{"paper_id":"0c1d5892-6e97-4564-b190-b03403847c23","body_text":"A novel nonsense variant of the KAT6B gene associated with cystic hygroma in fetus | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article A novel nonsense variant of the KAT6B gene associated with cystic hygroma in fetus Guan Wang, YanChou Ye, LongSheng Zhan, Ting Xue, JunWei Lin, Jun Zhang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4544246/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Cystic hygroma is a vascular anomaly associated with lymphatic malformations and is relatively common in prenatal ultrasonography, presenting as thickened nuchal translucency(NT). However, the underlying molecular mechanism of cystic hygroma is complex and not yet completely understood. Methods Trio-based whole exome sequencing(WES) was performed on a fetus with thickened NT but without chromosomal aberration, to indentify candidate pathogenic variants of potential Mendelian disorders. And Sanger sequencing was then conducted on the trio to confirm the variant. Results In this case, the fetus was diagnosed with cystic hygroma via the first-trimester ultrasonography, leading to termination of the pregnancy based on the pregnant woman's decision. Subsequently, trio-based WES was performed on the tissue of the aborted fetus and the blood samples of the parents. Data analysis indentified a novel nonsense variant, c.3822C > G(p.Tyr1274Ter) of the KAT6B gene (NM_012330.4) that had not been reported previously. And Sanger sequencing of the trio confirmed this variant. Genetic consulting was provided to the woman for the subsequent pregnancies. Conclusion KAT6B-related disorders manifest as cardiac diseases, and cardiac anomalies have been associated with disruptions in lymphatic system function, potentially contributing to the occurrence of cystic hygroma. Our findings illustrated the etiology of fetal abnormal development and lay the foundation for eugenics in the subsequent pregnancies. Additionally, findings expand the spectrum of variations in the KAT6B gene, offering further insights into its clinical relevance in prenatal cystic hygroma. KAT6B whole exome sequencing cystic hygroma thickened nuchal translucency Figures Figure 1 Introduction Cystic hygroma presents as a fluid-filled cystic mass located at the posterior neck. It commonly manifests in fetuses during the first trimester and can be detected as thickened nuchal translucency (NT) via ultrasonography. Usually, fetuses with cystic hygroma may face poor outcome, including cardiac and skeletal anomalies, fetal hydrops, pregnancy termination, and for those who survive will also suffer potential complications such as cerebral palsy and developmental delay[1, 2]. At present, the underlying genetic mechanisms of cystic hygroma are complex and diverse, and it is being investigated increasingly. Over the past three decades, investigations were predominantly focused on chromosomal anomalies. Malone FD, Gezer, C and Beke, A reported that individuals diagnosed with cystic hygroma, often exhibit chromosomal abnormalities, primarily involving trisomy-21, 45XO, trisomy-18, and trisomy-13[1, 3, 4]. However, Schreurs L’s investigation revealed that only 65.9% cases with cystic hygroma are associated with chromosome anomalies, while 34.1% exhibit a normal karyotype, remaining unexplained[5]. With the advent of chromosomal microarray analysis(CMA), cystic hygroma is reported to be linked to microdeletions and microduplications, such as 2p25.1 duplication, 3p25.3 deletion, 22q11.2 deletion, 22q11.2 duplication, partial monosomy 10q and partial trisomy 18q[6–8]. Yet, CMA only yields an additional detection rate of 4–8%[9, 10], leaving nearly 30% of cases still unexplained. Recently, sporadic investigations reported that monogenic disorders such as defects in PTPN11, KDR, KRIT1, MID1 and KAT6B genes may also relate to cystic hygroma[11–14]. That is to say, the hereditary factors contributing to cystic hygroma may be multifaceted, warranting further exploration to fully elucidate its etiology. So in this study, we conducted trio-based whole exome sequencing (WES) on a fetus with cystic hygroma and identified a novel nonsense variant of the KAT6B gene associated with the condition. And we subsequently discussed the potential implications of the KAT6B gene in relation to cystic hygroma. Methods Genetic Consulting Pre-test genetic counseling was provided to the pregnant woman, and informed consent was obtained. Post-test counseling was also offered to her regarding suggestions for her next pregnancy. Sample collection Tissue from the aborted fetus was carefully dissected and collected into a 2ml collection tube. Then 1.5ml normal saline was added for three times’ wash, and the wash solution was discarded. Simultaneously, 2ml of peripheral blood was collected from each parent of the fetus. Genomic DNA extraction The collected tissue was finely chopped using surgical scissors, followed by genomic DNA extraction according to the instructions of QIAamp DNA Mini Kit(Cat No.: 51304, QIAGEN, German). DNA concentration was quantified by Qubit™ dsDNA HS Assay Kit, and OD260/280 ratio was assessed by Nano-100(ALLSHENG, Hangzhou China). Library preparation 200ng of genomic DNA was fragmented into approximately 300bp fragments by Covaris S2(covaris, America). Subsequently end-repair was conducted with the NEBNext® End Repair Module (NEB, America) and incubated at 20°C for 30 minutes, followed by 65°C for another 30 minutes. A-tailing of the repaired DNA fragments was achieved using NEBNext dA-Tailing Module, with an incubation period at 37°C for 30 minutes. Adapter ligation was then carried out employing the NEBNext® Ultra™ II Ligation Module, and incubated at 20°C for 15 minutes. The library underwent PCR amplification and was ultimately purified using Ampure XP beads (Beckman Coulter, America). Finally, the quality of the library was assessed using the Qbit 3.0 and Agilent 2100 platforms. Data analysis The library was sequenced using NovaSeq 6000 system (Illumina, America). Raw reads underwent processing with Trimmomatic (Anthony M. Bolger, Marc Lohse, Bjoern Usadel) to eliminate adapter contamination and low-quality reads. Subsequently, clean reads were aligned to the hg19 reference genome by BWA (Li H. and Durbin R.), and variants were called by GATK (Aaron McKenna et al). The identified variants were then annotated by Annovar and Intervar. Variants were filtered based on criteria including total depth < 20×, mutation frequency < 20%, and population frequency > 5% in gnomAD and 1000G databases. Variants located in exonic regions and splicing junction sites were retained, while those annotated as synonymous, benign, or likely benign were excluded. The remaining variants were further sorted based on inheritance