{"paper_id":"0a7772ba-0cdf-4e02-b8c6-b6683e265d2d","body_text":"1 \nDNA replication stress-induced transcriptome of Human Burkitt’s lymphoma identifies 1 \nMBD1 as a novel suppressor of BCL6 rearrangements in germinal center derived B-2 \nlymphomagenesis 3 \n 4 \nSantosh Kumar Gothwal1, Kyoko Oichai2, Jacqueline H Barlow3 5 \n1 Institute of Frontier Science Initiative, Kanazawa University, Japan 6 \n2 Department of Biochemistry, Graduate School of Medicine, Tohuku University, Japan 7 \n3 Department of Microbiology and Molecular Genetics, University of California Davis, United  8 \nStates 9 \n 10 \n 11 \n 12 \n 13 \n* Corresponding author: skgothwal@staff.kanazawa-u.ac.jp / santoshgothwalbio@gmail.com 14 \n 15 \nKey words - BCL6, B -lymphomagenesis, MBD1, IRF4, DLBCL, Waldenström 16 \nmacroglobulinemia, Multiple myeloma. 17 \n 18 \nKey Points- 19 \n1. MBD1 suppresses BCL6 expression under the DNA replication stress 20 \n2. MBD1 suppresses genomic instability at BCL6 translocation hotspots 21 \n3. MBD1 depletion is associated with reduced  tumorigenicity in mouse xenograft and 22 \nsensitivity to DNA replication inhibitors. 23 \n 24 \n 25 \n 26 \n 27 \n 28 \n 29 \n 30 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 2 \nAbstract: BCL6 is a master transcriptional regulator of germinal center (GC) B cells. BCL6 is 31 \nfrequently translocated at the major translocation cluster (MTC) within intron 1 of the BCL6 locus, 32 \na hotspot commonly rearranged in diffuse large B  cell lymphomas (DLBCLs). BCL6 33 \namplifications are associated with therap eutic resistance and poor survival outcomes  in 34 \nhematological and solid cancers. However the mechanisms suppressing genome instability at the 35 \nBCL6-MTC preventing BCL6 rearragements remain unclear.  Here, transcriptome analysis and 36 \ngenome-wide mapping of histone H3 lysine 4 trimethylation (H3K4me3) in hydroxyurea (HU) -37 \ntreated Raji cells (a Burkitt’s lymphoma model) revealed the induced expression of MBD1, 38 \nencoding the DNA CpG methylation-binding protein. Functional studies using shRNA silencing 39 \nand ectopic overexpression demonstrated that MBD1 suppresses BCL6 transcription whose 40 \npromoter harbours conserved CpG methylation sites, suggesting a DNA  methylation-dependent 41 \nregulation of BCL6 trasncription by MBD1 . Conversely, BCL6 repressed MBD1 expression by 42 \nbinding to its promoter.  MBD1-depleted Raji cells exhibited increased genomic instability at the 43 \nBCL6-MTC upon HU treatment, heightened sensitivity to DNA replication inhibitors (HU, 44 \ngemcitabine, and etoposide), and reduced tumorigenicity in xenograft mouse models. We propose 45 \nthat MBD1 prevents genomic instability at the BCL6-MTC to suppress DLBCL formation . 46 \nMoreover, MBD1 promotes genomic stability and cell viability during DNA replication stress. 47 \nMBD1 thus represents a potential therapeutic target for cancers exhibiting resistance to 48 \nchemotherapies targeting DNA replication. 49 \n 50 \nIntroduction 51 \nDark zones (DZs) and Light zones (LZs) are two main anatomical compartments (Phan, 2005 #36) 52 \nwithin GCs [1]. DZs accommodate GC B cells undergoing activation induced cytosine deaminase 53 \n(AID)-induced somatic hypermutation (SHM) [2], and LZs are proposed anatomical sites favoring 54 \nAID induced class switch recombination (CSR) [3, 4]. GC B cells remain at high risk of genetic 55 \nrearrangement in both DZs and LZs because dysregulated AID activity during SHM and CSR can 56 \ninitiate oncogenic chromosomal translocations including those fusing the Immunoglobulin locus 57 \n(IG) with trans loci such as MYC and BCL6 [5, 6]. GC B cells with these translocations develop 58 \ninto Burkitt’s lymphoma (IG-MYC) and DLBCL s (IG-BCL6) [5]. The hijacked regulation of 59 \ndifferentiation pathways toward plasma and memory B cells in Germinal center derived B -60 \nlymphomas (GCDBL)  can lead to Multiple Myeloma (MM) and B  cell chronic lymphocytic 61 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 3 \nleukemia (B -CLL), respectively  [7]. Additionally, DLBCL s overexpressing CXCR4, which 62 \nencodes G -protein coupled receptors (GPCRs), can develop into Waldenström 63 \nmacroglobulinemia, another DLBCL subtype marked by BCL6 and CXCR4 co-amplification [1, 64 \n8-11]. Thus, controlling genetic rearrangements in GC B cells, along with regulated differentiation 65 \nand affinity maturation, is important for GCDBL elimination. 66 \n 67 \nThe BCL6 is a master transcriptional regulator of GC B cells belonging to the zinc finger and BTB 68 \n(ZBTB) family and is comprised of an N-terminal BTB/POZ (Broad-complex, Tramtrack, Bric-a-69 \nbrac/Poxvirus and zinc fingers) domain and Krüppel-type zinc fingers at the C terminus [12, 13]. 70 \nThe zinc finger domain of BCL6 is required for DNA binding to recruit the 71 \nSMRT/mSIN3A/histone deacetylase for transcriptional suppression of genes in cell cycle arrest, 72 \nDNA damage repair and p53 response [12, 13] . Thus, BCL6 drives the transcription program 73 \npromoting GC B cell activation  and survival by inhibiting the DNA damage response, apoptosis 74 \nin GC B cells undergoing the SHM and CSR [14, 15]. 75 \n 76 \nBCL6 overexpression is frequently observed in DLBCL [5, 16] . The breakpoint analysis of 77 \nhematological malignancies suggests that 31% of DLBCLs harbor BCL6 translocations on intron 78 \n1, a 10502 base pair sequence also known as major translocation cluster (MTC) [5, 16]. The start 79 \ncodon of BCL6 is located on exon 3, thus translocations involving intron 1 encodes for full length 80 \nBCL6 when juxtaposed with an active locus in trans. 52% of BCL6 translocations involve the 81 \nImmunoglobulin heavy chain (IGH) locus, 10% with immunoglobulin light chain (IGL), and 38% 82 \nwith non-IG loci [5, 16, 17], suggesting random nature of BCL6-translocation to sites other than 83 \nIG locus. BCL6 also acts as a proto -oncogene in the pathogenesis of breakpoint cluster region 84 \n(BCLR)–v-abl Abelson murine leukemia viral oncogene homolog  1(ABL1)-driven acute 85 \nlymphoblastic leukemia (ALL). BCL6 translocations have been also observed in glioblastoma and 86 \nelevated BCL6 activity—along with its corepressor NcoR—is associated with AXL signaling and 87 \ntherapy resistance in glioblastoma  [18]. BCL6 overexpression enables survival of Philadelphia 88 \nchromosome-positive ALL (Ph + ALL) cells upon BC LR–ABL1–kinase inhibition through 89 \nrepression of p53 expression [19]. BCL6 also drives therapy escape in non-small cell lung cancers, 90 \nbreast cancer, colorectal and gall bladder cancer [20, 21]. 91 \n 92 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 4 \nGC B cell differentiation is driven by dynamic changes in chromatin state including the DNA  93 \nmethylation and EZH2 driven histone H3K27me3 of the genes regulating the plasma B cell 94 \ndifferentiation such as IRF4 and PRDM1 [22, 23]. The DNA CpG methylation binding protein 1 95 \n(MBD1) exhibits binding to methylated and unmethylated DNA via its CXXC domains ({Fujita, 96 \n2003 #78 ) and regulates gene expression by recruiting transcriptional suppressors such as 97 \nSETDB2, HP-1a, SUV39H, histone-deacetylases-3 and PML-RARA {Fujita, 2003 #78;Clouaire, 98 \n2010 #79[24]. However, it is not yet clear if MBD1 regulates BCL6 transcription through DNA 99 \nmethylation-dependent or -independent manner. During the plasma B cell differentiation, DNA  100 \nhypomethylation of the promoters of PRDM1, XBP1, IRF8,  SPIB genes assists plasma B cell 101 \ndifferentiation [22, 25]. DNA methyltransferase activity was reported to be decreased in GC B 102 \ncells than naïve B cells and Dnmt1 hypomorphic mice had a defective GC reaction [22], suggesting 103 \na role for DNA methylation axis in GC B cell activation and differentiation. 104 \n 105 \nIntron 1 of BCL6 locus harbors four major CpG rich domains [16] [5], suggesting a role of DNA 106 \nmethylation in BCL6 transcription. CTCF, an insulator which binds to unmethylated DNA, also 107 \nbinds on intron 1 and suppresses BCL6 transcription, suggesting this transcriptional suppression is 108 \nmethylation-independent [26]. CpG methylation is catalyzed by the ten eleven translocation (TET) 109 \nenzymes and is recognized by methylation bi nding proteins (MBDs), suggest ing a complex 110 \nregulation involving DNA  demethylation, TET enzymes, MBD and CTCF binding in the 111 \nregulation of BCL6 transcription [4, 27 -30]. The mechanistic link between DNA  methylation-112 \ndependent suppression of BCL6 transcription and whether MBD proteins are involved in BCL6 113 \ntranscription and remain unknown.  114 \n 115 \nIn the current study, we have characterized the roles of MBD1 in regulation of key genes involved 116 \nin GC B cell fate determination  utilizing a recently described approach for identification of new 117 \nGC regulators. Functional characterization of  MBD1 revealed its roles in suppression of  BCL6 118 \nunder DNA replication stress. Moreover, MBD1 knockdown resulted in increased DNA damage 119 \non the BCL6-MTC region while MBD1-depelted Raji cells exhibited  higher sensitivity to DNA  120 \nreplication inhibitors. These place MBD1 as a novel regulator of BCL6 translocation and 121 \nexpression of BCL6. This role of MBD1 in GC B cells undergoing dynamic chromatin 122 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 5 \nmodification and differentiation could be essential for allowing the differentiation of GC B cells 123 \nassuring the healthy immune response and suppression of the GCDBLs.  