{"paper_id":"09e16ec9-690d-4d9a-897d-50d9590650f8","body_text":"Bacterial community in sardines condemned for histamine contamination: a case study in the canned fish industry | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Bacterial community in sardines condemned for histamine contamination: a case study in the canned fish industry Luca Frondana, Daniel da Rosa Farias, Delano Dias Schleder This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3195309/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract In some fish species, such as tuna, mackerel, and sardines, improper handling after fishing promotes the growth of histamine-forming bacteria. If consumed, histamine-contaminated fish can cause various symptoms, including vomiting, diarrhea, erythema, urticaria, and even anaphylaxis in severe cases. Understanding the main bacteria responsible for histamine production is crucial for public health. This study utilized next-generation sequencing to analyze the bacterial community in histamine-contaminated sardines. For this study, 1000 g of muscle samples were collected from 40–45 sardines per batch, all obtained from the same supplier, fishing area, and time period, for histamine analysis. Samples from five different batches with ≥ 200 ppm of histamine (contaminated) and five with < 1 ppm (non-contaminated) underwent microbial analysis. Histamine-contaminated sardines exhibited lower microbial diversity and a higher abundance of the genera Photobacteria and Shewanellae . These bacteria thrive under mild temperatures and indicate fish spoilage and the production of biogenic amines. In contrast, Psychobacter and Pseudoalteromonas , known to withstand harsh conditions, including low temperatures, were more prevalent in non-contaminated sardines. Our findings suggest that contaminated sardines experienced inadequate refrigeration during transportation and processing, indicating the potential use of Psychobacter and Pseudoalteromonas as quality indicators for fish. Histamine Canned Fish Scombrotoxin Fish Poisoing Fishing Industry Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction World fish production reached 214 million tons in 2020, of which 90 million came from marine fisheries (FAO, 2022). Fish from the Clupeidae family, such as Sardina , Sardinops , and Sardinella , are cosmopolitan and contribute significantly to the world's extractive fisheries. Brazilian fish production is around 1.5 million tons per year, with marine extractive fishing as the primary source (MAPA, 2011). Marine fish are highly susceptible to microbial spoilage due to their high water content, oxidizable fats, and a pH close to neutral (pH 6.6–6.8). Inadequate handling and storage conditions promote the growth of bacteria that produce the enzyme histidine decarboxylase, which catalyzes the formation of histamine when it interacts with the histidine present in the fish musculature (Oliveira et al., 2004). Histamine, a primary and heterocyclic biogenic diamine, is an important compound found in fish like tuna, mackerel, bonito, and sardines (Rossano et al., 2006 ). Despite undergoing commercial sterilization, histamine remains present in these fish without altering their sensory characteristics. Proper handling and storage practices are crucial to prevent histamine formation and ensure consumer safety. Histamine levels in foods must not exceed 200ppm to prevent scombroid poisoning, a condition caused by ingesting this substance in high concentrations. Symptoms such as abdominal pain, vomiting, diarrhea, headache, erythema, urticaria, and hypotension may arise, resembling an allergic reaction. In severe cases, it can even lead to anaphylactic shock (FDA, 2020). Histamine formation is unlikely to occur if the fish is processed under satisfactory hygienic-sanitary conditions. The formation of this biogenic amine in fish-derived products is due to contamination by bacteria and exposure to inappropriate temperatures. To minimize the risk of excessive histamine formation, it is recommended to freeze fish at -15°C. This temperature helps inactivate the majority of bacteria that produce the enzyme histidine decarboxylase (FDA, 2020). The bacteria commonly associated with histidine decarboxylation include Morganella morganii , Klebsiella pneumoniae , Hafnia alvei , Citrobacter freundii , Enterobacter aerogenes , Vibrio alginolyticus , Proteus spp ., and Photobacterium spp . (Jay et al., 2005; Takahashi, 2015). Histamine poses a significant challenge for the sardine canning industry. While histamine detection techniques are reliable, the main bacteria responsible for histamine formation in sardines remain unclear. This study utilized Next Generation Sequencing (NGS) to identify the predominant bacterial populations in sardine samples with high histamine content and histamine-free fish samples. The characterization of the microbiota can greatly benefit the sardine production chain by reducing raw material wastage and minimizing health risks. 2. Material and Method 2.1 Sample Collection and Histamine Detection: Biological samples of previously eviscerated Sardinella pilchardus were obtained from a supplier in Morocco and collected at the Gomes da Costa (GDC) fish canning plant in Itajaí, Santa Catarina, Brazil. The samples were transported in a refrigerated container at -21°C, following the RIISPOA (MAPA, 2020) standards. Histamine analysis was performed using the Biofish® enzymatic method, confirming the presence of histamine in the collected samples. A reanalysis was conducted on samples from all pallets in the container, revealing varying histamine levels below 1 ppm and 200 ppm or higher. To ensure reliability, the entire batch was reserved for further experimentation, and the sample collection procedure was repeated. 2.2 Sampling for Sequencing and Confirmatory Histamine Analysis: Muscle samples weighing approximately 1000 g (± 10 g) were obtained from pallets containing sardines with histamine levels of 200 ppm or higher. Additionally, samples were collected from histamine-free pallets with histamine levels below 1 ppm. All sample collection was performed within a refrigeration chamber at -18°C. The muscle samples were placed in sterile RNase and DNase-free sample bags (3M® sample bag) and transported in a temperature-controlled container to the GDC laboratory, where they were stored at -18°C. Histamine analysis was conducted on a portion of the samples using the Biofish® enzymatic method. Ten 1 g samples were then collected from each group for further analysis. These samples were stored frozen in RNase and DNase-free microtubes, packed with dry ice, and sent to Neoprospecta for total DNA extraction, amplification of the 16S rRNA gene, and sequencing. 2.3 DNA Extraction and Next Generation Sequencing: Total DNA extraction was performed using the phenol/chloroform method according to the Neoprospecta laboratory's standard protocol. The DNA concentration of each sample was estimated using Picogreen dsDNA (Invitrogen, Carlsbad, California, USA). For microbial population identification, the DNA library bank was adjusted to a final concentration of 11 pM, and PCR amplification of the V3-V4 region of the 16S rRNA gene was conducted using primers 341F (5' CCTACGGGRSGCAGCAG 3') and 805R (5' GGACTACCAGGGTATCTAAT 3'). Sequencing of the libraries was performed on the Illumina MiSeq platform, employing a 2 x 300 nt paired-end configuration with a volume of 100 K per sample. Operational Taxonomic Units (OTUs) were generated from the sequences using USEARCH (version 11.0.667) at 97% similarity with the UPARSE algorithm. Taxonomic attribution was determined using the SILVA database (version 138) with 91% identity. Richness and diversity indices were calculated using the vegan R package, and Good's Coverage was determined using the QsRutils R package. 