{"paper_id":"0bbeb148-1964-43b6-beb5-a3c361a4f01f","body_text":"Astragaloside IV attenuates uremia-induced myocardial injury by inhibiting autophagy via ATF4 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Astragaloside IV attenuates uremia-induced myocardial injury by inhibiting autophagy via ATF4 Jihao Xu, Qiudi Tu, Li Zhao, Xianyun Ye, Jianlan Zheng, Bin Zhu, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7145726/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 04 Dec, 2025 Read the published version in Scientific Reports → Version 1 posted 4 You are reading this latest preprint version Abstract Background Cardiovascular pathology is one of the primary causes of mortality in patients with uremia. The therapeutic value of intravenous Astragaloside (AS-IV)in the treatment of cardiovascular diseases (CVDs) has been widely recognized. However, research on its treatment ofCVDs complicated by uremia remains extremely limited. The aim of this study was therefore to determine the effects and potential mechanisms of AS-IV in the treatment of CVD associated with uremia. Methods The 5/6 nephrectomized mouse and uremic serum-induced myocardial injury model of H9C2 cells were constructed. A variety of techniques, including echocardiography, ELISA, TUNEL assay, flow cytometry, Western blotting, immunofluorescence, transmission electron microscopy,andqRT-PCRwere used to investigate the effects of AS-IV on uremia-associated myocardial injury and its impact on autophagy and related signaling pathway proteins. An ATF4 inhibitor and plasmid transfection techniques were used to modulate ATF4 expression and investigate the role of ATF4 in AS-IV-mediated protection against myocardial injury. Results AS-IVsignificantly improved cardiorenal function and attenuated uremia-associated cardiomyocyte apoptosis in the 5/6 nephrectomized mice. Autophagy levels were activated significantly and ATF4 expression was increased significantly in these mice and uremic toxin-treated cardiomyocytes. AS-IV also significantly inhibited ATF4 expression and cardiomyocyte autophagy. Inhibition of ATF4 expression reduced cardiomyocyte apoptosis, while overexpression of ATF4 significantly attenuated the cardioprotective effects of AS-IV. AS-IV significantly activated the PI3K pathway, while modulation of ATF4 expression affected activation of the PI3K pathway by AS-IV. Conclusions AS-IVameliorates uremia-associated myocardial injury by suppressing ATF4 expression and regulating cardiomyocyte autophagy activity. The PI3K pathway may be involved in this modulation of autophagy. Health sciences/Cardiology Biological sciences/Cell biology Health sciences/Diseases Health sciences/Nephrology Astragaloside-IV Autophagy ATF4 Myocardial injury Uremia Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Chronic kidney disease (CKD) is an increasingly serious global public health problem, affecting more than 10% of the general population worldwide, equivalent to over 800 million people [1] .CKD,especially end-stage renal disease(ESRD) is associated with an increased risk of cardiovascular disease (CVD) and an absolute risk of all-cause mortality, leading to a decrease in the quality-of-life and being one of the main burdens on the healthcare system [2] .There is no doubt that CVD caused by chronic kidney disease has become a public health crisis. In the past few decades, natural compounds extracted from traditional Chinese medicine have become important resources for drug development, especially for treating CVDs [3] . Astragaloside IV (AS-IV) is a purified small-molecule saponin extracted from Astragalus membranaceushasexhibits and has several biological activities,such asantioxidative stress, anti-inflammatory, anti-fibrosis and immune regulatory effects [4] .Accumulating evidence has indicated that AS-IVhas an ameliorating effect on cardiac myocytes in various diseases, such as septic cardiomyopathy [5] , ischemia-reperfusion injury [6] , and diabetic cardiomyopathy [7] . However, only a small number of studieshave investigated the effect and specific molecular mechanism of AS-IV in uremia-induced myocardial injury. Autophagy is a lysosomal dependent pathway that degrades cytoplasmic substances and damagesorganelles, and plays an important role in cell renewal and the maintenanceof intracellular homeostasis [8] .Previous studies haveshownthat AS-IV amelioratesmyocardial injury by regulatingautophagy [9, 10] . Activating transcription factor 4(ATF4)is an alkaline leucine zipper transcriptional factor, that belongs to the activator of transcription family༈ATF),and has animportant role in regulating the survival, growth, and development of normal tissue. ATF4 is also involved in many physiological metabolism processes such as the stress response [11] ,autophagy [12] ,inflammation and tumor growth [13] .A previous studydemonstrated that AS-IV suppressed the expression of ATF4 protein, thereby protecting rat podocyte apoptosis induced by streptozotocin [14] . It has also been shown thatATF4is involved in the regulation of autophagy in alcohol-induced myocardial injury [15] and cardiac atrophy [16] .However, little is known about the role of ATF4 in uremia-induced myocardial injury and whether or not autophagy is involved in this process.The aim of the current study was thereforeto evaluate the role of ATF4 and autophagy in the neuroprotective effects of AS-IV against uremia-induced myocardial injury. Materials and Methods Animalsand treatments The use of animals and the experimental protocols were approved by the Animal Care and Use Committee of Zhejiang Provincial People's Hospital of China. A total of 24, 10-week-old C57BL/6J male mice weighing 24–30 g were obtained from Yangzhou University Experimental Animal Center and were divided randomly into the following four groups: Sham (n = 6), 5/6-nephrectomized (5/6 Nx) (n = 6), 5/6 Nx + AS-IV (n = 6), and 5/6 Nx + AS-IV + rapamycin (n = 6).The 5/6 Nx operations were performed as follows. The animals were anesthetized with an intraperitoneal injection of a 10% sodium pentobarbital solution (150 µL). A left abdominal incision was made to expose the left kidney,and after ligation of the left kidney with polyglycolic acid sutures (i.e., about 1/3 of the volume of each kidney), the upper and lower poles were cut with ophthalmic scissors, with bleeding then stopped for 2 min. The residual kidney was repositioned and sutured back layer by layer.One week after surgery, the right kidney was exposed and its artery and ureter ligated, followed by removal of the kidney.Sham operations were conducted at the same time that involved onlya laparotomy. Six weeks after feeding,the mice of the sham and 5/6 Nx groupsreceived intraperitoneal injections of 1 mL saline once a day. The mice in the 5/6 Nx + AS-IV group were given intraperitoneal injections of 40 mg/kg/d of AS-IV once a day [17] , while the 5/6 Nx + AS-IV + Rap group was treated with AS-IV (40 mg/kg/d) and rapamycin (2 mg/kg/d) once a day for seven weeks. At the end of the intervention, the mice were anesthetized with 10% pentobarbital sodium solution for collection of blood samples and then euthanized to collect myocardial tissue. Echocardiography After sevenweeks of administration, the mice were anesthetized with 10% pentobarbital sodium solution, withcardiac ultrasonography(MyLab™X8, Esaote, Italy) thenperformed to assess cardiac function.The end-diastolic left ventricular posterior wall thickness (LVPW.d), end-systolic left ventricular posterior wall thickness (LVPW.s), end-diastolic inner diameter (LVID.d), end-systolic inner diameter (LVID.s), left ventricular ejection fraction (LVEF), and left ventricular shortening fraction (LVFS), were measured in a blinded fashion. Terminal deoxynucleotidyl transferase dUTP Nick End Labeling (TUNEL) assay The myocardial tissues were dehydrated,embedded in paraffin, sectioned at 4 µm thickness, with the paraffin sections then dewaxed, rehydrated in a series of graded alcohol solutions,and incubated in TUNEL reagent (C1086,Beyotime) for 60 min. The nuclei of the cells were stained with DAPI (1:1000, C1005,Beyotime).All the stained sections were observed by fluorescent microscopy(BX53, Olympus). Enzyme-linked immunosorbent assays (ELISA) The ELISA kits for measuring serumcreatinine(Scr),blood urea nitrogen(BUN), lactate dehydrogenase(LDH) andcreatine kinase-MB(CK-MB)levels were purchased separately fromNanjingJiancheng Bioengineering Institute.All the tests were performed following the instructions of the manufacturer. Immunohistochemistry assay The myocardial tissues were dehydrated,embedded in paraffin, and then sectioned at 4 µm thickness. The paraffin sections were dewaxed, subjected to antigen retrieval in citrate buffer at 92 ℃-96 ℃ for 10-15min,blocked with 10% goat serum(SL038,Solarbio) at room temperature for 15min,then incubation with the primary antibodies,anti-α-SMA(1:200,#19245,Cell Signaling Technology) andanti-α-actinin(1:250,ab108198, Abcam)at 4°Covernight, followed by incubation with the corresponding secondary antibody (1:1000,ab205718, Abcam) for 15min.The sections were then stained with DAB and observed using a microscope (Leica, Wetzlar) and analyzed using ImageJ software. Cell culture and intervention H9C2 cells were purchased from Procell Life Science &Technology Co.,Ltd(China), and were cultured in DMEM(C11885500BT, Gibco, USA) with 10% FBS and 1% penicillin streptomycin(SV30010Hyclone, USA) at 37°C and 5% CO 2 conditions.The cells were sub-cultured when the density reached between 80 to 90% confluence.The cells were then assigned randomly into experimental or control groups. The control group was cultured in DMEM containing 10% normal mouse plasma, while the experimental groupwas maintained in DMEM containing10% uremic mouse plasma(US)to create a uremic environment. Different concentrations of AS-IV(5, 15, 30, and 60 µg/mL) were added after 2h, followed by incubation for a further48 h to determine the optimal treatment concentration. Cell viability assay Cell viability was measured using a Cell Counting Kit-8 (CCK-8) (C0037,Beyotime, China).Briefly, the H9C2 cells were seeded in 96-well plates at a density of 1×10 4 cells/well and then treated with uremic mouse plasma and different concentrations of AS-IV for 48 h as described above.After the indicated treatments, each well was supplemented with 10 µl CCK-8 solution, followed by incubation for an additional 2 h at 37°C and 5% CO 2 . The absorbance at wavelength 450 nm was measured using a microplatereader(ThermoScientific, Waltham, USA). Cell transfection The plasmids(PCD513B)encoding ATF4 and the empty vector were purchased from Jiangxi Qiyun Biotechnology Co., Ltd. H9C2 cardiomyocytes were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin solution. When the cell density reached 80%-90%, plasmid transfection was performed using Lipofectamine™ 2000 transfection reagent(Thermo Fisher) according to the manufacturer’s protocol. Transmission electron microscopy (TEM) The cell culture medium wascentrifuged for 10 mins at 800r/min and the supernatant discarded.The cells were fixed in 2.5% glutaraldehyde for 48h and 1% osmic acid for 1 h,dehydrated with graded ethanol and then embedded in Epon 812 using standard laboratory procedures. Ultrathin sections of 50–70 nm were prepared, mounted on nickel grids,followed by staining with lead citrate for TEM(Tecnai F30). Western blot analysis Mice myocardial tissue or H9C2 cells were lysed using RIPA lysis buffer (P0013B,Beyotime Institute of Biotechnology) and the proteins quantified using a bicinchoninic acid protein assay kit(PC0020, Solarbio). An equal amount of protein (50 µg) was separated by 12% SDS PAGE, electro-transferred onto a nitrocellulose membrane, and then probed with the