhrlichia chaffeensis\\u003c/em\\u003e by sequence analyses of 16S ribosomal DNA in \\u003cem\\u003eBoophilus microplus\\u003c/em\\u003e ticks from Tibet.\\u003cem\\u003e\\u0026nbsp;J Clin Microbiol\\u003c/em\\u003e 2002; 40: 3286-90.\\u003c/li\\u003e\\n \\u003cli\\u003eParola P, Paddock C D, Socolovschi C, et al. Update on tick-borne rickettsioses around the world: a geographic approach. \\u003cem\\u003eClin Microbiol Rev\\u003c/em\\u003e 2013; 26(4): 657-702.\\u003c/li\\u003e\\n \\u003cli\\u003ePlatonov A E, Karan L S, Kolyasnikova N M, et al. Humans infected with relapsing fever spirochete Borrelia miyamotoi, Russia. \\u003cem\\u003eEmerg Infect Dis\\u003c/em\\u003e 2011;17: 1816-23.\\u003c/li\\u003e\\n \\u003cli\\u003eChu C Y, Jiang B G, Liu W, et al. Presence of pathogenic Borrelia burgdorferi sensu lato in ticks and rodents in Zhejiang, south-east China. \\u003cem\\u003eJ Med Microbiol\\u003c/em\\u003e 2008; 57: 980-5.\\u003c/li\\u003e\\n \\u003cli\\u003eDahl E L, Shock J L, Shenai B R, et al. Tetracyclines specifically target the apicoplast of the malaria parasite Plasmodium falciparum. \\u003cem\\u003eAntimicrob Agents Chemother\\u003c/em\\u003e 2006; 50:3124-31.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eVercammen F, De Deken R, Maes L. Prophylactic treatment of experimental canine babesiosis (Babesia canis) with doxycycline. \\u003cem\\u003eVet Parasitol\\u003c/em\\u003e 1996;66:251-55.\\u003c/li\\u003e\\n \\u003cli\\u003eAlmendros A, Burchell R, Wierenga J. An alternative combination therapy with metronidazole, clindamycin and doxycycline for Babesia gibsoni (Asian genotype) in dogs in Hong Kong. \\u003cem\\u003eJ Vet Med Sci\\u0026nbsp;\\u003c/em\\u003e2020;82:1334-40.\\u003c/li\\u003e\\n \\u003cli\\u003eHerwaldt BL, Linden JV, Bosserman E, Young C, Olkowska D, Wilson M. transfusion-associated babesiosis in the United States: a description of cases.\\u003cem\\u003e\\u0026nbsp;Ann Intern Med\\u003c/em\\u003e 2011; 155:509\\u0026ndash;19.\\u003c/li\\u003e\\n \\u003cli\\u003eTonnetti L, Eder AF, Dy B, et al. Transfusion-transmitted \\u003cem\\u003eBabesia microti\\u0026nbsp;\\u003c/em\\u003eidentified through hemovigilance. \\u003cem\\u003eTransfusion\\u003c/em\\u003e 2009; 49:2557\\u0026ndash;63.\\u003c/li\\u003e\\n \\u003cli\\u003eWiesner J, Seeber F. The plastid-derived organelle of protozoan human parasites as a target of established and emerging drugs. \\u003cem\\u003eExpert Opin Ther Targets\\u003c/em\\u003e 2005; 9: 23-44.\\u003c/li\\u003e\\n \\u003cli\\u003e\\u0026nbsp;Sanchez E, Vannier E, Wormser GP, Hu LT. Diagnosis, Treatment, and Prevention of Lyme Disease, Human Granulocytic Anaplasmosis, and Babesiosis: A Review. \\u003cem\\u003eJAMA\\u003c/em\\u003e 2016 Apr 26;315(16):1767-77.\\u003c/li\\u003e\\n \\u003cli\\u003eAl-Tawfiq JA, Memish ZA. Antibiotic susceptibility and treatment of brucellosis. \\u003cem\\u003eRecent Pat Antiinfect Drug Discov\\u003c/em\\u003e 2013 Apr;8(1):51-54.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"infectious-diseases-of-poverty\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"idop\",\"sideBox\":\"Learn more about [Infectious Diseases of Poverty](http://idpjournal.biomedcentral.com)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/idop/default.aspx\",\"title\":\"Infectious Diseases of Poverty\",\"twitterHandle\":\"@BioMedCentral\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Human babesiosis, Babesia venatorum, Doxycycline monotherapy, China\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-2735617/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-2735617/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cstrong\\u003eBackground: \\u003c/strong\\u003eHuman babesiosis is a worldwide disease caused by intraerythrocytic protozoa of the genus \\u003cem\\u003eBabesia\\u003c/em\\u003e, which are transmitted by bites from ixodid ticks but also mechanically transmitted by blood transfusion. This disease is primarily treated with quinine and/or atovaquone, which are not readily available in China. A novel treatment regimen with doxycycline monotherapy in one severe patient with \\u003cem\\u003eBabesia venatorum\\u003c/em\\u003e infection was achieved as an alternative therapeutic medication.