2.4 Statistical analysis Microbiome data were analyzed using R software (version 3.5.1). Due to differences in sequencing depth between samples (up to 9.3x), count data (readings) were normalized using the Bioconductor DESeq2 package. Normalized DESeq2 counts were used to determine beta diversity, NMDS, PERMANOVA, alpha diversity indices and relative abundance (Love et al., 2014 ). Student's t test was used to identify differences in alpha diversity indices between each treatment in the R environment. Multivariate analysis was performed based on Bray-Curtis dissimilarity matrices, using the “vegan” package (Oksanen et al., 2019 ). Generalized univariate linear models (GLMs, package “mvabund”) were used to identify OTUs (Wang et al., 2022 ). Figures were generated using the “ggplot2” package (Wickham, 2016 ). The significance level adopted was 5.0% for all tests. 3. Results After processing and filtering the Next-generation sequencing (NGS) data, the sequences were grouped into 18 operational taxonomic units (OTUs). Based on the alpha-diversity analysis (Fig. 1), the richness indices (Richness and Chao1) exhibited opposite behavior compared to the diversity indices (Shannon and Inverse Simpson). Histamine-contaminated samples had higher microbial richness, whereas histamine-free samples showed higher diversity. The beta-diversity analysis (NMDS and PCoA) based on Bray-Curtis dissimilarity matrices indicated significant differences (p < 0.05) among the samples, suggesting that histamine-contaminated sardine muscle samples exhibited different bacterial compositions (Fig. 2). The most abundant bacterial families in both treatment groups were Vibrionaceae and Moraxellaceae (Fig. 3). Histamine-contaminated samples exhibited a predominance of the Vibrionaceae family, while Moraxellaceae was the most abundant in histamine-free samples. Other identified families included Arcobacteraceae , Planococcaceae, Fusobacteriaceae, Pseudoalteromonadaceae , and Shewanellaceae . The 18 OTUs identified in the sardine muscle samples belonged to ten different bacterial genera. Among them, seven comprised more than 95% of the bacterial community, as shown in Fig. 4. In the histamine group, the most abundant genera were Aliivibrio , Cetobacterium , Photobacterium , Psychrobacter , Shewanella, and Vibrio . The no-histamine group showed a predominance of Photobacterium , Pseudoalteromona s, Psychrobacter , and Vibrio . In both groups, the most abundant genera were Photobacterium and Psychrobacter . However, their abundance showed opposite patterns, with Photobacterium being more abundant in the histamine group and Psychrobacte r more abundant in the no-histamine group. Statistical analysis revealed that histamine-contaminated samples showed a higher relative abundance of the genera Photobacterium (2 and 17 OTUs) and Shewanella (4, 9, and 12 OTUs). Meanwhile, the genera Psychrobacter (1, 3, 8, 16, and 18 OTUs), Pseudoalteromonas (OTU 5), and Vibrio (OTU 11) were more abundant in samples without histamine. Regarding the genera Aliivibrio and Cetobacterium , they were more abundant in histamine-contaminated samples; however, the difference was not statistically significant (Table 1 , Fig. 4, and S1). Table 1 Mean relative abundance (%) of the statistically different OTUs between samples showing (A) histamine concentration > 200ppm (histamine) and < 1ppm (no-histamine). Data presented in mean ± standard deviation. OTUs histamine no-histamine OTU 2_ Photobacterium 52.00 ± 21.97 21.00 ± 13.87 OTU 3_ Psychrobacter 3.50 ± 2,50 11.70 ± 5.02 OTU 4_ Shewanella 4.82 ± 9.02 0.05 ± 0.05 OTU 5_ Pseudoalteromas 2.68 ± 1.30 7.95 ± 4.68 OTU 11_ Vibrio 1.67 ± 0.84 3.61 ± 1.71 OTU 16_ Psychrobacter 1.17 ± 1.36 4.33 ± 2.19 OTU 18_ Psychrobacter 0.31 ± 0.36 1.56 ± 1.23 4. Discussion Samples contaminated with histamine (> 200 ppm) exhibited higher bacterial richness but lower diversity, indicating a greater number of bacterial species. However, there was a predominance of certain bacteria in terms of abundance, particularly Photobacterium spp . and Shewanella spp. These two genera are known as the main decomposers of saltwater fish (Leisner et al., 2004). Therefore, these results suggest that batches with high levels of histamine were exposed to conditions that favored the proliferation of decomposing bacteria. Photobacterium strains produce secondary metabolites that inhibit the growth of other bacteria, indicating that the high dominance of Photobacterium spp. in histamine-contaminated samples and the subsequent lower microbial diversity could be attributed to their ability to suppress the growth of other bacterial strains involved in fish decomposition (Oku, 2008). On the other hand, samples from the no-histamine group (< 1 ppm) exhibited the opposite pattern, with higher bacterial diversity but lower bacterial richness. This distinct bacterial composition was further confirmed by beta diversity indices, which indicated significant dissimilarities between the two bacterial communities. Regarding the bacterial families, Moraxelaceae and Vibrionaceae were more abundant in the samples without and with histamine, respectively. Bacteria belonging to the Moraxelaceae family ( Proteobacteria phylum ) are commonly isolated from marine and freshwater fish (González, 2000). They are predominant in the spoilage microbiota of aerobically stored animals, however, their participation in the spoilage process is still uncertain, since members of this family do not produce offensive by-products from amino acids as do other species, such as Pseudomonas or Shewanella (Yang, 2014 ). Members of the Vibrionaceae family ( Proteobacteria phylum ) are found in a variety of aquatic biotopes, and include extremophiles such as the psychrophile Photobacterium profundum , which lives at high ocean depths, as well as highly specialized symbionts such as Vibrio fischeri , and pathogens, such as Vibrio cholerae (Thompson, 2006 ). Bacteria of this family are among the main decomposers of seafood at room temperature, e.g., Photobacterium phosphoreum and Aeromonas spp (Marshall, 2014 ). Based on the abundance of these families, it may suggest that the samples with histamine had ideal conditions for the proliferation of bacteria closely related to seafood spoilage. The genus Photobacterium was detected in all samples, constituting 52% of the microbiota in histamine-contaminated samples and 21% in samples without histamine. This genus is widely distributed in the aquatic environment and is associated with symbiotic interactions with fish and squid, commensalism in the intestines of various marine organisms, pathogenicity, and primarily, decomposition of fish (Burtseva, 2020; Gram, 2009; Martini et al., 2013 ; Widder, 2010 ). It is also involved in the production of biogenic amines, including putrescine and cadaverine in fish and shrimp (Lakshmanan, 2008). Additionally, this genus is directly linked to scombroid poisoning and is frequently identified as a significant contributor to histamine production, particularly in fish samples stored at temperatures between 5 and 15°C (Lehane et al., 2000; Masashi et al., 2004 ). Photobacterium spp . can thrive in low temperatures, exhibiting optimal growth typically between 5 and 25°C (Moi et al., 2017 ). However, histamine production by Photobacterium spp . significantly decreases at temperatures below 5°C (Takashi et al., 2015). Additionally, a decrease from 42.8–26.6% in the overall abundance of this genus' strains was observed in ice-cold (< 0°C) shrimp samples (Shiliang et al., 2019 ). Therefore, treatment involving temperatures below 5°C appears to be effective in suppressing the growth of this bacterial genus and, consequently, the production of histamine. The Shewanella genus also showed a higher relative abundance in samples with histamine. This genus is composed of mesophilic bacteria that decompose and exhibit optimal growth at a pH close to neutrality (Møretrø et al., 2017). They are affected by low pH, which limits their spoilage potential in many types of meat products. Shewanella spp . are found almost exclusively within the decomposing microbiota of fish. They are sensitive to low pH and are responsible for the characteristic odor of \"rotten fish\" by