pattern, phenotype, and pathogenicity. Sanger sequencing Forward primer AGGCAGTAAAGACAATCCCGA and reverse primer TTGGACTTACAGGGGCACAT were designed by Primer 3 online and synthesized by ShengGong Corporation (Shanghai, China). Subsequently, PCR was performed using the tissue DNA from the aborted fetus and the blood DNA from her parents, utilizing the ABI Veriti PCR thermocycler (Life Technologies, America). The PCR products were then sequenced on Applied Biosystems 3730×DNA analyzers (Life Technologies, America), and the sequences were analyzed by Chromas software. Results A 31-year-old pregnant woman visited our genetic clinic seeking for genetic counseling due to concerns about cystic hygroma detected in her fetus. She was G2P1, and denied family history of genetic disease. During the early pregnancy, 3D-color ultrasonography revealed a NT value of 8.8mm and an echo region in the fetal neck measuring 25×7mm, raising suspicion of cystic hygroma (Fig. 1 a). A week later, repeat 3D-color ultrasonography confirmed the presence of cystic hygroma and bilateral renal hydrops. At 15 weeks of pregnancy, the fetus was aborted according to the pregnant woman's wishes. Upon examination, cystic hygroma measuring 10×10mm and an abdominal bulge were observed. DNA was extracted from tissue of the aborted fetus. Initially, we conducted CMA, which yielded no pathogenic copy number variations. Subsequently, a trio-based WES assay was implemented, revealing a novel heterozygous nonsense variation c.3822C > G(p.Tyr1274Ter) in the KAT6B (NM_012330.4) gene. Sanger sequencing of the trio confirmed this variant (Fig. 1 b). This nonsense variant is predicted to convert a tyrosine residue into a stop codon, resulting in premature termination of translation and production of a truncated protein. Notably, this variant was not detected in the parents, implicating it as a de novo mutation. Furthermore, it was absent in the general population as evidenced by the absence in the 1000 Genomes and gnomAD databases. According to the ACMG guidelines, this variant meets criteria of PVS1, PS2_moderate, and PM2_supporting, and is regarded as pathogenic variant. The KAT6B protein, a monocytic leukemia zinc finger protein-related factor, is essential for histone transacetylation. Defects of this protein are associated with the autosomal dominant genetic disorders Genitopatellar syndrome (GPS) or Say-Barber-Biesecker-Young-Simpson syndrome (SBBYSS). Based on these findings, we postulate that variant of the KAT6B gene may contribute to the development of cystic hygroma in this fetus. As previously reported, a heterozygous variant in the KAT6B gene can result in an autosomal dominant KAT6B-related disorder, GPS or SBBYSS[15–18]. Typically, clinical manifestations of the disorder may include atrial septal and ventricular septal defect, pulmonary hypoplasia, hydronephrosis and multicystic kidneys, severe psychomotor retardation, congenital flexion contractures of the lower extremities, abnormal or missing patellae, urogenital anomalies, microcephaly and characteristic coarse facial features, polyhydramnios and so on. Genetic counseling was provided to inform her the condition associated with this disorder. Additionally, the suggestion of prenatal diagnosis for this variant in her next pregnancy was made, considering the possibility of mosaic germ cell. Therefore, in this case, we identified a novel nonsense variant in the KAT6B gene in a fetus with cystic hygroma, and findings expanded the variation profile of the KAT6B gene. Discussion In this report, we identified a heterozygous novel truncating variant in exon 18 of the KAT6B gene in a fetus, which was not present in her parents, through trio-based WES. KAT6B, also known as MYST4, is a monocytic leukemia zinc finger protein-related factor responsible for histone acetylation. As a histone acetyltransferase, it is expressed in almost all adult human tissues and plays a crucial role in gene transcription regulation. The variant c.3822C > G alters a tyrosine residue to a stop codon, resulting in a truncated protein. We searched 1000G and gnomAD databases, and find that it is absent in the general population. Additionally, this variant has not been reported in the Clinvar and HGMD databases, nor has been documented in existing literature, indicating its novelty. Furthermore, We reviewed the pathogenic variants of the KAT6B gene in Clinvar and HGMD databases, and found that the majority of the variants are located in exon 18, suggesting that exon 18 may serve as a mutation hotspot for the KAT6B gene. Variations in exon 18 have been associated with the development of GPS through a gain-of-function mechanism, as outlined by investigations from Hung-Chun Yu's and Philippe M. Campeau's groups [19, 20]. Therefore, in this case, the nonsense variant c.3822C > G may lead to a truncated KAT6B protein, potentially contributing to the onset of GPS. As is reported, clinical investigations of KAT6B-related disorders typically focus on postnatal cases, and less frequently reported prenatally on fetuses. In 2020 and 2021, Li Xin Zhang and Megan Yabumoto reported that variations of the KAT6B gene were associated with prenatal findings of cystic hygroma in three cases[12, 19]. Similarly, our case presented another novel variant of the KAT6B gene in an aborted fetus with cystic hygroma. However, the precise relationship between variation of the KAT6B gene and cystic hygroma remains to be fully elucidated. As has been always reported, cystic hygroma is a subtype lymphatic malformation and characterized by fluid accumulation, often manifesting as thickened NT during the first trimester of pregnancy[20]. Carlo Bellini and Monique C.Haak summarized the close relationship between lymphatic malformation and thickened NT[21, 22]. Furthermore, investigations reviewed the function of cardiac lymphatic, and suggested that there is a close relationship between cardiac disease and lymphatic system traffic[23]. So it is evident that cardic defect may disrupt lymphatic system development, potentially leading to lymphatic edema and subsequently resulting in cystic hygroma formation in the fetus. As has been described above, variation of the KAT6B gene may cause GPS or SBBYSS accompany with heart disease such as atrial septal, ventricular septal defect. Robert Bendon reported three cases of Noonan’s syndrome presenting with jugular lymphatic obstruction, two of whom had a membranous ventricular septal defect[24]. Similarly, another investigation highlighted the link between atrial septal defect and intestinal lymphangiectasia[25]. Consequently, there is a suspicion that defects in the KAT6B gene may contribute to heart defects such as atrial septal, ventricular septal defect, impacting lymphatic system traffic and ultimately leading to cystic