following primary antibodies: LC3(1:1,000,#4108, Cell Signaling Technology), p62 (1:1,000,# 23214, Cell Signaling Technology),GAPDH(1:2,000,#5174,Cell Signaling Technology),ATF4(1:1,000,DF6008, Affinity), PI3K(1:1,000,AF6241,Affinity), p-PI3K(1:1,000,AF3241, Affinity) at 4°C overnight.The membranes were then incubated with HRP-conjugated anti-rabbit secondary antibodies (1:2,000, ab205718, Abcam) for 1–2 h at room temperature. The blots were visualized using the enhanced chemiluminescence (ECL) reagents (Thermo Fisher Scientific). Immunofluorescence analysis Myocardial tissues sections were deparaffinized as described previously. The H9C2 cells were fixed in 4% paraformaldehyde for 30 min.After blocking with 5% BSA(SL038,Solarbio),the sections or the cells were incubated with the primary antibody(anti-LC3 1:200,anti-p62 1:400) at 4℃ overnight, followed by incubation with theFITC-conjugated anti-rabbit IgG(1:500,ab150077, Abcam) or Cy3-conjugated anti-rabbit IgG antibody (1:200,A0516, Beyotime)for 1 h at room temperature.The fluorescent images were observed usinga confocal laser scanning microscope(UltraVIEWVOX,PerkinElmer,USA). Flow cytometry The Annexin V-FITC apoptosis detection kit (C1062S, Beyotime) was used to evaluate cell apoptosis. The cells were suspended in binding buffer at a concentration of 1x10 6 cells/mL and then stained with 5 µL Annexin V-FITC plus 10 µl propidium iodide (PI) at room temperature in the dark for 15–20 min.Cell apoptosis was determined using a flow cytometer (CytoFLEXS, Beckman) and the data analyzed using CytExpert software (Beckman Coulter 2.4). Quantitative real-time PCR (qRT-PCR) Total RNA was isolated fromculturedH9C2 cells using Trizol reagent (15596018CN,Invitrogen) following the manufacturer’s instructions.The RNA was reverse-transcribed into cDNA using a FastKing-RT SuperMix kit (KR118; Tiangen, China).Quantitative RT-PCR was performed with SYBR Green PCR Master Mix (A46012,Applied Biosystems) in a Bio-radreal-time PCR detection system (CFX96 Touch, Bio-rad). The reaction conditions were 95°C for 3 min, followed by 40 cycles of 95°C for 12 s and 60°C for 40 s. The primer sequences are listed in Table 1 . Table 1 The primer sequencesforATF4 and GAPDH Name of primer Primer sequence(5’-3’) Length (bp) ATF4 forward CTGAACAGCGAAGTGTTGGC 214 ATF4 reverse AAAAGGCATCCTCCTTGCCG GAPDH forward GCGAGATCCCGCTAACATCA 178 GAPDH reverse CTCGTGGTTCACACCCATCA Statistical analysis All the data were expressed as mean ± standard deviation (mean ± SD). Differences between the groups were compared using one-way analysis of variance (ANOVA). All the statistical analyses were performed using GraphPad Prism 7.0 software, with a P -value < 0.05 considered statistically significant. Results AS-IV improved cardiac and renal function as well as ameliorated myocardial fibrosis in 5/6 nephrectomized mice ELISA analysis was performed to determine changesin the myocardial injury markers (LDH and CK-MB) and renal function markers (Scr and BUN) in the serum of mice from each group. As shown in Fig. 1 A, the levels of Scr, BUN, LDH, and CK-MB were increased significantly in the 5/6Nx group compared with those measured in the Sham group. However, these parameters were reduced significantly in the 5/6Nx + AS-IV group. Following the addition of rapamycin, the protective effect of AS-IV was not observed. To examine the effect of AS-IV on cardiac function in uremic mice, echocardiographic analysis (Figs. 1 B-C) showed that compared with the 5/6Nx mice, LVEF and LVFS were increased significantly in the 5/6Nx + AS-IVgroup, accompanied by a reduction in LVPW.d, LVPW.s, LVID.d, and LVID.s. This protective effect of AS-IV was inhibited significantly by rapamycin. Immunohistochemistry was used to detect the expression of α-actinin and α-SMA in myocardial tissues, with the results (Figs. 1 D-E), demonstrating that the expression of α-actinin and α-SMA was increased significantly in the 5/6Nx group compared to that observed in the Sham group. However, compared to the 5/6Nx group, the expression of α-actinin and α-SMA was decreased significantly in the 5/6Nx + AS-IV group. As expected, the expression of α-actinin and α-SMA was significantly increased by the addition of rapamycin. Taken together, these data indicated that AS-IV improved cardiac function and amelioratedmyocardial fibrosis in 5/6 nephrectomized mice, and that rapamycin inhibited this protective effect. AS-IVattenuated cardiomyocytes apoptosis in 5/6 nephrectomized mice inducedby uremic toxins To elucidate the cardioprotective mechanisms of AS-IVin uremia-induced myocardial injury we systematically investigated its anti-apoptotic effects using both in vivo and in vitro experimental approaches. In the in vivo study, myocardial apoptosis was assessed quantitatively using the TUNEL assay. The quantitative analysis showed a significant reduction in the apoptotic index in the 5/6 nephrectomy (5/6Nx) + AS-IV and 5/6Nx + AS-IV + Rap groups compared to that measured in the sham-operated controls. Notably, the apoptosis rate in the 5/6Nx + AS-IV + Rap group exhibited a statistically significant increase relative to that ofthe 5/6Nx + AS-IV group (Figs. 2 A-B). For the in vitro evaluation, the cytotoxic effects of uremic serum and the cytoprotective potential of AS-IV were assessed using the Cell Counting Kit-8 (CCK-8) assay following 48hof treatment. Quantitative analysis demonstrated a significant reduction in H9C2 cardiomyocyte viability following uremic serum exposure. AS-IV treatment dose-dependently attenuated the uremic serum-induced cytotoxicity, with the maximal protective effect observed at 60 µg/mL (Fig. 2 C). This optimal concentration was subsequently used in the mechanistic investigations. Flow cytometric analysis of apoptosis showed a marked increase in the apoptotic rate in the 10% uremic serum (US) group compared to that observed in the controls. Co-treatment with AS-IV and the integrated stress response inhibitor (ISRIB) or the endogenous ATF4 inhibitor, significantly ameliorated uremic serum-induced apoptosis (Figs. 2 D-E). ATF4 mediated the cardioprotective effects of AS-IV in 5/6 nephrectomizedmice and uremic serum-induced cardiomyocyte injury We then examined ATF4 expression across the experimental groups. Quantitative analysis showed significant upregulation of ATF4 expression in the 5/6Nx group compared to that observed in the Sham group(Figs. 3 A,B). Notably, AS-IV treatment markedly attenuated this increase in the 5/6Nx + AS-IV group. Intriguingly, rapamycin co-treatment resulted in significant upregulation of ATF4, suggesting a potential association between ATF4 expression and autophagic regulation.To validate these findings, we performed in vitro investigations using Western blotting and qRT-PCR analyses to assess the expression levels of ATF4 protein and mRNA. Consistent with our in vivo observations, exposure to 10% uremic serum (US) significantly elevated both ATF4 protein and transcript levels. This upregulation was effectively suppressed by AS-IV treatment (Figs. 3 C-E). Consistent with our previous findings, pharmacological inhibition of ATF4 using ISRIB significantly ameliorated apoptosis induced in cardiomyocytes by uremic toxins(Figs. 2 D and E). To further elucidate the functional role of ATF4, we used vector transfection to establishH9C2 cells that overexpressed ATF4. Notably, ATF4 overexpression substantially attenuated the cardioprotective effects of AS-IV against uremic toxin-induced injury in these cells (Fig. 3 F). Taken together, these findings suggest that the protective effects of AS-IV against uremic cardiomyopathy may be mediated, at least in part, through modulation of ATF4 signaling pathways. AS-IV attenuated cardiomyocyte autophagyin 5/6 nephrectomized mice To elucidate the potential involvement of autophagy in the cardioprotective effects of AS-IV against uremia-induced myocardial injury,we examined key autophagy markers (LC3 II/I and p62) using Western blotting and immunofluorescence analyses.Immunofluorescence analysis showeda significant increase in LC3 puncta formation accompanied by reducedexpression of p62 in the 5/6Nx group compared to that observed in the controls.Notably, AS-IV treatment markedly attenuated these changes. This indicated that decreased LC3 puncta and increased p62 expression (Figs. 4 A-D)wereassociated with suppression of autophagic flux.These findings were corroborated by the Western blot analysis, which showed significantly increasedLC3 II/I ratios and reduced p62 levels in the 5/6Nx mice. Importantly, these alterations were largelyreversed following 7-wk of AS-IV treatment (Figs. 4 E-F). Based on these collective findings, we propose that the cardioprotective mechanism of AS-IV may involve modulation of cardiomyocyte autophagy. This hypothesis wasfurther supported by our observation that rapamycin-induced autophagy reactivation attenuated the protective effects of AS-IV. AS-IVinhibited cardiomyocyte autophagyinduced by uremic serum via ATF4 To further elucidate the cardioprotective mechanisms of AS-IV we conducted in vitro investigations to evaluate its regulatory effects on autophagy in uremia-induced cardiomyocyte injury.In addition, we focused on delineating the mechanistic role of ATF4 in AS-IV-mediated regulation of cardiomyocyte autophagy. First, ISRIB, an endogenous ATF4 inhibitor, was used to inhibit ATF4 expression.Western blot analysis showedthat 10% uremic serum (US) treatment significantly increasedthe LC3 II/I ratio, while reducing p62 expression in H9C2 cells. Notably, these US-induced alterations were effectively reversed by AS-IV treatment (Figs. 5 A,B). Consistent with these findings, ISRIB treatment hadsimilar effects on autophagy markers.TEM analysis demonstrated a substantial increase in double-membrane autophagosomes in H9C2 cells treated with 10% US compared to that observed in the controls. Both AS-IV and ISRIB treatments significantly attenuated the formation of autophagosomes(Fig. 5 C).These observations were validated by immunofluorescence analysis, which showed increased fluorescent spots of LC3 and decreased p62 expression in the 10% US group. Importantly, these changes were reversed by either AS-IV or ISRIB treatment (Figs. 5 D,E). Next,we initiated overexpression of ATF4 in H9C2 cells usingplasmid vector transfection.As shown in Figs. 6 A–C, the level of LC3 II/I was decreased significantly in the 10% US + AS-IV group in line with the increased expression of p62.Notably, ATF4 overexpression substantially attenuated the anti-autophagic effects of AS-IV.Consistent with these findings, TEM analysis demonstrated a significant reduction in autophagosome formation in the 10% US + AS-IV group compared to that measured in the 10% US group. Importantly, ATF4 overexpression reversed this effect, leading to increased formation of autophagosomes(Fig. 6 D). These collective findings provide compelling evidence that ATF4 plays a crucial role in mediating AS-IV's regulation of cardiomyocyte autophagy. PI3K pathway activation mediated ATF4-dependent autophagyregulated by AS-IV in uremic cardiomyopathy Given the critical involvement of the PI3K signaling pathway in autophagy regulation, we investigated its potential role in ATF4-dependent regulation of cardiac autophagy mediated by AS-IV.Quantitative analysis of PI3K pathway activation was conducted through Western blot detection of PI3K and its phosphorylated form (p-PI3K) in vitro . As shown in Figs. 7 A and B,the p-PI3K/PI3K ratio was decreased significantly in the 10% US group compared with that in the control group.However, the phosphorylation level of PI3K was increased significantly in both the AS-IV treatment and ATF4 inhibitor treatment groups. This suggested that AS-IV may restore inhibition of