124 \n 125 \nResults:  126 \nInverse correlation between MBD1 and BCL6 expression in GC B and cancers 127 \nWe recently defined a novel  approach using Raji cells to define the molecular mechanisms 128 \nregulating the fate of GC B cells and GCDBLs [31]. Briefly, we exposed Raji cells to 4mM HU 129 \nfor 12 hours to induce the  genotoxic-stress as experienced by GC B cells experience during rapid 130 \nproliferation coupled with SHM and CSR [31]. We hypothesized that factors induced during this 131 \ntreatment could be important regulators on GC B cells. Based on this screening, we centered our 132 \ninvestigation on MBD1 due to its significant upregulation as one the the top 50 genes identified in 133 \nour study (Figure 1A). We first confirmed whether MBD1 expression is induced in cancer cells 134 \ntreated with DNA replication inhibitors and the DNA  damage inducers Hydroxyurea  (HU), 135 \nGemcitabine, and Etoposide (Supplementary Figures 1A, B). We performed short hairpin RNA 136 \n(shRNA) mediated knockdown of MBD1 in Raji cells (shMBD1 -Raji) and in breast cancer cells 137 \n(shMBD1-SUM149PT), and control cells with scrambled shRNA (shSCR -Raji and shSCR -138 \nSUM149PT) (Supplementary Figures 1A, B).  We confimed that MBD1 expression was 139 \nsignificantly induced in  scramble-knockdown cells, shSCR -Raji cells treated with HU, 140 \nGemcitabine or Etoposide (Supplementary Figures 1A). While we confirmed that shMBD1 cells 141 \nreduced MBD1 expression by ~75% compared to  shSCR-Raji cells (Supplementary Figure 1A), 142 \nshMBD1-Raji cells treated with these agents also exhibited an trend of induced MBD1 expression 143 \n(Supplementary Figure 1A). Similarly, breast cancer origin cells, shSCR-SUM149PT also induced 144 \nMBD1 expression with HU -treatment  (Supplementary Figure 2B ). These results suggest that 145 \nMBD1 expression is induced in DNA  replication stress-dependent manner. In addit ion, we 146 \nobserved histone H3K4me3 enrichment within -2 kilobase pairs of its TSS in HU -treated cells 147 \n(Figure 1B), suggesting MBD1 expression is partially dependent on histone H3K4me3 under HU 148 \nstress (Figure 1B). 149 \nTo examine the expression of MBD1 in GC B cells, we analyzed the real-time transcriptome data 150 \nfrom activated human tonsil GC B cells (AGCBs) (Figure 1 C) [32]. We simultaneously plotted 151 \nthe log2 fold change (Log2FC) values of MBD1 transcripts against BCL6 transcripts across 152 \nsubpopulations, including DZa, DZb, DZc, and intermediate (INT) populations (INTa, INTb, 153 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 6 \nINTc, INTd, INTe), as well as LZa, LZb, LZc, pre -memory (preM), and plasmablasts A and B  154 \n(Figure 1C). These subpopulations were clustered based on genes specifically enriched in each 155 \ncompartment [32]. Log2FC values for MBD1 were relatively low in DZa, DZb, INTa, INTb, INTc, 156 \nINTd, INTe, LZa, and LZb, with values ranging from -0.34 to 0.163 (Figure 1C). However, log2FC 157 \nvalues of MBD1 were higher in pre-memory (0.625) and plasmablast a cells (1.320) (Figure 1C). 158 \nIn contrast, BCL6 expression sharply declined in pre-memory and plasmablast stages (Figure 1C), 159 \nsuggesting a reciprocal relationship between MBD1 and BCL6 expression in GC B cells.  160 \nGiven the reciprocal expression of BCL6 and MBD1 in human AGCBs, we checked the possibility 161 \nof mututal suppression of MBD1 and BCL6.  Among the tumor samples avai lable in the cancer 162 \ngenome atlas (TCGA), we first categorized BCL6 and MBD1 altered tumors based on their genetic 163 \nstatus and quantified their mRNA level in each group (Supplementary Figure 1B, C). We found 164 \nthat MBD1 mRNA levels positively correlate with genetic alteration (Supplementary Figure 1C). 165 \nWe also observed  a similar relationhip of BCL6 mRNA expression with its copy number aleration 166 \nin tumors (Supplementary Figure 1D).  167 \nWe then examined MBD1-mutated tumors for alterations in BCL6 expression. Tumors with 168 \nMBD1-shallow deletions exhibited higher BCL6 expression than MBD1-diploid tumors (Figure 169 \n1D). On the other hand, BCL6 mRNA levels were significantly lower in MBD1-gain tumors 170 \n(Figure 1 D). Similarly, MBD1-amplified tumors exhibited reduced trend of BCL6 mRNA 171 \nexpression while tumors with MBD1-deep-deletion status exhibited higher BCL6 mRNA levels 172 \nthan MBD1-diploid tumors, although this trend was not significant in these groups  (Figure 1D). 173 \nFurther, DLBCL samples with MBD1-gain status exhibited lower BCL6 expression than MBD1-174 \ndiploid tumors (Figure 1E). Taken together, these results indicate an inverse relationship between 175 \nMBD1 and BCL6 expression. To determine if BCL6 levels also inversely correlate with MBD1 176 \nmRNA levels, we sorted tumors with MBD1-diploid samples and classified them as BCL6-diploid, 177 \nBCL6-deep-deletion, BCL6-shallow-deletion, BCL6-gain and BCL6-amplification (Figure 1 F). 178 \nWe found that MBD1 mRNA was significantly lower in BCL6-gain and BCL6-amplified cancers, 179 \nwhile MBD1-mRNA was higher in BCL6-deleted samples (Figure 1F). These results indiciate that 180 \nBCL6 levels are inversely corealted with the MBD1 mRNA levels, sugesting the mutual suppresion 181 \nof BCL6 and MBD1 by each others.  182 \n 183 \nMBD1 suppresses BCL6 expression during DNA replication stress 184 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 7 \nGiven the abnormal expression of BCL6 in breast cancer cells , we investigated whether MBD1 185 \nknockdown also impacts BCL6 levels in breast cancer cell lines MCF7, MDA-MB-231, SUM-186 \n149PT, and MDA -MB-436 (Figure 2 A). Notably, BCL6 expression was induced in shMBD1 -187 \nMCF7 and shMBD1 -MDA-MB-231 cells compared to control cells (Figure 2 A). These results 188 \nconfirm that MBD1 can suppress BCL6 expression (Figure 2A). However, MBD1 depletion in 189 \nSUM149PT and MDA-MB-436 cells did not induce the BCL6 suppression, suggesting additional 190 \nmechanisms may regulate BCL6 transcription in these cells. Overall, these results confirm that 191 \nMBD1 loss is associated with the induced BCL6 expression not only in B-lymphoma cells but also 192 \nin breast cancer.   193 \n 194 \nTo further confirm that MBD1 suppresses BCL6 expression in B cells, we transiently transfected 195 \nRaji cells with pcDNA-MBD1 (Figure 2B, C). Compared to pcDNA3.1 (empty vector : EV) 196 \ntransfected cells, pcDNA-MBD1 cells induced MBD1 expression in Raji cells (Figure 2B). While 197 \npcDNA-MBD1-transfected cells did not have significantly reduced BCL6 mRNA, treatment with 198 \ngemcitabine caused a significant  reduction in BCL6 levels in pcDNA-MBD1 transfected cells 199 \n(Figure 2C). In addition, 24 and 48 hours of gemcitabine treatment yielded significant reduction 200 \nin BCL6 mRNA since EV-transfected Raji cells exhibited 86% and 71% of BCL6 levels after 24 201 \nand 48 hours of gemcitabine treatment , respectively, while pcDNA-MBD1-transfected Raji cells 202 \nshowed 71% and 61% of BCL6 levels (Figure 2C). Exposure to HU induced a similar trend: after 203 \n24 hours of HU treatment, BCL6 levels were 90% in EV-transfected Raji cells and 86% in pcDNA-204 \nMBD1-transfected cells (Figure 2C). Though not significant, this trend persisted after 48 hours of 205 \nHU treatment, with pcDNA-MBD1 showing 43% BCL6 mRNA levels compared to  51%  in EV-206 \ntransfected cells (Figure 2C). These results further support a role for MBD1 in suppressing BCL6 207 \ntranscription during replication stress. This is distinct from breast cancer cells, where exogenous 208 \nDNA replication stress was not required for MBD 1-mediated suppression of BCL6 expression 209 \n(Figure 2A). 210 \n 211 \nMBD1 recognizes DNA methylation on CpG sequences[24, 33, 34] , we investigated whether 212 \nMBD1 might bind to methylated DNA  sequences on  the BCL6 locus and suppress BCL6 213 \ntranscription. Using the ENCODE database, we identified four dispersed CpG methylation sites 214 \nwithin intron 1 of the BCL6 locus, where the BCL6-MTC resides (Figure 2D). In addition, by 215 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 8 \nanalyzing ChIP-atlas data and MBD1 ChIP-seq results from HCT116 cells, we confirmed MBD1 216 \nbinding along the BCL6 gene body including intron  1 (Figure 2 E). These results suggest that 217 \nMBD1 binds to the BCL6 locus and the repression of BCL6 transcription could be influenced by 218 \nDNA methylation and DNA replication stress. 219 \n 220 \nMBD1 suppresses DNA break formation on the BCL6-MTC in Raji cells- 221 \nMutations increasing MBD1 expression negatively correlate with BCL6 transcription (Figure 1D), 222 \nhowever the relationship between MBD1 and BCL6 mutations in tumors is unclear. To determine 223 \nif MBD1 and BCL6 mutations co-occur, we analyzed their co -occurrence in 27 different tumor 224 \ntypes using TCGA  (Figure 3A). We found that MBD1 deep-deletion or MBD1-shallow deletion 225 \nsamples (commonly referred as MBD1-deleted hereafter) exhibited a higher percentage of BCL6 226 \nalterations, suggesting that genetic alterations in MBD1 and BCL6 are positively associated (Figure 227 \n3A). Further, DLBCL tumors with MBD1-deleted status exhibited a significantly higher frequency 228 \nof BCL6 alterations, suggesting a strong correlation between MBD1 and BCL6-mutated B 229 \nlymphomas (Figure 3B). Based on these results, we hypothesized that MBD1 may also influence 230 \nBCL6 translocation by suppressing DNA breaks on BCL6-MTC preventing its rearrangement. To 231 \ninvestigate this hypothesis, we analyzed gH2AX signal by chromatin immunoprecipitation (ChIP) 232 \non BCL6-MTC after HU-induced DNA replication stress in shSCR-Raji and shSCR-MBD1 cells 233 \n(Figure 3C). We analyzed gH2AX abundance at four primer locations G, J, M and P on BCL6 234 \nintron 1, which spans 10.5 kb (Figure 3C) [26]. The level of gH2AX signal was higher in HU-235 \ntreated shMBD1-Raji cells than HU-treated shSCR-Raji cells (Figure 3D), suggesting that MBD1 236 \nprevents HU-induced DNA damage at BCL6-MTC (Figure 3D). This role of MBD1 in suppressing 237 \nDNA damage at BCL6-MTC suggests that it could suppress BCL6 rearrangements in GC B cells 238 \nand prevent DLBCL formation. Since CTCF binds to intron 1 of BCL6-MTC and suppresses BCL6 239 \ntranscription in MM cells [26], we hypothesized that MBD1 may prevent BCL6 transcription by 240 \ncollaborating with CTCF. We compared CTCF ChIP signal in HU -treated shMBD1-Raji and 241 \nshSCR-Raji cells on the BCL6-MTC (Figure 3E). Compared to HU-treated shSCR-Raji cells, HU-242 \ntreated shMBD1-Raji cells exhibited decreased CTCF occupancy at BCL6-MTC compared to HU-243 \ntreated shSCR-Raji cells (Figure 3E). This result suggests that MBD1 promotes CTCF recruitment 244 \nto BCL6-MTC during replication stress (Figure 3E).    