{"paper_id":"0cc267b5-ca11-44ec-8b46-e7c99e05dfe4","body_text":"Caspia-LAMP - species-specific LAMP-based tool for the molecular detection of Cordylophora caspia (Pallas 1771) (Cnidaria, Hydrozoa) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Caspia-LAMP - species-specific LAMP-based tool for the molecular detection of Cordylophora caspia (Pallas 1771) (Cnidaria, Hydrozoa) Rayan Silva de Paula, Júlia Meireles Nogueira, Amanda Maria Siqueira Moreira, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7553152/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 15 Dec, 2025 Read the published version in Molecular Biology Reports → Version 1 posted 8 You are reading this latest preprint version Abstract The rapid detection of invasive species is crucial for effective management and mitigation of their ecological and economic impacts. Cordylophora caspia is an invasive hydroid that has successfully colonized freshwater and brackish ecosystems worldwide, causing significant environmental and infrastructural problems. Traditional morphological identification methods are often insufficient for early detection, particularly when populations are sparse or specimens are damaged or inappropriately preserved. Here, we present the validation of a Loop-Mediated Isothermal Amplification (LAMP) protocol specifically designed for the detection of C. caspia DNA (Caspia-LAMP). The method targets unique repetitive DNA sequences identified through genome analysis, enabling highly specific detection without cross-reactivity with other cnidarians or co-occurring invasive species. Our optimized protocol demonstrates remarkable sensitivity, capable of detecting as little as 10 − 7 ng of C. caspia DNA, surpassing conventional PCR methods. This rapid, sensitive, and field-applicable method represents a valuable tool for early detection and monitoring of C. caspia populations, potentially enabling more timely and cost-effective management interventions. The successful development of this protocol also serves as a model for creating similar molecular tools for other invasive species detection and monitoring programs. Clinical trial number: not applicable. Environmental monitoring Early detection Hydrozoan LAMP method repetitive DNA Figures Figure 1 Figure 2 Figure 3 Introduction The proliferation of invasive species represents a pressing challenge for global biodiversity conservation, as these species often disrupt native ecosystems and lead to substantial ecological and economic impacts (Bellard et al., 2016 ; Pimentel et al., 2021 ). Among invasive aquatic species, Cordylophora caspia (Pallas 1771) has emerged as a particularly problematic organism due to its adaptability to diverse environmental conditions, particularly in brackish and freshwater systems (Bij de Vaate et al., 2002; Folino-Rorem & Indelicato, 2005 ). Native to the Caspian and Black Sea regions, C. caspia has successfully established populations across a range of geographical locations through human-mediated pathways, such as shipping and canal construction, which have facilitated its spread (Meek et al., 2012 ; Wollschlager et al., 2013 ). As it colonizes new habitats, C. caspia competes with native species, alters food web dynamics, and may clog water systems, affecting water management infrastructure necessitating costly maintenance (Mant et al., 2012 ), especially in hydrothermal power plants (Folino-Rorem & Indelicato, 2005 ; Grohmann, 2008 ; Pucherelli et al., 2016 ; Pucherelli et al., 2018 ). The detection and monitoring of C. caspia are essential for effective management and mitigation efforts (Darling & Blum, 2007 ). However, conventional detection methods often rely on morphological identification, which can be labor-intensive and requires taxonomic expertise (Trebitz et al., 2017 ). These methods are particularly limited when C. caspia populations are sparse, the colonies are fragmented, in early stages of establishment, or inappropriately preserved, complicating field collections and morphological analysis (Diem et al., 2023 ). Furthermore, many aquatic ecosystems contain a wide range of organisms with similar morphologies, increasing the risk of misidentification (Mills et al., 2007 ). For these reasons, there is a critical need for sensitive, accurate, and field-appropriate molecular detection methods that can overcome these limitations and improve the efficiency of C. caspia surveillance programs (Darling & Mahon, 2011 ). Loop-Mediated Isothermal Amplification (LAMP) is a molecular method with significant advantages for the DNA detection of invasive species, such as C. caspia (Notomi et al., 2015 ). Developed as an alternative to Polymerase Chain Reaction (PCR), the LAMP method enables DNA amplification under isothermal conditions (60–65°C), eliminating the need for thermal cyclers, which facilitates its use in field analyses (Tomita et al., 2008 ). This simplicity makes LAMP a powerful tool for field applications, as reactions can be carried out in portable water baths or with other basic heat sources (Wong et al., 2018 ). LAMP employs a set of four to six primers targeting specific DNA sequences (typically 80–250 base pairs), offering a high degree of specificity that is crucial for identifying target species even in complex environmental samples (Mori & Notomi, 2020 ). Beyond its ease of use, one of the main advantages of LAMP is the speed of obtaining results, which are usually detectable within 30 to 60 minutes after the reaction begins (Zhang et al., 2014 ). The method is highly sensitive and can detect low quantities of DNA, which is particularly valuable for early detection in ecosystems where C. caspia may be present in low densities (Nagamine et al., 2002 ). Furthermore, the products of LAMP reactions can be detected through different approaches, such as changes in turbidity, color shifts, or fluorescence emission, depending on the reagents employed (Tanner et al., 2015 ). This study aims to develop a LAMP protocol specifically designed for the detection of C. caspia (Caspia-LAMP), targeting a DNA region unique to the species to avoid cross-reactivity with non-target organisms. We hypothesize that Caspia-LAMP will provide a rapid, specific, and sensitive detection method suitable for both laboratory (this study) and field (in the future) environments. By implementing LAMP, we seek to provide a tool that can facilitate more effective and accessible monitoring of C. caspia , contributing to broader efforts to manage invasive species and protect vulnerable aquatic ecosystems (Hulme, 2009 ; Lodge et al., 2016 ), especially in places such as Brazil, where the presence of C. caspia has been neglected despite the invasion has been silently established for a long time (de Paula et al., 2024 ). Material and methods Sampling and DNA extraction The C. caspia sample used here was previously manually collected from two coal seal filters of the hydroelectric power plant São Simão (HPP-São Simão) on the Paranaíba River in Goiás (GO) state, Brazil (-19.018683; -50.500142), and its morphological characterization was shown by de Paula et al. ( 2024 ). Total DNA was extracted from gonophores and the terminal portion of tentacles using the E.Z.N.A® Mollusc DNA Kit (Omega Bio-tek, Norcross, GA), according to the manufacturer’s instructions. To optimize DNA quality, the pulverized samples treated with proteinase K were incubated overnight at 37°C in a water bath (CB 830-E, Heto-Holten, Gydevang, DK), following an alternative protocol recommended by the kit manufacturer. DNA concentration and purity were assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). All molecular assays involving the genetic heritage of the organisms used in this study comply with the standards of SisGen ( Sistema Nacional de Gestão do Patrimônio Genético e do Conhecimento Tradicional Associado ) and are registered under access code A4659D9. Primer design Draft genome sequence data of C. caspia (unpublished) were analyzed using RepeatModeler2 (version 2.0.4) (Flynn et al., 2020 ) to identify transposable element (TE) families. The resulting consensus families were processed to remove satellites and artifacts. Remaining sequences were submitted to RepeatMasker ( https://www.repeatmasker.org/ ) to estimate copy number and Kimura 2-parameter (K2P) divergence within the C. caspia genome. This approach was based on the hypothesis that high repetitiveness and low divergence would enhance the efficiency of LAMP amplification for C. caspia DNA. Only consensus sequences with less than 65% similarity to other cnidarians and mollusks, evaluated by blastn (BLAST 2.2.31 + version), were retained for further analysis, ensuring specificity to C. caspia . TE families that had more than 50 slightly divergent copies in the C. caspia genome and covering at least 80% of the consensus length were identified using the TE-Aid tool ( https://github.com/clemgoub/TE-Aid ). Primers were designed using Primer Explorer V5 ( https://primerexplorer.jp/e/ ) and are shown in Table 1 . The resulting amplicon sequence was also aligned against all available cnidarian genomes, as well as the NCBI NT database, to confirm its specificity to C. caspia . Table 1 LAMP primers used to detect Cordylophora caspia . F3/B3 : outer primers; FIP/BIP : inner primers; LF/BF : loop-primers. Primer Sequence Caspia-LAMP_F3 TGCCAAAGAAAATGGTGAAC Caspia-LAMP_B3 GCAACAATATCATGGTCCAAAT Caspia-LAMP_FIP ACCCATCTGTTGTGTGCAAATTCTTTCAATCACATTTGATGAGTCTAC Caspia-LAMP_BIP TCTTGGAATGGTCCGTGTCAGAATTTTTCAAGTCGTTGCTTTA Caspia-LAMP_LF TCATAAATCGCCGATTCCTTACAGA Caspia-LAMP_LB GGCAGCATGAACACTGAGAAACT Loop-Mediated Isothermal Amplification for C. caspia (Caspia-LAMP) detection The Caspia-LAMP reaction mixture was prepared as follows: 1 µL of Bst DNA Polymerase 2.0 WarmStart (320 U/mL, New England Biolabs, Ipswich, MA), 2.5 µL of 10X Isothermal Amplification Buffer containing 2 mM MgSO₄ (New England Biolabs), 1.5 µL of 6 mM additional MgSO₄ (final concentration of 8 mM), 3.5 µL of dNTP Mix (1.4 mM each), 1 µL of FIP/BIP primers (1.6 µM each), 1 µL of F3/B3 primers (0.2 µM each), and 1 µL of LoopF/LoopB primers (0.4 µM each). DNA quantities varied depending on the assay, and the final volume was adjusted to 25 µL with nuclease-free water. Reactions were incubated at 65°C in a water bath (CB 830-E, Heto-Holten, Gydevang, DK), with incubation times adjusted according to experimental conditions (described below). After amplification, the enzyme was inactivated by heating at 80°C for 20 minutes. For visualization, 1 µL of 10,000X SYBR® Green I Nucleic Acid Stain (Lonza Bioscience, Morrisville, NC) was added directly to each tube, and fluorescence was examined under UV light. Amplification was further confirmed by resolving the products on a 2% agarose gel. To minimize contamination, DNA extraction, LAMP mixture, and amplification were conducted in separate rooms. SYBR® Green I was added to open tubes within a hood. All assays were conducted in triplicate, from independent assays performed on different days. Amplification Sensitivity The Limit of Detection (LoD) of the Caspia-LAMP assay was determined using serial dilutions of C. caspia DNA, ranging from 10 to 10⁻⁸ ng. The assay was considered negative when SYBR® Green I fluorescence was no longer detectable under UV light. Each reaction was incubated for 60 min in a water bath (CB 830-E, Heto-Holten), followed by enzyme inactivation and visualization on 2% agarose gel under UV light. Minimum reaction time for detection To determine the minimum detection time of the Caspia-LAMP assay, four samples containing 1 ng of C. caspia DNA were incubated at 65°C in a water bath (CB 830-E, Heto-Holten) for 30, 60, 90, and 120 min. Following incubation, SYBR® Green I was added, and fluorescence was examined under UV light. Amplification was further confirmed by resolving the products on a 2% agarose gel. Cross-reactivity with other species Cross-reactivity tests were performed using 1 ng of total DNA from C. caspia and control DNA (previously available in the laboratory) from various organisms to the LAMP assay for 30 min in a water bath (CB 830-E, Heto-Holten), followed by enzyme denaturation and UV visualization. Control species tested with Caspia-LAMP primers included: cnidarians Hydra sp. (cf. viridissima Pallas 1766) and Haliclystus antarcticus Pfeffer 1889; and co-invasive bivalves with C. caspia in South America, Corbicula fluminea (Müller 1774), Corbicula largillierti (Philippi 1844), and Limnoperna fortunei (Dunker 1857) — and North America, Dreissena polymorpha (Pallas 1771) and Dreissena bugensis (Andrusov 1897). The products were further verified on a 2% agarose gel to confirm amplification. Results Caspia-LAMP has a LoD of 10⁻⁷ ng for C. caspia DNA DNA concentrations ranging from 10 ng to 10⁻⁸ ng were tested, with the assay demonstrating a sensitivity range from 10 ng to 10⁻⁷ ng (Fig. 1 ). Under UV light, successful amplification was indicated by green fluorescence (Fig. 1 a 1 –9) or high-intensity light (Fig. 1 b 1 –9), while reactions without amplification displayed orange staining or no light, representing negative results (Fig. 1 a/b 10) and the negative control (Fig. 1 a/b NC). The colorimetric results were consistent with the ladder-like amplification pattern observed on the agarose gel (Fig. 1 c). This pattern was visible for all samples containing C. caspia DNA (Fig. 1 c, lanes 1–9). Caspia-LAMP detects C. caspia DNA within 30 minutes Samples subjected to reaction conditions for 30, 60, 90, and 120 minutes demonstrated detection starting at 30 minutes, as indicated by the green staining of tubes and samples from that point onward (Fig. 2 a/b 1–4). The negative controls for each reaction time are represented by the corresponding sample number with an apostrophe (Fig. 2 a/b 1'–4'), showing orange staining or absence of fluorescence, indicating no amplification. The fluorimetric results were further validated by the ladder-like amplification pattern observed on the agarose gel for samples incubated at all tested times (Fig. 2 c, lanes 1–4). Notably, no spurious amplification was detected, even at longer incubation periods (90 and 120 minutes), indicating that the Caspia-LAMP assay is robust, with minimal to no interference. Caspia-LAMP specifically identifies C. caspia without cross-reactivity to other species Cross-amplification reactions were performed to evaluate the specificity of primers for C. caspia , using DNA obtained from various species, including cnidarians and mollusks — specifically bivalves that are invasive species co-occurring with C. caspia (Fig. 3 ). The assay produced a green fluorescence exclusively in the reaction containing C. caspia DNA (Fig. 3 a/b Cc ). Reactions using template DNA from other cnidarians — Hydra sp. (Fig. 3 a/b Hy ) and H. antarcticus (Fig. 3 a/b Ha) — as well as from co-invasive bivalves — C. fluminea (Fig. 3 a/b Cf ), C. largillierti (Fig. 3 a/b Cl ), L. fortunei (Fig. 3 a/b Lf ), D. polymorpha (Fig. 3 a/b Dp ), and D. bugensis (Fig. 3 a/b Db ) — all exhibited either orange staining or absence of fluorescence, indicating no amplification. The negative control (Fig. 3 a/b NC) likewise showed no amplification. Further confirmation of specificity was provided by the ladder-like amplification pattern observed exclusively on the agarose gel for the C. caspia reaction (Fig. 3 c, lane Cc ). Discussion The development of specific molecular tools for the early detection of invasive species represents a crucial advancement in environmental monitoring and conservation efforts. Traditionally, the identification of aquatic invasive species has relied heavily on universal molecular markers, such as the Folmer region of COI ( Cytochrome C Oxidase Subunit 1 ; Folmer et al., 1994 ), which, while valuable for broad taxonomic studies, may lack the specificity required for rapid and accurate species-level identification. The absence of species-specific molecular markers for C. caspia has historically limited our ability to detect this invasive hydrozoan during early invasion stages, when management interventions are most effective (Trebitz et al., 2017 ), also resulting in neglected biological knowledge and an underestimated geographical distribution of the species (de Paula et al., 2024 ). Establishment of markers for C. caspia is particularly crucial given its role as a foundation species in invaded environments. The complex three-dimensional structure of C. caspia colonies provides substrate and shelter for various organisms, including other hydrozoans, amphipods, and microorganisms (Pucherelli et al., 2016 ; Pucherelli et al., 2018 ; da Silva Bertão et al., 2021 ), even facilitating the invasion of other species, such as the golden mussel L. fortunei (Portella et al., 2009 ). This ecological characteristic makes traditional morphological identification even more challenging, as samples may contain multiple species intertwined within filaments of the hydroid. Additionally, bacterial and algal biofilms commonly associated with C. caspia colonies can interfere with DNA-based detection methods that lack species specificity (Medlin & Orozco, 2017 ). Caspia-LAMP protocol addresses these challenges by targeting unique genomic regions of C. caspia , enabling accurate identification even in samples containing multiple species. Our study addresses this gap by developing a specific LAMP-based detection method for C. caspia that demonstrates remarkable sensitivity, agility, and specificity with a LoD of 10 − 7 ng (0.1 pg) DNA from 30 minutes. This level of sensitivity surpasses that typically achieved through conventional PCR methods, which often require DNA concentrations in the picogram to nanogram range (Notomi et al., 2015 ). The enhanced sensitivity of our Caspia-LAMP protocol is particularly valuable for early detection programs, as it enables the identification of C. caspia even when present at very low densities or during initial colonization phases (Darling & Mahon, 2011 ). The use of LAMP technology for species-specific detection has shown significant promise across various fields, including parasite detection in medical diagnostics (Wong et al., 2018 ), conservation monitoring of endangered species (Khodaparast et al., 2024 ), and surveillance of other invasive species (Carvalho et al., 2021 ; de Paula et al., 2023 ). Our results align with these studies, demonstrating the versatility and reliability of LAMP as a molecular tool. The success of the method in detecting C. caspia suggests potential applications for monitoring other invasive cnidarians, particularly in complex aquatic environments where traditional morphological identification may be challenging. A particularly promising aspect of our Caspia-LAMP protocol is its potential application for environmental DNA (eDNA) detection and various life stages of C. caspia , including larvae and menonts (de Paula et al., 2024 ). While our current study focused on DNA extracted directly from tissue samples, the high sensitivity of LAMP suggests it could effectively detect trace amounts of DNA in water samples or identify cryptic life stages that are typically difficult to detect through visual inspection (Thomsen & Willerslev, 2015 ). This capability could revolutionize monitoring programs by enabling non-invasive sampling and early detection of C. caspia populations before they become visually apparent. The economic implications of invasive species management are substantial, with global costs estimated in the hundreds of billions of dollars annually (Diagne et al., 2021 ). Early detection methods, such as the Caspia-LAMP protocol, offer a cost-effective approach to monitoring and can facilitate rapid response strategies when invasions are detected. The isothermal nature of LAMP makes it particularly suitable for field applications, requiring minimal equipment and providing results within hours rather than days (Mori & Notomi, 2020 ). The development of this specific molecular tool for C. caspia represents a significant step forward in invasive species monitoring. The high sensitivity and specificity of the Caspia-LAMP protocol, combined with its potential field applications, provide environmental managers with a powerful tool for early detection and rapid response to C. caspia invasions. This advancement comes at a crucial time when global climate change and increased global trade are facilitating the spread of invasive species across traditional biogeographic barriers (Seebens et al., 2017 ). Conclusion Our study demonstrates that LAMP technology offers a promising alternative for monitoring invasive species, particularly in aquatic environments where early detection is crucial but challenging. The successful development of a species-specific LAMP protocol for C. caspia (Caspia-LAMP) not only provides a valuable tool for managing this particular species but also serves as a model for developing similar protocols for other invasive species. As we face increasing challenges from biological invasions, the implementation of sensitive, specific, and field-applicable molecular tools will become increasingly important for effective environmental management and conservation efforts. Declarations Acknowledgements The authors gratefully acknowledge Fapemig ( Fundação de Amparo à Pesquisa do Estado de Minas Gerais), CAPES ( Coordenação de Aperfeiçoamento de Pessoal de Nível Superior ), CNPq ( Conselho Nacional de Desenvolvimento Científico e Tecnológico ) and Fiocruz for financial support. ECJ received a scholarship from CNPq. RLdMN is a CNPq research fellow (grant number CNPq 312353/2023-5). Research coordinated by RLdMN is supported by Fapemig and “Programa Inova Fiocruz” from Oswaldo Cruz Foundation. GLW hold fellowships from CNPq (Grant processes 307209/2023-7). Author contributions RSdP: Conceptualization, Methodology, Investigation; Writing original draft preparation and editing. JMN: Conceptualization; Methodology; Investigation; Writing review and editing. AMSM: Conceptualization; Methodology; Writing review and editing. RLdMN: Conceptualization and design; Methodology; Writing and revision and editing; Mentoring and