reducing trimethylamine oxide into trimethylamine, as well as producing H2S (Gram, 2009). Batches with high levels of histamine did not receive proper cold chain from fishing to processing and to freezing. Thus, they were exposed to higher temperatures. The samples with and without histamine were taken from the same container. The logistic and unloading process did not result in temperature variations that could affect the samples differently. If there were variations in this process, all samples would have been subjected to high temperatures, and there would probably be no significant differences among the samples' microbiota. The presence of Shewanella spp. and Photobacterium in these samples demonstrates that the products are in deterioration, which, along with Photobacterium, are important markers of poor fish quality. On the other hand, the genus Psychrobacter showed a higher relative abundance in histamine-free samples. The bacteria are psychotropic and halotolerant, capable of growing in a wide temperature range from minus ten degrees Celsius to 42 degrees Celsius. They are isolated from various regions of the globe, including inhospitable Antarctica (Ayala-del-Río et al., 2010 ; Bozal et al., 2003 ; Møretrø et al., 2016 ). As members of the resident microbiota of fish and other seafood, they are unrelated to the production of H2S or histamine, and they are unable to compete with spoilage bacteria (Moreto et al., 2017; García-López et al., 2014). Another genus that showed a greater abundance in sardine muscle samples without histamine was Pseudoalteromona s, which is abundant in the marine environment and has high resistance to hostile marine environments, such as the very low temperatures of polar seas and the high pressure of deep ocean waters (Parrilli et al., 2019). This ability is due to the peculiar metabolic mechanisms of this group, which confer resistance and enable survival in these places with extreme conditions (Bowman et al., 1997 ). The greater abundance of this genus in histamine-free samples, allied with the almost incipient abundance in the histamine-contaminated samples, reinforces the hypothesis that there must have been differences in the preservation of sardines from the moment of fishing to freezing between the two sample groups (batches). Our data also suggest that strains of the genus Pseudoalteromonas can be used as quality markers for frozen seafood since their survival could be related to the efficiency of the cold chain. Species of the Vibrio genus commonly colonize fish, marine invertebrates, and algae. They can form biofilms on biotic and abiotic surfaces, which play an essential role in their environmental persistence (Garrity et al., 2006). There is no relationship between the presence of the Vibrio genus and the formation of histamine in the consulted literature. The greater abundance of OTU 11 is probably related to the good conservation of the fish from capture to freezing, as it is a commensal bacterium with no direct relationship with the deterioration of the fish. 5. Conclusion Sardine samples, with and without histamine, exhibited significant differences in their associated microbiota. The higher abundance of Photobacterium and Shewanella genera in histamine-containing samples suggests a likely break in the cold chain during preservation. These bacteria are indicators of deterioration and the formation of biogenic amines, including histamine. Conversely, Psychobacte r and Pseudoalteromas were more prevalent in samples without histamine, suggesting proper management from fishing to freezing. Strains from these genera can serve as vital quality markers for preserving fish and other seafood. Declarations 6.1 Ethics approval and consent to participate Not applicable. 6.2 Consent for publication All authors have consented to the submission of this manuscript. 6.3 Availability of data and material Data and material can be made available upon request. 6.4 Competing interests No competing interests. 6.5 Funding GDC Alimentos S/A. 6.6 Authors' contributions Luca Frondana: Data curation, Formal analysis, Investigation, Methodology Roles/Writing - original draft. Daniel da Rosa Farias - Data curation, Formal analysis Roles/Writing - original draft; Writing - review & editing.; Delano Dias Schleder - Funding acquisition, Conceptualization, Supervision, Formal analysis, Visualization, Roles/Writing - original draft; Writing - review & editing. 6.7 Acknowledgements We thank GDC Alimentos S/A for funding this study. References Ayala-del-río, H.L., Chain, P.S., Grzymski, J.J., Ponder, M.A., Ivanova, N., Bergholz, P.W., Di Bartoli, G., Hauser, L., Land, M., Bakermans, C. (2010). The genome sequence of Psychrobacter arcticus 273-4, a psychroactive Siberian permafrost bacterium, reveals mechanisms for adaptation to low-temperature growth. Applied and Environmental Microbiology, 76, 2304-2312. https://doi.org/10.1128/AEM.02101-09 Bowman, J.P., McCammon, S.A., Brown, M.V., Nichols, D.S., McMeekin, T.A. (1997). Diversity and association of psychrophilic bacteria in Antarctic sea ice. Applied and Environmental Microbiology, 63, 3068-3078. https://doi.org/10.1128/aem.63.8.3068-3078.1997 Bozal, N., Montes, M.J., Tudela, E., Guinea, J. (2003). Characterization of several Psychrobacter strains isolated from Antarctic environments and description of Psychrobacter luti sp. and Psychrobacter fozii sp. International Journal of Systematic and Evolutionary Microbiology, 53(Pt 4), 1093-1100. https://doi.org/10.1099/ijs.0.02457-0 Burtseva, O., Kublanovskaya, A., Baulina, O., Fedorenko, T., Lobakova, E., Chekanov, K. (2020). The strains of bioluminescent bacteria isolated from the White Sea finfishes: Genera Photobacterium, Aliivibrio, Vibrio, Shewanella, and first luminous Kosakonia. Journal of Photochemistry and Photobiology B: Biology, 111895. https://doi.org/doi:10.1016/j.jphotobiol.2020.111895 FAO (Food And Agriculture Organization Of The United Nations). The state of world fisheries and aquaculture. Italy, 2022. FDA (Food and Drug Administration). Scombrotoxin (histamine) formation. Ch. 7. In Fish and Fishery Products Hazards and Controls Guidance (pp. 83-102). Washington, 2020. González, C.J., Santos, J.A., García-López, M.L., Otero, A. (2000). Psychrobacters and related bacteria in freshwater fish. Journal of Food Protection, 63, 315-321. https://doi.org/10.4315/0362-028X-63.3.315 Garrity, G.M., Bell, J.A., Lilburn, T. (2005). Bergey's Manual of Systematic Bacteriology (pp. 491-494). Springer, New York. Gram, L. (2009). Microbiological spoilage of fish and seafood products. In: Sperber, W., Doyle, M. (Eds.), Compendium of the microbiological spoilage of foods and beverages (pp. 87-119). New York: Springer.Jay, J.M., Loessner M.J., Golden, D.A. 2005. Modern Food Microbiology. 7.ed, p.101-124, SpringerLink. Lakshmanan, R., Shakila, R., Jeyasekaran, G. (2002). Survival of amine-forming bacteria during the ice storage of fish and shrimp. Food Microbiology, 19, 617-625. https://doi.org/10.1006/fmic.2002.0481 Lehane, L., Lewis, R.J. (2000). Ciguatera: recent advances but the risk remains. International Journal of Food Microbiology, 61(2-3), 91-125. https://doi.org/10.1016/S0168-1605(00)00382-2 Leisner, J.J., Gram, L. (2014). Danish Institute for Fisheries Research, Danish Technical University, Lyngby, Denmark. Elsevier Ltd. https://doi.org/10.1016/B978-0-12-384730-0.00125-7 Love, M.I., Huber, W., Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology, 15(12). https://doi.org/10.1186/s13059-014-0550-8 Martini, S., Al Ali, B., Garel, M., Nerini, D., Grossi, V., Pacton, M. (2013). Effects of hydrostatic pressure on growth and luminescence of a moderately-piezophilic luminous bacterium Photobacterium phosphoreum ANT-2200. PLoS One, 8, e66580. https://doi.org/10.1371/journal.pone.0066580 Masashi, K., Yoda, T., Masanori, I., Teizo, T.O. (2004). Photobacterium phosphoreum caused a histamine fish poisoning incident. International Journal of Food Microbiology, 92(1), 79-87. https://doi.org/10.1016/j.ijfoodmicro.2003.08.019 