245 \n 246 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 9 \nBCL6 negatively regulates MBD1 transcription 247 \nBCL6 suppresses plasma B cell differentiation by inhibiting expression of IRF4 and PRDM1 [35]. 248 \nGiven the inverse correlation of BCL6 and MBD1 expression in AGCBs (Figure 1 C, D, F ), we 249 \nhypothesized that BCL6 may suppress MBD1 expression in GC B cells undergoing plasma B cell 250 \ndifferentiation. To test the effect of BCL6 inhibition on MBD1 expression, we treated Raji cells 251 \nwith FX1, a potent BCL6 inhibitor which binds to the BCL6 lateral groove  and inhibits the 252 \nformation of the BCL6 repression complex  [36]. We found that FX1 treatment significantly 253 \ninduced MBD1 expression in Raji cells (Figure 4A), suggesting that inhibition of BCL6 binding 254 \nto its DNA target sequences suppresses MBD1 transcription (Figure 4A). These results suggest 255 \nthat MBD1 and BCL6 can regulate each other’s expression in GB B cells and is suggestive of 256 \nmutual negative feedback.  In addition, shBCL6-Raji cells exhibited a trend of increased MBD1 257 \nexpression compared to shSCR-Raji cells, however this difference was not significant  (Figure 4B). 258 \nWe confirmed that BCL6 knockdown was significantly achieved in shBCL6-Raji cells (Figure 259 \n4B), and IRF4 levels were enhanced in shBCL6 -Raji cells confirming the previous reports on 260 \nBCL6 of the IRF4 [37].  261 \n 262 \nTo explore how BCL6 suppresses MBD1 transcription, we performed in-silico binding analysis of 263 \nBCL6 on the MBD1 promoter (Figure 4C). We observed two BCL6 binding motifs on the MBD1 264 \npromoter present at -235 and -900 bp upstream of MBD1-TSS (Figure 4 C, D). To determine if 265 \nBCL6 binding occurs at these sites, we cloned 1 kb of the MBD1 promoter region, and inserted 266 \ninto the luciferase reporter pGL4 vector then performed site -directed mutagenesis on DNA 267 \nsequences flanking these two binding sites (Figure 4D) . 293T cells  transfected with pGL4-pr-268 \nMBD1 induced luciferase signal nearly 38-fold compared to 293T cells transfected with empty 269 \npGL4  (Figure 4D). Interestingly, co-transfection of pGL4-pr-MBD1 and pcDNA-BCL6 reduced 270 \nthe luciferase signal to around 15%, suggesting that BCL6 suppresses MBD1 expression by 271 \nbinding its promoter (Figure 4D). Deletion of either BCL6 binding motif significantly increased 272 \nluciferase signal, suggesting that BCL6 binding to the predicted binding motifs negatively regulate 273 \ntranscription (Figure 4D). Of note, pcDNA-BCL6 expression had a smaller impact on luciferase 274 \nsignal from the pGL4-pr-MBD1 Δ235-BCL6 or pGL4-pr-MBD1 Δ900-BCL6 reporters than the 275 \nwild-type promoter sequence (Figure 4D). Particularly, deletion of the site located -900 upstream 276 \nof MBD1-TSS (Figure 4D) had a greater rescue from BCL6-mediated suppression, suggesting that 277 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 10 \nBCL6 binding to this motif plays a crucial role in regulating MBD1 expression (Figure 4D). We 278 \nnext examined  whether BCL6 binding is present on the endogenous MBD1 promoter. Using BCL6 279 \nChIP-seq datasets from ChIP-atlas, we confirmed BCL6 binding on MBD1 promoter in multiple 280 \ncell lines including SUDHL4 (DLBCL), OCI-LY1 (DLBCL), OCI-LY3 (DLBCL) and in B-cell 281 \nacute lymphoblastic leukemia (B-ALL) cell lines (Figure 4E). These results suggest that BCL6 282 \nbinds to the MBD1 promoter and suppresses its transcription (Figure 4D, E). 283 \n 284 \nTo investigate whether BCL6 regulation is associated with Mbd1 regulation in mouse GC B cells, 285 \nwe examined the DNA methylation status of the Mbd1 promoter in wild-type and Sca1-Bcl6Δ mice 286 \n(Supplementary Figure 2A[38]. We noted that the Mbd1 promoter in activated GC B cells of wild 287 \ntype mice showed two distinct DNA methylation peaks, and one peak was lost in Sca1-Bcl6Δ mice 288 \n(Supplementary Figure 2A). These results suggest that BCL6 suppression of Mbd1 could be 289 \nassociated with DNA methylation on the Mbd1 promoter in mouse GC B cells.  To determine if 290 \nmethylation impacts MBD1 expression, we  analyzed human B lymphomas treated with 5 -291 \nAzacytidine (AZA), a DNA methyltransferase inhibitor (Supplementary Figure 2B), and observed 292 \nthat AZA treatment increased transcripts per million (TPM) counts of MBD1 in OCI -LY1, 293 \nSUDHL2, and OCI -LY19 cells. Together these results  suggest that MBD1 expression in GC B 294 \ncells is regulated by BCL6 and DNA methylation (Supplementary Figure 2B). 295 \n 296 \nGC B cells are regulated by BCL6 and AID, both of which also act as oncoproteins. Since BCL6 297 \nsuppresses MBD1 (Figure 4A, D), it is possible that MBD1 may function as a tumor suppressor in 298 \nGC B cells. AID is also involved in B-lymphomagenesis due to its mutagenic roles in GC B cells 299 \n[10, 39], therefore we explored if AID is associated with MBD1 mutagenesis. We looked for AID 300 \nsignatures in MBD1-mutant cancers  in the Catalogue of somatic mutation in cancer cells 301 \n(COSMIC) (Figure 4F) . Interestingly, AID mutation signatures (C>T) , which are initiated by 302 \ncysteine deamination to uracil in non-replicating B cells, were frequent (38.9%) along the MBD1 303 \ngene in MBD1 mutant tumors (Figure 4F). Furthermore, C>G and C>A signatures, which are not 304 \nas strongly associated with AID activity and could arise due to translesion synthesis and mismatch 305 \nrepair, were 3.4 % and 5.5%, respectively (Figure 4 F). Among non -AID signature mutations in 306 \nthe MBD1 gene, G>A were the most frequent (27.9%) among all samples (Figure 4 F). These 307 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 11 \nresults suggest that MBD1 is mutated by AID and underscore MBD1 as a pivotal target for both 308 \nBCL6 and AID in promoting B lymphomagenesis.  309 \n 310 \nIncreased sensitivity of MBD1-depleted cells to chemotherapeutics targeting DNA 311 \nreplication and reduced tumorigenicity in mouse xenograft model 312 \nThe increased levels of gH2AX signal at the BCL6-MTC in HU-treated shMBD1 cells indicates 313 \nincreased susceptibility of MBD1-depleted cells to chemotherapeutic agents inducing replication 314 \nstress (Figure 3D). To determine if shMBD1 -Raji cells exhibit higher susceptibility to other 315 \nchemotherapeutic agents , we treated shSCR -Raji and shMBD1 -Raji cells with gemcitabine or 316 \netoposide (Figure 5A). Control ShSCR-Raji cells showed modest sensitivity to HU and 317 \nGemcitabine, and greater sensitivity to etoposide  (Figure 5A). However, depletion of MBD1 led 318 \nto significantly greater sensitivity to all drugs tested : the  viability in shMBD1 -Raji cells was 319 \nfurther reduced to 60 %, 8 1.5% and 40.5% compared to shSCR-Raji cells treated with HU, 320 \ngemcitabine or etoposide (Figure 5A). These results suggest that MBD1-deficient cells are more 321 \nsensitive to genotoxic agents than shSCR-Raji and indicate a role of MBD1 in promoting cell 322 \nviability in response to DNA replication stress/genotoxic stress. 323 \n 324 \nFinally, to test whether tumorigenicity is altered in MBD1-silenced cells, we performed xenograft 325 \nexperiments by injecting shSCR-Raji and shMBD1-Raji cells into nude mice (Figure 5B-D). Mice 326 \ninjected with shSCR-Raji cells exhibited mean tumor weight of 0.62 gm (Figure 5D). In contrast, 327 \nthe mean weight of shMBD1-Raji tumors was 0.15 gm (Figure 5D). This reduction in tumor weight 328 \nof shMBD1-Raji xenograft was significantly lower than those in shSCR-Raji cells (Figure 5C, D). 329 \nThis result suggests that MBD1 is required for the tumorgenicity of Raji cells in vivo (Figure 5E, 330 \nC, D). It is possible that accumulative genotoxic stress may surpass the threshold cells can tolerate 331 \nin shMBD1-Raji cells  therefore perturbing the cellular proliferation , tumorgenicity and tumor 332 \ngrowth (Figure 5B,C, D). 333 \n 334 \nCorrelation of MBD1 and IRF4 expression in B-Lymphoma 335 \nHuman AGCBs induce  MBD1 expression in GC B cells undergoing differentiation into plasma 336 \nand memory B cells while BCL6 expression was reduced at similar stages, suggesting that the 337 \nupregulation of MBD1 in differentiating GC B cells  is correlated  with BCL6 downregulation 338 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 12 \n(Figure 1C). We hypothesized that MBD1 could regulate the expression of genes in GC B cells 339 \nundergoing terminal differentiation. To define the relationship between MBD1 mutation status and 340 \nIRF4 expression, we explored their correlation in samples from  TCGA datasets and the  Gene 341 \nExpression Profiling Interactive Analysis  (GEPIA) (Supplementary Figure 3A, B ). IRF4 342 \nexpression was highest in DLBCL samples exhibiting MDB1:gain status, suggesting a positive 343 \ncorrelation between MBD1 and IRF4 expression (Supplementary Figure 3A). Moreover, DLBCL 344 \ntumors from GEPIA also exhibited a positive correlation in MBD1 and IRF4 (Supplementary 345 \nFigure 3B). Since IRF4 expression is induced in plasma B cells, we examined whether mouse 346 \nplasma B cells exhibit higher Mbd1 expression than activated GC B cells (Supplementary Figure 347 \n3C). Interestingly, Mbd1 expression was increased in mouse plasma B cells , when IRF4 is high  348 \n(Supplementary Figure 3C) [40], suggesting that Mbd1 induction in plasma B cells is coordinated 349 \nwith Irf4 expression. We also measured the effect of MBD1 knockdown on the expression of two 350 \nkey genes determining GC B cell fate, IRF4 and PRDM1 (Supplementary Figure 3D).  