hygroma. Nicole B. Burger et al reviewed the genetic mechanisms of heart defects in fetus with thickened NT, identifying 15 genes including ADM, FOXC2,VEGFR3, VEZF1 and so on, responsible for endothelial differentiation, thereby influencing embryos cardiac and lymphatic development[26]. Additionally, in 2017, there reported that histone acetyltransferase 7 (KAT7) has been demonstrated to be involved in the regulation of endothelial cell gene expression[27]. Given that KAT6B is another member of histone acetyltransferase family, it is plausible that it also affects the endothelial differentiation, potentially impacting cardiac development. Above all, it is hypothesized that defects in the KAT6B gene may disrupt endothelial differentiation, leading to cardiac abnormalities, then affecting lymphatic system traffic, resulting in thickened NT and the formation of cystic hygroma. However, more functional investigations are still needed to further elucidating the underlying mechanisms. Conclusion In summary, we have reported a novel nonsense variant, c.3822C > G(p.Tyr1274Ter) of the KAT6B gene in a fetus with cystic hygroma. KAT6B-related disorder present with manifestations of cardiac disease, and cardiac disease has been reported to be related with lymphatic system traffic, potentially contributing to the development of cystic hygroma. Our findings shed light on the etiology of fetal abnormal development and lay the foundation for eugenics in the subsequent pregnancies. Moreover, our findings expand the spectrum of variations associated with the KAT6B gene, thereby aiding in the diagnosis of KAT6B-related disorders in the future. It is worth noting that combining the ultrasound findings of cystic hygroma or other KAT6B-related manifestations in the first trimester with prompt molecular testing in the subsequent invasive prenatal diagnosis, can realize early diagnosis of KAT6B-related disorders prenatally, facilitating timely intervention and management for the fetus. Hence, our study contributed valuable clinical evidence for diagnosis of KAT6B-related disorders in the field of fetal medicine. Abbreviations WES Whole Exome Sequencing ACMG American College of Medical Genetics and Genomics NT nuchal translucency CMA chromosomal microarray analysis BWA Burrows-Wheeler Aligner GATK Genome Analysis ToolKit GPS Genitopatellar syndrome SBBYSS Say-Barber- Biesecker-Young-Simpson syndrome 1000G 1000 Genomes Project gnomAD Genome Aggregation Database Clinvar Clinical Variation HGMD Human Gene Mutation Database. Declarations Ethics approval and consent to participate The study was approved by the Medical Ethics Committee of The Third Affiliated Hospital of Sun Yat-sen University (Guangzhou, China). Consent for publication Genetic counseling was given to the participant and informed consent was signed. Availability of data and materials The datasets used and analyzed during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests. Funding Not applicable. Authors' contributions LS Z and JW L performed the WES and Sanger sequencing assays. G W and YC Y carried out the data analysis. T X was responsible for the genetic consulting. G W drafted the manuscript. J Z revised the manuscript. All authors read and approved the final manuscript. Acknowledgements We thank the participant for cooperating with our study. References Malone, F.D., et al., First-trimester septated cystic hygroma: prevalence, natural history, and pediatric outcome. Obstet Gynecol, 2005. 106 (2): p. 288 − 94. Tanriverdi, H.A., et al., Hygroma colli cysticum: prenatal diagnosis and prognosis. Am J Perinatol, 2001. 18 (8): p. 415 − 20. Beke, A., et al., Incidence of chromosomal abnormalities in the presence of fetal subcutaneous oedema, such as nuchal oedema, cystic hygroma and non-immune hydrops. Fetal Diagn Ther, 2009. 25 (1): p. 83–92. Gezer, C., et al., Prenatal karyotype results of fetuses with nuchal edema, cystic hygroma, and non-immune hydrops. Clin Exp Obstet Gynecol, 2015. 42 (5): p. 586-9. Schreurs, L., et al., First trimester cystic hygroma colli: Retrospective analysis in a tertiary center. Eur J Obstet Gynecol Reprod Biol, 2018. 231 : p. 60–64. Lund, I.C., et al., Chromosomal microarray in fetuses with increased nuchal translucency. Ultrasound Obstet Gynecol, 2015. 45 (1): p. 95–100. Stipoljev, F., et al., Fetal Cystic Hygroma Associated with Terminal 2p25.1 Duplication and Terminal 3p25.3 Deletion: Cytogenetic, Fluorescent in Situ Hybridization and Microarray Familial Characterization of Two Different Chromosomal Structural Rearrangements. Balkan J Med Genet, 2020. 23 (2): p. 79–86. Chen, C.P., et al., Prenatal diagnosis and molecular cytogenetic analysis of partial monosomy 10q (10q25.3–>qter) and partial trisomy 18q (18q23–>qter) in a fetus associated with cystic hygroma and ambiguous genitalia. Prenat Diagn, 2005. 25 (6): p. 492-6. Cicatiello, R., et al., Chromosomal Microarray Analysis versus Karyotyping in Fetuses with Increased Nuchal Translucency. Med Sci (Basel), 2019. 7 (3). Grande, M., et al., Genomic microarray in fetuses with increased nuchal translucency and normal karyotype: a systematic review and meta-analysis. Ultrasound Obstet Gynecol, 2015. 46 (6): p. 650-8. Noia, G., et al., Cystic Hygroma: A Preliminary Genetic Study and a Short Review from the Literature. Lymphat Res Biol, 2019. 17 (1): p. 30–39. Zhang, L.X., et al., Further delineation of the clinical spectrum of KAT6B disorders and allelic series of pathogenic variants. Genet Med, 2020. 22 (8): p. 1338–1347. Gezdirici, A., et al., How necessary is to analyze PTPN11 gene in fetuses with first trimester cystic hygroma and normal karyotype? J Matern Fetal Neonatal Med, 2017. 30 (8): p. 938–941. Lord, J., et al., Prenatal exome sequencing analysis in fetal structural anomalies detected by ultrasonography (PAGE): a cohort study. Lancet, 2019. 393 (10173): p. 747–757. Simpson, M.A., et al., De novo mutations of the gene encoding the histone acetyltransferase KAT6B cause Genitopatellar syndrome. Am J Hum Genet, 2012. 90 (2): p. 290-4. Szakszon, K., et al., De novo mutations of the gene encoding the histone acetyltransferase KAT6B in two patients with Say-Barber/Biesecker/Young-Simpson syndrome. Am J Med Genet A, 2013. 161A (4): p. 884-8. Campeau, P.M., et al., Mutations in KAT6B, encoding a histone acetyltransferase, cause Genitopatellar syndrome. Am J Hum Genet, 2012. 90 (2): p. 282-9. Clayton-Smith, J., et al., Whole-exome-sequencing identifies mutations in histone acetyltransferase gene KAT6B in individuals with the Say-Barber-Biesecker variant of Ohdo syndrome. Am J Hum Genet, 2011. 89 (5): p. 675 − 81. Yabumoto, M., et al., Novel variants in KAT6B spectrum of disorders expand our knowledge of clinical manifestations and molecular mechanisms. Mol Genet Genomic Med, 2021. 