MAPA (Ministry of Agriculture, Livestock, and Food Supply). (2019). Government eliminates import tariffs on sardines for one year. Available at: https://www.gov.br/agricultura/pt-br/assuntos/noticias/governo-reduz-tarifa-de-importacao-de-sardinha-a-zero-por-um-ano. Accessed May 16, 2021. MAPA (Ministry of Agriculture, Livestock, and Food Supply), Brasília. (2010). Brazil, 2020. Regulation of Industrial and Sanitary Inspection of Animal Products (RIISPOA). Marshall, D.L. (2014). Spoilage of Animal Products | Seafood. In: Batt, C.A., Tortorello, M.L. (eds.) Encyclopedia of Food Microbiology, 3rd ed., 2021-2029. https://doi.org/10.1016/B978-0-12-384730-0.00372-4 Møretrø, T., Langsrud, S. (2017). Residential bacteria on surfaces in the food industry and their implications for food safety and quality. Comprehensive Reviews in Food Science and Food Safety, 16, 1022-1041. doi.org/10.1111/1541-4337.12283 Møretrø, T., Moen, B., Heir, E., Hansen, A. A., Langsrud, S. (2016). Contamination of salmon fillets and processing plants with spoilage bacteria. International Journal of Food Microbiology, 237, 98–108. https://doi.org/10.1016/j.ijfoodmicro.2016.08.016 Moi, I.M., Roslan, N.N., & Leow, A.T.C. (2017). The biology and importance of Photobacterium species. Applied Microbiology and Biotechnology, 101, 4371–4385. https://doi.org/10.1007/s00253-017-8300 Oksanen, J., Blanchet, F.G., Friendly, M., Kindt, R., Legendre, P., Mcglinn, D., Wagner, H. (2019). Vegan: Community Ecology Package. R package version 2.5-5. https://CRAN.R-project.org/package=vegan Oku, N., Kawabata, K., Adachi K., Katsuta A., Shizuri, Y. (2008). Unnarmicins A and C, new antibacterial depsipeptides produced by marine bacterium Photobacterium sp. MBIC06485. The Journal of Antibiotics, 61, 11–17. doi.org/10.1038/ja.2008.103 Oliveira, H.A.C. (2004). Determination of histamine by reversed-phase high-performance liquid chromatography in canned tuna and sardines. Revista Ciência Agronômica, 35(Special issue), 179-188. Parrilli, E., Tedesco, P., Fondi, M., Tutino, M.L., Giudice, A., Pascale, D., Fani, R. (2021). The art of adapting to extreme environments: The model system Pseudoalteromonas. Physics of Life Reviews, 36, 137-161. doi.org/10.1016/j.plrev.2019.04.003 Rossano, R., Mastrangelo, L., Ungaro, N., Riccio, P. (2006). Influence of storage temperature and freezing time on histamine level in the European anchovy Engraulis encrasicholus (L., 1758): a study by capillary electrophoresis. Journal of Chromatography B, 830(1), 161-164. https://doi.org/10.1016/j.jchromb.2005.10.026 Shiliang, J., Yiming, L., Shuai, Z., Xiaohui, S., Yan, L., Hui, H., Yuanmeng, L., Yongkang, L. (2019). Effect of ε-polylysine and ice storage on microbiota composition and quality of Pacific white shrimp (Litopenaeus vannamei) stored at 0 °C. Food Microbiology, 83, 27-35. https://doi.org/10.1016/j.fm.2019.04.007 Takahashi, H., Ogai M., Miya S., Kuda T., Kimura B. (2015). Effects of environmental factors on histamine production in the psychrophilic histamine-producing bacterium Photobacterium iliopiscarium. Food Control, 52, 39-42. https://doi.org/10.1016/j.foodcont.2014.12.023 Thompson, F.L., Swings, J. (2006). Taxonomy of the Vibrios. In: F.L. Thompson, B. Austin, & J. Swings (Eds.), The Biology of Vibrios (pp. 29-43). Washington DC: ASM Press. https://doi.org/10.1128/9781555815714 Wang, Y., Naumann, U., Eddelbuettel, D., Wilshire, J., Warton, D., Byrnes, J., Silva V. S., Niku, J., Renner, I., Wright, S. (2022). mvabund: Statistical Methods for Analysing Multivariate Abundance Data. R package version 4.0.1. https://CRAN.R-project.org/package=mvabund Wickham, H. (2016). ggplot2: Elegant Graphics for Data Analysis. Springer-Verlag, New York. Widder, E.A. (2010). Bioluminescence in the ocean: Origins of biological, chemical, and ecological diversity. Science, 328, 704-708. Yang, X. (2014). Moraxellaceae. In Encyclopedia of Food Microbiology (Second Edition) (pp. 826-833). Academic Press. https://doi.org/10.1016/B978-0-12-384730-0.00441-9. Additional Declarations No competing interests reported. Supplementary Files FigS1.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3195309\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":222067454,\"identity\":\"52ff2401-242d-4932-9568-b580a7656417\",\"order_by\":0,\"name\":\"Luca Frondana\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Instituto Federal Catarinense\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Luca\",\"middleName\":\"\",\"lastName\":\"Frondana\",\"suffix\":\"\"},{\"id\":222067455,\"identity\":\"8030cbc6-9c0a-4ae8-80da-851826b8e8d8\",\"order_by\":1,\"name\":\"Daniel da Rosa Farias\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Instituto Federal Catarinense\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Daniel\",\"middleName\":\"da Rosa\",\"lastName\":\"Farias\",\"suffix\":\"\"},{\"id\":222067456,\"identity\":\"ea2192be-7441-49e8-92dc-c501ff820438\",\"order_by\":2,\"name\":\"Delano Dias Schleder\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABE0lEQVRIie3QsUrDQBjA8e84uOli14RA8wpXHEqpkFe5wyFTQRBKBoeEwLmEzgf2IXyEhANdjs4BRdO9Q8FFKIrXqoOQRtwc7g+B7xt+yV0AXK7/WIWzz8G3AwUYElzZjQCwowR9E3Qgp4TwPxKR/UZO7vP85SKFeHCT5+0mfUoWBLewnWsYh1UnCUxdhMqAUI91MVqay5kkhCG10jBZ8E7CGpGFngTOfCHtwGcyKgF7UgMz3Qdjz+tiZ0lsyfXOe+cJIRTwWx9p0P7lgG7tV7CXcX4gqIcERsgpNb5QjSiC5R0f7e9Sl6uETspjf0zrB5qexQN1Xm83VzyKJF63r/PpcEy7yVf+z7WyTz9wuVwuV28fDCxapU2vhGEAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Instituto Federal Catarinense\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Delano\",\"middleName\":\"Dias\",\"lastName\":\"Schleder\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2023-07-22 20:59:06\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3195309/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3195309/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":40913789,\"identity\":\"cd4b1318-61b5-4dfa-acac-6185a48eeaf4\",\"added_by\":\"auto\",\"created_at\":\"2023-08-01 22:54:59\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":26018,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eLegend not included with this version\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3195309/v1/9307da139729dbfa957dd89e.png\"},{\"id\":40911670,\"identity\":\"61c35211-fae5-4237-95d8-9071573133ce\",\"added_by\":\"auto\",\"created_at\":\"2023-08-01 22:46:59\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":28495,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eLegend not included with this version\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3195309/v1/039aa24699b7328926ad9029.png\"},{\"id\":40911668,\"identity\":\"fb04d78e-909e-48ea-8561-6d74d1958f87\",\"added_by\":\"auto\",\"created_at\":\"2023-08-01 22:46:59\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":29930,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eLegend not included with this version\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3195309/v1/63c50452140369fe13e9df4c.png\"},{\"id\":40914579,\"identity\":\"c02c3249-775c-4129-96af-d94f1da7cdfd\",\"added_by\":\"auto\",\"created_at\":\"2023-08-01 23:02:59\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":50606,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eLegend not included with this version\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3195309/v1/e9d0bc57a00f10a15eb4b0fc.png\"},{\"id\":46094442,\"identity\":\"0db9c348-cb38-46f9-bd81-bc04bca57cf1\",\"added_by\":\"auto\",\"created_at\":\"2023-11-08 14:37:44\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":490301,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3195309/v1/63094e98-d73b-4de4-b225-710d0a9fee68.pdf\"},{\"id\":40911672,\"identity\":\"29b1d673-faaa-4cf7-8004-86da64967713\",\"added_by\":\"auto\",\"created_at\":\"2023-08-01 22:46:59\",\"extension\":\"pdf\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":41124,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FigS1.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3195309/v1/330bdc868ef9573716213edd.