consulting. GLW: Methodology; Writing review and editing. ESdM: Methodology; Writing review and editing. ECJ: Funding provision; Writing review and editing. manuscript. LSM: Conceptualization; Funding provision; Writing review and editing. All authors read and approved the final manuscript. Data availability All data generated or analysed during this study are included in this published article. Ethical approval All authors have read, understood, and have complied as applicable with the statement on “Ethical responsibilities of Authors” as found in the Instructions for Authors. Competing interests Results presented here are the basis for C. caspia LAMP-based molecular detection that could be part of a solution for field application. Funding This study was supported by the FAPEMIG APQ-02147–21. References Bellard, C., Cassey, P., & Blackburn, T. M. (2016). Alien species as a driver of recent extinctions. Biology Letters, 12(2), 20150623. https://royalsocietypublishing.org/doi/full/10.1098/rsbl.2015.0623 Bij de Vaate, A., Jazdzewski, K., Ketelaars, H. A., Gollasch, S., & Van der Velde, G. (2002). Geographical patterns in range extension of Ponto-Caspian macroinvertebrate species in Europe. Canadian Journal of Fisheries and Aquatic Sciences, 59(7), 1159-1174. https://doi.org/10.1139/f02-098 Carvalho, J., Garrido-Maestu, A., Azinheiro, S., Fuciños, P., Barros-Velázquez, J., De Miguel, R. J., ... & Prado, M. (2021). Faster monitoring of the invasive alien species (IAS) Dreissena polymorpha in river basins through isothermal amplification. Scientific Reports , 11 (1), 10175. https://doi.org/10.1038/s41598-021-89574-w da Silva Bertão, A. P., Leite, R. V. V., Horodesky, A., Pie, M. R., Zanin, T. L., Netto, O. S. M., & Ostrensky, A. (2021). Ecological interactions between invasive and native fouling species in the reservoir of a hydroelectric plant. Hydrobiologia, 848, 5169-5185. https://doi.org/10.1007/s10750-021-04706-7 Darling, J. A., & Blum, M. J. (2007). DNA-based methods for monitoring invasive species: a review and prospectus. Biological Invasions, 9(7), 751-765. https://doi.org/10.1007/s10530-006-9079-4 Darling, J. A., & Mahon, A. R. (2011). From molecules to management: adopting DNA-based methods for monitoring biological invasions in aquatic environments. Environmental Research, 111(7), 978-988. https://doi.org/10.1016/j.envres.2011.02.001 de Paula, R. S., Cunha, A. F. E., Reis, M. P., Souza, C. C.., de Oliveira Junior, R. B., Barbosa, N. P. U., ... & Miranda, L. S. (2024). Evidence of cryptic speciation in the invasive hydroid Cordylophora caspia (Pallas, 1771) (Cnidaria, Hydrozoa) supported by new records. Organisms Diversity & Evolution, 24(1), 35-50. https://doi.org/10.1007/s13127-023-00632-9 de Paula, R. S., Monte-Neto, R. L., da Luz Wallau, G., de Paula Reis, M., Souza, C. C., Nogueira, J. M., ... & Jorge, E. C. (2023). Laboratory validation of loop-mediated isothermal amplification (LAMP) assay for Limnoperna fortunei (Dunker 1857) detection. Biological Invasions, 25(12), 3859-3870. https://doi.org/10.1007/s10530-023-03143-y Diagne, C., Leroy, B., Vaissière, A. C., Gozlan, R. E., Roiz, D., Jarić, I., ... & Courchamp, F. (2021). High and rising economic costs of biological invasions worldwide. Nature, 592(7855), 571-576. https://doi.org/10.1038/s41586-021-03405-6 Diem, A., Ramalhosa, P., Cacabelos, E., Ferrario, J., Castro, N., Henriques, F., ... & Gestoso, I. (2023). Monitoring non-indigenous species with passive sampling methods in an Oceanic Island. Journal of Marine Science and Engineering, 11(2), 264. https://doi.org/10.3390/jmse11020264 Folino-Rorem, N. C., & Indelicato, J. (2005). Controlling biofouling caused by the colonial hydroid Cordylophora caspia . Water Research, 39(12), 2731-2737. https://doi.org/10.1016/j.watres.2005.04.053 Folmer, O., Black, M., Hoeh, W., Lutz, R., & Vrijenhoek, R. (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3(5), 294-299. Flynn, J. M., Hubley, R., Goubert, C., Rosen, J., Clark, A. G., Feschotte, C., & Smit, A. F. (2020). RepeatModeler2 for automated genomic discovery of transposable element families. Proceedings of the National Academy of Sciences, 117(17), 9451-9457. https://doi.org/10.1073/pnas.1921046117 Grohmann, P. A. (2008). Bioencrustration in the turbine cooling system at the funil hydroelectric power plant, Itatiaia, Rio de Janeiro, Brazil. Naturalia, 31, 16-21. Hulme, P. E. (2009). Trade, transport and trouble: managing invasive species pathways in an era of globalization. Journal of Applied Ecology, 46(1), 10-18. https://doi.org/10.1111/j.1365-2664.2008.01600.x Khodaparast, M., Sharley, D., Marshall, S., & Beddoe, T. (2024). Rapid and cost‐effective Platypus eDNA detection in waterways using loop‐mediated isothermal amplification assay: advancing conservation efforts. Environmental DNA, 6(5), e70003. https://doi.org/10.1002/edn3.70003 Lodge, D. M., Simonin, P. W., Burgiel, S. W., Keller, R. P., Bossenbroek, J. M., Jerde, C. L., ... & Zhang, H. (2016). Risk analysis and bioeconomics of invasive species to inform policy and management. Annual Review of Environment and Resources, 41, 453-488. https://doi.org/10.1146/annurev-environ-110615-085532 Mant, R. C., Moggridge, G. D., & Aldridge, D. C. (2012). Control of biofouling by Cordylophora caspia in freshwater using one-off, pulsed and intermittent dosing of chlorine: laboratory evaluation. Biofouling, 28(8), 849-860. https://doi.org/10.1080/08927014.2012.683865 Medlin, L. K., & Orozco, J. (2017). Molecular techniques for the detection of organisms in aquatic environments, with emphasis on harmful algal bloom species. Sensors , 17 (5), 1184. https://doi.org/10.3390/s17051184 Meek, M. H., Wintzer, A. P., Wetzel, W. C., & May, B. (2012). Climate change likely to facilitate the invasion of the non‐native hydroid, Cordylophora caspia , in the San Francisco estuary. PLoS One, 7(10), e46373. https://doi.org/10.1371/journal.pone.0046373 Mills, C. E., Marques, A. C., Migotto, A. E., Calder, D. R., & Hand, C. (2007). Hydrozoa: descriptions of genera and species. The Light and Smith Manual: Intertidal Invertebrates from Central California to Oregon, 118-168. Mori, Y., & Notomi, T. (2020). Loop-mediated isothermal amplification (LAMP): expansion of its practical application as a tool to achieve universal health coverage. Journal of Infection and Chemotherapy, 26(1), 13-17. https://doi.org/10.1016/j.jiac.2019.07.020 Nagamine, K., Hase, T., & Notomi, T. (2002). Accelerated reaction by loop-mediated isothermal amplification using loop primers. Molecular and Cellular Probes, 16(3), 223-229. https://doi.org/10.1006/mcpr.2002.0415 Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., & Hase, T. (2015). Loop-mediated isothermal amplification of DNA. Nucleic Acids Research, 28(12), e63-e63. https://doi.org/10.1093/nar/28.12.e63 Pimentel, D., Zuniga, R., & Morrison, D. (2021). Update on the environmental and economic costs associated with alien-invasive species in the United States. Ecological Economics, 52(3), 273-288. https://doi.org/10.1016/j.ecolecon.2004.10.002 Portella, K. F., Joukoski, A., Silva, A. S., Brassac, N. M., & Belz, C. E. (2009). Biofouling e biodeterioração química de argamassa de cimento portland em reservatório de usina hidroelétrica. Química Nova, 32(4), 1047-1051. https://doi.org/10.1590/S0100-40422009000400037 Pucherelli, S. F., Claudi, R., & Prescott, T. (2018). Control of biofouling in hydropower cooling systems using HOD ultraviolet light. Management of Biological Invasions, 9(4), 451. https://doi.org/10.3391/mbi.2018.9.4.08 Pucherelli, S. F., Keele, J., Passamaneck, Y. J., Beaver, J. R., & Renicker, T. R. (2016). Range expansion of the invasive hydroid, Cordylophora caspia (Pallas, 1771), in Colorado River reservoirs. Bioinvasions Records , 5 (3), 133-137. me 5, Issue 3: 133–137 DOI: http://dx.doi.org/10.3391/bir.2016.5.3.02 Seebens, H., Blackburn, T. M., Dyer, E. E., Genovesi, P., Hulme, P. E., Jeschke, J. M., ... & Essl, F. (2017). No saturation in the accumulation of alien species worldwide. Nature Communications, 8(1), 1-9. https://doi.org/10.1038/ncomms14435 Tanner, N. A., Zhang, Y., & Evans Jr, T. C. (2015). Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes. BioTechniques, 58(2), 59-68. https://doi.org/10.2144/000114253 Thomsen, P. F., & Willerslev, E. (2015). Environmental DNA – An emerging tool in conservation for monitoring past and present biodiversity. Biological Conservation, 183, 4-18. https://doi.org/10.1016/j.biocon.2014.11.019 Tomita, N., Mori, Y., Kanda, H., & Notomi, T. (2008). Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols, 3(5), 877-882. https://doi.org/10.1038/nprot.2008.57 Trebitz, A. S., Hoffman, J. C., Darling, J. A., Pilgrim, E. M., Kelly, J. R., Brown, E. A., ... & Schardt, J. C. (2017). Early detection monitoring for aquatic non-indigenous species: Optimizing surveillance, incorporating advanced technologies, and identifying research needs. Journal of Environmental Management, 202, 299-310. https://doi.org/10.1016/j.jenvman.2017.07.045 Wollschlager, J., Folino-Rorem, N., & Daly, M. (2013). Nematocysts of the invasive hydroid Cordylophora caspia (Cnidaria: Hydrozoa). The Biological Bulletin, 224(2), 99-109. Wong, Y. P., Othman, S., Lau, Y. L., Radu, S., & Chee, H. Y. (2018). Loop-mediated isothermal amplification (LAMP): a versatile technique for detection of microorganisms. Journal of Applied Microbiology, 124(3), 626-643. https://doi.org/10.1111/jam.13647 Zhang, X., Lowe, S. B., & Gooding, J. J. (2014). Brief review of monitoring methods for loop-mediated isothermal amplification (LAMP). Biosensors and Bioelectronics, 61, 491-499. https://doi.org/10.1016/j.bios.2014.05.039 Additional Declarations Competing interest reported. Results presented here are the basis for C. caspia LAMP-based molecular detection that could be part of a solution for field application. Supplementary Files Supplementaryfile1.FulluncroppedGelofFig.1.png Supplementaryfile2.FulluncroppedGelofFig.2Top.png Supplementaryfile3.FulluncroppedGelofFig.3Bottom.png Cite Share Download PDF Status: Published Journal Publication published 15 Dec, 2025 Read the published version in Molecular Biology Reports → Version 1 posted Editorial decision: Revision requested 28 Oct, 2025 Reviews received at journal 23 Oct, 2025 Reviewers agreed at journal 14 Oct, 2025 Reviewers agreed at journal 09 Sep, 2025 Reviewers invited by journal 09 Sep, 2025 Editor assigned by journal 09 Sep, 2025 Submission checks completed at journal 09 Sep, 2025 First submitted to journal 06 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-7553152\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":513882783,\"identity\":\"1ee007bb-a93a-49c1-aeb4-e74a49f11f78\",\"order_by\":0,\"name\":\"Rayan Silva de Paula\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9UlEQVRIiWNgGAWjYPACZhBuYPgApNjYidfC2MA4A6SFmRQtzDwwNj5g3n7G8HPBH+s8/hmJjZ9tfm2T52NmYPzwMQe3FpkzOcbSM9vSiyVuJDZL5/bdNmxjZmCWnLkNtxYJhhwDad6Gw4kNNxIbpHN7bjMCtbAx8+LTwv/G+DfPn8OJ84G2/LbsuW1PWItEjpk0D9vhxA03EtukGX7cTiRCy7Mya16gXwzPPGyz7G24ndzGzNiM3y/8yZtv8wBDTO548uEbP/7ctp3f3nzww0c8WhgYOAxAZAKYzdgGJhvwqQcC9gcILQx/CCgeBaNgFIyCEQkAG3VQxmSoG/sAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Universidade