MBD1 351 \ndepletion in Raji cells resulted in increased expression of IRF4 and PRDM1, indicating a negative 352 \nregulatory role of MBD1 in their transcription (Supplementary Figure 3D). Conversely, 353 \noverexpression of MBD1 led to a reduction in IRF4 expression (Supplementary Figure 3E) , 354 \nsuggesting that MBD1 plays a critical role in IRF4 regulation.  355 \n 356 \nFinally, we analyzed if MBD1 depletion affects the expression of key factors regulating GC B cell 357 \nactivation and survival including essential homing receptors (CXCR4, CXCR5, CCR7, CXCR4, 358 \nCXCR5, S1PR2, P2RY8), genes encoding the components of migration machinery (RAC1, RHOA), 359 \nBCL6 targets, (IRF7, IFNGR1, STAT1), or genes encoding factor s regulating BCL6 turnover, 360 \n(FBXO11, XBP1) (Supplementary Figure 3F). Among the GC B cell receptors tested , shMBD1-361 \nRaji cells exhibited increased expression of CCR7, P2RY8 and STAT1 but reduced expression of 362 \nRAC1 compared to shSCR-Raji cells (Supplementary Figure 3F). The expression of BCL6 targets 363 \nor regulators S1PR2, RHOA, FBXO11, XBP1, IRF7 and IGNGR1 was not alter ed upon in the 364 \nshMBD1-Raji cells (Supplementary Figure 3 F). Overall, these observations suggest that MBD1 365 \ncan affect the position of B cells within the GC compartment by regulating the expression levels 366 \nof CCR7, CXCR5, and CXCR4 in cells  belonging to T-B border (T-B), light zone (LZ), and dark 367 \nzone (DZ),  respectively. MBD1’s regulation of RAC1 and P2RY8 may also affect the dynamic 368 \nmigration of GC B cells, given a role of RAC1 and P2RY8 in GC B cell LZ-migration [41, 42].  369 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 13 \n 370 \nDiscussion: 371 \nMechanism of MBD1 induction in GC B cells undergoing Plasma B Cell Differentiation – 372 \nThe increased MBD1 expression we observed in HU-treated Raji cells correlates with elevated 373 \nMBD1 levels in human AGCBs classified as pre -memory and plasma B cells [32] (Figure 1 C). 374 \nSimilarly, mouse GC B cells undergoing PC differentiation also exhibit increased Mbd1 levels 375 \n(Supplementary Figure 3C). This evidence highlights MBD1’s role in GC B cell differentiation in 376 \nboth humans and mice (Figures 1C, supplementary Figure 3C). The transition from GC B cells to 377 \nplasma cells necessitates dynamic DNA hypomethylation in genes involved GC B differentiation 378 \n[25, 43], suggesting that MBD1 expression could be induced by hypomethylation of its promoter. 379 \nThis is supported by our observations of  DNA methylation loss in the Mbd1 promoter in Sca1-380 \nBCL6Δ mice (Supplementary Figure 2A) , and the induction of MBD1 expression in the presence 381 \nof the methylation inhibitor AZA in DLBCLs (Supplementary Figure 2B) [38]. MBD1 induction 382 \nduring plasma B cell differentiation could also be related to BCL6 downregulation since we 383 \nprovide evidence that BCL6 suppresses MBD1 expression by binding to its promoter (Figures 4A, 384 \nD). The increased MBD1 levels in plasma B cells might also result from reduced EZH2-dependent 385 \nsilencing of the  MBD1 promoter, as this suppresion is removed in GC B cell undergoing 386 \ndifferentiation [23]. In contrast, induction of MBD1 in cancer cells undergoing chemotherapy with 387 \nDNA replication inbibito rs suggest s a pr ogrammed activation of MBD1 transcription which 388 \npotentially regulates  cell survival (Supplementary Figure 1A, B , Figure 5A -D). The detailed 389 \nmechanims regulating MBD1 -mediated cell survival  should be explored in future studies to 390 \nrationally design effective combination therapy for MBD1-inactivated cancers. MBD1 alteration 391 \nmay also be an effective biomarker for tumor exhibiting higher BCL6 and IRF4 expression which 392 \nalso correlates with increased chemotherapeutic resistance [19, 44].  393 \n 394 \nBCL6 translocations and reduced tumorigenicity in MBD1-depleted cancer cells–The BCL6-395 \nMTC contains highly conserved CpG methylated sites on it intron  1 (Figure 2D) [26], therefore 396 \nMBD1 may bind to the BCL6-MTC in a DNA  methylation-dependent manner (Figure 2D, E). 397 \nMBD1 binding can help recruit histone deacetylases like SUV39H for transcriptional repression 398 \nat the BCL6 locus [5, 24, 33, 45]. MBD1-dependent BCL6 suppression may take place in GC B 399 \ncells undergoing terminal differentiation, correlating with reduced BCL6 levels in plasma B cells 400 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 14 \n[46]. MBD1 binding to BCL6 promoter is observed in HCT116 cells (ChIP atlas:DRX021118 401 \n;https://chip-atlas.org/view?id=DRX021118; Figure 2 E). MBD1 binding may contribute to 402 \nreduced genomic instability at the BCL6 locus preventing BCL6 rearregements as well as global 403 \nrearrangements in GC B cells. On the other hand, shMBD1-Raji cells exhibited higher sensitivity 404 \nto HU, gemcitabine, and etoposide as well as  reduced tumorogencity in xenograft mo dels than 405 \nshSCR-Raji cells (Figure 5A). These results suggest that MBD1 promotes survival in cancer cells, 406 \nmaking MBD1 an attractive therpautic target.  The reduced tumorigenicity observed in the 407 \nshMBD1-Raji xenograft could be due to the increased accumulation of genomic instabilit y in 408 \nshMBD1-Raji cells compared to shSCR-Raji cells (Figure 5C, D). 409 \n 410 \nAID mutation signatures in MBD1-mutant somatic cancers – AID-mediated mutagenesis  411 \ndrives B lymphomagenesis by mutating tumor suppresor genes and superenhancers, altering the 412 \nbinding of transcription factors and chromatin remodelers [10]. Interestingly, about 39% of single 413 \nbase-pair alterations in MBD1 were C>T transition mutations (Figure 4F), a classic signature of 414 \nAID-dependent mutagenesis (Figure 4F). Thus AID-dependent MBD1 mutagenesis could serve as 415 \nan important adapation for B lymphoma selection during the GC reaction.  416 \n 417 \nMBD1 and IRF4 expression in differentiating GC B cells and B-lymphomas- We found that 418 \nMBD1 and IRF4 expression is positively correlated in DLBCL (Supplementary Figure 3A,B). On 419 \nthe other hand, Mbd1 and Irf4 were induced in mouse and human GC B cells undergoing plasma 420 \nB differentiation (Figure 1C, Supplementary Figure 3C), indicating a synchronous upregulation of 421 \nMBD1 and IRF4 in GC B cells undergoing differe ntiation.  The mechanims of MBD1 and IRF4 422 \nco-expression in GC B cells is not yet clear. It is possible that MBD1 and IRF4 could be induced 423 \nby decreased BCL6 levels in differetiating GC B cells. Also, MBD1 in differentiating GC B cells 424 \ncould suppreses BCL6, allowing for higher IRF4 expression and plasma B cell differe ntiation. 425 \nImportantly, IRF4 suppression is mediated by EZH2 -dependent H3K27me3 [23]. Is is po ssible 426 \nthat MBD1 may counteract EZH2 by recruiting histone deacetylases and transcriptional repressors 427 \nto the EZH2 promoter [5, 24, 33, 45]. This positions MBD1 as a novel regulator of GC B cell 428 \ndifferentiation regulating the plasma B cell differe ntiation [47, 48]. Another po ssibility is that 429 \nMBD1 may work alongside BCL6 and BACH2, both of which negatively regulate IRF4 and 430 \nPRDM1 [46], al lowing for homestasis of IRF4 expression. This is consistent with our finding 431 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 15 \nwhere MBD1 depletion in Raji cells induced IRF4 expression (Supplementary Figure 3 D). 432 \nHowever MBD1-mediated suppression of IRF4 in Raji lymphoma cells may be distinct from WT 433 \nB cells residing in the GC comp artment, therefore we can not rule out the possibility that MBD1 434 \npromotes plasma B cell differentiation.  435 \n 436 \nMBD1-mediated regulation of IRF4 and PRDM1 and its significance in  the suppression and/or 437 \nsurvival  of B-lymphomas remains to be elucidated. We propose two potential regulatory scenarios 438 \nfor MBD1 -dependent IRF4 regulation depending on the stage of tumorigenesis . In  the first 439 \nscenario, GC B cells with high -affinity B cell receptors (BCR)  might experience higher MBD1 440 \nexpression, facilitating normal GC B cell differentiation. In the second, B lymphoma precursors—441 \nunproductive GC B cells with damaged BCRs —may experience reduced MBD1 expression 442 \nblocking the expression of plasma B cell differentiation genes including IRF4 and mitigating the 443 \nrisk of malignant transformation into multiple myeloma (MM).  Thus, MBD1 may differentially 444 \nregulate plasma B cell differentiation in normal plasma B cells versus B lymphoma precursors.  445 \n 446 \nIn summary, our findings suggest that MBD1 is a key regulator of GC B cell differentiation, acting 447 \nindependently of both BCL6 and BACH2. Additionally, MBD1 may prevent BCL6 rearrangement 448 \nin GC B cells, thereby inhibiting the formation of GCDBL. Finally, considering MBD1’s role in 449 \ncell viability in cells treated with DNA-replication inhibitors, it could serve as a novel therapeutic 450 \ntarget for relapsed and refractory B cell cancers that are resistant to chemotherapy. 451 \n 452 \nDeclarations 453 \nEthical Approval – The use of human/animal samples (wherever applicable) was approved as per 454 \nInstitutional ethical board.  455 \nCompeting interests- The authors declare no competing interest financially.  