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Bacterial community in sardines condemned for histamine contamination: a case study in the canned fish industry\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003eWorld fish production reached 214\\u0026nbsp;million tons in 2020, of which 90\\u0026nbsp;million came from marine fisheries (FAO, 2022). Fish from the \\u003cem\\u003eClupeidae\\u003c/em\\u003e family, such as \\u003cem\\u003eSardina\\u003c/em\\u003e, \\u003cem\\u003eSardinops\\u003c/em\\u003e, and \\u003cem\\u003eSardinella\\u003c/em\\u003e, are cosmopolitan and contribute significantly to the world's extractive fisheries. Brazilian fish production is around 1.5\\u0026nbsp;million tons per year, with marine extractive fishing as the primary source (MAPA, 2011). Marine fish are highly susceptible to microbial spoilage due to their high water content, oxidizable fats, and a pH close to neutral (pH 6.6\\u0026ndash;6.8). Inadequate handling and storage conditions promote the growth of bacteria that produce the enzyme histidine decarboxylase, which catalyzes the formation of histamine when it interacts with the histidine present in the fish musculature (Oliveira et al., 2004).\\u003c/p\\u003e \\u003cp\\u003eHistamine, a primary and heterocyclic biogenic diamine, is an important compound found in fish like tuna, mackerel, bonito, and sardines (Rossano et al., \\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e). Despite undergoing commercial sterilization, histamine remains present in these fish without altering their sensory characteristics. Proper handling and storage practices are crucial to prevent histamine formation and ensure consumer safety. Histamine levels in foods must not exceed 200ppm to prevent scombroid poisoning, a condition caused by ingesting this substance in high concentrations. Symptoms such as abdominal pain, vomiting, diarrhea, headache, erythema, urticaria, and hypotension may arise, resembling an allergic reaction. In severe cases, it can even lead to anaphylactic shock (FDA, 2020). Histamine formation is unlikely to occur if the fish is processed under satisfactory hygienic-sanitary conditions. The formation of this biogenic amine in fish-derived products is due to contamination by bacteria and exposure to inappropriate temperatures. To minimize the risk of excessive histamine formation, it is recommended to freeze fish at -15\\u0026deg;C. This temperature helps inactivate the majority of bacteria that produce the enzyme histidine decarboxylase (FDA, 2020). The bacteria commonly associated with histidine decarboxylation include \\u003cem\\u003eMorganella morganii\\u003c/em\\u003e, \\u003cem\\u003eKlebsiella pneumoniae\\u003c/em\\u003e, \\u003cem\\u003eHafnia alvei\\u003c/em\\u003e, \\u003cem\\u003eCitrobacter freundii\\u003c/em\\u003e, \\u003cem\\u003eEnterobacter aerogenes\\u003c/em\\u003e, \\u003cem\\u003eVibrio alginolyticus\\u003c/em\\u003e, \\u003cem\\u003eProteus spp\\u003c/em\\u003e., and \\u003cem\\u003ePhotobacterium spp\\u003c/em\\u003e. (Jay et al., 2005; Takahashi, 2015).\\u003c/p\\u003e \\u003cp\\u003eHistamine poses a significant challenge for the sardine canning industry. While histamine detection techniques are reliable, the main bacteria responsible for histamine formation in sardines remain unclear. This study utilized Next Generation Sequencing (NGS) to identify the predominant bacterial populations in sardine samples with high histamine content and histamine-free fish samples. The characterization of the microbiota can greatly benefit the sardine production chain by reducing raw material wastage and minimizing health risks.\\u003c/p\\u003e\"},{\"header\":\"2. Material and Method\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1 Sample Collection and Histamine Detection:\\u003c/h2\\u003e \\u003cp\\u003eBiological samples of previously eviscerated Sardinella pilchardus were obtained from a supplier in Morocco and collected at the Gomes da Costa (GDC) fish canning plant in Itaja\\u0026iacute;, Santa Catarina, Brazil. The samples were transported in a refrigerated container at -21\\u0026deg;C, following the RIISPOA (MAPA, 2020) standards. Histamine analysis was performed using the Biofish\\u0026reg; enzymatic method, confirming the presence of histamine in the collected samples. A reanalysis was conducted on samples from all pallets in the container, revealing varying histamine levels below 1 ppm and 200 ppm or higher. To ensure reliability, the entire batch was reserved for further experimentation, and the sample collection procedure was repeated.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2 Sampling for Sequencing and Confirmatory Histamine Analysis:\\u003c/h2\\u003e \\u003cp\\u003eMuscle samples weighing approximately 1000 g (\\u0026plusmn;\\u0026thinsp;10 g) were obtained from pallets containing sardines with histamine levels of 200 ppm or higher. Additionally, samples were collected from histamine-free pallets with histamine levels below 1 ppm. All sample collection was performed within a refrigeration chamber at -18\\u0026deg;C. The muscle samples were placed in sterile RNase and DNase-free sample bags (3M\\u0026reg; sample bag) and transported in a temperature-controlled container to the GDC laboratory, where they were stored at -18\\u0026deg;C. Histamine analysis was conducted on a portion of the samples using the Biofish\\u0026reg; enzymatic method. Ten 1 g samples were then collected from each group for further analysis. These samples were stored frozen in RNase and DNase-free microtubes, packed with dry ice, and sent to Neoprospecta for total DNA extraction, amplification of the 16S rRNA gene, and sequencing.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3 DNA Extraction and Next Generation Sequencing:\\u003c/h2\\u003e \\u003cp\\u003eTotal DNA extraction was performed using the phenol/chloroform method according to the Neoprospecta laboratory's standard protocol. The DNA concentration of each sample was estimated using Picogreen dsDNA (Invitrogen, Carlsbad, California, USA). For microbial population identification, the DNA library bank was adjusted to a final concentration of 11 pM, and PCR amplification of the V3-V4 region of the 16S rRNA gene was conducted using primers 341F (5' CCTACGGGRSGCAGCAG 3') and 805R (5' GGACTACCAGGGTATCTAAT 3'). Sequencing of the libraries was performed on the Illumina MiSeq platform, employing a 2 x 300 nt paired-end configuration with a volume of 100 K per sample. Operational Taxonomic Units (OTUs) were generated from the sequences using USEARCH (version 11.0.667) at 97% similarity with the UPARSE algorithm. Taxonomic attribution was determined using the SILVA database (version 138) with 91% identity. Richness and diversity indices were calculated using the vegan R package, and Good's Coverage was determined using the QsRutils R package.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4 Statistical analysis\\u003c/h2\\u003e \\u003cp\\u003eMicrobiome data were analyzed using R software (version 3.5.1). Due to differences in sequencing depth between samples (up to 9.3x), count data (readings) were normalized using the Bioconductor DESeq2 package. Normalized DESeq2 counts were used to determine beta diversity, NMDS, PERMANOVA, alpha diversity indices and relative abundance (Love et al., \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). Student's t test was used to identify differences in alpha diversity indices between each treatment in the R environment. Multivariate analysis was performed based on Bray-Curtis dissimilarity matrices, using the \\u0026ldquo;vegan\\u0026rdquo; package (Oksanen et al., \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). Generalized univariate linear models (GLMs, package \\u0026ldquo;mvabund\\u0026rdquo;) were used to identify OTUs (Wang et al., \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e). Figures were generated using the \\u0026ldquo;ggplot2\\u0026rdquo; package (Wickham, \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e). The significance level adopted was 5.0% for all tests.