9 (10): p. e1809. Scholl, J., et al., First-trimester cystic hygroma: relationship of nuchal translucency thickness and outcomes. Obstet Gynecol, 2012. 120 (3): p. 551-9. Haak, M.C., et al., Increased nuchal translucency is associated with jugular lymphatic distension. Hum Reprod, 2002. 17 (4): p. 1086-92. Bellini, C., et al., Nuchal translucency and lymphatic system maldevelopment. J Perinat Med, 2009. 37 (6): p. 673-6. Loukas, M., et al., The cardiac lymphatic system. Clin Anat, 2011. 24 (6): p. 684 − 91. Bendon, R. and A. Asamoah, Perinatal autopsy findings in three cases of jugular lymphatic obstruction sequence and cardiac polyvalvular dysplasia. Pediatr Dev Pathol, 2008. 11 (2): p. 133-7. Aroor, S., et al., Waldmann's Disease (Primary Intestinal Lymphangiectasia) with Atrial Septal Defect. J Clin Diagn Res, 2017. 11 (4): p. SD03-SD04. Burger, N.B., et al., Why increased nuchal translucency is associated with congenital heart disease: a systematic review on genetic mechanisms. Prenat Diagn, 2015. 35 (6): p. 517 − 28. Yan, M.S., et al., Histone acetyltransferase 7 (KAT7)-dependent intragenic histone acetylation regulates endothelial cell gene regulation. J Biol Chem, 2018. 293 (12): p. 4381–4402. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4544246\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":312412957,\"identity\":\"20eac433-b639-4f80-890a-029f7fb59372\",\"order_by\":0,\"name\":\"Guan Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Third Affiliated Hospital of Sun Yat-sen University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Guan\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":312412958,\"identity\":\"0d130cff-89dc-4343-89a8-39ec0f72fc9e\",\"order_by\":1,\"name\":\"YanChou Ye\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Seventh Affiliated Hospital Sun Yat-sen University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"YanChou\",\"middleName\":\"\",\"lastName\":\"Ye\",\"suffix\":\"\"},{\"id\":312412959,\"identity\":\"3fa14442-14da-447c-bb06-be5c9fcce7e5\",\"order_by\":2,\"name\":\"LongSheng Zhan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Third Affiliated Hospital of Sun Yat-sen University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"LongSheng\",\"middleName\":\"\",\"lastName\":\"Zhan\",\"suffix\":\"\"},{\"id\":312412960,\"identity\":\"e2fa9d28-6fd6-4d71-bf3d-3033eb1ff22e\",\"order_by\":3,\"name\":\"Ting Xue\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Third Affiliated Hospital of Sun Yat-sen University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ting\",\"middleName\":\"\",\"lastName\":\"Xue\",\"suffix\":\"\"},{\"id\":312412961,\"identity\":\"e94f2144-cc98-45d4-976f-2a33a164fe6e\",\"order_by\":4,\"name\":\"JunWei Lin\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Third Affiliated Hospital of Sun Yat-sen University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"JunWei\",\"middleName\":\"\",\"lastName\":\"Lin\",\"suffix\":\"\"},{\"id\":312412962,\"identity\":\"e5602e61-7918-49f7-8bf6-3467c3fea451\",\"order_by\":5,\"name\":\"Jun Zhang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABAUlEQVRIiWNgGAWjYDACCYYEBoYKGwYGZuYGmJgBEVrOpAG1MBKvhYGBse0wiCRSi/zshmfShW3no/nbGRsYf7bVJTawN2+TYKi5g1ML45wDadIzzt3OnXGYsYGZt+1wYgPPsTIJhmPPcGphlkhIk+Ypu53bANLC2HYgsUEix0yCseEwTi1sYC1s53LnH4Y5TP4Nfi08YC1tB3I3ALUw8LYxA23hwa9FQiIh2ZrnTHLuRqCWwzznDhu38aQVWyQcw61FfkZO4m2eCrvceecPH3z4o6xOtp/98MYbH2pwawE6LQHOPMDIBvQdiJWAQzEEsB9A4vzBq3QUjIJRMApGKAAAc2RUH8Kc2ukAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"The Third Affiliated Hospital of Sun Yat-sen University\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jun\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-06-07 07:15:32\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4544246/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4544246/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":59283286,\"identity\":\"1f4a3455-ee0a-4e13-b0c5-5d734a102a94\",\"added_by\":\"auto\",\"created_at\":\"2024-06-28 15:59:49\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":617071,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eUltrasonography and variant sequencing of the fetus. a 3D-color ultrasonography image of the fetus, with the red arrow indicating thickened NT. b Sanger sequencing of the variant, c.3822C\\u0026gt;G of the KAT6B gene.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4544246/v1/8b0178f01e3f747c65867eae.jpg\"},{\"id\":65755514,\"identity\":\"40116e6c-9c97-41d3-abda-200325abde8c\",\"added_by\":\"auto\",\"created_at\":\"2024-10-02 08:31:58\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":968269,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4544246/v1/5e412620-207d-4236-a0a2-4d3f36995706.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"A novel nonsense variant of the KAT6B gene associated with cystic hygroma in fetus\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eCystic hygroma presents as a fluid-filled cystic mass located at the posterior neck. It commonly manifests in fetuses during the first trimester and can be detected as thickened nuchal translucency (NT) via ultrasonography. Usually, fetuses with cystic hygroma may face poor outcome, including cardiac and skeletal anomalies, fetal hydrops, pregnancy termination, and for those who survive will also suffer potential complications such as cerebral palsy and developmental delay[1, 2]. At present, the underlying genetic mechanisms of cystic hygroma are complex and diverse, and it is being investigated increasingly. Over the past three decades, investigations were predominantly focused on chromosomal anomalies. Malone FD, Gezer, C and Beke, A reported that individuals diagnosed with cystic hygroma, often exhibit chromosomal abnormalities, primarily involving trisomy-21, 45XO, trisomy-18, and trisomy-13[1, 3, 4]. However, Schreurs L\\u0026rsquo;s investigation revealed that only 65.9% cases with cystic hygroma are associated with chromosome anomalies, while 34.1% exhibit a normal karyotype, remaining unexplained[5]. With the advent of chromosomal microarray analysis(CMA), cystic hygroma is reported to be linked to microdeletions and microduplications, such as 2p25.1 duplication, 3p25.3 deletion, 22q11.2 deletion, 22q11.2 duplication, partial monosomy 10q and partial trisomy 18q[6\\u0026ndash;8]. Yet, CMA only yields an additional detection rate of 4\\u0026ndash;8%[9, 10], leaving nearly 30% of cases still unexplained. Recently, sporadic investigations reported that monogenic disorders such as defects in PTPN11, KDR, KRIT1, MID1 and KAT6B genes may also relate to cystic hygroma[11\\u0026ndash;14]. That is to say, the hereditary factors contributing to cystic hygroma may be multifaceted, warranting further exploration to fully elucidate its etiology. So in this study, we conducted trio-based whole exome sequencing (WES) on a fetus with cystic hygroma and identified a novel nonsense variant of the KAT6B gene associated with the condition. And we subsequently discussed the potential implications of the KAT6B gene in relation to cystic hygroma.