the PI3K signaling pathway in cardiomyocytes induced by uremic toxins by suppressingATF4 expression.To further elucidate the role of ATF4 in the activation of the PI3K pathway by AS-IV, we treated cells with AS-IV in combination with ATF4 overexpression. The results showeda significant decrease in the ratio of p-PI3K/PI3K in the 10% US + AS-IV + oe-ATF4 group compared to that in the 10% US + AS-IV group(Figs. 7 C,D).These results suggested thatthe PI3K signaling pathway is implicated in the regulation of uremia-associated cardiomyocyte autophagy by AS-IV, thereby conferring itsprotective effect. Discussion CVDin patients with uremia represents a significant clinical issue and is the leading cause of mortality in these patients [18] . Multiple mechanisms contribute to the progression of CVD in uremic patients, including persistent microinflammatory states leading to endothelial cell injury, excessive production of reactive oxygen species (ROS) that accelerateatherosclerosis, disorders of mineral metabolism that promotevascular calcification, accumulation of uremic toxins, volume overload, and others [19–22] .The complexity of these mechanisms poses significant challenges for the prevention and treatment of CVD in uremia. AS-IV, a traditional Chinese medicinalingredient, has been widely usedin the treatment of CVDs. A previous study reportedthat an optimized derivative of AS-IV reversed myocardial remodeling induced by myocardial infarction and improved cardiac function by inhibiting lnc9456 in the heart [23] .A recent study also showed that AS-IV improved myocardial injury in LPS-induced sepsis models by restoring mitochondrial function and ER-autophagy [5] . The current studyuseda 5/6 nephrectomy mouse model and a uremic serum-induced H9C2 cardiomyocyte injury model to show that AS-IV significantly improved cardiac and renal function, reduced myocardial fibrosis, and alleviated uremia-related cardiomyocyte apoptosis. Furthermore, AS-IV exerted cardioprotective effects by inhibiting ATF4 expression and cardiomyocyte autophagy. These findings suggest that AS-IV possesses potential therapeutic value in the treatment of uremia-related CVDs. Recent studies have revealed that excessively activated autophagy is a detrimental factor in many CVDs. By inhibiting ROS-dependent autophagy and ferroptosis, cardiac function following myocardial infarction can be protectedeffectively [24] . Excessive activation of autophagy has beendetected in cardiomyocytes of diabetic mouse models,with evidence showing that empagliflozin reverses cardiac dysfunction in diabetic mice by inhibiting myocardial autophagy [25] .In our study, we observedthat autophagy levels were increased significantly in both 5/6 nephrectomized mice and uremic serum-treated H9C2 cells. This suggests that excessivelyactivated autophagy is a promoter of uremia-associated CVD,which is consistent with the findings of previous reports in the literature [26] . We showedthat AS-IV intervention significantly suppressed excessive autophagy activity. However, when autophagy was reactivated using rapamycin, the cardioprotective effects of AS-IV were markedly attenuated. These results further demonstrate that the protective role of AS-IV against uremia-associated myocardial injury is linked to the regulation of autophagy. ATF4, a basic region leucine zipper transcription factor, plays a critical role in numerous biological processes.In CVDs, overexpression of ATF4 activates autophagy, leading to fatal cardiac atrophy in mice [16] .Inhibition of ATF4-related signaling pathways has been shown to suppress cardiomyocyte autophagy, thereby alleviating myocardial ischemia-reperfusion (I/R) injury and reducing cardiomyocyte apoptosis [27] .Our study also showed that ATF4 expression was increased significantly in both nephrectomized miceand uremic serum-stimulated cardiomyocytes, withthis abnormal increase markedly suppressed by AS-IV. ATF4 inhibitors alone significantly reduced uremic toxin-induced cardiomyocyte autophagy and apoptosis. However, as their inhibitory effect was less pronounced compared to that of AS-IV, we speculate that additional mechanisms beyond ATF4 inhibition may contribute to the cardioprotective effects of AS-IV.This possibility requires further verification. PI3K is a critical signaling protein involved in autophagy regulation [28] .However, whether PI3K participates in ATF4-mediated modulation of myocardial autophagy by AS-IV remains to be elucidated. Dat P Ha et al. [29] identified ATF4 as thekey downstream target of the PI3K/AKT/mTOR signaling pathway. Our findings demonstrated that AS-IV significantly restored PI3K phosphorylation levels, while inhibition of ATF4 expression using ISRIB caused a similarenhancement ofPI3K activation. Furthermore, overexpression of ATF4 markedly attenuated the ability of AS-IV to activate PI3K, suggesting that ATF4 may act as an upstream regulator of the PI3K pathway. Conclusion In summary, we identified a role ofAS-IV as a potential therapeutic drug for uremia-related CVD. AS-IV suppressed excessive autophagy in cardiomyocytes, reduced cardiomyocyte apoptosis, and improved cardiac ejection function.We have also provided evidence that showsATF4 is involved in the regulation of cardiomyocyte autophagy by AS-IV. We also identifieda mechanistic role forthe PI3Ksignaling pathway that mediated cardiomyocyte autophagy. These findings provide new insights into our understanding of the effects of AS-IV,and mayidentify an innovative therapeutic strategy for uremic patients with cardiovascular complications. Declarations Acknowledgments We would like to thankthe molecular diagnosis and individualized therapy key laboratory of Zhejiang for excellent technical assistance. Funding This work was supported by grants from the Project of Scientific Research Foundation of Zhejiang Traditional Chinese Medicine Administration (grant nos. 2023ZL263) and the General Project of the Medical and Health of Zhejiang Province (grant nos. 2023KY023,2024KY705 and 2024KY667） Authors’ contributions Jianguang Gong designed the study,Jianlan Zheng and Bin Zhurevised the manuscript, Jihao Xu,Xianyun Ye,and Li Zhao performed the laboratory assays,Qiudi Tu performed the statistical analyses, and Jianguang Gong and Jianlan Zheng wrote the manuscript. The final version of the manuscript was approved by all the authors. Conflict of interest The authors declare that they have no potential conflict of interest. Ethics Approval and Consent to Participate All animal procedures were approved by the Institutional Ethical Committee of the Zhejiang Provincial People’s Hospital. References Kovesdy CP. Epidemiology of chronic kidney disease: an update 2022. Kidney Int Suppl (2011). 2022. 12(1): 7-11. GBD Chronic Kidney Disease Collaboration. Global, regional, and national burden of chronic kidney disease, 1990-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet. 2020. 395(10225): 709-733. Gao L, Cao M, Li JQ, Qin XM, Fang J. Traditional Chinese Medicine Network Pharmacology in Cardiovascular Precision Medicine. Curr Pharm Des. 2021. 27(26): 2925-2933. Liang Y, Chen B, Liang D, et al. Pharmacological Effects of Astragaloside IV: A Review. Molecules. 2023. 28(16): 6118. Wang J, Pu X, Zhuang H, et al. Astragaloside IV alleviates septic myocardial injury through DUSP1-Prohibitin 2 mediated mitochondrial quality control and ER-autophagy. J Adv Res. 2024 : S2090-1232(24)00471-5 [pii]. Zhai P, Chen Q, Wang X, et al. The combination of Tanshinone IIA and Astragaloside IV attenuates myocardial ischemia-reperfusion injury by inhibiting the STING pathway. Chin Med. 2024. 19(1): 34. Li X, Li Z, Dong X, et al. Astragaloside IV attenuates myocardial dysfunction in diabetic cardiomyopathy rats through downregulation of CD36-mediated ferroptosis. Phytother Res. 2023. 37(7): 3042-3056. Dunn WA Jr. Autophagy and related mechanisms of lysosome-mediated protein degradation. Trends Cell Biol. 1994. 4(4): 139-43. Luo LF, Qin LY, Wang JX, Guan P, Wang N, Ji ES. Astragaloside IV Attenuates the Myocardial Injury Caused by Adriamycin by Inhibiting Autophagy. Front Pharmacol. 2021. 12: 669782. Zhang J, Lu M, Li C, et al. Astragaloside IV mitigates hypoxia-induced cardiac hypertrophy through calpain-1-mediated mTOR activation. Phytomedicine. 2024. 125: 155250. Neill G, Masson GR. A stay of execution: ATF4 regulation and potential outcomes for the integrated stress response. Front Mol Neurosci. 2023. 16: 1112253. Vanhoutte D, Schips TG, Minerath RA, et al. Thbs1 regulates skeletal muscle mass in a TGFβ-Smad2/3-ATF4-dependent manner. Cell Rep. 2024. 43(5): 114149. Krall AS, Mullen PJ, Surjono F, et al. Asparagine couples mitochondrial respiration to ATF4 activity and tumor growth. Cell Metab. 2021. 33(5): 1013-1026.e6. Chen Y, Gui D, Chen J, He D, Luo Y, Wang N. Down-regulation of PERK-ATF4-CHOP pathway by Astragaloside IV is associated with the inhibition of endoplasmic reticulum stress-induced podocyte apoptosis in diabetic rats. Cell PhysiolBiochem. 2014. 33(6): 1975-87. Tian G, Li J, Zhou L. Ginsenoside Rg1 regulates autophagy and endoplasmic reticulum stress via the AMPK/mTOR and PERK/ATF4/CHOP pathways to alleviate alcohol‑induced myocardial injury. Int J Mol Med. 2023. 52(1): 56 [pii]. Vanhoutte D, Schips TG, Vo A, et al. Thbs1 induces lethal cardiac atrophy through PERK-ATF4 regulated autophagy. Nat Commun. 2021. 12(1): 3928. Lin J, Fang L, Li H, et al. Astragaloside IV alleviates doxorubicin induced cardiomyopathy by inhibiting NADPH oxidase derived oxidative stress. Eur J Pharmacol. 2019. 859: 172490. Sundström J, Bodegard J, Bollmann A, et al. Prevalence, outcomes, and cost of chronic kidney disease in a contemporary population of 2·4 million patients from 11 countries: The CaReMe CKD study. Lancet Reg Health Eur. 2022. 20: 100438. Mezzano D, Pais EO, Aranda E, et al. Inflammation, not hyperhomocysteinemia, is related to oxidative stress and hemostatic and endothelial dysfunction in uremia. Kidney Int. 2001. 60(5): 1844-50. Himmelfarb J, Stenvinkel P, Ikizler TA, Hakim RM. The elephant in uremia: oxidant stress as a unifying concept of cardiovascular disease in uremia. Kidney Int. 2002. 62(5): 1524-38. London GM, Marchais SJ, Guérin AP, Métivier F. Arteriosclerosis, vascular calcifications and cardiovascular disease in uremia. Curr Opin Nephrol Hypertens. 2005. 14(6): 525-31. Tonelli M, Karumanchi SA, Thadhani R. Epidemiology and Mechanisms of Uremia-Related Cardiovascular Disease. Circulation. 2016. 133(5): 518-36. Wan J, Zhang Z, Wu C, et al. Astragaloside IV derivative HHQ16 ameliorates infarction-induced hypertrophy and heart failure through degradation of lncRNA4012/9456. Signal Transduct Target Ther. 2023. 8(1): 414. Li D, Zhang G, Wang Z, et al. Idebenone attenuates ferroptosis by inhibiting excessive autophagy via the ROS-AMPK-mTOR pathway to preserve cardiac function after myocardial infarction. Eur J Pharmacol. 2023. 943: 175569. Madonna R, Moscato S, Cufaro MC, et al. Empagliflozin inhibits excessive autophagy through the AMPK/GSK3β signalling pathway in diabetic cardiomyopathy. Cardiovasc Res. 2023. 119(5): 1175-1189. Feng J, Li H, Wang S. Hydrogen sulfide alleviates uremic cardiomyopathy by regulating PI3K/PKB/mTOR-mediated overactive autophagy in 5/6 nephrectomy mice. Front Pharmacol. 2022. 13: 1027597. Wang CC, Li Y, Qian XQ, et al. Empagliflozin alleviates myocardial I/R injury and cardiomyocyte apoptosis via inhibiting ER stress-induced autophagy and the PERK/ATF4/Beclin1 pathway. J Drug Target. 2022. 30(8): 858-872. Glick D, Barth S, Macleod KF. Autophagy: cellular and molecular mechanisms. J Pathol. 2010. 221(1): 3-12. Ha DP, Lee AS. Insulin-like growth factor 1-receptor signaling stimulates GRP78 expression through the PI3K/AKT/mTOR/ATF4 axis. Cell Signal. 