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003cp\\u003eAfter processing and filtering the Next-generation sequencing (NGS) data, the sequences were grouped into 18 operational taxonomic units (OTUs). Based on the alpha-diversity analysis (Fig.\\u0026nbsp;1), the richness indices (Richness and Chao1) exhibited opposite behavior compared to the diversity indices (Shannon and Inverse Simpson). Histamine-contaminated samples had higher microbial richness, whereas histamine-free samples showed higher diversity.\\u003c/p\\u003e \\u003cp\\u003eThe beta-diversity analysis (NMDS and PCoA) based on Bray-Curtis dissimilarity matrices indicated significant differences (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) among the samples, suggesting that histamine-contaminated sardine muscle samples exhibited different bacterial compositions (Fig.\\u0026nbsp;2). The most abundant bacterial families in both treatment groups were \\u003cem\\u003eVibrionaceae\\u003c/em\\u003e and \\u003cem\\u003eMoraxellaceae\\u003c/em\\u003e (Fig.\\u0026nbsp;3). Histamine-contaminated samples exhibited a predominance of the Vibrionaceae family, while \\u003cem\\u003eMoraxellaceae\\u003c/em\\u003e was the most abundant in histamine-free samples. Other identified families included \\u003cem\\u003eArcobacteraceae\\u003c/em\\u003e, \\u003cem\\u003ePlanococcaceae, Fusobacteriaceae, Pseudoalteromonadaceae\\u003c/em\\u003e, and \\u003cem\\u003eShewanellaceae\\u003c/em\\u003e.\\u003c/p\\u003e \\u003cp\\u003eThe 18 OTUs identified in the sardine muscle samples belonged to ten different bacterial genera. Among them, seven comprised more than 95% of the bacterial community, as shown in Fig.\\u0026nbsp;4. In the histamine group, the most abundant genera were \\u003cem\\u003eAliivibrio\\u003c/em\\u003e, \\u003cem\\u003eCetobacterium\\u003c/em\\u003e, \\u003cem\\u003ePhotobacterium\\u003c/em\\u003e, \\u003cem\\u003ePsychrobacter\\u003c/em\\u003e, Shewanella, and \\u003cem\\u003eVibrio\\u003c/em\\u003e. The no-histamine group showed a predominance of \\u003cem\\u003ePhotobacterium\\u003c/em\\u003e, \\u003cem\\u003ePseudoalteromona\\u003c/em\\u003es, \\u003cem\\u003ePsychrobacter\\u003c/em\\u003e, and \\u003cem\\u003eVibrio\\u003c/em\\u003e. In both groups, the most abundant genera were \\u003cem\\u003ePhotobacterium\\u003c/em\\u003e and \\u003cem\\u003ePsychrobacter\\u003c/em\\u003e. However, their abundance showed opposite patterns, with Photobacterium being more abundant in the histamine group and \\u003cem\\u003ePsychrobacte\\u003c/em\\u003er more abundant in the no-histamine group.\\u003c/p\\u003e \\u003cp\\u003eStatistical analysis revealed that histamine-contaminated samples showed a higher relative abundance of the genera \\u003cem\\u003ePhotobacterium\\u003c/em\\u003e (2 and 17 OTUs) and \\u003cem\\u003eShewanella\\u003c/em\\u003e (4, 9, and 12 OTUs). Meanwhile, the genera \\u003cem\\u003ePsychrobacter\\u003c/em\\u003e (1, 3, 8, 16, and 18 OTUs), \\u003cem\\u003ePseudoalteromonas\\u003c/em\\u003e (OTU 5), and Vibrio (OTU 11) were more abundant in samples without histamine. Regarding the genera \\u003cem\\u003eAliivibrio\\u003c/em\\u003e and \\u003cem\\u003eCetobacterium\\u003c/em\\u003e, they were more abundant in histamine-contaminated samples; however, the difference was not statistically significant (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e, Fig.\\u0026nbsp;4, and S1).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eMean relative abundance (%) of the statistically different OTUs between samples showing (A) histamine concentration\\u0026thinsp;\\u0026gt;\\u0026thinsp;200ppm (histamine) and \\u0026lt;\\u0026thinsp;1ppm (no-histamine). Data presented in mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eOTUs\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ehistamine\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eno-histamine\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eOTU 2_ \\u003cem\\u003ePhotobacterium\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e52.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;21.97\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e21.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;13.87\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eOTU 3_ \\u003cem\\u003ePsychrobacter\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e3.50\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2,50\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e11.70\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;5.02\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eOTU 4_ \\u003cem\\u003eShewanella\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e4.82\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;9.02\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.05\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.05\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eOTU 5_ \\u003cem\\u003ePseudoalteromas\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e2.68\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.30\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e7.95\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;4.68\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eOTU 11_\\u003cem\\u003eVibrio\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1.67\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.84\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e3.61\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.71\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eOTU 16_ \\u003cem\\u003ePsychrobacter\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1.17\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.36\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e4.33\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.19\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eOTU 18_ \\u003cem\\u003ePsychrobacter\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.31\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.36\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1.56\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.23\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e\"},{\"header\":\"4. Discussion\",\"content\":\"\\u003cp\\u003eSamples contaminated with histamine (\\u0026gt;\\u0026thinsp;200 ppm) exhibited higher bacterial richness but lower diversity, indicating a greater number of bacterial species. However, there was a predominance of certain bacteria in terms of abundance, particularly \\u003cem\\u003ePhotobacterium spp\\u003c/em\\u003e. and \\u003cem\\u003eShewanella spp.\\u003c/em\\u003e These two genera are known as the main decomposers of saltwater fish (Leisner et al., 2004). Therefore, these results suggest that batches with high levels of histamine were exposed to conditions that favored the proliferation of decomposing bacteria. Photobacterium strains produce secondary metabolites that inhibit the growth of other bacteria, indicating that the high dominance of Photobacterium spp. in histamine-contaminated samples and the subsequent lower microbial diversity could be attributed to their ability to suppress the growth of other bacterial strains involved in fish decomposition (Oku, 2008). On the other hand, samples from the no-histamine group (\\u0026lt;\\u0026thinsp;1 ppm) exhibited the opposite pattern, with higher bacterial diversity but lower bacterial richness. This distinct bacterial composition was further confirmed by beta diversity indices, which indicated significant dissimilarities between the two bacterial communities.