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eGenetic Consulting\\u003c/h2\\u003e \\u003cp\\u003ePre-test genetic counseling was provided to the pregnant woman, and informed consent was obtained. Post-test counseling was also offered to her regarding suggestions for her next pregnancy.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSample collection\\u003c/h2\\u003e \\u003cp\\u003eTissue from the aborted fetus was carefully dissected and collected into a 2ml collection tube. Then 1.5ml normal saline was added for three times\\u0026rsquo; wash, and the wash solution was discarded. Simultaneously, 2ml of peripheral blood was collected from each parent of the fetus.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eGenomic DNA extraction\\u003c/h2\\u003e \\u003cp\\u003eThe collected tissue was finely chopped using surgical scissors, followed by genomic DNA extraction according to the instructions of QIAamp DNA Mini Kit(Cat No.: 51304, QIAGEN, German). DNA concentration was quantified by Qubit\\u0026trade; dsDNA HS Assay Kit, and OD260/280 ratio was assessed by Nano-100(ALLSHENG, Hangzhou China).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eLibrary preparation\\u003c/h2\\u003e \\u003cp\\u003e200ng of genomic DNA was fragmented into approximately 300bp fragments by Covaris S2(covaris, America). Subsequently end-repair was conducted with the NEBNext\\u0026reg; End Repair Module (NEB, America) and incubated at 20\\u0026deg;C for 30 minutes, followed by 65\\u0026deg;C for another 30 minutes. A-tailing of the repaired DNA fragments was achieved using NEBNext dA-Tailing Module, with an incubation period at 37\\u0026deg;C for 30 minutes. Adapter ligation was then carried out employing the NEBNext\\u0026reg; Ultra\\u0026trade; II Ligation Module, and incubated at 20\\u0026deg;C for 15 minutes. The library underwent PCR amplification and was ultimately purified using Ampure XP beads (Beckman Coulter, America). Finally, the quality of the library was assessed using the Qbit 3.0 and Agilent 2100 platforms.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eData analysis\\u003c/h2\\u003e \\u003cp\\u003eThe library was sequenced using NovaSeq 6000 system (Illumina, America). Raw reads underwent processing with Trimmomatic (Anthony M. Bolger, Marc Lohse, Bjoern Usadel) to eliminate adapter contamination and low-quality reads. Subsequently, clean reads were aligned to the hg19 reference genome by BWA (Li H. and Durbin R.), and variants were called by GATK (Aaron McKenna et al). The identified variants were then annotated by Annovar and Intervar. Variants were filtered based on criteria including total depth\\u0026thinsp;\\u0026lt;\\u0026thinsp;20\\u0026times;, mutation frequency\\u0026thinsp;\\u0026lt;\\u0026thinsp;20%, and population frequency\\u0026thinsp;\\u0026gt;\\u0026thinsp;5% in gnomAD and 1000G databases. Variants located in exonic regions and splicing junction sites were retained, while those annotated as synonymous, benign, or likely benign were excluded. The remaining variants were further sorted based on inheritance pattern, phenotype, and pathogenicity.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSanger sequencing\\u003c/h2\\u003e \\u003cp\\u003eForward primer AGGCAGTAAAGACAATCCCGA and reverse primer TTGGACTTACAGGGGCACAT were designed by Primer 3 online and synthesized by ShengGong Corporation (Shanghai, China). Subsequently, PCR was performed using the tissue DNA from the aborted fetus and the blood DNA from her parents, utilizing the ABI Veriti PCR thermocycler (Life Technologies, America). The PCR products were then sequenced on Applied Biosystems 3730\\u0026times;DNA analyzers (Life Technologies, America), and the sequences were analyzed by Chromas software.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003eA 31-year-old pregnant woman visited our genetic clinic seeking for genetic counseling due to concerns about cystic hygroma detected in her fetus. She was G2P1, and denied family history of genetic disease. During the early pregnancy, 3D-color ultrasonography revealed a NT value of 8.8mm and an echo region in the fetal neck measuring 25\\u0026times;7mm, raising suspicion of cystic hygroma (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea). A week later, repeat 3D-color ultrasonography confirmed the presence of cystic hygroma and bilateral renal hydrops. At 15 weeks of pregnancy, the fetus was aborted according to the pregnant woman's wishes. Upon examination, cystic hygroma measuring 10\\u0026times;10mm and an abdominal bulge were observed.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eDNA was extracted from tissue of the aborted fetus. Initially, we conducted CMA, which yielded no pathogenic copy number variations. Subsequently, a trio-based WES assay was implemented, revealing a novel heterozygous nonsense variation c.3822C\\u0026thinsp;\\u0026gt;\\u0026thinsp;G(p.Tyr1274Ter) in the KAT6B (NM_012330.4) gene. Sanger sequencing of the trio confirmed this variant (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eb). This nonsense variant is predicted to convert a tyrosine residue into a stop codon, resulting in premature termination of translation and production of a truncated protein. Notably, this variant was not detected in the parents, implicating it as a de novo mutation. Furthermore, it was absent in the general population as evidenced by the absence in the 1000 Genomes and gnomAD databases. According to the ACMG guidelines, this variant meets criteria of PVS1, PS2_moderate, and PM2_supporting, and is regarded as pathogenic variant. The \\u003cem\\u003eKAT6B\\u003c/em\\u003e protein, a monocytic leukemia zinc finger protein-related factor, is essential for histone transacetylation. Defects of this protein are associated with the autosomal dominant genetic disorders Genitopatellar syndrome (GPS) or Say-Barber-Biesecker-Young-Simpson syndrome (SBBYSS). Based on these findings, we postulate that variant of the KAT6B gene may contribute to the development of cystic hygroma in this fetus.\\u003c/p\\u003e \\u003cp\\u003eAs previously reported, a heterozygous variant in the KAT6B gene can result in an autosomal dominant KAT6B-related disorder, GPS or SBBYSS[15\\u0026ndash;18]. Typically, clinical manifestations of the disorder may include atrial septal and ventricular septal defect, pulmonary hypoplasia, hydronephrosis and multicystic kidneys, severe psychomotor retardation, congenital flexion contractures of the lower extremities, abnormal or missing patellae, urogenital anomalies, microcephaly and characteristic coarse facial features, polyhydramnios and so on. Genetic counseling was provided to inform her the condition associated with this disorder. Additionally, the suggestion of prenatal diagnosis for this variant in her next pregnancy was made, considering the possibility of mosaic germ cell.