Federal de Minas Gerais\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Rayan\",\"middleName\":\"Silva\",\"lastName\":\"de Paula\",\"suffix\":\"\"},{\"id\":513882784,\"identity\":\"be5a8355-82c6-48fb-854c-3fab85025c73\",\"order_by\":1,\"name\":\"Júlia Meireles Nogueira\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Universidade Federal de Minas Gerais\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Júlia\",\"middleName\":\"Meireles\",\"lastName\":\"Nogueira\",\"suffix\":\"\"},{\"id\":513882785,\"identity\":\"600470cb-e8b3-4bd6-ae7c-1531f5b2369d\",\"order_by\":2,\"name\":\"Amanda Maria Siqueira Moreira\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Universidade Federal de Minas Gerais\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Amanda\",\"middleName\":\"Maria Siqueira\",\"lastName\":\"Moreira\",\"suffix\":\"\"},{\"id\":513882786,\"identity\":\"77b9e1b2-b974-4e63-a0d2-946cbf886a3c\",\"order_by\":3,\"name\":\"Rubens Lima do Monte‑Neto\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Oswaldo Cruz Foundation\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Rubens\",\"middleName\":\"Lima do\",\"lastName\":\"Monte‑Neto\",\"suffix\":\"\"},{\"id\":513882787,\"identity\":\"6bb965f6-84ee-459f-8761-d78ad44bbbb4\",\"order_by\":4,\"name\":\"Gabriel da Luz Wallau\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Oswaldo Cruz Foundation\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Gabriel\",\"middleName\":\"da Luz\",\"lastName\":\"Wallau\",\"suffix\":\"\"},{\"id\":513882788,\"identity\":\"991e5188-6d26-4a6f-b4f9-ca0bc6558902\",\"order_by\":5,\"name\":\"Elverson Soares Melo\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Oswaldo Cruz Foundation\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Elverson\",\"middleName\":\"Soares\",\"lastName\":\"Melo\",\"suffix\":\"\"},{\"id\":513882789,\"identity\":\"575ae026-61fc-450e-95dc-214f581bfaa8\",\"order_by\":6,\"name\":\"Erika Cristina Jorge\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Universidade Federal de Minas Gerais\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Erika\",\"middleName\":\"Cristina\",\"lastName\":\"Jorge\",\"suffix\":\"\"},{\"id\":513882790,\"identity\":\"da5ade50-0644-412b-b520-273099e75a6a\",\"order_by\":7,\"name\":\"Lucília Souza Miranda\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Universidade Federal de Minas Gerais\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Lucília\",\"middleName\":\"Souza\",\"lastName\":\"Miranda\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-09-06 22:23:07\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-7553152/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-7553152/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1007/s11033-025-11378-2\",\"type\":\"published\",\"date\":\"2025-12-15T15:57:59+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":91457230,\"identity\":\"47fa802a-cabc-4e66-a935-1ce0eff26800\",\"added_by\":\"auto\",\"created_at\":\"2025-09-16 16:34:22\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":109479,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eLimit of detection of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eCordylophora caspia\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e using Caspia-LAMP. (a)\\u003c/strong\\u003e Green staining and \\u003cstrong\\u003e(b)\\u003c/strong\\u003e strong fluorescence indicate successful amplification, whereas orange staining or lack of fluorescence indicate negative reactions and controls. \\u003cstrong\\u003e(c)\\u003c/strong\\u003e Ladder-like patterns occurred only in positive samples. DNA concentrations in samples 1–9 were 10, 1, 0.1, 0.01, 0.001, 0.0001, 0.00001, 0.00001, and 0.00001 ng, respectively. \\u003cstrong\\u003eNC:\\u003c/strong\\u003e non-template control; \\u003cstrong\\u003e*:\\u003c/strong\\u003e 1 Kb Plus DNA Ladder (Thermo Fisher Scientific, Waltham, MA).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7553152/v1/48310cedcf1dd7b54004cde2.png\"},{\"id\":91457232,\"identity\":\"08b98076-f221-42b8-ba1f-a38a52f8c99a\",\"added_by\":\"auto\",\"created_at\":\"2025-09-16 16:34:22\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":138584,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMinimum detection time for \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eCordylophora caspia\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e by Caspia-LAMP.\\u003c/strong\\u003e \\u003cstrong\\u003e(a)\\u003c/strong\\u003eAmplification was detected starting at 30 minutes of reaction time, as indicated by green staining, and \\u003cstrong\\u003e(b)\\u003c/strong\\u003ehigh-intensity fluorescence in the tubes. \\u003cstrong\\u003e(c)\\u003c/strong\\u003eThe ladder-like amplification pattern was observed at all times tested. Samples 1, 2, 3, and 4 correspond to reaction times of 30, 60, 90, and 120 minutes, respectively, each containing 1 ng of DNA. Samples 1', 2', 3', and 4' are the corresponding negative controls for each reaction time. NC: non-template control; *: 1 Kb Plus DNA Ladder (Thermo Fisher Scientific).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7553152/v1/b1d6bdd1d3e3740df2270efa.png\"},{\"id\":91457233,\"identity\":\"2317c4ae-2927-4055-b044-19c88f338cd3\",\"added_by\":\"auto\",\"created_at\":\"2025-09-16 16:34:22\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":118440,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSpecies-specificity of the Caspia-LAMP for \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eCordylophora caspia\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e detection.\\u003c/strong\\u003e \\u003cstrong\\u003e(a)\\u003c/strong\\u003e A green color and \\u003cstrong\\u003e(b)\\u003c/strong\\u003e high-intensity fluorescence were observed exclusively in the reaction containing \\u003cem\\u003eC. caspia\\u003c/em\\u003e DNA, indicating successful amplification. In contrast, reactions with DNA from other species displayed orange staining or no fluorescence, indicating no amplification. \\u003cstrong\\u003e(c)\\u003c/strong\\u003eThe ladder-like amplification pattern was observed exclusively in the samples containing \\u003cem\\u003eC. caspia\\u003c/em\\u003e DNA. Species tested included \\u003cem\\u003eC. caspia\\u003c/em\\u003e (\\u003cem\\u003eCc\\u003c/em\\u003e), \\u003cem\\u003eHydra \\u003c/em\\u003esp.\\u003cem\\u003e \\u003c/em\\u003e(\\u003cem\\u003eHy\\u003c/em\\u003e), \\u003cem\\u003eHaliclystus antarcticus \\u003c/em\\u003e(\\u003cem\\u003eHa\\u003c/em\\u003e), \\u003cem\\u003eCorbicula fluminea\\u003c/em\\u003e (\\u003cem\\u003eCf\\u003c/em\\u003e), \\u003cem\\u003eCorbicula largillierti\\u003c/em\\u003e (\\u003cem\\u003eCl\\u003c/em\\u003e), \\u003cem\\u003eLimnoperna fortunei \\u003c/em\\u003e(\\u003cem\\u003eLf\\u003c/em\\u003e), \\u003cem\\u003eDreissena polymorpha\\u003c/em\\u003e (\\u003cem\\u003eDp\\u003c/em\\u003e), and \\u003cem\\u003eDreissena bugensis\\u003c/em\\u003e (\\u003cem\\u003eDb\\u003c/em\\u003e). NC: non-template control; *: 1 Kb Plus DNA Ladder (Thermo Fisher Scientific).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7553152/v1/fa02086ceeaa1b0252ebbb5d.png\"},{\"id\":98814108,\"identity\":\"c309a8da-3be3-4e68-ac58-4da0a5ec88c3\",\"added_by\":\"auto\",\"created_at\":\"2025-12-22 16:11:08\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1045352,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7553152/v1/a26902fb-0ec9-4c1a-b4d5-df9008d71267.pdf\"},{\"id\":91457234,\"identity\":\"4219963b-71ae-4660-9d89-21ba4308fc40\",\"added_by\":\"auto\",\"created_at\":\"2025-09-16 16:34:22\",\"extension\":\"png\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":994860,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supplementaryfile1.FulluncroppedGelofFig.1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7553152/v1/a80ec4a52fefb3ac4f8dde9b.png\"},{\"id\":91457237,\"identity\":\"292b5150-fe68-4ba6-a49f-35ae167c4597\",\"added_by\":\"auto\",\"created_at\":\"2025-09-16 16:34:22\",\"extension\":\"png\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":1028179,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supplementaryfile2.FulluncroppedGelofFig.2Top.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7553152/v1/d04d23d58572628769651d5b.png\"},{\"id\":91458879,\"identity\":\"07855dfe-d6cb-4852-9142-61dc8cd02e4e\",\"added_by\":\"auto\",\"created_at\":\"2025-09-16 16:50:23\",\"extension\":\"png\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":1772101,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supplementaryfile3.FulluncroppedGelofFig.3Bottom.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7553152/v1/3f339dd4f414c17f41c40865.png\"}],\"financialInterests\":\"Competing interest reported. Results presented here are the basis for C. caspia LAMP-based molecular detection that could be part of a solution for field application.\",\"formattedTitle\":\"Caspia-LAMP - species-specific LAMP-based tool for the molecular detection of Cordylophora caspia (Pallas 1771) (Cnidaria, Hydrozoa)\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eThe proliferation of invasive species represents a pressing challenge for global biodiversity conservation, as these species often disrupt native ecosystems and lead to substantial ecological and economic impacts (Bellard et al., \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e; Pimentel et al., \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). Among invasive aquatic species, \\u003cem\\u003eCordylophora caspia\\u003c/em\\u003e (Pallas 1771) has emerged as a particularly problematic organism due to its adaptability to diverse environmental conditions, particularly in brackish and freshwater systems (Bij de Vaate et al., 2002; Folino-Rorem \\u0026amp; Indelicato, \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e). Native to the Caspian and Black Sea regions, \\u003cem\\u003eC. caspia\\u003c/em\\u003e has successfully established populations across a range of geographical locations through human-mediated pathways, such as shipping and canal construction, which have facilitated its spread (Meek et al., \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e2012\\u003c/span\\u003e; Wollschlager et al., \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). As it colonizes new habitats, \\u003cem\\u003eC. caspia\\u003c/em\\u003e competes with native species, alters food web dynamics, and may clog water systems, affecting water management infrastructure necessitating costly maintenance (Mant et al., \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e2012\\u003c/span\\u003e), especially in hydrothermal power plants (Folino-Rorem \\u0026amp; Indelicato, \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e; Grohmann, \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e; Pucherelli et al., \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e; Pucherelli et al., \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eThe