\\u003c/p\\u003e \\u003cp\\u003eRegarding the bacterial families, \\u003cem\\u003eMoraxelaceae\\u003c/em\\u003e and \\u003cem\\u003eVibrionaceae\\u003c/em\\u003e were more abundant in the samples without and with histamine, respectively. Bacteria belonging to the \\u003cem\\u003eMoraxelaceae\\u003c/em\\u003e family (\\u003cem\\u003eProteobacteria phylum\\u003c/em\\u003e) are commonly isolated from marine and freshwater fish (Gonz\\u0026aacute;lez, 2000). They are predominant in the spoilage microbiota of aerobically stored animals, however, their participation in the spoilage process is still uncertain, since members of this family do not produce offensive by-products from amino acids as do other species, such as \\u003cem\\u003ePseudomonas\\u003c/em\\u003e or \\u003cem\\u003eShewanella\\u003c/em\\u003e (Yang, \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eMembers of the \\u003cem\\u003eVibrionaceae\\u003c/em\\u003e family (\\u003cem\\u003eProteobacteria phylum\\u003c/em\\u003e) are found in a variety of aquatic biotopes, and include extremophiles such as the psychrophile \\u003cem\\u003ePhotobacterium profundum\\u003c/em\\u003e, which lives at high ocean depths, as well as highly specialized symbionts such as \\u003cem\\u003eVibrio fischeri\\u003c/em\\u003e, and pathogens, such as \\u003cem\\u003eVibrio cholerae\\u003c/em\\u003e (Thompson, \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e). Bacteria of this family are among the main decomposers of seafood at room temperature, e.g., \\u003cem\\u003ePhotobacterium phosphoreum\\u003c/em\\u003e and \\u003cem\\u003eAeromonas\\u003c/em\\u003e spp (Marshall, \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). Based on the abundance of these families, it may suggest that the samples with histamine had ideal conditions for the proliferation of bacteria closely related to seafood spoilage.\\u003c/p\\u003e \\u003cp\\u003eThe genus \\u003cem\\u003ePhotobacterium\\u003c/em\\u003e was detected in all samples, constituting 52% of the microbiota in histamine-contaminated samples and 21% in samples without histamine. This genus is widely distributed in the aquatic environment and is associated with symbiotic interactions with fish and squid, commensalism in the intestines of various marine organisms, pathogenicity, and primarily, decomposition of fish (Burtseva, 2020; Gram, 2009; Martini et al., \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e; Widder, \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e). It is also involved in the production of biogenic amines, including putrescine and cadaverine in fish and shrimp (Lakshmanan, 2008). Additionally, this genus is directly linked to scombroid poisoning and is frequently identified as a significant contributor to histamine production, particularly in fish samples stored at temperatures between 5 and 15\\u0026deg;C (Lehane et al., 2000; Masashi et al., \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2004\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003ePhotobacterium spp\\u003c/em\\u003e. can thrive in low temperatures, exhibiting optimal growth typically between 5 and 25\\u0026deg;C (Moi et al., \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). However, histamine production by \\u003cem\\u003ePhotobacterium spp\\u003c/em\\u003e. significantly decreases at temperatures below 5\\u0026deg;C (Takashi et al., 2015). Additionally, a decrease from 42.8\\u0026ndash;26.6% in the overall abundance of this genus' strains was observed in ice-cold (\\u0026lt;\\u0026thinsp;0\\u0026deg;C) shrimp samples (Shiliang et al., \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). Therefore, treatment involving temperatures below 5\\u0026deg;C appears to be effective in suppressing the growth of this bacterial genus and, consequently, the production of histamine.\\u003c/p\\u003e \\u003cp\\u003eThe \\u003cem\\u003eShewanella\\u003c/em\\u003e genus also showed a higher relative abundance in samples with histamine. This genus is composed of mesophilic bacteria that decompose and exhibit optimal growth at a pH close to neutrality (M\\u0026oslash;retr\\u0026oslash; et al., 2017). They are affected by low pH, which limits their spoilage potential in many types of meat products. \\u003cem\\u003eShewanella spp\\u003c/em\\u003e. are found almost exclusively within the decomposing microbiota of fish. They are sensitive to low pH and are responsible for the characteristic odor of \\\"rotten fish\\\" by reducing trimethylamine oxide into trimethylamine, as well as producing H2S (Gram, 2009).\\u003c/p\\u003e \\u003cp\\u003eBatches with high levels of histamine did not receive proper cold chain from fishing to processing and to freezing. Thus, they were exposed to higher temperatures. The samples with and without histamine were taken from the same container. The logistic and unloading process did not result in temperature variations that could affect the samples differently. If there were variations in this process, all samples would have been subjected to high temperatures, and there would probably be no significant differences among the samples' microbiota. The presence of Shewanella spp. and Photobacterium in these samples demonstrates that the products are in deterioration, which, along with Photobacterium, are important markers of poor fish quality.\\u003c/p\\u003e \\u003cp\\u003eOn the other hand, the genus \\u003cem\\u003ePsychrobacter\\u003c/em\\u003e showed a higher relative abundance in histamine-free samples. The bacteria are psychotropic and halotolerant, capable of growing in a wide temperature range from minus ten degrees Celsius to 42 degrees Celsius. They are isolated from various regions of the globe, including inhospitable Antarctica (Ayala-del-R\\u0026iacute;o et al., \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e; Bozal et al., \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e2003\\u003c/span\\u003e; M\\u0026oslash;retr\\u0026oslash; et al., \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e). As members of the resident microbiota of fish and other seafood, they are unrelated to the production of H2S or histamine, and they are unable to compete with spoilage bacteria (Moreto et al., 2017; Garc\\u0026iacute;a-L\\u0026oacute;pez et al., 2014).\\u003c/p\\u003e \\u003cp\\u003eAnother genus that showed a greater abundance in sardine muscle samples without histamine was \\u003cem\\u003ePseudoalteromona\\u003c/em\\u003es, which is abundant in the marine environment and has high resistance to hostile marine environments, such as the very low temperatures of polar seas and the high pressure of deep ocean waters (Parrilli et al., 2019). This ability is due to the peculiar metabolic mechanisms of this group, which confer resistance and enable survival in these places with extreme conditions (Bowman et al., \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e1997\\u003c/span\\u003e). The greater abundance of this genus in histamine-free samples, allied with the almost incipient abundance in the histamine-contaminated samples, reinforces the hypothesis that there must have been differences in the preservation of sardines from the moment of fishing to freezing between the two sample groups (batches). Our data also suggest that strains of the genus \\u003cem\\u003ePseudoalteromonas\\u003c/em\\u003e can be used as quality markers for frozen seafood since their survival could be related to the efficiency of the cold chain.\\u003c/p\\u003e \\u003cp\\u003eSpecies of the \\u003cem\\u003eVibrio\\u003c/em\\u003e genus commonly colonize fish, marine invertebrates, and algae. They can form biofilms on biotic and abiotic surfaces, which play an essential role in their environmental persistence (Garrity et al., 2006). There is no relationship between the presence of the \\u003cem\\u003eVibrio\\u003c/em\\u003e genus and the formation of histamine in the consulted literature. The greater abundance of OTU 11 is probably related to the good conservation of the fish from capture to freezing, as it is a commensal bacterium with no direct relationship with the deterioration of the fish.