\\u003c/p\\u003e \\u003cp\\u003eTherefore, in this case, we identified a novel nonsense variant in the KAT6B gene in a fetus with cystic hygroma, and findings expanded the variation profile of the KAT6B gene.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eIn this report, we identified a heterozygous novel truncating variant in exon 18 of the KAT6B gene in a fetus, which was not present in her parents, through trio-based WES. KAT6B, also known as MYST4, is a monocytic leukemia zinc finger protein-related factor responsible for histone acetylation. As a histone acetyltransferase, it is expressed in almost all adult human tissues and plays a crucial role in gene transcription regulation. The variant c.3822C\\u0026thinsp;\\u0026gt;\\u0026thinsp;G alters a tyrosine residue to a stop codon, resulting in a truncated protein. We searched 1000G and gnomAD databases, and find that it is absent in the general population. Additionally, this variant has not been reported in the Clinvar and HGMD databases, nor has been documented in existing literature, indicating its novelty. Furthermore, We reviewed the pathogenic variants of the KAT6B gene in Clinvar and HGMD databases, and found that the majority of the variants are located in exon 18, suggesting that exon 18 may serve as a mutation hotspot for the KAT6B gene. Variations in exon 18 have been associated with the development of GPS through a gain-of-function mechanism, as outlined by investigations from Hung-Chun Yu's and Philippe M. Campeau's groups [19, 20]. Therefore, in this case, the nonsense variant c.3822C\\u0026thinsp;\\u0026gt;\\u0026thinsp;G may lead to a truncated \\u003cem\\u003eKAT6B\\u003c/em\\u003e protein, potentially contributing to the onset of GPS.\\u003c/p\\u003e \\u003cp\\u003eAs is reported, clinical investigations of KAT6B-related disorders typically focus on postnatal cases, and less frequently reported prenatally on fetuses. In 2020 and 2021, Li Xin Zhang and Megan Yabumoto reported that variations of the KAT6B gene were associated with prenatal findings of cystic hygroma in three cases[12, 19]. Similarly, our case presented another novel variant of the KAT6B gene in an aborted fetus with cystic hygroma. However, the precise relationship between variation of the KAT6B gene and cystic hygroma remains to be fully elucidated. As has been always reported, cystic hygroma is a subtype lymphatic malformation and characterized by fluid accumulation, often manifesting as thickened NT during the first trimester of pregnancy[20]. Carlo Bellini and Monique C.Haak summarized the close relationship between lymphatic malformation and thickened NT[21, 22]. Furthermore, investigations reviewed the function of cardiac lymphatic, and suggested that there is a close relationship between cardiac disease and lymphatic system traffic[23]. So it is evident that cardic defect may disrupt lymphatic system development, potentially leading to lymphatic edema and subsequently resulting in cystic hygroma formation in the fetus.\\u003c/p\\u003e \\u003cp\\u003eAs has been described above, variation of the KAT6B gene may cause GPS or SBBYSS accompany with heart disease such as atrial septal, ventricular septal defect. Robert Bendon reported three cases of Noonan\\u0026rsquo;s syndrome presenting with jugular lymphatic obstruction, two of whom had a membranous ventricular septal defect[24]. Similarly, another investigation highlighted the link between atrial septal defect and intestinal lymphangiectasia[25]. Consequently, there is a suspicion that defects in the KAT6B gene may contribute to heart defects such as atrial septal, ventricular septal defect, impacting lymphatic system traffic and ultimately leading to cystic hygroma. Nicole B. Burger et al reviewed the genetic mechanisms of heart defects in fetus with thickened NT, identifying 15 genes including ADM, FOXC2,VEGFR3, VEZF1 and so on, responsible for endothelial differentiation, thereby influencing embryos cardiac and lymphatic development[26]. Additionally, in 2017, there reported that histone acetyltransferase 7 (KAT7) has been demonstrated to be involved in the regulation of endothelial cell gene expression[27]. Given that KAT6B is another member of histone acetyltransferase family, it is plausible that it also affects the endothelial differentiation, potentially impacting cardiac development.\\u003c/p\\u003e \\u003cp\\u003eAbove all, it is hypothesized that defects in the KAT6B gene may disrupt endothelial differentiation, leading to cardiac abnormalities, then affecting lymphatic system traffic, resulting in thickened NT and the formation of cystic hygroma. However, more functional investigations are still needed to further elucidating the underlying mechanisms.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eIn summary, we have reported a novel nonsense variant, c.3822C\\u0026thinsp;\\u0026gt;\\u0026thinsp;G(p.Tyr1274Ter) of the KAT6B gene in a fetus with cystic hygroma. KAT6B-related disorder present with manifestations of cardiac disease, and cardiac disease has been reported to be related with lymphatic system traffic, potentially contributing to the development of cystic hygroma. Our findings shed light on the etiology of fetal abnormal development and lay the foundation for eugenics in the subsequent pregnancies. Moreover, our findings expand the spectrum of variations associated with the KAT6B gene, thereby aiding in the diagnosis of KAT6B-related disorders in the future. It is worth noting that combining the ultrasound findings of cystic hygroma or other KAT6B-related manifestations in the first trimester with prompt molecular testing in the subsequent invasive prenatal diagnosis, can realize early diagnosis of KAT6B-related disorders prenatally, facilitating timely intervention and management for the fetus. Hence, our study contributed valuable clinical evidence for diagnosis of KAT6B-related disorders in the field of fetal medicine.