2020. 75: 109736. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 04 Dec, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 19 Jul, 2025 Editor assigned by journal 19 Jul, 2025 Submission checks completed at journal 18 Jul, 2025 First submitted to journal 17 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-7145726\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":487731480,\"identity\":\"f899cea6-8511-41e6-8ec6-fac9b81972a7\",\"order_by\":0,\"name\":\"Jihao Xu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Zhejiang Provincial People's Hospital, Hangzhou Medical College\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jihao\",\"middleName\":\"\",\"lastName\":\"Xu\",\"suffix\":\"\"},{\"id\":487731481,\"identity\":\"e9f06b50-e710-44b2-95fe-d98d9611208d\",\"order_by\":1,\"name\":\"Qiudi Tu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Zhejiang Provincial People's Hospital, Hangzhou Medical College\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Qiudi\",\"middleName\":\"\",\"lastName\":\"Tu\",\"suffix\":\"\"},{\"id\":487731482,\"identity\":\"4a8e5498-f480-4251-a903-457f9e2f60d3\",\"order_by\":2,\"name\":\"Li Zhao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Zhejiang Provincial People's Hospital, Hangzhou Medical College\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Li\",\"middleName\":\"\",\"lastName\":\"Zhao\",\"suffix\":\"\"},{\"id\":487731484,\"identity\":\"76a10571-d14a-49bb-9705-8f6e7d187649\",\"order_by\":3,\"name\":\"Xianyun Ye\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Zhejiang Provincial People's Hospital, Hangzhou Medical College\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xianyun\",\"middleName\":\"\",\"lastName\":\"Ye\",\"suffix\":\"\"},{\"id\":487731485,\"identity\":\"a2d1b899-6aab-4c8a-ab85-8b144e8e5ec5\",\"order_by\":4,\"name\":\"Jianlan Zheng\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Zhejiang Provincial People's Hospital, Hangzhou Medical College\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jianlan\",\"middleName\":\"\",\"lastName\":\"Zheng\",\"suffix\":\"\"},{\"id\":487731489,\"identity\":\"30030b4f-4350-49f6-9eff-9e7f993e002b\",\"order_by\":5,\"name\":\"Bin Zhu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Zhejiang Provincial People's Hospital, Hangzhou Medical College\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Bin\",\"middleName\":\"\",\"lastName\":\"Zhu\",\"suffix\":\"\"},{\"id\":487731490,\"identity\":\"aaf98421-68c9-49de-a008-9193b7348635\",\"order_by\":6,\"name\":\"Jianguang Gong\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIie2PMQrCQBBFJwQ2zWAdiZoraGOjYOk1JgixEREEK4tUayPYegy9wchi0oi1pcELaCGksNAIWsa1E9zXffiPPwNgMPwmxABTFE5kMX2hxJUSMmgrOXa75hKwVtfvRunmKgWK8unIqVRDcNR2VaQ0dkyqKisovLDOgVRjwDA8FCpLIlXOVzx6KkHkYlNHsR+HJWc9xXeJNpdccVFzpY6PX2Afo8DBiGnfD+SnX/zZvHfJJtOOP0vWaTZpBQtHxcUrjGTjK1kCQBTVnyuRw1b2jrdPfYPBYPhH7oamUg3juX//AAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Zhejiang Provincial People's Hospital, Hangzhou Medical College\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Jianguang\",\"middleName\":\"\",\"lastName\":\"Gong\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-07-17 06:53:32\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-7145726/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-7145726/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1038/s41598-025-30374-x\",\"type\":\"published\",\"date\":\"2025-12-04T15:58:15+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":87712702,\"identity\":\"a7fb7f42-ea0f-4a56-aeec-99910e45f85d\",\"added_by\":\"auto\",\"created_at\":\"2025-07-28 08:52:47\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1986444,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eAS-IV improved cardiac function and ameliorated myocardial fibrosis.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e(A) ELISA was used to measure the levels of LDH, Scr, BUN, and CK-MB in the serum of mice from each group. (B)Representative echocardiographic images of each group. (C)Echocardiographic parameters,including LVPW.d, LVPW.s, LVID.d,, LVID.s ,LVEF, and LVFS. (D)The expression of α-actinin and α-SMA in myocardial tissues was detected by immunohistochemistry (magnification, ×400). (E)Quantitative evaluation of the expression ofα-actinin and α-SMAprotein. The data are expressedas the means ± SD,n=6. *\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05,**\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs.Sham group.\\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs.5/6Nxgroup.\\u003csup\\u003e\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05,\\u003csup\\u003e\\u0026amp;\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs. 5/6Nx +AS-IVgroup.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"fig1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7145726/v1/f39abf7e7b43558a804d98df.png\"},{\"id\":87714415,\"identity\":\"21857682-08d9-46a6-a226-d329265c5a78\",\"added_by\":\"auto\",\"created_at\":\"2025-07-28 09:00:48\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1015183,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eAS-IVattenuated cardiomyocytes apoptosis in 5/6 nephrectomized mice and uremic serum treated H9C2 cells.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e(A)Myocardial apoptosis was detected by the TUNEL assay. The representative images are shown.(B)Bar graphs showingtheapoptosis rate in each group.(C)The CCK-8 assay was used to assess the cell viability ineach group.(D)Representative images of the flow cytometry analysisare shown for each group.(E)Bar graphs showingquantitative analysis of apoptotic cells. The data are expressedas the means ± SD. *\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05,**\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs.Sham group or Control group.\\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs.5/6Nxgroup or 10%US group.\\u003csup\\u003e\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05,\\u003csup\\u003e\\u0026amp;\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs. 5/6Nx +AS-IVgroup or 10%US + AS-IV group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"fig2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7145726/v1/5552f4e46f0ec1ba02a1f44b.png\"},{\"id\":87711915,\"identity\":\"099c4a70-ebf5-40b8-89e3-95255b186cbf\",\"added_by\":\"auto\",\"created_at\":\"2025-07-28 08:44:47\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":542984,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eAS-IV inhibited ATF4 expression. (A)Representative immunoblotting images of ATF4in the myocardial tissue of mice (n=6). (B)Bar graphs showingthe relative expression ofATF4protein in the myocardial tissue of mice. (C)Bar graphs showing therelative mRNA expression of ATF4 in H9C2 cells. (D)Representative immunoblotting images of ATF4 inH9C2 cells. (E)Bar graphs showingthe relative expression ofATF4protein inH9C2 cells. (F)The CCK-8 assay was used to assess the cell viability ofeach group.The data are expressedas the mean ± SD. *\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05,**\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs.Sham group or Control group.\\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs.5/6Nxgroup or 10%US group.\\u003csup\\u003e\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05,\\u003csup\\u003e\\u0026amp;\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs. 5/6Nx +AS-IV group or 10%US + AS-IV group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"fig3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7145726/v1/b950162f474c89a245e34101.png\"},{\"id\":87715840,\"identity\":\"e22c6fab-2078-4262-b8ab-e6fb1843aef9\",\"added_by\":\"auto\",\"created_at\":\"2025-07-28 09:09:05\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1458185,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eAS-IV attenuated cardiomyocytes autophagy in 5/6 nephrectomizedmice.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e(A and B)Representative photomicrographs of immunofluorescence staining(magnification,×400) and quantitative analysis of LC3in the myocardial tissue of mice.(C and D) Representative photomicrographs of immunofluorescence staining(magnification,×400) and quantitative analysis of p62in the myocardial tissue of mice.(E) Representative immunoblotting images of LC3I,LC3II, and p62 in the myocardial tissue of mice. (F)Bar graphs showing the relative expression of LC3II/I andp62 protein.The data are expressedas means ± SD,n=6. *\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05 ,**\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs.Sham group.\\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs.5/6Nxgroup.\\u003csup\\u003e\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05,\\u003csup\\u003e\\u0026amp;\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs.5/6Nx +AS-IV group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"fig4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7145726/v1/b3b6190c0ab2560482fa9fe1.png\"},{\"id\":87712706,\"identity\":\"6fd7482b-b27d-4e4f-bf97-a653d5122b5e\",\"added_by\":\"auto\",\"created_at\":\"2025-07-28 08:52:48\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1672880,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSuppression of ATF4 expression inhibited autophagy in H9C2 cardiomyocytes.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e(A and B) Representative Western blot images and quantitative analysis of LC3 I, LC3 II, and p62 in H9C2 cells. (C) Representative TEM images of autophagosomes (arrows) in each group(scale bar, 2 μm,).(D and E) Representative photomicrographs of immunofluorescence staining (magnification, ×400) and quantitative analysis of LC3 (D) and p62(E) in each group.The data are expressed as the mean ± SD. *\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05,**\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs.Control group.\\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs.10%US group.\\u003csup\\u003e\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05,\\u003csup\\u003e\\u0026amp;\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs. 10%US + AS-IV group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"fig5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7145726/v1/b50676967d92fa7b52719252.png\"},{\"id\":87714420,\"identity\":\"7fbc2adb-3c05-46ec-9492-b60499ebb296\",\"added_by\":\"auto\",\"created_at\":\"2025-07-28 09:00:48\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":697968,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eUpregulation of ATF4 expression alleviated the suppressive effect of AS-VI on cardiomyocyte autophagy.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e(A)Representative immunoblotting images ofLC3 I, LC3II, and p62 in each group. (B and C) Bar graphs showing the relative expression ofLC3II/ I and p62proteinin each group.(D) Representative TEMimagesof autophagosomes (arrows) in each group(scale bar, 2 μm,).The data are expressedas the mean ± SD. *\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05,**\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs.Control group.\\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs.10%US group.\\u003csup\\u003e\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05,\\u003csup\\u003e\\u0026amp;\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs. 10%US + AS-IV group.\\u0026nbsp;\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"fig6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7145726/v1/b10eaf6ce30391541ffd2d3b.png\"},{\"id\":87711925,\"identity\":\"9c67a387-3e96-4548-a8ec-8d382a87a9c0\",\"added_by\":\"auto\",\"created_at\":\"2025-07-28 08:44:48\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":479269,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eAS-VI promotedactivation of the PI3K signaling pathway. \\u003c/strong\\u003e(A and C) Representative immunoblotting images of PI3K and p-PI3K in H9C2 cells.