456 \nAuthors' contributions - SKG designed the original hypothesis, performed experiments, and 457 \nanalyzed data. KO analyzed Mbd1 transcripts in mouse plasma B cells and provided constructive 458 \nfeedback. SKG wrote the manuscript. JHB critically read the manuscript and provided constructive 459 \nfeedback. All authors read and agreed to manuscript.  460 \n 461 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 16 \nFunding- This work is supported grant number 21K16142 from Japan Society for the Promotion 462 \nsciences (JSPS) to SKG. 463 \n 464 \nAvailability of data and materials- All data needed to evaluate the conclusions in the paper are 465 \npresent in the main text and the supplementary materials.  466 \n 467 \nMaterial and Methods: 468 \nHuman B lymphoma cultures , treatment with inhibitors  and plasmid overexpression :  469 \nHuman B lymphoma Cell lines Raji were obtained from Department of Hematology, Kyoto 470 \nuniversity hospital, RIKEN cell bioresources, Japan. MCF7, MDA-MB-231, SUM149PT, MDA-471 \nMB-436 were available at the Cancer Research Institute, Kanazawa University. Raji and 472 \nHEK293T cells  were cultured in RPMI  medium (30264-85, Nakalai) including the  10% fetal 473 \nbovine serum ( FBS), 1% Penicillin -Streptomycin & Amphotericin B solution (Waken#  161-474 \n23181) at 37°C maintaining the 5% CO2 concentration. Breast cancer cell lines MDA -MB-231, 475 \nMDA-MB-436, MCF-7 cells were cultured DMEM, supplemented with 10% fetal bovine serum 476 \n(FBS), 2 mM L-glutamine and 1 × Penicillin-Streptomycin (Life Technologies).  SUM149PT cell 477 \nwere cultivated in Ham’s F -12 medium containing 5% FBS, 10 μg/ml insulin, 1% Penicillin -478 \nStreptomycin & Amphotericin B solution (Waken# 161-23181), and supplemented with 0.5 μg/ml 479 \nhydrocortisone. Cells were propagated at 37 °C in a 5% CO 2 atmosphere. FX1 (S8591, Selleck 480 \nJapan), Gemcitabine ( S1714, Selleck, Japan), Hydroxyurea ( 085-06653, Wako, Japan)  and 481 \netoposide (055-0843, Wako, Japan) treatments were performed as described in figure legends. The 482 \npreparation of these chemical was performed  as per the manufacturer’s recommendation. For the 483 \noverexpression of pcDNA and pcDNA-BCL6 plasmids in Raji cells, the cells were cultured for 2 484 \nhours in RPMI medium containing 1% FBS, followed by transfection with Lipofectamine 3000 485 \naccording to the manufacturer's instructions (Thermo Fisher, Japan). Twelve hours post -486 \ntransfection, the total FBS concentration was adjusted to 10% by adding additional FBS. Cells 487 \nwere collected for analysis at the indicated time points. 488 \n 489 \nshRNA preparation and len tivirus induced knockdown- HEK293T cells were culture d at the 490 \n70% confluency. For transfection mixture and lentivirus preparation, viral vector PAX2, pVSVG 491 \nand pLKO.1 plasmids (1 µg of each) cloned with respective shRNA sequences were mixed in 200  492 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 17 \nµl of warm Optimem medium followed by addition of 3 µg of PEI reagent. The mix incubated for 493 \n20 minutes at room temperature follwed by addition to the H3K293T cells. Fresh medium DMEM 494 \nmedium was replaced to transfected cells after 24 hours. The H3K293T cells were then cultured 495 \nfor additional 48 hours. The culture medium containing the lentivirus particles was then filtered 496 \nusing the 0.45-micron filters and the filtrate was aliquoted and stocked in -80 °C until used. For 497 \nstable transfection of Raji cells, 1 million cells were transduced with  400 µl of filtered lentiviral 498 \nsupernatant follwed by selection with puromycin (2000 ng/ml)  for 2 days . The 2 days selected 499 \ncells were again washed and selected for additional 2 days with similar dose of Puromycin.  500 \n 501 \nRNA isolation, cDNA preparation, qPCR analysis and RNA-seq analysis - Total RNA was 502 \nisolated with NucleoSpin® RNA Plus (#740984.50, Takara) and cDNA was prepared with the RT-503 \nPCR mix (FSQ#201, Toyobo Japan) .  qPCR was performed using the SYBR mix as per 504 \nmanufacturer’s instructions (Thunderbolt QPS-201, Toyobo Japan). Data were analyzed using the 505 \ndelta-delta Ct method indicating relative transcript levels to the respective control samples. ACTB 506 \ngene signals were used as a housekeeping gene. Computational analyses of RNA -seq were 507 \nperformed as described (Reference; transcriptome paper).  The RNA-seq and ChIP  data set are 508 \nunder GEO accession numbers GSE242375 and GSE242936 respectively.   509 \n 510 \nChromatin Immunoprecipitation (ChIP) , ChIP-seq Library Preparation,  Computational 511 \nAnalysis of ChIP -seq Data, and MBD1 Binding to BCL6 locus withChIP-Atlas- ChIP was 512 \nperformed as previously described [6]. The ChIP -seq library was prepared as per the 513 \nmanufacturer’s instruction (Thruplex DNA -seq Kit, R400675, Takarabio, Japan).  ChIP-seq was 514 \nperformed as described [31]. The ChIP-seq files were deposited to NCBI under accession number 515 \nGSE242936. DNA CpG methylation status of mouse Mbd1 promoter in B cells were reanalyzed 516 \nusing the wild type and Sca1-Bcl6Δ mice data [25, 43]. Binding of MDB1 on BCL6 promoter was 517 \nexamined using the dataset # DRX021118 available on ChIP-atlas (https://chip-518 \natlas.org/view?id=DRX021118).  519 \n 520 \nBCL6 binding motif, luciferase assay  and COSMIC datasets : The luciferase plasmids 521 \ndepleting the BCL6 binding motifs on the MBD1 promoter were constructed using the Q5 site -522 \ndirected mutagenesis kit (NEB# E0554S) and as per the manufacturer’s instructions. Primers used 523 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 18 \nfor the site -directed mutagenesis are listed in Table 1. The plasmids were transfected in the 524 \nHEK293T cells for 24 h ours using lipofectamine -3000 (ThermoFisher#  L3000001). After 24 525 \nhours, cell lysates were prepared using Promega luciferase assay kit. The Catalogue of somatic 526 \nmutation in cancers (COSMIC) datasets were searched  for cancers with MBD1 mutation and the 527 \nmutation signatures were classified and filtered for the AID signatures. 528 \n 529 \nTumor xenograft in nude mouse  and estimation of cell viability- For tumor xenograft, and 530 \ninjection of Raji  into nude mice, 0.6 million cells were suspended in 200 µl of Matrigel and 531 \nmedium mix, suspended well and subcutaneously injected into the right arm of the nude mice. The 532 \ntumor growth was observed for 55 days and mice were sacrificed, followed by isolation of tumor 533 \nand weighing. Treatment with chemotherapeutics and cell viability was tested by the cell viability 534 \nkit (Dojindo Japan) as per the manufacturer’s instructions. 535 \n 536 \nSupplementary Table 1 for primer sequences- 537 \nTranscript name Primer sequences for qPCR (5’ to 3’) \nACTB-FP GATGATGATATCGCCGCGCT \nACTB-RP GAATCCTTCTGACCCATGCC \nCXCR5-FP AGATTCTCTTCGCCAAAGTC \nCXCR5-RP (GP48) CACCAGCATGGGCAGCAGGAAT \nCCR7-FP GTACTCCATCATTTGTTTCGTG \nCCR7-RP CAGAAGGGAAGGGTCAGGAG \nS1PR2-FP CAACAGAGGGAGACTCCATCTC \nS1PR2-RP CTTGTACTCGGAGTACCTGAAC \nP2RY8-FP CATCATCACCTGCTTCGACGT \nP2RY8-RP CAACAGCTTGAGGATGGTGGC \nBCL6-FP CATGCAGAGATGTGCCTCCACA \nBCL6-RP TCAGAGAAGCGGCAGTCACACT \nPRDM1-FP CAGTTCCTAAGAACGCCAACAGG \nPRDM1-RP GTGCTGGATTCACATAGCGCATC \nXBP1-FP CTGCCAGAGATCGAAAGAAGGC \nXBP1-RP CTCCTGGTTCTCAACTACAAGGC \nFBXO11-FP ATCATGGACGTGATGTTGGTGTG \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 19 \n 538 \n 539 \n 540 \n 541 \n 542 \n 543 \n 544 \n 545 \n 546 \n 547 \n 548 \n 549 \n 550 \n 551 \n 552 \n 553 \n 554 \n 555 \n 556 \n 557 \nSupplementary Table-2 558 \nAntibody name Purpose Product/Manufacturer \nBCL6 WB GeneTex#GTC101338 \nHistone H3K4-trimethyl ChIP CST#C42D8  \nACTB WB Novusbio (NB100-56874) \nHistone H3 WB Biolegend (819411) \ngH2AX ChIP Abcam#ab20669  \nCTCF ChIP, WB, IP Active Motif#61932  \nMBD1 WB Abeomics (ABM15H2)  \n 559 \nFBXO11-RP CCACTGTAGGGTTAGCATAGGC \nIRF4-FP GAACGAGGAGAAGAGCATCTTCC \nIRF4-RP CGATGCCTTCTCGGAACTTTCC \nPrimers for shRNA-Knockdown (5’ to 3’) \nshRNA-MBD1 CCGGGAACAGAGAATGTTTAA \nshRNA-CTCF ACGTGTCCACGGCGTTCAAAT \nshRNA-BCL6 CCCATGATGTAGTGCCTCTTT \nPrimer sequences for ChIP analysis \nPrimers  Primer sequence  \nBCL6-G_Forward TGGATTCGTGCGGCTGTG \nBCL6-G_Reverse GGGAAGGGAAGGAAGAAGAGG \nBCL6-J_Forward GGCGACTTGAAGGAGACAGC \nBCL6-J_Reverse CCCATCCCTATCCACCAAACC \nBCL6-M_Forward GCTGAAGGGTGTGGGTCTC  \nBCL6-M_Reverse TTCTCGCCAGGCTACTATGC \nBCL6-P_Forward AAATAAACTTCGGAATCGGACAAC \nBCL6-P_Reverse CCCACCTCTCACCCACAAC \nPrimer for BCL6-binding motif deletion on MBD1-promoter \nBCL6-D235-FP GCTGTCGTTGAACGTC \nBCL6-D235-RP AACCTGAAGGGAAGC \nBCL6-D875-FP TTCTGGATAAGATGGGG \nBCL6-D875-FP GCAAGGATGAGTGGAC \n \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 20 \nSupplementary Table 3- List of tumor acronym from TCGA study datasets 560 \n 561 \nStudy Abbreviation Study Name \nLAML Acute Myeloid Leukemia \nACC Adrenocortical carcinoma \nBLCA Bladder Urothelial Carcinoma \nBRCA Breast invasive carcinoma \nCESC Cervical squamous cell carcinoma and endocervical \nadenocarcinoma \nCHOL Cholangiocarcinoma \nCOAD Colon adenocarcinoma \nESCA Esophageal carcinoma \nGBM Glioblastoma multiforme \nHNSC Head and Neck squamous cell carcinoma \nKICH Kidney Chromophobe \nKIRC Kidney renal clear cell carcinoma \nKIRP Kidney renal papillary cell carcinoma \nLIHC Liver hepatocellular carcinoma \nLUAD Lung adenocarcinoma \nLUSC Lung squamous cell carcinoma \nDLBC Lymphoid Neoplasm Diffuse Large B cell Lymphoma \nPAAD Pancreatic adenocarcinoma \nPCPG Pheochromocytoma and Paraganglioma \nPRAD Prostate adenocarcinoma \nREAD Rectum adenocarcinoma \nSKCM Skin Cutaneous Melanoma \nSTAD Stomach adenocarcinoma \nTGCT Testicular Germ Cell Tumors \nTHYM Thymoma \nUCS Uterine Carcinosarcoma \nUCEC Uterine Corpus Endometrial Carcinoma \nUVM Uveal Melanoma \n 562 \n 563 \nFigure legends 564 \nFigure 1: Identification of the DNA-replication stress-induced transcriptome in Raji cells. 