\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cdiv class=\\\"DefinitionList\\\"\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eWES\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eWhole Exome Sequencing\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eACMG\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eAmerican College of Medical Genetics and Genomics\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eNT\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003enuchal translucency\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eCMA\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003echromosomal microarray analysis\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eBWA\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eBurrows-Wheeler Aligner\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eGATK\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eGenome Analysis ToolKit\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eGPS\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eGenitopatellar syndrome\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eSBBYSS\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eSay-Barber- Biesecker-Young-Simpson syndrome\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e1000G\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003e1000 Genomes Project\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003egnomAD\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eGenome Aggregation Database\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eClinvar\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eClinical Variation\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eHGMD\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eHuman Gene Mutation Database.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe study was approved by the Medical Ethics Committee of The Third Affiliated Hospital of Sun Yat-sen University (Guangzhou, China).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eGenetic counseling was given to the participant and informed consent was signed.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe datasets used and analyzed during the current study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no competing interests.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors\\u0026apos; contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eLS Z and JW L performed the WES and Sanger sequencing assays. G W and YC Y carried out the data analysis. T X was responsible for the genetic consulting. G W drafted the manuscript. J Z revised the manuscript. All authors read and approved the final manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe thank the participant for cooperating with our study.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eMalone, F.D., et al., \\u003cem\\u003eFirst-trimester septated cystic hygroma: prevalence, natural history, and pediatric outcome.\\u003c/em\\u003e Obstet Gynecol, 2005. \\u003cstrong\\u003e106\\u003c/strong\\u003e(2): p. 288\\u0026thinsp;\\u0026minus;\\u0026thinsp;94.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eTanriverdi, H.A., et al., \\u003cem\\u003eHygroma colli cysticum: prenatal diagnosis and prognosis.\\u003c/em\\u003e Am J Perinatol, 2001. \\u003cstrong\\u003e18\\u003c/strong\\u003e(8): p. 415\\u0026thinsp;\\u0026minus;\\u0026thinsp;20.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eBeke, A., et al., \\u003cem\\u003eIncidence of chromosomal abnormalities in the presence of fetal subcutaneous oedema, such as nuchal oedema, cystic hygroma and non-immune hydrops.\\u003c/em\\u003e Fetal Diagn Ther, 2009. \\u003cstrong\\u003e25\\u003c/strong\\u003e(1): p. 83\\u0026ndash;92.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eGezer, C., et al., \\u003cem\\u003ePrenatal karyotype results of fetuses with nuchal edema, cystic hygroma, and non-immune hydrops.\\u003c/em\\u003e Clin Exp Obstet Gynecol, 2015. \\u003cstrong\\u003e42\\u003c/strong\\u003e(5): p. 586-9.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eSchreurs, L., et al., \\u003cem\\u003eFirst trimester cystic hygroma colli: Retrospective analysis in a tertiary center.\\u003c/em\\u003e Eur J Obstet Gynecol Reprod Biol, 2018. \\u003cstrong\\u003e231\\u003c/strong\\u003e: p. 60\\u0026ndash;64.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eLund, I.C., et al., \\u003cem\\u003eChromosomal microarray in fetuses with increased nuchal translucency.\\u003c/em\\u003e Ultrasound Obstet Gynecol, 2015. \\u003cstrong\\u003e45\\u003c/strong\\u003e(1): p. 95\\u0026ndash;100.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eStipoljev, F., et al., \\u003cem\\u003eFetal Cystic Hygroma Associated with Terminal 2p25.1 Duplication and Terminal 3p25.3 Deletion: Cytogenetic, Fluorescent in Situ Hybridization and Microarray Familial Characterization of Two Different Chromosomal Structural Rearrangements.\\u003c/em\\u003e Balkan J Med Genet, 2020. \\u003cstrong\\u003e23\\u003c/strong\\u003e(2): p. 79\\u0026ndash;86.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eChen, C.P., et al., \\u003cem\\u003ePrenatal diagnosis and molecular cytogenetic analysis of partial monosomy 10q (10q25.3\\u0026ndash;\\u0026gt;qter) and partial trisomy 18q (18q23\\u0026ndash;\\u0026gt;qter) in a fetus associated with cystic hygroma and ambiguous genitalia.\\u003c/em\\u003e Prenat Diagn, 2005. \\u003cstrong\\u003e25\\u003c/strong\\u003e(6): p. 492-6.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eCicatiello, R., et al., \\u003cem\\u003eChromosomal Microarray Analysis versus Karyotyping in Fetuses with Increased Nuchal Translucency.\\u003c/em\\u003e Med Sci (Basel), 2019. \\u003cstrong\\u003e7\\u003c/strong\\u003e(3).\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eGrande, M., et al., \\u003cem\\u003eGenomic microarray in fetuses with increased nuchal translucency and normal karyotype: a systematic review and meta-analysis.\\u003c/em\\u003e Ultrasound Obstet Gynecol, 2015. \\u003cstrong\\u003e46\\u003c/strong\\u003e(6): p. 650-8.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eNoia, G., et al., \\u003cem\\u003eCystic Hygroma: A Preliminary Genetic Study and a Short Review from the Literature.\\u003c/em\\u003e Lymphat Res Biol, 2019. \\u003cstrong\\u003e17\\u003c/strong\\u003e(1): p. 30\\u0026ndash;39.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eZhang, L.X., et al., \\u003cem\\u003eFurther delineation of the clinical spectrum of KAT6B disorders and allelic series of pathogenic variants.\\u003c/em\\u003e Genet Med, 2020. \\u003cstrong\\u003e22\\u003c/strong\\u003e(8): p. 1338\\u0026ndash;1347.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eGezdirici, A., et al., \\u003cem\\u003eHow necessary is to analyze PTPN11 gene in fetuses with first trimester cystic hygroma and normal karyotype?\\u003c/em\\u003e J Matern Fetal Neonatal Med, 2017. \\u003cstrong\\u003e30\\u003c/strong\\u003e(8): p. 938\\u0026ndash;941.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eLord, J., et al., \\u003cem\\u003ePrenatal exome sequencing analysis in fetal structural anomalies detected by ultrasonography (PAGE): a cohort study.\\u003c/em\\u003e Lancet, 2019. \\u003cstrong\\u003e393\\u003c/strong\\u003e(10173): p. 747\\u0026ndash;757.