detection and monitoring of \\u003cem\\u003eC. caspia\\u003c/em\\u003e are essential for effective management and mitigation efforts (Darling \\u0026amp; Blum, \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e2007\\u003c/span\\u003e). However, conventional detection methods often rely on morphological identification, which can be labor-intensive and requires taxonomic expertise (Trebitz et al., \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). These methods are particularly limited when \\u003cem\\u003eC. caspia\\u003c/em\\u003e populations are sparse, the colonies are fragmented, in early stages of establishment, or inappropriately preserved, complicating field collections and morphological analysis (Diem et al., \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). Furthermore, many aquatic ecosystems contain a wide range of organisms with similar morphologies, increasing the risk of misidentification (Mills et al., \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e2007\\u003c/span\\u003e). For these reasons, there is a critical need for sensitive, accurate, and field-appropriate molecular detection methods that can overcome these limitations and improve the efficiency of \\u003cem\\u003eC. caspia\\u003c/em\\u003e surveillance programs (Darling \\u0026amp; Mahon, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eLoop-Mediated Isothermal Amplification (LAMP) is a molecular method with significant advantages for the DNA detection of invasive species, such as \\u003cem\\u003eC. caspia\\u003c/em\\u003e (Notomi et al., \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e). Developed as an alternative to Polymerase Chain Reaction (PCR), the LAMP method enables DNA amplification under isothermal conditions (60\\u0026ndash;65\\u0026deg;C), eliminating the need for thermal cyclers, which facilitates its use in field analyses (Tomita et al., \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e). This simplicity makes LAMP a powerful tool for field applications, as reactions can be carried out in portable water baths or with other basic heat sources (Wong et al., \\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). LAMP employs a set of four to six primers targeting specific DNA sequences (typically 80\\u0026ndash;250 base pairs), offering a high degree of specificity that is crucial for identifying target species even in complex environmental samples (Mori \\u0026amp; Notomi, \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eBeyond its ease of use, one of the main advantages of LAMP is the speed of obtaining results, which are usually detectable within 30 to 60 minutes after the reaction begins (Zhang et al., \\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). The method is highly sensitive and can detect low quantities of DNA, which is particularly valuable for early detection in ecosystems where \\u003cem\\u003eC. caspia\\u003c/em\\u003e may be present in low densities (Nagamine et al., \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e2002\\u003c/span\\u003e). Furthermore, the products of LAMP reactions can be detected through different approaches, such as changes in turbidity, color shifts, or fluorescence emission, depending on the reagents employed (Tanner et al., \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eThis study aims to develop a LAMP protocol specifically designed for the detection of \\u003cem\\u003eC. caspia\\u003c/em\\u003e (Caspia-LAMP), targeting a DNA region unique to the species to avoid cross-reactivity with non-target organisms. We hypothesize that Caspia-LAMP will provide a rapid, specific, and sensitive detection method suitable for both laboratory (this study) and field (in the future) environments. By implementing LAMP, we seek to provide a tool that can facilitate more effective and accessible monitoring of \\u003cem\\u003eC. caspia\\u003c/em\\u003e, contributing to broader efforts to manage invasive species and protect vulnerable aquatic ecosystems (Hulme, \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2009\\u003c/span\\u003e; Lodge et al., \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e), especially in places such as Brazil, where the presence of \\u003cem\\u003eC. caspia\\u003c/em\\u003e has been neglected despite the invasion has been silently established for a long time (de Paula et al., \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e).\\u003c/p\\u003e\"},{\"header\":\"Material and methods\",\"content\":\"\\u003cp\\u003eSampling and DNA extraction\\u003c/p\\u003e\\u003cp\\u003eThe \\u003cem\\u003eC. caspia\\u003c/em\\u003e sample used here was previously manually collected from two coal seal filters of the hydroelectric power plant S\\u0026atilde;o Sim\\u0026atilde;o (HPP-S\\u0026atilde;o Sim\\u0026atilde;o) on the Parana\\u0026iacute;ba River in Goi\\u0026aacute;s (GO) state, Brazil (-19.018683; -50.500142), and its morphological characterization was shown by de Paula et al. (\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). Total DNA was extracted from gonophores and the terminal portion of tentacles using the E.Z.N.A\\u0026reg; Mollusc DNA Kit (Omega Bio-tek, Norcross, GA), according to the manufacturer\\u0026rsquo;s instructions. To optimize DNA quality, the pulverized samples treated with proteinase K were incubated overnight at 37\\u0026deg;C in a water bath (CB 830-E, Heto-Holten, Gydevang, DK), following an alternative protocol recommended by the kit manufacturer. DNA concentration and purity were assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).\\u003c/p\\u003e\\u003cp\\u003eAll molecular assays involving the genetic heritage of the organisms used in this study comply with the standards of SisGen (\\u003cem\\u003eSistema Nacional de Gest\\u0026atilde;o do Patrim\\u0026ocirc;nio Gen\\u0026eacute;tico e do Conhecimento Tradicional Associado\\u003c/em\\u003e) and are registered under access code A4659D9.\\u003c/p\\u003e\\u003cp\\u003ePrimer design\\u003c/p\\u003e\\u003cp\\u003eDraft genome sequence data of \\u003cem\\u003eC. caspia\\u003c/em\\u003e (unpublished) were analyzed using RepeatModeler2 (version 2.0.4) (Flynn et al., \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e) to identify transposable element (TE) families. The resulting consensus families were processed to remove satellites and artifacts. Remaining sequences were submitted to RepeatMasker (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.repeatmasker.org/\\u003c/span\\u003e\\u003cspan address=\\\"https://www.repeatmasker.org/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) to estimate copy number and Kimura 2-parameter (K2P) divergence within the \\u003cem\\u003eC. caspia\\u003c/em\\u003e genome. This approach was based on the hypothesis that high repetitiveness and low divergence would enhance the efficiency of LAMP amplification for \\u003cem\\u003eC. caspia\\u003c/em\\u003e DNA. Only consensus sequences with less than 65% similarity to other cnidarians and mollusks, evaluated by blastn (BLAST 2.2.31\\u0026thinsp;+\\u0026thinsp;version), were retained for further analysis, ensuring specificity to \\u003cem\\u003eC. caspia\\u003c/em\\u003e. TE families that had more than 50 slightly divergent copies in the \\u003cem\\u003eC. caspia\\u003c/em\\u003e genome and covering at least 80% of the consensus length were identified using the TE-Aid tool (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://github.com/clemgoub/TE-Aid\\u003c/span\\u003e\\u003cspan address=\\\"https://github.com/clemgoub/TE-Aid\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e).\\u003c/span\\u003e Primers were designed using Primer Explorer V5 (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://primerexplorer.jp/e/\\u003c/span\\u003e\\u003cspan address=\\\"https://primerexplorer.jp/e/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e)\\u003c/span\\u003e and are shown in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. The resulting amplicon sequence was also aligned against all available cnidarian genomes, as well as the NCBI NT database, to confirm its specificity to \\u003cem\\u003eC. caspia\\u003c/em\\u003e.\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eLAMP primers used to detect \\u003cem\\u003eCordylophora caspia\\u003c/em\\u003e. \\u003cb\\u003eF3/B3\\u003c/b\\u003e: outer primers; \\u003cb\\u003eFIP/BIP\\u003c/b\\u003e: inner primers; \\u003cb\\u003eLF/BF\\u003c/b\\u003e: loop-primers.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"2\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003ePrimer\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eSequence\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCaspia-LAMP_F3\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eTGCCAAAGAAAATGGTGAAC\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCaspia-LAMP_B3\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eGCAACAATATCATGGTCCAAAT\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCaspia-LAMP_FIP\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eACCCATCTGTTGTGTGCAAATTCTTTCAATCACATTTGATGAGTCTAC\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCaspia-LAMP_BIP\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eTCTTGGAATGGTCCGTGTCAGAATTTTTCAAGTCGTTGCTTTA\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCaspia-LAMP_LF\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eTCATAAATCGCCGATTCCTTACAGA\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCaspia-LAMP_LB\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eGGCAGCATGAACACTGAGAAACT\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003eLoop-Mediated Isothermal Amplification for \\u003cem\\u003eC. caspia\\u003c/em\\u003e (Caspia-LAMP) detection\\u003c/p\\u003e\\u003cp\\u003eThe Caspia-LAMP reaction mixture was prepared as follows: 1 \\u0026micro;L of \\u003cem\\u003eBst\\u003c/em\\u003e DNA Polymerase 2.0 WarmStart (320 U/mL, New England Biolabs, Ipswich, MA), 2.5 \\u0026micro;L of 10X Isothermal Amplification Buffer containing 2 mM MgSO₄ (New England Biolabs), 1.5 \\u0026micro;L of 6 mM additional MgSO₄ (final concentration of 8 mM), 3.5 \\u0026micro;L of dNTP Mix (1.4 mM each), 1 \\u0026micro;L of FIP/BIP primers (1.6 \\u0026micro;M each), 1 \\u0026micro;L of F3/B3 primers (0.2 \\u0026micro;M each), and 1 \\u0026micro;L of LoopF/LoopB primers (0.4 \\u0026micro;M each). DNA quantities varied depending on the assay, and the final volume was adjusted to 25 \\u0026micro;L with nuclease-free water. Reactions were incubated at 65\\u0026deg;C in a water bath (CB 830-E, Heto-Holten, Gydevang, DK), with incubation times adjusted according to experimental conditions (described below). After amplification, the enzyme was inactivated by heating at 80\\u0026deg;C for 20 minutes. For visualization, 1 \\u0026micro;L of 10,000X SYBR\\u0026reg; Green I Nucleic Acid Stain (Lonza Bioscience, Morrisville, NC) was added directly to each tube, and fluorescence was examined under UV light. Amplification was further confirmed by resolving the products on a 2% agarose gel.