(B and D) Bar graphs showing the relative expression of p-PI3K/ PI3K in H9C2 cells.The data are expressed as the mean ± SD. *\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05,**\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs.Control group.\\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs.10%US group.\\u003csup\\u003e\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05,\\u003csup\\u003e\\u0026amp;\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01 vs. 10%US + AS-IV group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"fig7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7145726/v1/3e0f5ff49597af43afd91862.png\"},{\"id\":97723961,\"identity\":\"ad2f7493-b499-41f6-b01b-0d6926dc5adf\",\"added_by\":\"auto\",\"created_at\":\"2025-12-08 16:10:14\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":8708241,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7145726/v1/36a3d204-f999-4045-b5c2-9566ff03b3a7.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Astragaloside IV attenuates uremia-induced myocardial injury by inhibiting autophagy via ATF4\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eChronic kidney disease (CKD) is an increasingly serious global public health problem, affecting more than 10% of the general population worldwide, equivalent to over 800\\u0026nbsp;million people\\u003csup\\u003e[1]\\u003c/sup\\u003e.CKD,especially end-stage renal disease(ESRD) is associated with an increased risk of cardiovascular disease (CVD) and an absolute risk of all-cause mortality, leading to a decrease in the quality-of-life and being one of the main burdens on the healthcare system\\u003csup\\u003e[2]\\u003c/sup\\u003e.There is no doubt that CVD caused by chronic kidney disease has become a public health crisis.\\u003c/p\\u003e\\u003cp\\u003eIn the past few decades, natural compounds extracted from traditional Chinese medicine have become important resources for drug development, especially for treating CVDs\\u003csup\\u003e[3]\\u003c/sup\\u003e. Astragaloside IV (AS-IV) is a purified small-molecule saponin extracted from \\u003cem\\u003eAstragalus membranaceushasexhibits\\u003c/em\\u003eand has several biological activities,such asantioxidative stress, anti-inflammatory, anti-fibrosis and immune regulatory effects\\u003csup\\u003e[4]\\u003c/sup\\u003e.Accumulating evidence has indicated that AS-IVhas an ameliorating effect on cardiac myocytes in various diseases, such as septic cardiomyopathy\\u003csup\\u003e[5]\\u003c/sup\\u003e, ischemia-reperfusion injury\\u003csup\\u003e[6]\\u003c/sup\\u003e, and diabetic cardiomyopathy\\u003csup\\u003e[7]\\u003c/sup\\u003e. However, only a small number of studieshave investigated the effect and specific molecular mechanism of AS-IV in uremia-induced myocardial injury.\\u003c/p\\u003e\\u003cp\\u003eAutophagy is a lysosomal dependent pathway that degrades cytoplasmic substances and damagesorganelles, and plays an important role in cell renewal and the maintenanceof intracellular homeostasis\\u003csup\\u003e[8]\\u003c/sup\\u003e.Previous studies haveshownthat AS-IV amelioratesmyocardial injury by regulatingautophagy\\u003csup\\u003e[9, 10]\\u003c/sup\\u003e. Activating transcription factor 4(ATF4)is an alkaline leucine zipper transcriptional factor, that belongs to the activator of transcription family༈ATF),and has animportant role in regulating the survival, growth, and development of normal tissue. ATF4 is also involved in many physiological metabolism processes such as the stress response\\u003csup\\u003e[11]\\u003c/sup\\u003e,autophagy\\u003csup\\u003e[12]\\u003c/sup\\u003e,inflammation and tumor growth\\u003csup\\u003e[13]\\u003c/sup\\u003e.A previous studydemonstrated that AS-IV suppressed the expression of ATF4 protein, thereby protecting rat podocyte apoptosis induced by streptozotocin\\u003csup\\u003e[14]\\u003c/sup\\u003e. It has also been shown thatATF4is involved in the regulation of autophagy in alcohol-induced myocardial injury\\u003csup\\u003e[15]\\u003c/sup\\u003eand cardiac atrophy\\u003csup\\u003e[16]\\u003c/sup\\u003e.However, little is known about the role of ATF4 in uremia-induced myocardial injury and whether or not autophagy is involved in this process.The aim of the current study was thereforeto evaluate the role of ATF4 and autophagy in the neuroprotective effects of AS-IV against uremia-induced myocardial injury.\\u003c/p\\u003e\"},{\"header\":\"Materials and Methods\",\"content\":\"\\u003cp\\u003e\\u003cb\\u003eAnimalsand treatments\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003e The use of animals and the experimental protocols were approved by the Animal Care and Use Committee of Zhejiang Provincial People's Hospital of China. A total of 24, 10-week-old C57BL/6J male mice weighing 24\\u0026ndash;30 g were obtained from Yangzhou University Experimental Animal Center and were divided randomly into the following four groups: Sham (n\\u0026thinsp;=\\u0026thinsp;6), 5/6-nephrectomized (5/6 Nx) (n\\u0026thinsp;=\\u0026thinsp;6), 5/6 Nx\\u0026thinsp;+\\u0026thinsp;AS-IV (n\\u0026thinsp;=\\u0026thinsp;6), and 5/6 Nx\\u0026thinsp;+\\u0026thinsp;AS-IV\\u0026thinsp;+\\u0026thinsp;rapamycin (n\\u0026thinsp;=\\u0026thinsp;6).The 5/6 Nx operations were performed as follows. The animals were anesthetized with an intraperitoneal injection of a 10% sodium pentobarbital solution (150 \\u0026micro;L). A left abdominal incision was made to expose the left kidney,and after ligation of the left kidney with polyglycolic acid sutures (i.e., about 1/3 of the volume of each kidney), the upper and lower poles were cut with ophthalmic scissors, with bleeding then stopped for 2 min. The residual kidney was repositioned and sutured back layer by layer.One week after surgery, the right kidney was exposed and its artery and ureter ligated, followed by removal of the kidney.Sham operations were conducted at the same time that involved onlya laparotomy. Six weeks after feeding,the mice of the sham and 5/6 Nx groupsreceived intraperitoneal injections of 1 mL saline once a day. The mice in the 5/6 Nx\\u0026thinsp;+\\u0026thinsp;AS-IV group were given intraperitoneal injections of 40 mg/kg/d of AS-IV once a day\\u003csup\\u003e[17]\\u003c/sup\\u003e, while the 5/6 Nx\\u0026thinsp;+\\u0026thinsp;AS-IV\\u0026thinsp;+\\u0026thinsp;Rap group was treated with AS-IV (40 mg/kg/d) and rapamycin (2 mg/kg/d) once a day for seven weeks. At the end of the intervention, the mice were anesthetized with 10% pentobarbital sodium solution for collection of blood samples and then euthanized to collect myocardial tissue.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eEchocardiography\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eAfter sevenweeks of administration, the mice were anesthetized with 10% pentobarbital sodium solution, withcardiac ultrasonography(MyLab\\u0026trade;X8, Esaote, Italy) thenperformed to assess cardiac function.The end-diastolic left ventricular posterior wall thickness (LVPW.d), end-systolic left ventricular posterior wall thickness (LVPW.s), end-diastolic inner diameter (LVID.d), end-systolic inner diameter (LVID.s), left ventricular ejection fraction (LVEF), and left ventricular shortening fraction (LVFS), were measured in a blinded fashion.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eTerminal deoxynucleotidyl transferase dUTP Nick End Labeling (TUNEL) assay\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe myocardial tissues were dehydrated,embedded in paraffin, sectioned at 4 \\u0026micro;m thickness, with the paraffin sections then dewaxed, rehydrated in a series of graded alcohol solutions,and incubated in TUNEL reagent (C1086,Beyotime) for 60 min. The nuclei of the cells were stained with DAPI (1:1000, C1005,Beyotime).All the stained sections were observed by fluorescent microscopy(BX53, Olympus).\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eEnzyme-linked immunosorbent assays (ELISA)\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe ELISA kits for measuring serumcreatinine(Scr),blood urea nitrogen(BUN), lactate dehydrogenase(LDH) andcreatine kinase-MB(CK-MB)levels were purchased separately fromNanjingJiancheng Bioengineering Institute.All the tests were performed following the instructions of the manufacturer.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eImmunohistochemistry assay\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe myocardial tissues were dehydrated,embedded in paraffin, and then sectioned at 4 \\u0026micro;m thickness. The paraffin sections were dewaxed, subjected to antigen retrieval in citrate buffer at 92 ℃-96 ℃ for 10-15min,blocked with 10% goat serum(SL038,Solarbio) at room temperature for 15min,then incubation with the primary antibodies,anti-α-SMA(1:200,#19245,Cell Signaling Technology) andanti-α-actinin(1:250,ab108198, Abcam)at 4\\u0026deg;Covernight, followed by incubation with the corresponding secondary antibody (1:1000,ab205718, Abcam) for 15min.The sections were then stained with DAB and observed using a microscope (Leica, Wetzlar) and analyzed using ImageJ software.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eCell culture and intervention\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eH9C2 cells were purchased from Procell Life Science \\u0026amp;Technology Co.,Ltd(China), and were cultured in DMEM(C11885500BT, Gibco, USA) with 10% FBS and 1% penicillin streptomycin(SV30010Hyclone, USA) at 37\\u0026deg;C and 5% CO\\u003csup\\u003e2\\u003c/sup\\u003e conditions.The cells were sub-cultured when the density reached between 80 to 90% confluence.The cells were then assigned randomly into experimental or control groups. The control group was cultured in DMEM containing 10% normal mouse plasma, while the experimental groupwas maintained in DMEM containing10% uremic mouse plasma(US)to create a uremic environment. Different concentrations of AS-IV(5, 15, 30, and 60 \\u0026micro;g/mL) were added after 2h, followed by incubation for a further48 h to determine the optimal treatment concentration.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eCell viability assay\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eCell viability was measured using a Cell Counting Kit-8 (CCK-8) (C0037,Beyotime, China).Briefly, the H9C2 cells were seeded in 96-well plates at a density of 1\\u0026times;10\\u003csup\\u003e4\\u003c/sup\\u003e cells/well and then treated with uremic mouse plasma and different concentrations of AS-IV for 48 h as described above.After the indicated treatments, each well was supplemented with 10 \\u0026micro;l CCK-8 solution, followed by incubation for an additional 2 h at 37\\u0026deg;C and 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e. The absorbance at wavelength 450 nm was measured using a microplatereader(ThermoScientific, Waltham, USA).\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eCell transfection\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe plasmids(PCD513B)encoding ATF4 and the empty vector were purchased from Jiangxi Qiyun Biotechnology Co., Ltd. H9C2 cardiomyocytes were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin solution. When the cell density reached 80%-90%, plasmid transfection was performed using Lipofectamine\\u0026trade; 2000 transfection reagent(Thermo Fisher) according to the manufacturer\\u0026rsquo;s protocol.