565 \n(A) Differentially expressed genes in control  and HU-treated Raji cells  (n=3) x axis indicated 566 \nlog2FC for mRNA fold change and y axis indicated -log10 of adjusted p values. data is from three 567 \nindependent samples (B) Analysis of histone H3K4me3 trimethylation ChIP -seq on the MBD1 568 \nlocus in vehicle -treated or HU -treated Raji cells  (C) Real-time kinetics of MBD1 and BCL6 569 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 21 \nexpression in activated germinal center B cells (AGCBs) from human tonsil (D) BCL6-diploid 570 \ndiploid tumors were classified into MBD1-amplification (n=6) , MBD1-deep deletion  (n=19), 571 \nMBD1: diploid (n=4230),  MBD1:gain (n=298) and MBD1-shallow deletion (n=1397) exhibiting 572 \nmean BCL6-mRNA values of 1.110, 1.375,1.103,  0.8686 and 1.309 in each group respectively.  573 \np=<0.0001 MBD1:diploids vs MBD1:gain and MBD1-diploid vs MBD1 -shallow deletion 574 \nrespectively. Dunnett’s multiple comparison test One way ANOVA. Data are presented as mean 575 \n± SEM . (E) Comparison of BCL6 mRNA levels in the DLBC L samples (TCGA database)  576 \nexhibiting either MBD1:diploid or MBD1:gain status. Normalization of BCL6 mRNA in MBD1 577 \naltered groups was calculated by normalizing the RSEM  values of BCL6 mRNA by RSEM values 578 \nof MBD1 mRNA in each sample. p= 0.0.0307 for MBD1:diploid vs MBD1:gain. T-test, Mann-579 \nWhitney test (F) MBD1-diploid tumors were classified into  BCL6-amplification, BCL6-deep 580 \ndeletion, BCL6-diploid, and BCL6-gain and BCL6-shallow deletion groups. Values on y -axis 581 \nindicates normalized RSEM values of MBD1 mRNA with the RSEM values of BCL6 mRNA. The 582 \nmean of normalized MBD1 mRNA was 0.8332 in BCL6-amplification (n=182), 2.201 for BCL6-583 \ndeep deletion (n=15), 1.57 in BCL6-diploid (n=4230),  1.171 in BCL6-gain (n=972), and 2.027 in 584 \nBCL6-shallow deletion (n=390) group.  p< 0.0001 for BCL6-amplification vs BCL6-diploid, p< 585 \n0.0001 for BCL6-diploid vs BCL6-gain. Dunnett’s multiple comparison test, One way ANOVA.   586 \n 587 \nFigure 2: MBD1 suppresses BCL6 expression under DNA replication stress. 588 \n(A) shMBD1-MCF7, and shMBD1-MDA-MB-231 cells exhibit higher levels of BCL6 expression 589 \nthan shSCR -MCF7 and shSCR -MDA-MB-231 cells. For BCL6 group:  p<0.0001 for shSCR -590 \nMCF7 vs shMBD1 -MCF7 cells., p<0.0001 for shSCR-MDA-MB-231 vs shMBD1 -MDA-MB-591 \n231 cells, p= 0.9927 for shSCR -MDAMB436 vs shMBD1 -MDAMB436, p>0.9999 for shSCR -592 \nSUM149PT vs shMBD1 -SUM149PT. For MBD1: p= 0.0051 for shSCR -MCF7 vs shMBD1 -593 \nMCF7, p<0.0001 for shSCR -MDAMB231 vs shSCR -MDAMB231, p=0.0339 for shSCR -594 \nMDAMB436 vs shMBD1 -MDAMB436, p=0.0001 for shSCR -SUM149PT vs shMBD1 -595 \nSUM149PT. Two-way ANOVA. Tukey’s multiple comparison test (B) pcDNA (1 μg) or pcDNA-596 \nMBD1 (1 μg and 5 μg) were transfected into 0.5 million Raji cells seeded in 12-well plates. RNA 597 \nwas extracted 24 hours post-transfection, and cDNA preparation and qPCR were conducted for 598 \nMBD1. p=0.0070 for pcDNA (1 μg) vs pcDNA-MBD1 (1 μg) and p<0.0001 for pcDNA (1 μg) vs 599 \npcDNA-MBD1 (5 μg). Sidak’s multiple comparison test (ordinary one -way Anova). Data are 600 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 22 \npresented as mean ± SEM from three independent experiments  (C) MBD1 overexpression was 601 \nperformed in Raji cells and cells were treated with HU  and g emcitabine for 24 and 48 hour s 602 \nfollowed by estimation of BCL6 mRNA levels by qRT -PCR. For 24 hour -treated samples: 603 \np=0.9990 for pcDNA (DMSO) vs pcDNA-MBD1 (DMSO), p=0.6897 for pcDNA (HU) vs pcDNA-604 \nMBD1 (HU), and p=0.0009 for pcDNA (Gemcitabine) vs pcDNA-MBD1 (Gemcitabine). For 48 605 \nhour-treated samples: p=0.9748 for pcDNA (DMSO) vs pcDNA-MBD1 (DMSO), p=0.2108 for 606 \npcDNA (HU) vs pcDNA-MBD1 (HU), and p=0.0394 for pcDNA (Gemcitabine) vs pcDNA-MBD1 607 \n(Gemcitabine). Two -way ANO VA. Tukey’s multiple comparison test  (D) BCL6 promoter 608 \nharbours CpG Methylation sites. Encode datasets of CpG methylation on BCL6 gene among 609 \nseveral cells lines is shown using the UCSD datasets (E) MBD1 binds to the BCL6 promoters in 610 \nHCT116 cells. Region highlighted in the above panel indicates the CpG methylation-rich regions 611 \nexhibiting MBD1 peaks in HCT116. The lower panel shows BCL6 genetic locus with MBD1 peaks 612 \nthrough the gene body. MDB1 binding on  BCL6 locus was examined using the dataset 613 \n#DRX021118 from the ChIP-atlas. (https://chip-atlas.org/view?id=DRX021118). 614 \n 615 \nFigure 3: Increased genomic instability at BCL6-MTC in MBD1-depleted cells  616 \n(A) TCGA dataset of  27 tumor types exhibiting the MBD1-diploid of MBD1-deletion status. 617 \nDeletion and shallow deletion samples are counted as deletion samples. Percentage of BCL6 618 \nalteration is compared in each tumor type between MBD1:diploid or MBD1:deletion status. BCL6 619 \nalteration are the samples exhibiting with BCL6:deep deletion, BCL6:shallow deletion, BCL6:gain 620 \nor BCL6:amplification. Tumor samples exhibiting BCL6:diploid status are not included as altered 621 \nBCL6 status (B) The percentage of BCL6 alterations in DLBCL samples from TCGA database was 622 \nquantified in MBD1-diploid and MBD1-deleted tumors and presented in the graph. MBD1-deleted 623 \ntumors include samples with MBD1 deep and shallow -deletions. BCL6 alterations encompass 624 \ntumor samples with BCL6 deep-deletion, shallow-deletion, gain, and amplification, while BCL6 625 \ndiploid samples were not considered altered  (C) Schematic representation of the major 626 \ntranslocation cluster of the human BCL6 gene indicating exons and introns. Primer pair G, J, M, P 627 \nlocation analyzed for ChIP-qPCR  is indicated (D) γH2AX ChIP analysis in shSCR-Raji cells and 628 \nshMBD1-Raji cells treated with 10 mM HU . qPCR analysis was performed using four primer 629 \npairs, G, J, M, and P, targeting intron 1 of the BCL6 locus. Primer pair locations are not to scale. 630 \nFor primer pair G, p = 0.1563 for shSCR-Raji (10 mM HU) vs. shMBD1 -Raji (10 mM HU); for 631 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 23 \nJ, p = 0.0006 for shSCR-Raji (10 mM HU) vs. shMBD1-Raji (10 mM HU); for M, p = 0.0259 for 632 \nshSCR-Raji (10 mM HU) vs. shMBD1 -Raji (10 mM HU); for P, p = 0.1209 for shSCR-Raji (10 633 \nmM HU) vs. shMBD1 -Raji (10 mM HU) . Unpaired t -test. Data are presented as mean ± SEM 634 \n(n=3) (E) CTCF ChIP analysis in vehicle - or HU-treated shSCR-Raji cells and HU -treated Raji 635 \ncells. For primer pair G, p = 0.0002 for shSCR-Raji (10 mM HU) vs. shMBD1-Raji (10 mM HU); 636 \nfor J, p = 0.0093 for shSCR-Raji (10 mM HU) vs. shMBD1-Raji (10 mM HU); for M, p = 0.0022 637 \nfor shSCR-Raji (10 mM HU) vs. shMBD1 -Raji (10 mM HU); for P, p <0.0001 for shSCR-Raji 638 \n(10 mM HU) vs. shMBD1-Raji (10 mM HU) Unpaired t-test. Data are presented as mean ± SEM 639 \n(n=3). 640 \n 641 \nFigure 4: BCL6 and AID inactivate MBD1 at transcriptional and genetic levels. 642 \n(A) Treatment of Raji cells with the BCL6 inhibitor, FX1 (10 μM and 50 μM), induces MBD1 643 \ntranscript levels in a dose -dependent manner. Data are presented as mean ± SEM from three 644 \nindependent experiments. Dunnett's multiple comparison test: p = 0.0223  for Raji (DMSO) vs. 645 \nRaji (FX1-50 μM) treatment groups (B) qPCR analysis of BCL6, MBD1, and IRF4 transcript levels 646 \nin shSCR-Raji and shBCL6-Raji cells. Sidak’s multiple comparison test: two-way ANNOVA, For 647 \nMBD1, p =0,8412 for shSCR-Raji vs shBCL6-Raji groups; For BCL6, p=0.0030 for shSCR-Raji 648 \nvs. shBCL6-Raji. For IRF4 group, p <0.0001 for shSCR-Raji vs. shBCL6-Raji groups (C) In silico 649 \nprediction of the BCL6 binding motif at the MBD1 promoter using JASPAR CORE 2018 650 \nVertebrates, available in the Eukaryotic Promoter Database (EPD).  The sequences of two BCL6 651 \nbinding motif located on -235 and -875 base pair upstream of MBD1 TSS are indicated. The given 652 \nsequence represents the regions deleted in the pGL4-pr-MBD1 plasmids  (D) Schematic 653 \nrepresentation of the MBD1 promoter cloned upstream of the luciferase gene in pGL4-luc2 and the 654 \nBCL6 binding motif. Location of BCL6 binding motif and deletion are shown.  HEK293T cells 655 \nwere transfected with pGL4-luc2, pGL4-luc2 + pcDNA -BCL6, pGL4-luc2-pr-MBD1, pGL4-pr-656 \nMBD1 + pcDNA-BCL6, pGL4-luc2-pr-MBD1Δ235 + pcDNA-BCL6, and pGL4-luc2-pr-657 \nMBD1Δ900 + pcDNA-BCL6 plasmids and examined for luciferase activity after 24 hours. Data 658 \nare presented as mean ± SEM from three independent experiments. Tukey’s multiple comparison 659 \ntest: p < 0.0001 for pGL4-luc2 vs. pGL4-luc2-pr-MBD1; p < 0.0001 for pGL4-luc2-pr-MBD1 vs. 660 \npGL4-luc2-pr-MBD1 + pcDNA-BCL6 groups; p < 0.0001  for pGL4-luc2-pr-MBD1 vs. pGL4-661 \nluc2-pr-MBD1Δ235 + pcDNA-BCL6; p = 0. 0416 for pGL4-luc2-pr-MBD1 vs. pGL4-luc2-pr-662 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 24 \nMBD1Δ900 + pcDNA-BCL6 (E) BCL6 binds to MBD1 locus in SUDHL4, OCI -LY1 (DLBCL), 663 \nB-ALL and HepG2 cells  cells. The data are analyzed from ChIP -atlas database. Datasets : 664 \nSUDHL4:SRX4609168; OCI-LY1:SRX689470, B-ALL:SRX18259603, HepG2:2636278 665 \n(https://chip-atlas.dbcls.jp/data/hg38/target/BCL6.10.html) (F) The COSMIC mutation landscape 666 \nof the MBD1 gene, showing the frequencies of A>C, A>G, A>T, C>A, C>T, C>G, G>A, G>C, 667 \nG>T, T>A, T>C, and T>G mutations. 