\\u003c/p\\u003e\\u003cp\\u003eTo minimize contamination, DNA extraction, LAMP mixture, and amplification were conducted in separate rooms. SYBR\\u0026reg; Green I was added to open tubes within a hood. All assays were conducted in triplicate, from independent assays performed on different days.\\u003c/p\\u003e\\u003cp\\u003eAmplification Sensitivity\\u003c/p\\u003e\\u003cp\\u003eThe Limit of Detection (LoD) of the Caspia-LAMP assay was determined using serial dilutions of \\u003cem\\u003eC. caspia\\u003c/em\\u003e DNA, ranging from 10 to 10⁻⁸ ng. The assay was considered negative when SYBR\\u0026reg; Green I fluorescence was no longer detectable under UV light. Each reaction was incubated for 60 min in a water bath (CB 830-E, Heto-Holten), followed by enzyme inactivation and visualization on 2% agarose gel under UV light.\\u003c/p\\u003e\\u003cp\\u003eMinimum reaction time for detection\\u003c/p\\u003e\\u003cp\\u003eTo determine the minimum detection time of the Caspia-LAMP assay, four samples containing 1 ng of \\u003cem\\u003eC. caspia\\u003c/em\\u003e DNA were incubated at 65\\u0026deg;C in a water bath (CB 830-E, Heto-Holten) for 30, 60, 90, and 120 min. Following incubation, SYBR\\u0026reg; Green I was added, and fluorescence was examined under UV light. Amplification was further confirmed by resolving the products on a 2% agarose gel.\\u003c/p\\u003e\\u003cp\\u003eCross-reactivity with other species\\u003c/p\\u003e\\u003cp\\u003eCross-reactivity tests were performed using 1 ng of total DNA from \\u003cem\\u003eC. caspia\\u003c/em\\u003e and control DNA (previously available in the laboratory) from various organisms to the LAMP assay for 30 min in a water bath (CB 830-E, Heto-Holten), followed by enzyme denaturation and UV visualization. Control species tested with Caspia-LAMP primers included: cnidarians \\u003cem\\u003eHydra\\u003c/em\\u003e sp. (cf. \\u003cem\\u003eviridissima\\u003c/em\\u003e Pallas 1766) and \\u003cem\\u003eHaliclystus antarcticus\\u003c/em\\u003e Pfeffer 1889; and co-invasive bivalves with \\u003cem\\u003eC. caspia\\u003c/em\\u003e in South America, \\u003cem\\u003eCorbicula fluminea\\u003c/em\\u003e (M\\u0026uuml;ller 1774), \\u003cem\\u003eCorbicula largillierti\\u003c/em\\u003e (Philippi 1844), and \\u003cem\\u003eLimnoperna fortunei\\u003c/em\\u003e (Dunker 1857) \\u0026mdash; and North America, \\u003cem\\u003eDreissena polymorpha\\u003c/em\\u003e (Pallas 1771) and \\u003cem\\u003eDreissena bugensis\\u003c/em\\u003e (Andrusov 1897). The products were further verified on a 2% agarose gel to confirm amplification.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003eCaspia-LAMP has a LoD of 10⁻⁷ ng for \\u003cem\\u003eC. caspia\\u003c/em\\u003e DNA\\u003c/p\\u003e\\u003cp\\u003eDNA concentrations ranging from 10 ng to 10⁻⁸ ng were tested, with the assay demonstrating a sensitivity range from 10 ng to 10⁻⁷ ng (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). Under UV light, successful amplification was indicated by green fluorescence (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e\\u0026ndash;9) or high-intensity light (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eb \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e\\u0026ndash;9), while reactions without amplification displayed orange staining or no light, representing negative results (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea/b 10) and the negative control (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea/b NC). The colorimetric results were consistent with the ladder-like amplification pattern observed on the agarose gel (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ec). This pattern was visible for all samples containing \\u003cem\\u003eC. caspia\\u003c/em\\u003e DNA (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ec, lanes 1\\u0026ndash;9).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eCaspia-LAMP detects \\u003cem\\u003eC. caspia\\u003c/em\\u003e DNA within 30 minutes\\u003c/p\\u003e\\u003cp\\u003eSamples subjected to reaction conditions for 30, 60, 90, and 120 minutes demonstrated detection starting at 30 minutes, as indicated by the green staining of tubes and samples from that point onward (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ea/b 1\\u0026ndash;4). The negative controls for each reaction time are represented by the corresponding sample number with an apostrophe (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ea/b 1'\\u0026ndash;4'), showing orange staining or absence of fluorescence, indicating no amplification.\\u003c/p\\u003e\\u003cp\\u003eThe fluorimetric results were further validated by the ladder-like amplification pattern observed on the agarose gel for samples incubated at all tested times (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ec, lanes 1\\u0026ndash;4). Notably, no spurious amplification was detected, even at longer incubation periods (90 and 120 minutes), indicating that the Caspia-LAMP assay is robust, with minimal to no interference.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eCaspia-LAMP specifically identifies \\u003cem\\u003eC. caspia\\u003c/em\\u003e without cross-reactivity to other species\\u003c/p\\u003e\\u003cp\\u003eCross-amplification reactions were performed to evaluate the specificity of primers for \\u003cem\\u003eC. caspia\\u003c/em\\u003e, using DNA obtained from various species, including cnidarians and mollusks \\u0026mdash; specifically bivalves that are invasive species co-occurring with \\u003cem\\u003eC. caspia\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). The assay produced a green fluorescence exclusively in the reaction containing \\u003cem\\u003eC. caspia\\u003c/em\\u003e DNA (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea/b \\u003cem\\u003eCc\\u003c/em\\u003e). Reactions using template DNA from other cnidarians \\u0026mdash; \\u003cem\\u003eHydra\\u003c/em\\u003e sp. (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea/b \\u003cem\\u003eHy\\u003c/em\\u003e) and \\u003cem\\u003eH. antarcticus\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea/b \\u003cem\\u003eHa)\\u003c/em\\u003e \\u0026mdash; as well as from co-invasive bivalves \\u0026mdash; \\u003cem\\u003eC. fluminea\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea/b \\u003cem\\u003eCf\\u003c/em\\u003e), \\u003cem\\u003eC. largillierti\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea/b \\u003cem\\u003eCl\\u003c/em\\u003e), \\u003cem\\u003eL. fortunei\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea/b \\u003cem\\u003eLf\\u003c/em\\u003e), \\u003cem\\u003eD. polymorpha\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea/b \\u003cem\\u003eDp\\u003c/em\\u003e), and \\u003cem\\u003eD. bugensis\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea/b \\u003cem\\u003eDb\\u003c/em\\u003e) \\u0026mdash; all exhibited either orange staining or absence of fluorescence, indicating no amplification. The negative control (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea/b NC) likewise showed no amplification. Further confirmation of specificity was provided by the ladder-like amplification pattern observed exclusively on the agarose gel for the \\u003cem\\u003eC. caspia\\u003c/em\\u003e reaction (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ec, lane \\u003cem\\u003eCc\\u003c/em\\u003e).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eThe development of specific molecular tools for the early detection of invasive species represents a crucial advancement in environmental monitoring and conservation efforts. Traditionally, the identification of aquatic invasive species has relied heavily on universal molecular markers, such as the Folmer region of \\u003cem\\u003eCOI\\u003c/em\\u003e (\\u003cem\\u003eCytochrome C Oxidase Subunit 1\\u003c/em\\u003e; Folmer et al., \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e1994\\u003c/span\\u003e), which, while valuable for broad taxonomic studies, may lack the specificity required for rapid and accurate species-level identification. The absence of species-specific molecular markers for \\u003cem\\u003eC. caspia\\u003c/em\\u003e has historically limited our ability to detect this invasive hydrozoan during early invasion stages, when management interventions are most effective (Trebitz et al., \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e), also resulting in neglected biological knowledge and an underestimated geographical distribution of the species (de Paula et al., \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eEstablishment of markers for \\u003cem\\u003eC. caspia\\u003c/em\\u003e is particularly crucial given its role as a foundation species in invaded environments. The complex three-dimensional structure of \\u003cem\\u003eC. caspia\\u003c/em\\u003e colonies provides substrate and shelter for various organisms, including other hydrozoans, amphipods, and microorganisms (Pucherelli et al., \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e; Pucherelli et al., \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e; da Silva Bert\\u0026atilde;o et al., \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e), even facilitating the invasion of other species, such as the golden mussel \\u003cem\\u003eL. fortunei\\u003c/em\\u003e (Portella et al., \\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e2009\\u003c/span\\u003e). This ecological characteristic makes traditional morphological identification even more challenging, as samples may contain multiple species intertwined within filaments of the hydroid. Additionally, bacterial and algal biofilms commonly associated with \\u003cem\\u003eC. caspia\\u003c/em\\u003e colonies can interfere with DNA-based detection methods that lack species specificity (Medlin \\u0026amp; Orozco, \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). Caspia-LAMP protocol addresses these challenges by targeting unique genomic regions of \\u003cem\\u003eC. caspia\\u003c/em\\u003e, enabling accurate identification even in samples containing multiple species.\\u003c/p\\u003e\\u003cp\\u003eOur study addresses this gap by developing a specific LAMP-based detection method for \\u003cem\\u003eC. caspia\\u003c/em\\u003e that demonstrates remarkable sensitivity, agility, and specificity with a LoD of 10\\u003csup\\u003e\\u0026minus;\\u0026thinsp;7\\u003c/sup\\u003e ng (0.1 pg) DNA from 30 minutes. This level of sensitivity surpasses that typically achieved through conventional PCR methods, which often require DNA concentrations in the picogram to nanogram range (Notomi et al., \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e). The enhanced sensitivity of our Caspia-LAMP protocol is particularly valuable for early detection programs, as it enables the identification of \\u003cem\\u003eC. caspia\\u003c/em\\u003e even when present at very low densities or during initial colonization phases (Darling \\u0026amp; Mahon, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eThe use of LAMP technology for species-specific detection has shown significant promise across various fields, including parasite detection in medical diagnostics (Wong et al., \\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e), conservation monitoring of endangered species (Khodaparast et al., \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e), and surveillance of other invasive species (Carvalho et al., \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e; de Paula et al., \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). Our results align with these studies, demonstrating the versatility and reliability of LAMP as a molecular tool. The success of the method in detecting \\u003cem\\u003eC. caspia\\u003c/em\\u003e suggests potential applications for monitoring other invasive cnidarians, particularly in complex aquatic environments where traditional morphological identification may be challenging.