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eTransmission electron microscopy (TEM)\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe cell culture medium wascentrifuged for 10 mins at 800r/min and the supernatant discarded.The cells were fixed in 2.5% glutaraldehyde for 48h and 1% osmic acid for 1 h,dehydrated with graded ethanol and then embedded in Epon 812 using standard laboratory procedures. Ultrathin sections of 50\\u0026ndash;70 nm were prepared, mounted on nickel grids,followed by staining with lead citrate for TEM(Tecnai F30).\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eWestern blot analysis\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eMice myocardial tissue or H9C2 cells were lysed using RIPA lysis buffer (P0013B,Beyotime Institute of Biotechnology) and the proteins quantified using a bicinchoninic acid protein assay kit(PC0020, Solarbio). An equal amount of protein (50 \\u0026micro;g) was separated by 12% SDS PAGE, electro-transferred onto a nitrocellulose membrane, and then probed with the following primary antibodies: LC3(1:1,000,#4108, Cell Signaling Technology), p62 (1:1,000,# 23214, Cell Signaling Technology),GAPDH(1:2,000,#5174,Cell Signaling Technology),ATF4(1:1,000,DF6008, Affinity), PI3K(1:1,000,AF6241,Affinity), p-PI3K(1:1,000,AF3241, Affinity) at 4\\u0026deg;C overnight.The membranes were then incubated with HRP-conjugated anti-rabbit secondary antibodies (1:2,000, ab205718, Abcam) for 1\\u0026ndash;2 h at room temperature. The blots were visualized using the enhanced chemiluminescence (ECL) reagents (Thermo Fisher Scientific).\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eImmunofluorescence analysis\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eMyocardial tissues sections were deparaffinized as described previously. The H9C2 cells were fixed in 4% paraformaldehyde for 30 min.After blocking with 5% BSA(SL038,Solarbio),the sections or the cells were incubated with the primary antibody(anti-LC3 1:200,anti-p62 1:400) at 4℃ overnight, followed by incubation with theFITC-conjugated anti-rabbit IgG(1:500,ab150077, Abcam) or Cy3-conjugated anti-rabbit IgG antibody (1:200,A0516, Beyotime)for 1 h at room temperature.The fluorescent images were observed usinga confocal laser scanning microscope(UltraVIEWVOX,PerkinElmer,USA).\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eFlow cytometry\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe Annexin V-FITC apoptosis detection kit (C1062S, Beyotime) was used to evaluate cell apoptosis. The cells were suspended in binding buffer at a concentration of 1x10\\u003csup\\u003e6\\u003c/sup\\u003e cells/mL and then stained with 5 \\u0026micro;L Annexin V-FITC plus 10 \\u0026micro;l propidium iodide (PI) at room temperature in the dark for 15\\u0026ndash;20 min.Cell apoptosis was determined using a flow cytometer (CytoFLEXS, Beckman) and the data analyzed using CytExpert software (Beckman Coulter 2.4).\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eQuantitative real-time PCR (qRT-PCR)\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eTotal RNA was isolated fromculturedH9C2 cells using Trizol reagent (15596018CN,Invitrogen) following the manufacturer\\u0026rsquo;s instructions.The RNA was reverse-transcribed into cDNA using a FastKing-RT SuperMix kit (KR118; Tiangen, China).Quantitative RT-PCR was performed with SYBR Green PCR Master Mix (A46012,Applied Biosystems) in a Bio-radreal-time PCR detection system (CFX96 Touch, Bio-rad). The reaction conditions were 95\\u0026deg;C for 3 min, followed by 40 cycles of 95\\u0026deg;C for 12 s and 60\\u0026deg;C for 40 s. The primer sequences are listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eThe primer sequencesforATF4 and GAPDH\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"3\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eName of primer\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003ePrimer sequence(5\\u0026rsquo;-3\\u0026rsquo;)\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eLength (bp)\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eATF4 forward\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCTGAACAGCGAAGTGTTGGC\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e\\u003cp\\u003e214\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eATF4 reverse\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eAAAAGGCATCCTCCTTGCCG\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eGAPDH forward\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eGCGAGATCCCGCTAACATCA\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e\\u003cp\\u003e178\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eGAPDH reverse\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCTCGTGGTTCACACCCATCA\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e\\u003cp\\u003eAll the data were expressed as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation (mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD). Differences between the groups were compared using one-way analysis of variance (ANOVA). All the statistical analyses were performed using GraphPad Prism 7.0 software, with a \\u003cem\\u003eP\\u003c/em\\u003e-value\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 considered statistically significant.\\u003c/p\\u003e\\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAS-IV improved cardiac and renal function as well as ameliorated myocardial fibrosis in 5/6 nephrectomized mice\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eELISA analysis was performed to determine changesin the myocardial injury markers (LDH and CK-MB) and renal function markers (Scr and BUN) in the serum of mice from each group. As shown in Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA, the levels of Scr, BUN, LDH, and CK-MB were increased significantly in the 5/6Nx group compared with those measured in the Sham group. However, these parameters were reduced significantly in the 5/6Nx\\u0026thinsp;+\\u0026thinsp;AS-IV group. Following the addition of rapamycin, the protective effect of AS-IV was not observed. To examine the effect of AS-IV on cardiac function in uremic mice, echocardiographic analysis (Figs. \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB-C) showed that compared with the 5/6Nx mice, LVEF and LVFS were increased significantly in the 5/6Nx\\u0026thinsp;+\\u0026thinsp;AS-IVgroup, accompanied by a reduction in LVPW.d, LVPW.s, LVID.d, and LVID.s. This protective effect of AS-IV was inhibited significantly by rapamycin. Immunohistochemistry was used to detect the expression of \\u0026alpha;-actinin and \\u0026alpha;-SMA in myocardial tissues, with the results (Figs. \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD-E), demonstrating that the expression of \\u0026alpha;-actinin and \\u0026alpha;-SMA was increased significantly in the 5/6Nx group compared to that observed in the Sham group. However, compared to the 5/6Nx group, the expression of \\u0026alpha;-actinin and \\u0026alpha;-SMA was decreased significantly in the 5/6Nx\\u0026thinsp;+\\u0026thinsp;AS-IV group. As expected, the expression of \\u0026alpha;-actinin and \\u0026alpha;-SMA was significantly increased by the addition of rapamycin. Taken together, these data indicated that AS-IV improved cardiac function and amelioratedmyocardial fibrosis in 5/6 nephrectomized mice, and that rapamycin inhibited this protective effect.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAS-IVattenuated cardiomyocytes apoptosis in 5/6 nephrectomized mice inducedby uremic toxins\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo elucidate the cardioprotective mechanisms of AS-IVin uremia-induced myocardial injury we systematically investigated its anti-apoptotic effects using both \\u003cem\\u003ein vivo\\u003c/em\\u003e and \\u003cem\\u003ein vitro\\u003c/em\\u003eexperimental approaches. In the \\u003cem\\u003ein vivo\\u003c/em\\u003e study, myocardial apoptosis was assessed quantitatively using the TUNEL assay. The quantitative analysis showed a significant reduction in the apoptotic index in the 5/6 nephrectomy (5/6Nx)\\u0026thinsp;+\\u0026thinsp;AS-IV and 5/6Nx\\u0026thinsp;+\\u0026thinsp;AS-IV\\u0026thinsp;+\\u0026thinsp;Rap groups compared to that measured in the sham-operated controls. Notably, the apoptosis rate in the 5/6Nx\\u0026thinsp;+\\u0026thinsp;AS-IV\\u0026thinsp;+\\u0026thinsp;Rap group exhibited a statistically significant increase relative to that ofthe 5/6Nx\\u0026thinsp;+\\u0026thinsp;AS-IV group (Figs. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA-B).\\u003c/p\\u003e\\n\\u003cp\\u003eFor the \\u003cem\\u003ein vitro\\u003c/em\\u003e evaluation, the cytotoxic effects of uremic serum and the cytoprotective potential of AS-IV were assessed using the Cell Counting Kit-8 (CCK-8) assay following 48hof treatment. Quantitative analysis demonstrated a significant reduction in H9C2 cardiomyocyte viability following uremic serum exposure. AS-IV treatment dose-dependently attenuated the uremic serum-induced cytotoxicity, with the maximal protective effect observed at 60 \\u0026micro;g/mL (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC). This optimal concentration was subsequently used in the mechanistic investigations. Flow cytometric analysis of apoptosis showed a marked increase in the apoptotic rate in the 10% uremic serum (US) group compared to that observed in the controls. Co-treatment with AS-IV and the integrated stress response inhibitor (ISRIB) or the endogenous ATF4 inhibitor, significantly ameliorated uremic serum-induced apoptosis (Figs. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD-E).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eATF4 mediated the cardioprotective effects of AS-IV in 5/6 nephrectomizedmice and uremic serum-induced cardiomyocyte injury\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe then examined ATF4 expression across the experimental groups. Quantitative analysis showed significant upregulation of ATF4 expression in the 5/6Nx group compared to that observed in the Sham group(Figs. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA,B). Notably, AS-IV treatment markedly attenuated this increase in the 5/6Nx\\u0026thinsp;+\\u0026thinsp;AS-IV group. Intriguingly, rapamycin co-treatment resulted in significant upregulation of ATF4, suggesting a potential association between ATF4 expression and autophagic regulation.To validate these findings, we performed \\u003cem\\u003ein vitro\\u003c/em\\u003e investigations using Western blotting and qRT-PCR analyses to assess the expression levels of ATF4 protein and mRNA. Consistent with our \\u003cem\\u003ein vivo\\u003c/em\\u003e observations, exposure to 10% uremic serum (US) significantly elevated both ATF4 protein and transcript levels. This upregulation was effectively suppressed by AS-IV treatment (Figs. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC-E).\\u003c/p\\u003e\\n\\u003cp\\u003eConsistent with our previous findings, pharmacological inhibition of ATF4 using ISRIB significantly ameliorated apoptosis induced in cardiomyocytes by uremic toxins(Figs. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD and E). To further elucidate the functional role of ATF4, we used vector transfection to establishH9C2 cells that overexpressed ATF4. Notably, ATF4 overexpression substantially attenuated the cardioprotective effects of AS-IV against uremic toxin-induced injury in these cells (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eF). Taken together, these findings suggest that the protective effects of AS-IV against uremic cardiomyopathy may be mediated, at least in part, through modulation of ATF4 signaling pathways.