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eSimpson, M.A., et al., \\u003cem\\u003eDe novo mutations of the gene encoding the histone acetyltransferase KAT6B cause Genitopatellar syndrome.\\u003c/em\\u003e Am J Hum Genet, 2012. \\u003cstrong\\u003e90\\u003c/strong\\u003e(2): p. 290-4.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eSzakszon, K., et al., \\u003cem\\u003eDe novo mutations of the gene encoding the histone acetyltransferase KAT6B in two patients with Say-Barber/Biesecker/Young-Simpson syndrome.\\u003c/em\\u003e Am J Med Genet A, 2013. \\u003cstrong\\u003e161A\\u003c/strong\\u003e(4): p. 884-8.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eCampeau, P.M., et al., \\u003cem\\u003eMutations in KAT6B, encoding a histone acetyltransferase, cause Genitopatellar syndrome.\\u003c/em\\u003e Am J Hum Genet, 2012. \\u003cstrong\\u003e90\\u003c/strong\\u003e(2): p. 282-9.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eClayton-Smith, J., et al., \\u003cem\\u003eWhole-exome-sequencing identifies mutations in histone acetyltransferase gene KAT6B in individuals with the Say-Barber-Biesecker variant of Ohdo syndrome.\\u003c/em\\u003e Am J Hum Genet, 2011. \\u003cstrong\\u003e89\\u003c/strong\\u003e(5): p. 675\\u0026thinsp;\\u0026minus;\\u0026thinsp;81.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eYabumoto, M., et al., \\u003cem\\u003eNovel variants in KAT6B spectrum of disorders expand our knowledge of clinical manifestations and molecular mechanisms.\\u003c/em\\u003e Mol Genet Genomic Med, 2021. \\u003cstrong\\u003e9\\u003c/strong\\u003e(10): p. e1809.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eScholl, J., et al., \\u003cem\\u003eFirst-trimester cystic hygroma: relationship of nuchal translucency thickness and outcomes.\\u003c/em\\u003e Obstet Gynecol, 2012. \\u003cstrong\\u003e120\\u003c/strong\\u003e(3): p. 551-9.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eHaak, M.C., et al., \\u003cem\\u003eIncreased nuchal translucency is associated with jugular lymphatic distension.\\u003c/em\\u003e Hum Reprod, 2002. \\u003cstrong\\u003e17\\u003c/strong\\u003e(4): p. 1086-92.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eBellini, C., et al., \\u003cem\\u003eNuchal translucency and lymphatic system maldevelopment.\\u003c/em\\u003e J Perinat Med, 2009. \\u003cstrong\\u003e37\\u003c/strong\\u003e(6): p. 673-6.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eLoukas, M., et al., \\u003cem\\u003eThe cardiac lymphatic system.\\u003c/em\\u003e Clin Anat, 2011. \\u003cstrong\\u003e24\\u003c/strong\\u003e(6): p. 684\\u0026thinsp;\\u0026minus;\\u0026thinsp;91.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eBendon, R. and A. Asamoah, \\u003cem\\u003ePerinatal autopsy findings in three cases of jugular lymphatic obstruction sequence and cardiac polyvalvular dysplasia.\\u003c/em\\u003e Pediatr Dev Pathol, 2008. \\u003cstrong\\u003e11\\u003c/strong\\u003e(2): p. 133-7.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eAroor, S., et al., \\u003cem\\u003eWaldmann\\u0026apos;s Disease (Primary Intestinal Lymphangiectasia) with Atrial Septal Defect.\\u003c/em\\u003e J Clin Diagn Res, 2017. \\u003cstrong\\u003e11\\u003c/strong\\u003e(4): p. SD03-SD04.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eBurger, N.B., et al., \\u003cem\\u003eWhy increased nuchal translucency is associated with congenital heart disease: a systematic review on genetic mechanisms.\\u003c/em\\u003e Prenat Diagn, 2015. \\u003cstrong\\u003e35\\u003c/strong\\u003e(6): p. 517\\u0026thinsp;\\u0026minus;\\u0026thinsp;28.\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eYan, M.S., et al., \\u003cem\\u003eHistone acetyltransferase 7 (KAT7)-dependent intragenic histone acetylation regulates endothelial cell gene regulation.\\u003c/em\\u003e J Biol Chem, 2018. \\u003cstrong\\u003e293\\u003c/strong\\u003e(12): p. 4381\\u0026ndash;4402.\\u003c/span\\u003e\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"KAT6B, whole exome sequencing, cystic hygroma, thickened nuchal translucency\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4544246/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4544246/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e \\u003cp\\u003eCystic hygroma is a vascular anomaly associated with lymphatic malformations and is relatively common in prenatal ultrasonography, presenting as thickened nuchal translucency(NT). However, the underlying molecular mechanism of cystic hygroma is complex and not yet completely understood.\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e \\u003cp\\u003eTrio-based whole exome sequencing(WES) was performed on a fetus with thickened NT but without chromosomal aberration, to indentify candidate pathogenic variants of potential Mendelian disorders. And Sanger sequencing was then conducted on the trio to confirm the variant.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e \\u003cp\\u003eIn this case, the fetus was diagnosed with cystic hygroma via the first-trimester ultrasonography, leading to termination of the pregnancy based on the pregnant woman's decision. Subsequently, trio-based WES was performed on the tissue of the aborted fetus and the blood samples of the parents. Data analysis indentified a novel nonsense variant, c.3822C\\u0026thinsp;\\u0026gt;\\u0026thinsp;G(p.Tyr1274Ter) of the KAT6B gene (NM_012330.4) that had not been reported previously. And Sanger sequencing of the trio confirmed this variant. Genetic consulting was provided to the woman for the subsequent pregnancies.\\u003c/p\\u003e\\u003ch2\\u003eConclusion\\u003c/h2\\u003e \\u003cp\\u003eKAT6B-related disorders manifest as cardiac diseases, and cardiac anomalies have been associated with disruptions in lymphatic system function, potentially contributing to the occurrence of cystic hygroma. Our findings illustrated the etiology of fetal abnormal development and lay the foundation for eugenics in the subsequent pregnancies. Additionally, findings expand the spectrum of variations in the KAT6B gene, offering further insights into its clinical relevance in prenatal cystic hygroma.\\u003c/p\\u003e\",\"manuscriptTitle\":\"A novel nonsense variant of the KAT6B gene associated with cystic hygroma in fetus\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-06-28 15:59:44\",\"doi\":\"10.21203/rs.3.rs-4544246/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"29919d22-9902-49de-8314-9c8ebee2ba87\",\"owner\":[],\"postedDate\":\"June 28th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-10-02T08:23:49+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-06-28 15:59:44\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4544246\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4544246\",\"identity\":\"rs-4544246\",\"version\":[\"v1\"]},\"buildId\":\"zQwnuV7TCBrMSSSToR1PI\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}