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCase presentation: \\u003c/strong\\u003eA 73-year-old male who underwent splenectomy and blood transfusion 8 years previously had unexplained fever, headache and thrombocytopenia and was admitted to the Fifth Medical Center of the PLA General Hospital. The cases were confirmed to be infected with \\u003cem\\u003eB. venatorum\\u003c/em\\u003e by morphological observations on thin peripheral blood smears, multi-gene PCR, and sequencing of the entire 18s-rRNA and partial β-tubulin encoding genes, as well as isolation by animal inoculation. The doxycycline monotherapy regimen was administered following pharmacological guidance and an effective outcome was observed. The patient recovered rapidly following doxycycline monotherapy. The \\u003cem\\u003eBabesia\\u003c/em\\u003e protozoan load in peripheral blood samples decreased by 88% in hematocrit counts 8 days later, and negative PCR results were achieved in 90 days when he was examined in our hospital. The treatment course of the patient lasted 3 months without side effects or sequelae. The 9-month follow-up survey of the patient did not show signs of recrudescence or anti-babesial tolerance.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConclusions: \\u003c/strong\\u003eWe first reported an interesting clinical practice of successful doxycycline monotherapy for human babesiosis caused by \\u003cem\\u003eB. venatorum\\u003c/em\\u003e, which provides an optional medical intervention for human babesiosis.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Successful treatment with doxycycline monotherapy for human infection with Babesia venatorum (Babesiidae, Sporozoa) in China: a case report and clinic regimen\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2023-04-03 20:40:43\",\"doi\":\"10.21203/rs.3.rs-2735617/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Major revision\",\"date\":\"2023-04-15T20:20:51+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2023-04-07T02:08:41+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"\",\"date\":\"2023-03-31T01:47:09+00:00\",\"index\":0,\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2023-03-29T23:59:32+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Infectious Diseases of Poverty\",\"date\":\"2023-03-28T18:56:51+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"infectious-diseases-of-poverty\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"idop\",\"sideBox\":\"Learn more about [Infectious Diseases of Poverty](http://idpjournal.biomedcentral.com)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/idop/default.aspx\",\"title\":\"Infectious Diseases of Poverty\",\"twitterHandle\":\"@BioMedCentral\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"d339ac97-817d-420f-bc8c-ecfc73c6edec\",\"owner\":[],\"postedDate\":\"April 3rd, 2023\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2023-08-18T03:54:04+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-2735617\",\"link\":\"https://doi.org/10.1186/s40249-023-01111-1\",\"journal\":{\"identity\":\"infectious-diseases-of-poverty\",\"isVorOnly\":false,\"title\":\"Infectious Diseases of Poverty\"},\"publishedOn\":\"2023-07-13 01:08:20\",\"publishedOnDateReadable\":\"July 13th, 2023\"},\"versionCreatedAt\":\"2023-04-03 20:40:43\",\"video\":\"\",\"vorDoi\":\"10.1186/s40249-023-01111-1\",\"vorDoiUrl\":\"https://doi.org/10.1186/s40249-023-01111-1\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-2735617\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-2735617\",\"identity\":\"rs-2735617\",\"version\":[\"v1\"]},\"buildId\":\"WrCJVZZCHTDjtuVLN7oU0\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}