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAS-IV attenuated cardiomyocyte autophagyin 5/6 nephrectomized mice\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo elucidate the potential involvement of autophagy in the cardioprotective effects of AS-IV against uremia-induced myocardial injury,we examined key autophagy markers (LC3 II/I and p62) using Western blotting and immunofluorescence analyses.Immunofluorescence analysis showeda significant increase in LC3 puncta formation accompanied by reducedexpression of p62 in the 5/6Nx group compared to that observed in the controls.Notably, AS-IV treatment markedly attenuated these changes. This indicated that decreased LC3 puncta and increased p62 expression (Figs. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA-D)wereassociated with suppression of autophagic flux.These findings were corroborated by the Western blot analysis, which showed significantly increasedLC3 II/I ratios and reduced p62 levels in the 5/6Nx mice. Importantly, these alterations were largelyreversed following 7-wk of AS-IV treatment (Figs. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eE-F). Based on these collective findings, we propose that the cardioprotective mechanism of AS-IV may involve modulation of cardiomyocyte autophagy. This hypothesis wasfurther supported by our observation that rapamycin-induced autophagy reactivation attenuated the protective effects of AS-IV.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAS-IVinhibited cardiomyocyte autophagyinduced by uremic serum via ATF4\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo further elucidate the cardioprotective mechanisms of AS-IV we conducted \\u003cem\\u003ein vitro\\u003c/em\\u003e investigations to evaluate its regulatory effects on autophagy in uremia-induced cardiomyocyte injury.In addition, we focused on delineating the mechanistic role of ATF4 in AS-IV-mediated regulation of cardiomyocyte autophagy.\\u003c/p\\u003e\\n\\u003cp\\u003eFirst, ISRIB, an endogenous ATF4 inhibitor, was used to inhibit ATF4 expression.Western blot analysis showedthat 10% uremic serum (US) treatment significantly increasedthe LC3 II/I ratio, while reducing p62 expression in H9C2 cells. Notably, these US-induced alterations were effectively reversed by AS-IV treatment (Figs. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA,B). Consistent with these findings, ISRIB treatment hadsimilar effects on autophagy markers.TEM analysis demonstrated a substantial increase in double-membrane autophagosomes in H9C2 cells treated with 10% US compared to that observed in the controls. Both AS-IV and ISRIB treatments significantly attenuated the formation of autophagosomes(Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC).These observations were validated by immunofluorescence analysis, which showed increased fluorescent spots of LC3 and decreased p62 expression in the 10% US group. Importantly, these changes were reversed by either AS-IV or ISRIB treatment (Figs. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eD,E).\\u003c/p\\u003e\\n\\u003cp\\u003eNext,we initiated overexpression of ATF4 in H9C2 cells usingplasmid vector transfection.As shown in Figs. \\u003cspan class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA\\u0026ndash;C, the level of LC3 II/I was decreased significantly in the 10% US\\u0026thinsp;+\\u0026thinsp;AS-IV group in line with the increased expression of p62.Notably, ATF4 overexpression substantially attenuated the anti-autophagic effects of AS-IV.Consistent with these findings, TEM analysis demonstrated a significant reduction in autophagosome formation in the 10% US\\u0026thinsp;+\\u0026thinsp;AS-IV group compared to that measured in the 10% US group. Importantly, ATF4 overexpression reversed this effect, leading to increased formation of autophagosomes(Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eD). These collective findings provide compelling evidence that ATF4 plays a crucial role in mediating AS-IV\\u0026apos;s regulation of cardiomyocyte autophagy.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ePI3K pathway activation mediated ATF4-dependent autophagyregulated by AS-IV in uremic cardiomyopathy\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eGiven the critical involvement of the PI3K signaling pathway in autophagy regulation, we investigated its potential role in ATF4-dependent regulation of cardiac autophagy mediated by AS-IV.Quantitative analysis of PI3K pathway activation was conducted through Western blot detection of PI3K and its phosphorylated form (p-PI3K)\\u003cem\\u003ein vitro\\u003c/em\\u003e. As shown in Figs. \\u003cspan class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eA and B,the p-PI3K/PI3K ratio was decreased significantly in the 10% US group compared with that in the control group.However, the phosphorylation level of PI3K was increased significantly in both the AS-IV treatment and ATF4 inhibitor treatment groups. This suggested that AS-IV may restore inhibition of the PI3K signaling pathway in cardiomyocytes induced by uremic toxins by suppressingATF4 expression.To further elucidate the role of ATF4 in the activation of the PI3K pathway by AS-IV, we treated cells with AS-IV in combination with ATF4 overexpression. The results showeda significant decrease in the ratio of p-PI3K/PI3K in the 10% US\\u0026thinsp;+\\u0026thinsp;AS-IV\\u0026thinsp;+\\u0026thinsp;oe-ATF4 group compared to that in the 10% US\\u0026thinsp;+\\u0026thinsp;AS-IV group(Figs. \\u003cspan class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eC,D).These results suggested thatthe PI3K signaling pathway is implicated in the regulation of uremia-associated cardiomyocyte autophagy by AS-IV, thereby conferring itsprotective effect.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eCVDin patients with uremia represents a significant clinical issue and is the leading cause of mortality in these patients\\u003csup\\u003e[18]\\u003c/sup\\u003e. Multiple mechanisms contribute to the progression of CVD in uremic patients, including persistent microinflammatory states leading to endothelial cell injury, excessive production of reactive oxygen species (ROS) that accelerateatherosclerosis, disorders of mineral metabolism that promotevascular calcification, accumulation of uremic toxins, volume overload, and others\\u003csup\\u003e[19\\u0026ndash;22]\\u003c/sup\\u003e.The complexity of these mechanisms poses significant challenges for the prevention and treatment of CVD in uremia.\\u003c/p\\u003e\\u003cp\\u003eAS-IV, a traditional Chinese medicinalingredient, has been widely usedin the treatment of CVDs. A previous study reportedthat an optimized derivative of AS-IV reversed myocardial remodeling induced by myocardial infarction and improved cardiac function by inhibiting lnc9456 in the heart\\u003csup\\u003e[23]\\u003c/sup\\u003e.A recent study also showed that AS-IV improved myocardial injury in LPS-induced sepsis models by restoring mitochondrial function and ER-autophagy\\u003csup\\u003e[5]\\u003c/sup\\u003e. The current studyuseda 5/6 nephrectomy mouse model and a uremic serum-induced H9C2 cardiomyocyte injury model to show that AS-IV significantly improved cardiac and renal function, reduced myocardial fibrosis, and alleviated uremia-related cardiomyocyte apoptosis. Furthermore, AS-IV exerted cardioprotective effects by inhibiting ATF4 expression and cardiomyocyte autophagy. These findings suggest that AS-IV possesses potential therapeutic value in the treatment of uremia-related CVDs.\\u003c/p\\u003e\\u003cp\\u003eRecent studies have revealed that excessively activated autophagy is a detrimental factor in many CVDs. By inhibiting ROS-dependent autophagy and ferroptosis, cardiac function following myocardial infarction can be protectedeffectively\\u003csup\\u003e[24]\\u003c/sup\\u003e. Excessive activation of autophagy has beendetected in cardiomyocytes of diabetic mouse models,with evidence showing that empagliflozin reverses cardiac dysfunction in diabetic mice by inhibiting myocardial autophagy\\u003csup\\u003e[25]\\u003c/sup\\u003e.In our study, we observedthat autophagy levels were increased significantly in both 5/6 nephrectomized mice and uremic serum-treated H9C2 cells. This suggests that excessivelyactivated autophagy is a promoter of uremia-associated CVD,which is consistent with the findings of previous reports in the literature\\u003csup\\u003e[26]\\u003c/sup\\u003e. We showedthat AS-IV intervention significantly suppressed excessive autophagy activity. However, when autophagy was reactivated using rapamycin, the cardioprotective effects of AS-IV were markedly attenuated. These results further demonstrate that the protective role of AS-IV against uremia-associated myocardial injury is linked to the regulation of autophagy.\\u003c/p\\u003e\\u003cp\\u003eATF4, a basic region leucine zipper transcription factor, plays a critical role in numerous biological processes.In CVDs, overexpression of ATF4 activates autophagy, leading to fatal cardiac atrophy in mice\\u003csup\\u003e[16]\\u003c/sup\\u003e.Inhibition of ATF4-related signaling pathways has been shown to suppress cardiomyocyte autophagy, thereby alleviating myocardial ischemia-reperfusion (I/R) injury and reducing cardiomyocyte apoptosis\\u003csup\\u003e[27]\\u003c/sup\\u003e.Our study also showed that ATF4 expression was increased significantly in both nephrectomized miceand uremic serum-stimulated cardiomyocytes, withthis abnormal increase markedly suppressed by AS-IV. ATF4 inhibitors alone significantly reduced uremic toxin-induced cardiomyocyte autophagy and apoptosis. However, as their inhibitory effect was less pronounced compared to that of AS-IV, we speculate that additional mechanisms beyond ATF4 inhibition may contribute to the cardioprotective effects of AS-IV.This possibility requires further verification.\\u003c/p\\u003e\\u003cp\\u003ePI3K is a critical signaling protein involved in autophagy regulation\\u003csup\\u003e[28]\\u003c/sup\\u003e.However, whether PI3K participates in ATF4-mediated modulation of myocardial autophagy by AS-IV remains to be elucidated. Dat P Ha et al.\\u003csup\\u003e[29]\\u003c/sup\\u003e identified ATF4 as thekey downstream target of the PI3K/AKT/mTOR signaling pathway. Our findings demonstrated that AS-IV significantly restored PI3K phosphorylation levels, while inhibition of ATF4 expression using ISRIB caused a similarenhancement ofPI3K activation. Furthermore, overexpression of ATF4 markedly attenuated the ability of AS-IV to activate PI3K, suggesting that ATF4 may act as an upstream regulator of the PI3K pathway.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eIn summary, we identified a role ofAS-IV as a potential therapeutic drug for uremia-related CVD. AS-IV suppressed excessive autophagy in cardiomyocytes, reduced cardiomyocyte apoptosis, and improved cardiac ejection function.We have also provided evidence that showsATF4 is involved in the regulation of cardiomyocyte autophagy by AS-IV. We also identifieda mechanistic role forthe PI3Ksignaling pathway that mediated cardiomyocyte autophagy. These findings provide new insights into our understanding of the effects of AS-IV,and mayidentify an innovative therapeutic strategy for uremic patients with cardiovascular complications.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe would like to thankthe molecular diagnosis and individualized therapy key laboratory of Zhejiang for excellent technical assistance.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by grants from the Project of Scientific Research Foundation of Zhejiang Traditional Chinese Medicine Administration\\u0026nbsp;(grant nos. 2023ZL263) and\\u0026nbsp;the General Project of the Medical and Health of Zhejiang Province (grant nos. 2023KY023,2024KY705 and 2024KY667）\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eAuthors\\u0026rsquo; contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eJianguang Gong designed the study,Jianlan Zheng and Bin Zhurevised the manuscript, Jihao Xu,Xianyun Ye,and Li Zhao performed the laboratory assays,Qiudi Tu performed the statistical analyses, and Jianguang Gong and Jianlan Zheng wrote the manuscript. The final version of the manuscript was approved by all the authors.