\\u003c/p\\u003e\\u003cp\\u003eA particularly promising aspect of our Caspia-LAMP protocol is its potential application for environmental DNA (eDNA) detection and various life stages of \\u003cem\\u003eC. caspia\\u003c/em\\u003e, including larvae and menonts (de Paula et al., \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). While our current study focused on DNA extracted directly from tissue samples, the high sensitivity of LAMP suggests it could effectively detect trace amounts of DNA in water samples or identify cryptic life stages that are typically difficult to detect through visual inspection (Thomsen \\u0026amp; Willerslev, \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e). This capability could revolutionize monitoring programs by enabling non-invasive sampling and early detection of \\u003cem\\u003eC. caspia\\u003c/em\\u003e populations before they become visually apparent.\\u003c/p\\u003e\\u003cp\\u003eThe economic implications of invasive species management are substantial, with global costs estimated in the hundreds of billions of dollars annually (Diagne et al., \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). Early detection methods, such as the Caspia-LAMP protocol, offer a cost-effective approach to monitoring and can facilitate rapid response strategies when invasions are detected. The isothermal nature of LAMP makes it particularly suitable for field applications, requiring minimal equipment and providing results within hours rather than days (Mori \\u0026amp; Notomi, \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eThe development of this specific molecular tool for \\u003cem\\u003eC. caspia\\u003c/em\\u003e represents a significant step forward in invasive species monitoring. The high sensitivity and specificity of the Caspia-LAMP protocol, combined with its potential field applications, provide environmental managers with a powerful tool for early detection and rapid response to \\u003cem\\u003eC. caspia\\u003c/em\\u003e invasions. This advancement comes at a crucial time when global climate change and increased global trade are facilitating the spread of invasive species across traditional biogeographic barriers (Seebens et al., \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e).\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eOur study demonstrates that LAMP technology offers a promising alternative for monitoring invasive species, particularly in aquatic environments where early detection is crucial but challenging. The successful development of a species-specific LAMP protocol for \\u003cem\\u003eC. caspia\\u003c/em\\u003e (Caspia-LAMP) not only provides a valuable tool for managing this particular species but also serves as a model for developing similar protocols for other invasive species. As we face increasing challenges from biological invasions, the implementation of sensitive, specific, and field-applicable molecular tools will become increasingly important for effective environmental management and conservation efforts.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003eauthors gratefully acknowledge Fapemig (\\u003cem\\u003eFunda\\u0026ccedil;\\u0026atilde;o de Amparo \\u0026agrave; Pesquisa do Estado de Minas Gerais),\\u003c/em\\u003e CAPES (\\u003cem\\u003eCoordena\\u0026ccedil;\\u0026atilde;o de Aperfei\\u0026ccedil;oamento de Pessoal de N\\u0026iacute;vel Superior\\u003c/em\\u003e), CNPq (\\u003cem\\u003eConselho Nacional de Desenvolvimento Cient\\u0026iacute;fico e Tecnol\\u0026oacute;gico\\u003c/em\\u003e) and Fiocruz for financial support. ECJ received a scholarship from CNPq. RLdMN is a CNPq research fellow (grant number CNPq 312353/2023-5). Research coordinated by RLdMN is supported by Fapemig and \\u0026ldquo;Programa Inova Fiocruz\\u0026rdquo; from Oswaldo Cruz Foundation. GLW hold fellowships from CNPq (Grant processes 307209/2023-7).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003eRSdP:\\u003c/strong\\u003e Conceptualization, Methodology, Investigation; Writing original draft preparation and editing. \\u003cstrong\\u003eJMN:\\u003c/strong\\u003e Conceptualization; Methodology; Investigation; Writing review and editing. \\u003cstrong\\u003eAMSM:\\u003c/strong\\u003e Conceptualization; Methodology; Writing review and editing. \\u003cstrong\\u003eRLdMN:\\u003c/strong\\u003e Conceptualization and design; Methodology; Writing and revision and editing; Mentoring and consulting. \\u003cstrong\\u003eGLW:\\u0026nbsp;\\u003c/strong\\u003e Methodology; Writing review and editing. \\u003cstrong\\u003eESdM:\\u0026nbsp;\\u003c/strong\\u003eMethodology; Writing review and editing. \\u003cstrong\\u003eECJ:\\u0026nbsp;\\u003c/strong\\u003eFunding provision; Writing review and editing. manuscript. \\u003cstrong\\u003eLSM:\\u0026nbsp;\\u003c/strong\\u003eConceptualization; Funding provision; Writing review and editing. All authors read and approved the final manuscript.\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll data generated or analysed during this study are included in this published article.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003eEthical approval\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll authors have read, understood, and have complied as applicable with the statement on \\u0026ldquo;Ethical responsibilities of Authors\\u0026rdquo; as found in the Instructions for Authors.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eResults presented here are the basis for \\u003cem\\u003eC. caspia\\u0026nbsp;\\u003c/em\\u003eLAMP-based molecular detection that could be part of a solution for field application.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis study was supported by the FAPEMIG APQ-02147\\u0026ndash;21.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eBellard, C., Cassey, P., \\u0026amp; Blackburn, T. M. (2016). Alien species as a driver of recent extinctions. Biology Letters, 12(2), 20150623. https://royalsocietypublishing.org/doi/full/10.1098/rsbl.2015.0623 \\u003c/li\\u003e\\n\\u003cli\\u003eBij de Vaate, A., Jazdzewski, K., Ketelaars, H. A., Gollasch, S., \\u0026amp; Van der Velde, G. (2002). Geographical patterns in range extension of Ponto-Caspian macroinvertebrate species in Europe. Canadian Journal of Fisheries and Aquatic Sciences, 59(7), 1159-1174. https://doi.org/10.1139/f02-098 \\u003c/li\\u003e\\n\\u003cli\\u003eCarvalho, J., Garrido-Maestu, A., Azinheiro, S., Fuci\\u0026ntilde;os, P., Barros-Vel\\u0026aacute;zquez, J., De Miguel, R. J., ... \\u0026amp; Prado, M. (2021). Faster monitoring of the invasive alien species (IAS) Dreissena polymorpha in river basins through isothermal amplification. \\u003cem\\u003eScientific Reports\\u003c/em\\u003e, \\u003cem\\u003e11\\u003c/em\\u003e(1), 10175. https://doi.org/10.1038/s41598-021-89574-w \\u003c/li\\u003e\\n\\u003cli\\u003eda Silva Bert\\u0026atilde;o, A. P., Leite, R. V. V., Horodesky, A., Pie, M. R., Zanin, T. L., Netto, O. S. M., \\u0026amp; Ostrensky, A. (2021). Ecological interactions between invasive and native fouling species in the reservoir of a hydroelectric plant. Hydrobiologia, 848, 5169-5185. https://doi.org/10.1007/s10750-021-04706-7 \\u003c/li\\u003e\\n\\u003cli\\u003eDarling, J. A., \\u0026amp; Blum, M. J. (2007). DNA-based methods for monitoring invasive species: a review and prospectus. Biological Invasions, 9(7), 751-765. https://doi.org/10.1007/s10530-006-9079-4 \\u003c/li\\u003e\\n\\u003cli\\u003eDarling, J. A., \\u0026amp; Mahon, A. R. (2011). From molecules to management: adopting DNA-based methods for monitoring biological invasions in aquatic environments. Environmental Research, 111(7), 978-988. https://doi.org/10.1016/j.envres.2011.02.001 \\u003c/li\\u003e\\n\\u003cli\\u003ede Paula, R. S., Cunha, A. F. E., Reis, M. P., Souza, C. C.., de Oliveira Junior, R. B., Barbosa, N. P. U., ... \\u0026amp; Miranda, L. S. (2024). Evidence of cryptic speciation in the invasive hydroid \\u003cem\\u003eCordylophora caspia\\u003c/em\\u003e (Pallas, 1771) (Cnidaria, Hydrozoa) supported by new records. Organisms Diversity \\u0026amp; Evolution, 24(1), 35-50. https://doi.org/10.1007/s13127-023-00632-9 \\u003c/li\\u003e\\n\\u003cli\\u003ede Paula, R. S., Monte-Neto, R. L., da Luz Wallau, G., de Paula Reis, M., Souza, C. C., Nogueira, J. M., ... \\u0026amp; Jorge, E. C. (2023). Laboratory validation of loop-mediated isothermal amplification (LAMP) assay for \\u003cem\\u003eLimnoperna fortunei \\u003c/em\\u003e(Dunker 1857) detection. Biological Invasions, 25(12), 3859-3870. https://doi.org/10.1007/s10530-023-03143-y \\u003c/li\\u003e\\n\\u003cli\\u003eDiagne, C., Leroy, B., Vaissi\\u0026egrave;re, A. C., Gozlan, R. E., Roiz, D., Jarić, I., ... \\u0026amp; Courchamp, F. (2021). High and rising economic costs of biological invasions worldwide. Nature, 592(7855), 571-576. https://doi.org/10.1038/s41586-021-03405-6 \\u003c/li\\u003e\\n\\u003cli\\u003eDiem, A., Ramalhosa, P., Cacabelos, E., Ferrario, J., Castro, N., Henriques, F., ... \\u0026amp; Gestoso, I. (2023). Monitoring non-indigenous species with passive sampling methods in an Oceanic Island. Journal of Marine Science and Engineering, 11(2), 264. https://doi.org/10.3390/jmse11020264 \\u003c/li\\u003e\\n\\u003cli\\u003eFolino-Rorem, N. C., \\u0026amp; Indelicato, J. (2005). Controlling biofouling caused by the colonial hydroid \\u003cem\\u003eCordylophora caspia\\u003c/em\\u003e. Water Research, 39(12), 2731-2737. https://doi.org/10.1016/j.watres.2005.04.053 \\u003c/li\\u003e\\n\\u003cli\\u003eFolmer, O., Black, M., Hoeh, W., Lutz, R., \\u0026amp; Vrijenhoek, R. (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3(5), 294-299.\\u003c/li\\u003e\\n\\u003cli\\u003eFlynn, J. M., Hubley, R., Goubert, C., Rosen, J., Clark, A. G., Feschotte, C., \\u0026amp; Smit, A. F. (2020). RepeatModeler2 for automated genomic discovery of transposable element families. Proceedings of the National Academy of Sciences, 117(17), 9451-9457. https://doi.org/10.1073/pnas.1921046117 \\u003c/li\\u003e\\n\\u003cli\\u003eGrohmann, P. A. (2008). Bioencrustration in the turbine cooling system at the funil hydroelectric power plant, Itatiaia, Rio de Janeiro, Brazil. Naturalia, 31, 16-21.