668 \n 669 \nFigure 5: Reduced tumorigenicity of MBD1 depleted Raji cells in mouse xenograft model- 670 \n(A) Cell viability of shSCR-Raji and shMBD1 -Raji cells treated with DMSO, HU (10 mM), 671 \nGemcitabine (20 mM), and Etoposide (50 μM) for 24 hours. Sidak’s multiple comparison test: p 672 \n< 0.001 for shSCR-Raji (HU) vs. shMBD1-Raji (HU); p < 0.0001 for shSCR-Raji (Gemcitabine) 673 \nvs. shMBD1 -Raji (Gemcitabine); p = 0.0005 for shSCR -Raji (Etoposide) vs. shMBD1 -Raji 674 \n(Etoposide) (B) Tumor xenografts were established by subcutaneously injecting 1 million shSCR-675 \nRaji or shMBD1-Raji cells mixed with 200 μl of Matrigel above the right front limb of nude mice 676 \nto reach the subcutaneous pocket. Mice were monitored for tumor growth over a period of 55 days. 677 \nThe sample size consisted of n=4 for the shSCR -Raji group  (Upper panel)  and n=5 for the 678 \nshMBD1-Raji group (lower panel) (C) Tumor xenografts from shSCR -Raji and shMBD1 -Raji 679 \ncells injected into nude mice (n=4 for shSCR-Raji; n=5 for shMBD1-Raji)  (D) Violin plot showing 680 \nthe weight range of tumors in shSCR-Raji and shMBD1-Raji groups. Unpaired t-test: p = 0.0086. 681 \n 682 \nSupplementary Figure 1  (A)  Quantitative PCR (qPCR) analysis of MBD1 mRNA levels in 683 \nshSCR-Raji and shMBD1-Raji cells treated with DMSO, hydroxyurea (HU, 10 mM), gemcitabine 684 \n(20 mM), and etoposide (50 μM) for 24 hours. Data are presented as mean ± SEM, n = 3. Tukey’s 685 \nmultiple comparison test results: p < 0.0001 for shSCR-Raji (DMSO) vs. shMBD1-Raji (DMSO) 686 \ngroups, p < 0.0001 for shSCR-Raji (DMSO) vs. shSCR-Raji (gemcitabine) groups, p < 0.0001 for 687 \nshSCR-Raji (DMSO) vs. shSCR-Raji (etoposide) groups, p = 0.8068 for shMBD1 -Raji (DMSO) 688 \nvs. shMBD1 -Raji (HU) groups, p=0.0398 for shMBD1 -Raji (DMSO) vs. shMBD1 -Raji 689 \n(gemcitabine) groups, and p < 0.0010 for shMBD1-Raji (DMSO) vs. shMBD1 -Raji (etoposide) 690 \ngroups. Western blot image of MBD1 using cell lysates from shSCR-Raji and shMBD1-Raji cells  691 \n(B) qPCR analysis of MBD1 mRNA in shSCR -SUM149PT and shMBD1 -SUM149PT cells 692 \ntreated with or without HU (10 mM) for 24 hours. Tukey’s multiple comparison test: p < 0.001 693 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 25 \nfor shSCR -SUM149PT ( -HU) vs. shSCR -SUM149PT (+10 mM HU) cells  (C) MBD1 mRNA 694 \nexpression profile among the TCGA tumor samples. Mean MBD1 mRNA RSEM (log2+1) value 695 \nwas 850.3 in MBD1-shallow deletion (n=3208) , 646 in MBD1-deletions (n=56),  1171 in MBD1-696 \ndiploid (n=5789), 1465 in MBD1-gain (n=819),  1979 in MBD1-amplification  (n=17) groups 697 \nrespectively. p< 0.0001 for MBD1-diploid vs MBD1-amplification,  p< 0.0001 for MBD1-diploid 698 \nvs MBD1 Deep-deletion, p< 0.0001  for MBD1-diploid vs MBD1-gain, p< 0.0001 for MBD1-699 \ndiploid vs MBD1-shallow deletion. Dunnett’s multiple comparison  test, One way ANOVA.  (D) 700 \nBCL6 mRNA expression profile among the TCGA tumor samples. Mean BCL6 mRNA value 701 \n(RSEM:log2+1) was 2006 for BCL6-amplification (n=488), 726.3 for BCL6-deep deletions 702 \n(n=21), 1198  for BCL6-diploid (n=5950), 1417 for BCL6-gain (n=2587) and 949.6 for BCL6-703 \nshallow deletion (n=864)  group. p< 0.0001 for BCL6-diploid vs BCL6-amplification, p= 0.08 for 704 \nBCL6-diploid vs BCL6 Deep-deletion,  p< 0.0001 for BCL6-diploid vs BCL6-gain,  p< 0.0001 for 705 \nBCL6-diploid vs BCL6- shallow deletion. Dunnett’s multiple comparison  test, One way ANOVA.   706 \n 707 \nSupplementary Figure 2 - MBD1 expression is associated with DNA  methylation and Bcl6 708 \nstatus in mouse GC B cells (A) CpG methylation status of activated mouse GC B cell in wild 709 \ntype and Sca1-Bcl6Δ mice were analyzed from published study [25, 43]. The CpG methylation 710 \nsignal on position 4’4’ of wild type Mbd1 locus are lost in Sca1-Bcl6Δ (B) AZA treatment of OCI-711 \nLY1, SUDHL2 and OCI-LY19 induced MBD1 mRNA expression (GSE190319). Y-axis indicated 712 \nvalues of MBD1 mRNA in counts of Transcription per million. 713 \n 714 \nSupplementary Figure 3  (A) Correlation of MBD1 and IRF4 expression in DLBCL tumors 715 \navailable at TCGA database. DLBCL tumors exhibiting BACH2-diploid and IRF4-diploid status 716 \nwere sorted and catergorised into  MBD1-diploid (n=23), MBD1-gain (n=12) and MBD1-shallow 717 \ndeletion  (n=1) groups. The Y -axis displays normalized values of IRF4 mRNA (RSEM counts) 718 \nwith the MBD1 mRNA (RSEM counts). p=0.0051 for MBD1-diploid vs MBD1-gain tumors. Mann 719 \nWhiteny t-test. (B) Correlation of MBD1 and IRF4 co-expression in DLBCL samples obtained 720 \nfrom GEPIA. R=0.7, p=3.8e -08. (C) Mbd1 expression is induced in activated mouse germinal 721 \ncenter B cells at the stage of plasma cell differentiation (96 h ours) compared to unstimulated (0 722 \nhours) and germinal center B cells undergoing peak class switch recombination (CSR) and somatic 723 \nhypermutation (SHM). (D) qPCR analysis of IRF4, and PRDM1 in shSCR-Raji and shMBD1-Raji 724 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 26 \ncells. Data are presented as mean ± SEM, n = 3.  Unpaired t-test. For IRF4, p <0.0001 between 725 \nshSCR-Raji vs. shMBD1-Raji, for PRDM1 p =0.0018 between shSCR-Raji vs. shMBD1-Raji cells  726 \n(E) Raji cells were transfected with either the control pcDNA vector or the pcDNA-MBD1 plasmid 727 \nfor 24 hours, followed by quantification of IRF4 mRNA levels using qRT-PCR. Unpaired t-test. p 728 \n<0.0001 for pcDNA (1 μg) vs. pcDNA-MBD1 (1 μg); p = 0. 3360 for pcDNA-MBD1 (1 μg) vs. 729 \npcDNA-MBD1 (5 μg). Data are presented as mean ± SEM, n=3 (F)  qPCR analysis of GC marker 730 \ngenes in shSCR-Raji and shMBD1-Raji cells. MBD1; p <0.0001 for shSCR-Raji vs shMBD1-Raji 731 \ncells.  CCR7; p <0.0001 for shSCR-Raji vs shMBD1-Raji cells. P2RY8; p =0.0030 for shSCR-Raji 732 \nvs shMBD1-Raji cells. S1PR2; p =0.7833 for shSCR-Raji vs shMBD1-Raji cells. RAC1; p <0.0001 733 \nfor shSCR-Raji vs shMBD1-Raji cells. RHOA; p =0.5067 for shSCR-Raji vs shMBD1-Raji cells. 734 \nFBXO11; p >0.9999 for shSCR-Raji vs shMBD1-Raji cells. XBP1; p =0.6600 for shSCR-Raji vs 735 \nshMBD1-Raji cells.  IRF7; p =0.0724 for shSCR-Raji vs shMBD1-Raji cells. IFNGR1; p =0.3715 736 \nfor shSCR-Raji vs shMBD1-Raji cells. STAT1; p =0.0017 for shSCR-Raji vs shMBD1-Raji cells. 737 \nSidak's multiple comparisons test. Data are presented as mean ± SEM, n=3.  738 \n 739 \n 740 \nReferences: 741 \n1. Allen, C.D., et al., Germinal center dark and light zone organization is mediated by 742 \nCXCR4 and CXCR5. Nat Immunol, 2004. 5(9): p. 943-52. 743 \n2. Victora, G.D. and M.C. Nussenzweig, Germinal Centers. Annu Rev Immunol, 2022. 40: 744 \np. 413-442. 745 \n3. Muramatsu, M., et al., Class switch recombination and hypermutation require activation-746 \ninduced cytidine deaminase (AID), a potential RNA editing enzyme. Cell, 2000. 102(5): p. 747 \n553-63. 748 \n4. Roco, J.A., et al., Class-Switch Recombination Occurs Infrequently in Germinal Centers. 749 \nImmunity, 2019. 51(2): p. 337-350.e7. 750 \n5. Lu, Z., et al., BCL6 breaks occur at different AID sequence motifs in Ig-BCL6 and non-751 \nIg-BCL6 rearrangements. Blood, 2013. 121(22): p. 4551-4. 752 \n6. Gothwal, S.K., et al., BRD2 promotes antibody class switch recombination by facilitating 753 \nDNA repair in collaboration with NIPBL. Nucleic Acids Res, 2024. 754 \n7. Shaffer, A.L., et al., IRF4 addiction in multiple myeloma. Nature, 2008. 454(7201): p. 755 \n226-31. 756 \n8. Kaiser, L.M., et al., CXCR4 in Waldenström’s Macroglobulinema: chances and 757 \nchallenges. Leukemia, 2021. 35(2): p. 333-345. 758 \n9. Kurtova, A.V., et al., Mantle cell lymphoma cells express high levels of CXCR4, CXCR5, 759 \nand VLA-4 (CD49d): importance for interactions with the stromal microenvironment and 760 \nspecific targeting. Blood, 2009. 113(19): p. 4604-13. 761 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 27 \n10. Bal, E., et al., Super-enhancer hypermutation alters oncogene expression in B cell 762 \nlymphoma. Nature, 2022. 607(7920): p. 808-815. 763 \n11. Calpe, E., et al., ZAP-70 promotes the infiltration of malignant B-lymphocytes into the 764 \nbone marrow by enhancing signaling and migration after CXCR4 stimulation. PLoS One, 765 \n2013. 8(12): p. e81221. 766 \n12. Dhordain, P., et al., The LAZ3(BCL-6) oncoprotein recruits a SMRT/mSIN3A/histone 767 \ndeacetylase containing complex to mediate transcriptional repression. Nucleic Acids 768 \nRes, 1998. 26(20): p. 4645-51. 769 \n13. Chang, C.C., et al., BCL-6, a POZ/zinc-finger protein, is a sequence-specific 770 \ntranscriptional repressor. Proc Natl Acad Sci U S A, 1996. 93(14): p. 6947-52. 771 \n14. Phan, R.T., et al., BCL6 interacts with the transcription factor Miz-1 to suppress the 772 \ncyclin-dependent kinase inhibitor p21 and cell cycle arrest in germinal center B cells. 773 \nNat Immunol, 2005. 6(10): p. 1054-60. 774 \n15. Akkaya, M., K. Kwak, and S.K. Pierce, B cell memory: building two walls of protection 775 \nagainst pathogens. Nature Reviews Immunology, 2020. 20(4): p. 229-238. 776 \n16. Ye, B.H., et al., Alterations of a zinc finger-encoding gene, BCL-6, in diffuse large-cell 777 \nlymphoma. Science, 1993. 262(5134): p. 747-50. 778 \n17. Ci, W., J.M. Polo, and A. Melnick, B-cell lymphoma 6 and the molecular pathogenesis of 779 \ndiffuse large B-cell lymphoma. Curr Opin Hematol, 2008. 15(4): p. 381-90. 780 \n18. Ruggieri, S., et al., Translocation of the proto-oncogene Bcl-6 in human glioblastoma 781 \nmultiforme. Cancer Letters, 2014. 353(1): p. 41-51. 782 \n19. Duy, C., et al., BCL6 enables Ph+ acute lymphoblastic leukaemia cells to survive BCR-783 \nABL1 kinase inhibition. Nature, 2011. 473(7347): p. 384-8. 784 \n20. Walker, S.R., et al., The transcriptional modulator BCL6 as a molecular target for breast 785 \ncancer therapy. Oncogene, 2015. 34(9): p. 1073-82. 786 \n21. Xu, L., et al., BCL6 promotes glioma and serves as a therapeutic target. Proc Natl Acad 787 \nSci U S A, 2017. 114(15): p. 3981-3986. 788 \n22. Shaknovich, R., et al., DNA methyltransferase 1 and DNA methylation patterning 789 \ncontribute to germinal center B-cell differentiation. Blood, 2011. 118(13): p. 3559-69. 