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eConflict of interest\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no potential conflict of interest.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eEthics Approval and Consent to Participate\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll animal procedures were approved by the Institutional Ethical Committee of the Zhejiang Provincial People\\u0026rsquo;s Hospital.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eKovesdy CP. Epidemiology of chronic kidney disease: an update 2022. Kidney Int Suppl (2011). 2022. 12(1): 7-11.\\u003c/li\\u003e\\n\\u003cli\\u003eGBD Chronic Kidney Disease Collaboration. Global, regional, and national burden of chronic kidney disease, 1990-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet. 2020. 395(10225): 709-733.\\u003c/li\\u003e\\n\\u003cli\\u003eGao L, Cao M, Li JQ, Qin XM, Fang J. Traditional Chinese Medicine Network Pharmacology in Cardiovascular Precision Medicine. Curr Pharm Des. 2021. 27(26): 2925-2933.\\u003c/li\\u003e\\n\\u003cli\\u003eLiang Y, Chen B, Liang D, et al. Pharmacological Effects of Astragaloside IV: A Review. Molecules. 2023. 28(16): 6118.\\u003c/li\\u003e\\n\\u003cli\\u003eWang J, Pu X, Zhuang H, et al. Astragaloside IV alleviates septic myocardial injury through DUSP1-Prohibitin 2 mediated mitochondrial quality control and ER-autophagy. J Adv Res. 2024 : S2090-1232(24)00471-5 [pii].\\u003c/li\\u003e\\n\\u003cli\\u003eZhai P, Chen Q, Wang X, et al. The combination of Tanshinone IIA and Astragaloside IV attenuates myocardial ischemia-reperfusion injury by inhibiting the STING pathway. Chin Med. 2024. 19(1): 34.\\u003c/li\\u003e\\n\\u003cli\\u003eLi X, Li Z, Dong X, et al. Astragaloside IV attenuates myocardial dysfunction in diabetic cardiomyopathy rats through downregulation of CD36-mediated ferroptosis. Phytother Res. 2023. 37(7): 3042-3056.\\u003c/li\\u003e\\n\\u003cli\\u003eDunn WA Jr. Autophagy and related mechanisms of lysosome-mediated protein degradation. Trends Cell Biol. 1994. 4(4): 139-43.\\u003c/li\\u003e\\n\\u003cli\\u003eLuo LF, Qin LY, Wang JX, Guan P, Wang N, Ji ES. Astragaloside IV Attenuates the Myocardial Injury Caused by Adriamycin by Inhibiting Autophagy. Front Pharmacol. 2021. 12: 669782.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang J, Lu M, Li C, et al. Astragaloside IV mitigates hypoxia-induced cardiac hypertrophy through calpain-1-mediated mTOR activation. Phytomedicine. 2024. 125: 155250.\\u003c/li\\u003e\\n\\u003cli\\u003eNeill G, Masson GR. A stay of execution: ATF4 regulation and potential outcomes for the integrated stress response. Front Mol Neurosci. 2023. 16: 1112253.\\u003c/li\\u003e\\n\\u003cli\\u003eVanhoutte D, Schips TG, Minerath RA, et al. Thbs1 regulates skeletal muscle mass in a TGF\\u0026beta;-Smad2/3-ATF4-dependent manner. Cell Rep. 2024. 43(5): 114149.\\u003c/li\\u003e\\n\\u003cli\\u003eKrall AS, Mullen PJ, Surjono F, et al. Asparagine couples mitochondrial respiration to ATF4 activity and tumor growth. Cell Metab. 2021. 33(5): 1013-1026.e6.\\u003c/li\\u003e\\n\\u003cli\\u003eChen Y, Gui D, Chen J, He D, Luo Y, Wang N. Down-regulation of PERK-ATF4-CHOP pathway by Astragaloside IV is associated with the inhibition of endoplasmic reticulum stress-induced podocyte apoptosis in diabetic rats. Cell PhysiolBiochem. 2014. 33(6): 1975-87.\\u003c/li\\u003e\\n\\u003cli\\u003eTian G, Li J, Zhou L. Ginsenoside Rg1 regulates autophagy and endoplasmic reticulum stress via the AMPK/mTOR and PERK/ATF4/CHOP pathways to alleviate alcohol‑induced myocardial injury. Int J Mol Med. 2023. 52(1): 56 [pii].\\u003c/li\\u003e\\n\\u003cli\\u003eVanhoutte D, Schips TG, Vo A, et al. Thbs1 induces lethal cardiac atrophy through PERK-ATF4 regulated autophagy. Nat Commun. 2021. 12(1): 3928.\\u003c/li\\u003e\\n\\u003cli\\u003eLin J, Fang L, Li H, et al. Astragaloside IV alleviates doxorubicin induced cardiomyopathy by inhibiting NADPH oxidase derived oxidative stress. Eur J Pharmacol. 2019. 859: 172490.\\u003c/li\\u003e\\n\\u003cli\\u003eSundstr\\u0026ouml;m J, Bodegard J, Bollmann A, et al. Prevalence, outcomes, and cost of chronic kidney disease in a contemporary population of 2\\u0026middot;4 million patients from 11 countries: The CaReMe CKD study. Lancet Reg Health Eur. 2022. 20: 100438.\\u003c/li\\u003e\\n\\u003cli\\u003eMezzano D, Pais EO, Aranda E, et al. Inflammation, not hyperhomocysteinemia, is related to oxidative stress and hemostatic and endothelial dysfunction in uremia. Kidney Int. 2001. 60(5): 1844-50.\\u003c/li\\u003e\\n\\u003cli\\u003eHimmelfarb J, Stenvinkel P, Ikizler TA, Hakim RM. The elephant in uremia: oxidant stress as a unifying concept of cardiovascular disease in uremia. Kidney Int. 2002. 62(5): 1524-38.\\u003c/li\\u003e\\n\\u003cli\\u003eLondon GM, Marchais SJ, Gu\\u0026eacute;rin AP, M\\u0026eacute;tivier F. Arteriosclerosis, vascular calcifications and cardiovascular disease in uremia. Curr Opin Nephrol Hypertens. 2005. 14(6): 525-31.\\u003c/li\\u003e\\n\\u003cli\\u003eTonelli M, Karumanchi SA, Thadhani R. Epidemiology and Mechanisms of Uremia-Related Cardiovascular Disease. Circulation. 2016. 133(5): 518-36.\\u003c/li\\u003e\\n\\u003cli\\u003eWan J, Zhang Z, Wu C, et al. Astragaloside IV derivative HHQ16 ameliorates infarction-induced hypertrophy and heart failure through degradation of lncRNA4012/9456. Signal Transduct Target Ther. 2023. 8(1): 414.\\u003c/li\\u003e\\n\\u003cli\\u003eLi D, Zhang G, Wang Z, et al. Idebenone attenuates ferroptosis by inhibiting excessive autophagy via the ROS-AMPK-mTOR pathway to preserve cardiac function after myocardial infarction. Eur J Pharmacol. 2023. 943: 175569.\\u003c/li\\u003e\\n\\u003cli\\u003eMadonna R, Moscato S, Cufaro MC, et al. Empagliflozin inhibits excessive autophagy through the AMPK/GSK3\\u0026beta; signalling pathway in diabetic cardiomyopathy. Cardiovasc Res. 2023. 119(5): 1175-1189.\\u003c/li\\u003e\\n\\u003cli\\u003eFeng J, Li H, Wang S. Hydrogen sulfide alleviates uremic cardiomyopathy by regulating PI3K/PKB/mTOR-mediated overactive autophagy in 5/6 nephrectomy mice. Front Pharmacol. 2022. 13: 1027597.\\u003c/li\\u003e\\n\\u003cli\\u003eWang CC, Li Y, Qian XQ, et al. Empagliflozin alleviates myocardial I/R injury and cardiomyocyte apoptosis via inhibiting ER stress-induced autophagy and the PERK/ATF4/Beclin1 pathway. J Drug Target. 2022. 30(8): 858-872.\\u003c/li\\u003e\\n\\u003cli\\u003eGlick D, Barth S, Macleod KF. Autophagy: cellular and molecular mechanisms. J Pathol. 2010. 221(1): 3-12.\\u003c/li\\u003e\\n\\u003cli\\u003eHa DP, Lee AS. Insulin-like growth factor 1-receptor signaling stimulates GRP78 expression through the PI3K/AKT/mTOR/ATF4 axis. Cell Signal. 2020. 75: 109736.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"scientific-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"scirep\",\"sideBox\":\"Learn more about [Scientific Reports](http://www.nature.com/srep/)\",\"snPcode\":\"\",\"submissionUrl\":\"\",\"title\":\"Scientific Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Scientific Reports\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Astragaloside-IV, Autophagy, ATF4, Myocardial injury, Uremia\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-7145726/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-7145726/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e\\u003cp\\u003eCardiovascular pathology is one of the primary causes of mortality in patients with uremia. The therapeutic value of intravenous Astragaloside (AS-IV)in the treatment of cardiovascular diseases (CVDs) has been widely recognized. However, research on its treatment ofCVDs complicated by uremia remains extremely limited. The aim of this study was therefore to determine the effects and potential mechanisms of AS-IV in the treatment of CVD associated with uremia.\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e\\u003cp\\u003eThe 5/6 nephrectomized mouse and uremic serum-induced myocardial injury model of H9C2 cells were constructed. A variety of techniques, including echocardiography, ELISA, TUNEL assay, flow cytometry, Western blotting, immunofluorescence, transmission electron microscopy,andqRT-PCRwere used to investigate the effects of AS-IV on uremia-associated myocardial injury and its impact on autophagy and related signaling pathway proteins. An ATF4 inhibitor and plasmid transfection techniques were used to modulate ATF4 expression and investigate the role of ATF4 in AS-IV-mediated protection against myocardial injury.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e\\u003cp\\u003eAS-IVsignificantly improved cardiorenal function and attenuated uremia-associated cardiomyocyte apoptosis in the 5/6 nephrectomized mice. Autophagy levels were activated significantly and ATF4 expression was increased significantly in these mice and uremic toxin-treated cardiomyocytes. AS-IV also significantly inhibited ATF4 expression and cardiomyocyte autophagy. Inhibition of ATF4 expression reduced cardiomyocyte apoptosis, while overexpression of ATF4 significantly attenuated the cardioprotective effects of AS-IV. AS-IV significantly activated the PI3K pathway, while modulation of ATF4 expression affected activation of the PI3K pathway by AS-IV.\\u003c/p\\u003e\\u003ch2\\u003eConclusions\\u003c/h2\\u003e\\u003cp\\u003eAS-IVameliorates uremia-associated myocardial injury by suppressing ATF4 expression and regulating cardiomyocyte autophagy activity. The PI3K pathway may be involved in this modulation of autophagy.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Astragaloside IV attenuates uremia-induced myocardial injury by inhibiting autophagy via ATF4\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-07-28 08:44:43\",\"doi\":\"10.21203/rs.3.rs-7145726/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2025-07-19T06:43:08+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2025-07-19T05:33:33+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2025-07-18T08:06:55+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Scientific Reports\",\"date\":\"2025-07-17T06:50:25+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"scientific-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"scirep\",\"sideBox\":\"Learn more about [Scientific Reports](http://www.nature.com/srep/)\",\"snPcode\":\"\",\"submissionUrl\":\"\",\"title\":\"Scientific Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Scientific Reports\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"fca9f571-94dc-4910-8fe6-8e4809ab9ffe\",\"owner\":[],\"postedDate\":\"July 28th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[{\"id\":51782711,\"name\":\"Health sciences/Cardiology\"},{\"id\":51782712,\"name\":\"Biological sciences/Cell biology\"},{\"id\":51782713,\"name\":\"Health sciences/Diseases\"},{\"id\":51782714,\"name\":\"Health sciences/Nephrology\"}],\"tags\":[],\"updatedAt\":\"2025-12-08T16:03:58+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-7145726\",\"link\":\"https://doi.org/10.1038/s41598-025-30374-x\",\"journal\":{\"identity\":\"scientific-reports\",\"isVorOnly\":false,\"title\":\"Scientific Reports\"},\"publishedOn\":\"2025-12-04 15:58:15\",\"publishedOnDateReadable\":\"December 4th, 2025\"},\"versionCreatedAt\":\"2025-07-28 08:44:43\",\"video\":\"\",\"vorDoi\":\"10.1038/s41598-025-30374-x\",\"vorDoiUrl\":\"https://doi.org/10.1038/s41598-025-30374-x\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-7145726\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-7145726\",\"identity\":\"rs-7145726\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}