\\u003c/li\\u003e\\n\\u003cli\\u003eHulme, P. E. (2009). Trade, transport and trouble: managing invasive species pathways in an era of globalization. Journal of Applied Ecology, 46(1), 10-18. https://doi.org/10.1111/j.1365-2664.2008.01600.x \\u003c/li\\u003e\\n\\u003cli\\u003eKhodaparast, M., Sharley, D., Marshall, S., \\u0026amp; Beddoe, T. (2024). Rapid and cost‐effective \\u003cem\\u003ePlatypus \\u003c/em\\u003eeDNA detection in waterways using loop‐mediated isothermal amplification assay: advancing conservation efforts. Environmental DNA, 6(5), e70003. https://doi.org/10.1002/edn3.70003 \\u003c/li\\u003e\\n\\u003cli\\u003eLodge, D. M., Simonin, P. W., Burgiel, S. W., Keller, R. P., Bossenbroek, J. M., Jerde, C. L., ... \\u0026amp; Zhang, H. (2016). Risk analysis and bioeconomics of invasive species to inform policy and management. Annual Review of Environment and Resources, 41, 453-488. https://doi.org/10.1146/annurev-environ-110615-085532 \\u003c/li\\u003e\\n\\u003cli\\u003eMant, R. C., Moggridge, G. D., \\u0026amp; Aldridge, D. C. (2012). Control of biofouling by \\u003cem\\u003eCordylophora caspia\\u003c/em\\u003e in freshwater using one-off, pulsed and intermittent dosing of chlorine: laboratory evaluation. Biofouling, 28(8), 849-860. https://doi.org/10.1080/08927014.2012.683865 \\u003c/li\\u003e\\n\\u003cli\\u003eMedlin, L. K., \\u0026amp; Orozco, J. (2017). Molecular techniques for the detection of organisms in aquatic environments, with emphasis on harmful algal bloom species. \\u003cem\\u003eSensors\\u003c/em\\u003e, \\u003cem\\u003e17\\u003c/em\\u003e(5), 1184. https://doi.org/10.3390/s17051184 \\u003c/li\\u003e\\n\\u003cli\\u003eMeek, M. H., Wintzer, A. P., Wetzel, W. C., \\u0026amp; May, B. (2012). Climate change likely to facilitate the invasion of the non‐native hydroid, \\u003cem\\u003eCordylophora caspia\\u003c/em\\u003e, in the San Francisco estuary. PLoS One, 7(10), e46373. https://doi.org/10.1371/journal.pone.0046373 \\u003c/li\\u003e\\n\\u003cli\\u003eMills, C. E., Marques, A. C., Migotto, A. E., Calder, D. R., \\u0026amp; Hand, C. (2007). Hydrozoa: descriptions of genera and species. The Light and Smith Manual: Intertidal Invertebrates from Central California to Oregon, 118-168.\\u003c/li\\u003e\\n\\u003cli\\u003eMori, Y., \\u0026amp; Notomi, T. (2020). Loop-mediated isothermal amplification (LAMP): expansion of its practical application as a tool to achieve universal health coverage. Journal of Infection and Chemotherapy, 26(1), 13-17. https://doi.org/10.1016/j.jiac.2019.07.020 \\u003c/li\\u003e\\n\\u003cli\\u003eNagamine, K., Hase, T., \\u0026amp; Notomi, T. (2002). Accelerated reaction by loop-mediated isothermal amplification using loop primers. Molecular and Cellular Probes, 16(3), 223-229. https://doi.org/10.1006/mcpr.2002.0415 \\u003c/li\\u003e\\n\\u003cli\\u003eNotomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., \\u0026amp; Hase, T. (2015). Loop-mediated isothermal amplification of DNA. Nucleic Acids Research, 28(12), e63-e63. https://doi.org/10.1093/nar/28.12.e63 \\u003c/li\\u003e\\n\\u003cli\\u003ePimentel, D., Zuniga, R., \\u0026amp; Morrison, D. (2021). Update on the environmental and economic costs associated with alien-invasive species in the United States. Ecological Economics, 52(3), 273-288. https://doi.org/10.1016/j.ecolecon.2004.10.002 \\u003c/li\\u003e\\n\\u003cli\\u003ePortella, K. F., Joukoski, A., Silva, A. S., Brassac, N. M., \\u0026amp; Belz, C. E. (2009). Biofouling e biodeteriora\\u0026ccedil;\\u0026atilde;o qu\\u0026iacute;mica de argamassa de cimento portland em reservat\\u0026oacute;rio de usina hidroel\\u0026eacute;trica. Qu\\u0026iacute;mica Nova, 32(4), 1047-1051. https://doi.org/10.1590/S0100-40422009000400037 \\u003c/li\\u003e\\n\\u003cli\\u003ePucherelli, S. F., Claudi, R., \\u0026amp; Prescott, T. (2018). Control of biofouling in hydropower cooling systems using HOD ultraviolet light. Management of Biological Invasions, 9(4), 451. https://doi.org/10.3391/mbi.2018.9.4.08 \\u003c/li\\u003e\\n\\u003cli\\u003ePucherelli, S. F., Keele, J., Passamaneck, Y. J., Beaver, J. R., \\u0026amp; Renicker, T. R. (2016). Range expansion of the invasive hydroid, Cordylophora caspia (Pallas, 1771), in Colorado River reservoirs. \\u003cem\\u003eBioinvasions Records\\u003c/em\\u003e, \\u003cem\\u003e5\\u003c/em\\u003e(3), 133-137. me 5, Issue 3: 133\\u0026ndash;137 DOI: http://dx.doi.org/10.3391/bir.2016.5.3.02 \\u003c/li\\u003e\\n\\u003cli\\u003eSeebens, H., Blackburn, T. M., Dyer, E. E., Genovesi, P., Hulme, P. E., Jeschke, J. M., ... \\u0026amp; Essl, F. (2017). No saturation in the accumulation of alien species worldwide. Nature Communications, 8(1), 1-9. https://doi.org/10.1038/ncomms14435 \\u003c/li\\u003e\\n\\u003cli\\u003eTanner, N. A., Zhang, Y., \\u0026amp; Evans Jr, T. C. (2015). Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes. BioTechniques, 58(2), 59-68. https://doi.org/10.2144/000114253 \\u003c/li\\u003e\\n\\u003cli\\u003eThomsen, P. F., \\u0026amp; Willerslev, E. (2015). Environmental DNA \\u0026ndash; An emerging tool in conservation for monitoring past and present biodiversity. Biological Conservation, 183, 4-18. https://doi.org/10.1016/j.biocon.2014.11.019 \\u003c/li\\u003e\\n\\u003cli\\u003eTomita, N., Mori, Y., Kanda, H., \\u0026amp; Notomi, T. (2008). Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols, 3(5), 877-882. https://doi.org/10.1038/nprot.2008.57 \\u003c/li\\u003e\\n\\u003cli\\u003eTrebitz, A. S., Hoffman, J. C., Darling, J. A., Pilgrim, E. M., Kelly, J. R., Brown, E. A., ... \\u0026amp; Schardt, J. C. (2017). Early detection monitoring for aquatic non-indigenous species: Optimizing surveillance, incorporating advanced technologies, and identifying research needs. Journal of Environmental Management, 202, 299-310. https://doi.org/10.1016/j.jenvman.2017.07.045 \\u003c/li\\u003e\\n\\u003cli\\u003eWollschlager, J., Folino-Rorem, N., \\u0026amp; Daly, M. (2013). Nematocysts of the invasive hydroid Cordylophora caspia (Cnidaria: Hydrozoa). The Biological Bulletin, 224(2), 99-109.\\u003c/li\\u003e\\n\\u003cli\\u003eWong, Y. P., Othman, S., Lau, Y. L., Radu, S., \\u0026amp; Chee, H. Y. (2018). Loop-mediated isothermal amplification (LAMP): a versatile technique for detection of microorganisms. Journal of Applied Microbiology, 124(3), 626-643. https://doi.org/10.1111/jam.13647 \\u003c/li\\u003e\\n\\u003cli\\u003eZhang, X., Lowe, S. B., \\u0026amp; Gooding, J. J. (2014). Brief review of monitoring methods for loop-mediated isothermal amplification (LAMP). Biosensors and Bioelectronics, 61, 491-499. https://doi.org/10.1016/j.bios.2014.05.039\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"molecular-biology-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"mole\",\"sideBox\":\"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)\",\"snPcode\":\"11033\",\"submissionUrl\":\"https://submission.nature.com/new-submission/11033/3\",\"title\":\"Molecular Biology Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"Environmental monitoring, Early detection, Hydrozoan, LAMP method, repetitive DNA\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-7553152/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-7553152/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eThe rapid detection of invasive species is crucial for effective management and mitigation of their ecological and economic impacts. \\u003cem\\u003eCordylophora caspia\\u003c/em\\u003e is an invasive hydroid that has successfully colonized freshwater and brackish ecosystems worldwide, causing significant environmental and infrastructural problems. Traditional morphological identification methods are often insufficient for early detection, particularly when populations are sparse or specimens are damaged or inappropriately preserved. Here, we present the validation of a Loop-Mediated Isothermal Amplification (LAMP) protocol specifically designed for the detection of \\u003cem\\u003eC. caspia\\u003c/em\\u003e DNA (Caspia-LAMP). The method targets unique repetitive DNA sequences identified through genome analysis, enabling highly specific detection without cross-reactivity with other cnidarians or co-occurring invasive species. Our optimized protocol demonstrates remarkable sensitivity, capable of detecting as little as 10\\u003csup\\u003e− 7\\u003c/sup\\u003e ng of \\u003cem\\u003eC. caspia\\u003c/em\\u003e DNA, surpassing conventional PCR methods. This rapid, sensitive, and field-applicable method represents a valuable tool for early detection and monitoring of \\u003cem\\u003eC. caspia\\u003c/em\\u003e populations, potentially enabling more timely and cost-effective management interventions. The successful development of this protocol also serves as a model for creating similar molecular tools for other invasive species detection and monitoring programs.\\u003c/p\\u003e\\n\\u003cp\\u003eClinical trial number: not applicable.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Caspia-LAMP - species-specific LAMP-based tool for the molecular detection of Cordylophora caspia (Pallas 1771) (Cnidaria, Hydrozoa)\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-09-16 16:34:18\",\"doi\":\"10.21203/rs.3.rs-7553152/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2025-10-28T17:07:23+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-10-23T13:50:27+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"195162755280194435786065514775345932107\",\"date\":\"2025-10-14T14:48:12+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"136269974571084672807576940257861491022\",\"date\":\"2025-09-10T00:29:01+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2025-09-09T11:55:39+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2025-09-09T05:42:23+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2025-09-09T05:40:35+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Molecular Biology Reports\",\"date\":\"2025-09-06T22:17:09+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"molecular-biology-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"mole\",\"sideBox\":\"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)\",\"snPcode\":\"11033\",\"submissionUrl\":\"https://submission.nature.com/new-submission/11033/3\",\"title\":\"Molecular Biology Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"52923dfd-36a4-4d93-a650-b527f6368504\",\"owner\":[],\"postedDate\":\"September 16th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-12-22T16:05:42+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-7553152\",\"link\":\"https://doi.org/10.1007/s11033-025-11378-2\",\"journal\":{\"identity\":\"molecular-biology-reports\",\"isVorOnly\":false,\"title\":\"Molecular Biology Reports\"},\"publishedOn\":\"2025-12-15 15:57:59\",\"publishedOnDateReadable\":\"December 15th, 2025\"},\"versionCreatedAt\":\"2025-09-16 16:34:18\",\"video\":\"\",\"vorDoi\":\"10.1007/s11033-025-11378-2\",\"vorDoiUrl\":\"https://doi.org/10.1007/s11033-025-11378-2\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-7553152\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-7553152\",\"identity\":\"rs-7553152\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}