790 \n23. Béguelin, W., et al., EZH2 is required for germinal center formation and somatic EZH2 791 \nmutations promote lymphoid transformation. Cancer Cell, 2013. 23(5): p. 677-92. 792 \n24. Villa, R., et al., The methyl-CpG binding protein MBD1 is required for PML-RARalpha 793 \nfunction. Proc Natl Acad Sci U S A, 2006. 103(5): p. 1400-5. 794 \n25. Caron, G., et al., Cell-Cycle-Dependent Reconfiguration of the DNA Methylome during 795 \nTerminal Differentiation of Human B Cells into Plasma Cells. Cell Reports, 2015. 13(5): 796 \np. 1059-1071. 797 \n26. Lai, A.Y., et al., DNA methylation prevents CTCF-mediated silencing of the oncogene 798 \nBCL6 in B cell lymphomas. Journal of Experimental Medicine, 2010. 207(9): p. 1939-799 \n1950. 800 \n27. Bell, A.C. and G. Felsenfeld, Methylation of a CTCF-dependent boundary controls 801 \nimprinted expression of the Igf2 gene. Nature, 2000. 405(6785): p. 482-5. 802 \n28. Hark, A.T., et al., CTCF mediates methylation-sensitive enhancer-blocking activity at the 803 \nH19/Igf2 locus. Nature, 2000. 405(6785): p. 486-9. 804 \n29. Kosak, S.T., et al., Subnuclear compartmentalization of immunoglobulin loci during 805 \nlymphocyte development. Science, 2002. 296(5565): p. 158-62. 806 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\n 28 \n30. Jhunjhunwala, S., et al., The 3D structure of the immunoglobulin heavy-chain locus: 807 \nimplications for long-range genomic interactions. Cell, 2008. 133(2): p. 265-79. 808 \n31. Gothwal, S.K. and J.H. Barlow, Stress Induced Signaling Pathways in Burkitt Lymphoma 809 \nPlay Novel Mechanisms in Fate Determination and Pathogenesis of Germinal Center-810 \nDerived B-Lymphomas. bioRxiv, 2024: p. 2024.12.19.628635. 811 \n32. Holmes, A.B., et al., Single-cell analysis of germinal-center B cells informs on lymphoma 812 \ncell of origin and outcome. Journal of Experimental Medicine, 2020. 217(10). 813 \n33. Fujita, N., et al., Methyl-CpG binding domain 1 (MBD1) interacts with the Suv39h1-HP1 814 \nheterochromatic complex for DNA methylation-based transcriptional repression. J Biol 815 \nChem, 2003. 278(26): p. 24132-8. 816 \n34. Clouaire, T., et al., Recruitment of MBD1 to target genes requires sequence-specific 817 \ninteraction of the MBD domain with methylated DNA. Nucleic Acids Res, 2010. 38(14): 818 \np. 4620-34. 819 \n35. Ci, W., et al., The BCL6 transcriptional program features repression of multiple 820 \noncogenes in primary B cells and is deregulated in DLBCL. Blood, 2009. 113(22): p. 821 \n5536-48. 822 \n36. Cardenas, M.G., et al., Rationally designed BCL6 inhibitors target activated B cell diffuse 823 \nlarge B cell lymphoma. J Clin Invest, 2016. 126(9): p. 3351-62. 824 \n37. Saito, M., et al., A signaling pathway mediating downregulation of BCL6 in germinal 825 \ncenter B cells is blocked by BCL6 gene alterations in B cell lymphoma. Cancer Cell, 826 \n2007. 12(3): p. 280-92. 827 \n38. Green, M.R., et al., Transient expression of Bcl6 is sufficient for oncogenic function and 828 \ninduction of mature B-cell lymphoma. Nature Communications, 2014. 5(1): p. 3904. 829 \n39. Oprea, M. and A.S. Perelson, Somatic mutation leads to efficient affinity maturation 830 \nwhen centrocytes recycle back to centroblasts. J Immunol, 1997. 158(11): p. 5155-62. 831 \n40. Ochiai, K., et al., Accelerated plasma-cell differentiation in <i>Bach2</i>-deficient 832 \nmouse B cells is caused by altered IRF4 functions. The EMBO Journal, 2024. 43(10): p. 833 \n1947-1964-1964. 834 \n41. Margiotta, A. and C. Bucci, Coordination between Rac1 and Rab Proteins: Functional 835 \nImplications in Health and Disease. Cells, 2019. 8(5). 836 \n42. Green, J.A. and J.G. Cyster, S1PR2 links germinal center confinement and growth 837 \nregulation. Immunol Rev, 2012. 247(1): p. 36-51. 838 \n43. Kulis, M., et al., Whole-genome fingerprint of the DNA methylome during human B cell 839 \ndifferentiation. Nat Genet, 2015. 47(7): p. 746-56. 840 \n44. Amanda, S., et al., IRF4 drives clonal evolution and lineage choice in a zebrafish model 841 \nof T-cell lymphoma. Nat Commun, 2022. 13(1): p. 2420. 842 \n45. Fujita, N., et al., Mechanism of transcriptional regulation by methyl-CpG binding protein 843 \nMBD1. Mol Cell Biol, 2000. 20(14): p. 5107-18. 844 \n46. Huang, C., et al., Cooperative transcriptional repression by BCL6 and BACH2 in 845 \ngerminal center B-cell differentiation. Blood, 2014. 123(7): p. 1012-20. 846 \n47. Kuo, T.C., et al., Repression of BCL-6 is required for the formation of human memory B 847 \ncells in vitro. J Exp Med, 2007. 204(4): p. 819-30. 848 \n48. Lin, K.I., C. Tunyaplin, and K. Calame, Transcriptional regulatory cascades controlling 849 \nplasma cell differentiation. Immunol Rev, 2003. 194: p. 19-28. 850 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\nFigure- 1 Identification of MBD1 as a novel regulator of GC reaction\n-1.500\n-1.000\n-0.500\n0.000\n0.500\n1.000\n1.500\nDZ a\nDZ b\nDZ c\nINT a\nINT b\nINT c\nINT d\nINT e\nLZ a\nLZ b\nPre M\nPlasmablast a\nPlasmablast b\nMBD1-FC BCL6-FC\nA \nC\nB \nE F \nMBD1: Diploid\nMBD1: Gain\n0\n2\n4\n6\n8\nBCL6 mRNA normalized \nwith MBD1 mRNA  \nFig 1 E ( all bcl6 diploids)\n \nD \n5 kb\nRaji-Control\nRaji- HU\nMBD1\nRefseq\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\nA \nC \nE \nD \nFigure- 2 MBD1 suppreses  BCL6 transcription under DNA-replication stress\nB \nHCT116\nRefseq\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\nB \nA \nMTC \nC\nExon 1\nBCL6\nNP_001697.2NM_001706.5\nGenes, MANE Project (release v1.3)\nLOC100131635\nBCL6\nXP_011511364.1XM_011513062.4\nXP_047304611.1XM_047448655.1\nXP_005247751.1XM_005247694.5\nNP_001128210.1NM_001134738.1\nNP_001697.2NM_001706.5\nNP_001124317.1NM_001130845.2\nLOC122526776\nNR_173091.1\nNCBI RefSeq Annotation GCF_000001405.40-RS_2023_10\nenhancerenhancer enhancer\nenhancer silencer\nBiological regions, aggregate, NCBI RefSeq Annotation GCF_000001405.40-RS_2023_10\nENSG00000228804\nENST00000449623.5ENST00000437407.1\nENSG00000113916 [+18]\nENSG00000285938\nENST00000648485.1ENSP00000498467.1\nENSG00000290021\nENST00000702512.1\nENSG00000289331\nENST00000691617.2\nGenes, Ensembl release 110\nrs587778090GC/AT\nrs1474326C/A/T\nrs1523475T/A/C/G\nrs3774309A/C/G/T\nrs2229362C/A/T\nrs137878288G/A/T\nrs541016998G/A\nrs150656653T/C\nrs1056932G/A/C\nrs377059215G/A\nrs587778091T/C\nrs61752081C/A/Grs200263685G/A\nrs1880099C/A/G/T\nrs3774304C/A/G/T\nrs3733018A/C/G\nrs3733017T/A/G\nrs3774303C/A/G/T\nrs3172469T/C/G\nrs1523474T/A/C\nrs80031434C/A/G/T\nrs16862537T/C\nrs17797517T/C\nCited Variations, dbSNP b156 v2\nLive RefSNPs, dbSNP b156 v2\n133668AT 729093C\n2607821A\n2260739T\n734312A\n2458095T\n133676T\n2481684T\n133675A\n133674A\n781975G\n2540535A\n2521673A\n2245665C\n2596525T\n2228659A\n2355053T\n729094T\n2461434A\n133670C\n2606843T\n2335230A\n133672A\n133671C\n2375099A\n2612944T\n2559906G\n717149A\n2462878T\n133673A\n2519975A\n2515439G\n2463647T\n2294551C\n725713A\n787262T\n133669A\n2237756A\nClinVar variants with precise endpoints\n22201\n256\n22201\n256\n22201\n256\n22201\n256\nRNA-seq exon coverage, aggregate (filtered), NCBI Homo sapiens Annotation Release 110 - log 2 scaled\n13177\n256\n13177\n256\n13177\n256\n13177\n256\nRNA-seq intron-spanning reads, aggregate (filtered), NCBI Homo sapiens Annotation Release 110 - log 2 scaled\n5517\n52\n1156\n651\n11375102778074\n9139\n2627\n11120\nRNA-seq intron features, aggregate (filtered), NCBI Homo sapiens Annotation Release 110 Exon 10ATG\nD E\nG            J         M      P\nFigure 3- Increased genomic instablity at BCL6-MTC in MBD1-depleted Raji cells\nLAML\nACC\nBLCA\nBRCA\nCESC\nCHOL\nCOAD\nESCA\nGBM\nHNSC\nKICH\nKIRC\nKIRP\nLIHC\nLUAD\nLUSC\nDLBC\nPAAD\nPCPG\nPRAD\nREAD\nSKCM\nSTAD\nTHYM\nUCS\nUCEC\nUVM\n0\n50\n100\n150BCL6 alteration  (%)\nFig 4 A BCL6 alteration in all tumors\nMBD1: Diploid\nMBD1: Deletion\nLAML\nACC\nBLCA\nBRCA\nCESC\nCHOL\nCOAD\nESCA\nGBM\nHNSC\nKICH\nKIRC\nKIRP\nLIHC\nLUAD\nLUSC\nDLBC\nPAAD\nPCPG\nPRAD\nREAD\nSKCM\nSTAD\nTHYM\nUCS\nUCEC\nUVM\n0\n50\n100\n150BCL6 alteration  (%)\nFig 4 A BCL6 alteration in all tumors\nMBD1: Diploid\nMBD1: Deletion\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\nFigure 4- BCL6 suppreses MBD1 transcription in multiple B-lymphomas\nC \nF \nB \nD \nSUDHL4\nOCI-LY1\nRefseq\nB-ALL\nHepG2\nE \nDeleted sequence flanking to BCL6 binding on -875 bp\nupstream of MBD1 TSS (-906 to -821 deleted)\n5’CTCCTCTCCCTGGGTTTTGTT AA T AAAA TTTTGAAG\nAAACCAAGGAAGCTGTCTCCACATTGCTGCGGTTGC\nAACTGTTCCAGAC\nDeleted sequence flanking to BCL6 binding on -235 bp\nupstream of MBD1 TSS (-299 to -225 bp deleted)\n5”GAGGCTGGAAAGCGCATGCGCCAGCTAGATGGGC\nAGCGAGGAGAGCCGCAACTGCCAGTCCCTCGAAGGG\nGTTA \nSUDHL4\nOCI-LY1\nRefseq\nB-ALL\nHepG2\nA \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\nFigure 5  Increased Sensitivity to DNA-Replication Inhibitors and Reduced Tumorigenicity \nof MBD1-Depleted Cells\nA \nC D \nB\nshSCR-Raji\nshMBD1-Raji-0.5\n0.0\n0.5\n1.0\n1.5\nTumor weight (g)\n  \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\nA\nSupplementary Figure 1- MBD1 expression is induced by DNA replication stress\nC D\nshSCR-Raji   shMBD1-Raji\nMBD1\nβ-actin\nB\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\nSupplementary Figure 2- Association among MBD1 expression, DNA methylation \n and DNA replication stress \nA B\n0\n5\n10\n15\n20\n25\n30\n35\nOCI-LY1 SUDHL2 OCI-LY19\nPBS AZA\nTranscripts per million\nNormalized\nLost peak\nSca1-Bcl6Δ\nWild type\nRefseq\nSca1-Bcl6Δ\nWild type\nRefseq\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint \n\nSupplementary Figure 3- MBD1 expression in B-lymphomas and mouse GC B cells\nB\n0h 60h 96hSyn+\n0 10 20 30 40 50\nMbd1\nC\nMbd1 FPKM values\nTime in hours after BCR stimulation \n(primary Mouse B cells)\nunstimulated\nCSR\nSHM\nPlasma \nA\nD\nF\nE\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted March 15, 2025. ; https://doi.org/10.1101/2025.03.13.643172doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}