\\u003c/p\\u003e\"},{\"header\":\"5. Conclusion\",\"content\":\"\\u003cp\\u003eSardine samples, with and without histamine, exhibited significant differences in their associated microbiota. The higher abundance of \\u003cem\\u003ePhotobacterium\\u003c/em\\u003e and \\u003cem\\u003eShewanella\\u003c/em\\u003e genera in histamine-containing samples suggests a likely break in the cold chain during preservation. These bacteria are indicators of deterioration and the formation of biogenic amines, including histamine. Conversely, \\u003cem\\u003ePsychobacte\\u003c/em\\u003er and \\u003cem\\u003ePseudoalteromas\\u003c/em\\u003e were more prevalent in samples without histamine, suggesting proper management from fishing to freezing. Strains from these genera can serve as vital quality markers for preserving fish and other seafood.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e6.1 Ethics approval and consent to participate\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e6.2 Consent for publication\\u003c/p\\u003e\\n\\u003cp\\u003eAll authors have consented to the submission of this manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e6.3 Availability of data and material\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;Data and material can be made available upon request.\\u003c/p\\u003e\\n\\u003cp\\u003e6.4 Competing interests\\u003c/p\\u003e\\n\\u003cp\\u003eNo competing interests.\\u003c/p\\u003e\\n\\u003cp\\u003e6.5 Funding\\u003c/p\\u003e\\n\\u003cp\\u003eGDC Alimentos S/A.\\u003c/p\\u003e\\n\\u003cp\\u003e6.6 Authors\\u0026apos; contributions\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;Luca Frondana: Data curation, Formal analysis, Investigation, Methodology Roles/Writing - original draft.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;Daniel da Rosa Farias - Data curation, Formal analysis Roles/Writing - original draft; Writing - review \\u0026amp; editing.;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;Delano Dias Schleder - Funding acquisition, Conceptualization, Supervision, Formal analysis, Visualization, Roles/Writing - original draft; Writing - review \\u0026amp; editing.\\u003c/p\\u003e\\n\\u003cp\\u003e6.7 Acknowledgements\\u003c/p\\u003e\\n\\u003cp\\u003eWe thank GDC Alimentos S/A for funding this study.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eAyala-del-r\\u0026iacute;o, H.L., Chain, P.S., Grzymski, J.J., Ponder, M.A., Ivanova, N., Bergholz, P.W., Di Bartoli, G., Hauser, L., Land, M., Bakermans, C. (2010). The genome sequence of Psychrobacter arcticus 273-4, a psychroactive Siberian permafrost bacterium, reveals mechanisms for adaptation to low-temperature growth. Applied and Environmental Microbiology, 76, 2304-2312. https://doi.org/10.1128/AEM.02101-09\\u003c/li\\u003e\\n\\u003cli\\u003eBowman, J.P., McCammon, S.A., Brown, M.V., Nichols, D.S., McMeekin, T.A. (1997). Diversity and association of psychrophilic bacteria in Antarctic sea ice. Applied and Environmental Microbiology, 63, 3068-3078. https://doi.org/10.1128/aem.63.8.3068-3078.1997\\u003c/li\\u003e\\n\\u003cli\\u003eBozal, N., Montes, M.J., Tudela, E., Guinea, J. (2003). Characterization of several Psychrobacter strains isolated from Antarctic environments and description of Psychrobacter luti sp. and Psychrobacter fozii sp. International Journal of Systematic and Evolutionary Microbiology, 53(Pt 4), 1093-1100. https://doi.org/10.1099/ijs.0.02457-0\\u003c/li\\u003e\\n\\u003cli\\u003eBurtseva, O., Kublanovskaya, A., Baulina, O., Fedorenko, T., Lobakova, E., Chekanov, K. (2020). The strains of bioluminescent bacteria isolated from the White Sea finfishes: Genera Photobacterium, Aliivibrio, Vibrio, Shewanella, and first luminous Kosakonia. Journal of Photochemistry and Photobiology B: Biology, 111895. https://doi.org/doi:10.1016/j.jphotobiol.2020.111895\\u003c/li\\u003e\\n\\u003cli\\u003eFAO (Food And Agriculture Organization Of The United Nations). The state of world fisheries and aquaculture. Italy, 2022.\\u003c/li\\u003e\\n\\u003cli\\u003eFDA (Food and Drug Administration). Scombrotoxin (histamine) formation. Ch. 7. In Fish and Fishery Products Hazards and Controls Guidance (pp. 83-102). Washington, 2020.\\u003c/li\\u003e\\n\\u003cli\\u003eGonz\\u0026aacute;lez, C.J., Santos, J.A., Garc\\u0026iacute;a-L\\u0026oacute;pez, M.L., Otero, A. (2000). Psychrobacters and related bacteria in freshwater fish. Journal of Food Protection, 63, 315-321. https://doi.org/10.4315/0362-028X-63.3.315\\u003c/li\\u003e\\n\\u003cli\\u003eGarrity, G.M., Bell, J.A., Lilburn, T. (2005). Bergey\\u0026apos;s Manual of Systematic Bacteriology (pp. 491-494). Springer, New York.\\u003c/li\\u003e\\n\\u003cli\\u003eGram, L. (2009). Microbiological spoilage of fish and seafood products. In: Sperber, W., Doyle, M. (Eds.), Compendium of the microbiological spoilage of foods and beverages (pp. 87-119). New York: Springer.Jay, J.M., Loessner M.J., Golden, D.A. 2005. Modern Food Microbiology. 7.ed, p.101-124, SpringerLink.\\u003c/li\\u003e\\n\\u003cli\\u003eLakshmanan, R., Shakila, R., Jeyasekaran, G. (2002). Survival of amine-forming bacteria during the ice storage of fish and shrimp. Food Microbiology, 19, 617-625. https://doi.org/10.1006/fmic.2002.0481\\u003c/li\\u003e\\n\\u003cli\\u003eLehane, L., Lewis, R.J. (2000). Ciguatera: recent advances but the risk remains. International Journal of Food Microbiology, 61(2-3), 91-125. https://doi.org/10.1016/S0168-1605(00)00382-2\\u003c/li\\u003e\\n\\u003cli\\u003eLeisner, J.J., Gram, L. (2014). Danish Institute for Fisheries Research, Danish Technical University, Lyngby, Denmark. Elsevier Ltd. https://doi.org/10.1016/B978-0-12-384730-0.00125-7\\u003c/li\\u003e\\n\\u003cli\\u003eLove, M.I., Huber, W., Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology, 15(12). https://doi.org/10.1186/s13059-014-0550-8\\u003c/li\\u003e\\n\\u003cli\\u003eMartini, S., Al Ali, B., Garel, M., Nerini, D., Grossi, V., Pacton, M. (2013). Effects of hydrostatic pressure on growth and luminescence of a moderately-piezophilic luminous bacterium Photobacterium phosphoreum ANT-2200. PLoS One, 8, e66580. https://doi.org/10.1371/journal.pone.0066580\\u003c/li\\u003e\\n\\u003cli\\u003eMasashi, K., Yoda, T., Masanori, I., Teizo, T.O. (2004). Photobacterium phosphoreum caused a histamine fish poisoning incident. International Journal of Food Microbiology, 92(1), 79-87. https://doi.org/10.1016/j.ijfoodmicro.2003.08.019\\u003c/li\\u003e\\n\\u003cli\\u003eMAPA (Ministry of Agriculture, Livestock, and Food Supply). (2019). Government eliminates import tariffs on sardines for one year. Available at: https://www.gov.br/agricultura/pt-br/assuntos/noticias/governo-reduz-tarifa-de-importacao-de-sardinha-a-zero-por-um-ano. Accessed May 16, 2021.\\u003c/li\\u003e\\n\\u003cli\\u003eMAPA (Ministry of Agriculture, Livestock, and Food Supply), Bras\\u0026iacute;lia. (2010). Brazil, 2020. Regulation of Industrial and Sanitary Inspection of Animal Products (RIISPOA).\\u003c/li\\u003e\\n\\u003cli\\u003eMarshall, D.L. (2014). Spoilage of Animal Products | Seafood. In: Batt, C.A., Tortorello, M.L. (eds.) Encyclopedia of Food Microbiology, 3rd ed., 2021-2029. https://doi.org/10.1016/B978-0-12-384730-0.00372-4\\u003c/li\\u003e\\n\\u003cli\\u003eM\\u0026oslash;retr\\u0026oslash;, T., Langsrud, S. (2017). Residential bacteria on surfaces in the food industry and their implications for food safety and quality. Comprehensive Reviews in Food Science and Food Safety, 16, 1022-1041. doi.org/10.1111/1541-4337.12283\\u003c/li\\u003e\\n\\u003cli\\u003eM\\u0026oslash;retr\\u0026oslash;, T., Moen, B., Heir, E., Hansen, A. A., Langsrud, S. (2016). Contamination of salmon fillets and processing plants with spoilage bacteria. International Journal of Food Microbiology, 237, 98\\u0026ndash;108. https://doi.org/10.1016/j.ijfoodmicro.2016.08.016\\u003c/li\\u003e\\n\\u003cli\\u003eMoi, I.M., Roslan, N.N., \\u0026amp; Leow, A.T.C. (2017). The biology and importance of Photobacterium species. Applied Microbiology and Biotechnology, 101, 4371\\u0026ndash;4385. https://doi.org/10.1007/s00253-017-8300\\u003c/li\\u003e\\n\\u003cli\\u003eOksanen, J., Blanchet, F.G., Friendly, M., Kindt, R., Legendre, P., Mcglinn, D., Wagner, H. (2019). Vegan: Community Ecology Package. R package version 2.5-5. https://CRAN.R-project.org/package=vegan\\u003c/li\\u003e\\n\\u003cli\\u003eOku, N., Kawabata, K., Adachi K., Katsuta A., Shizuri, Y. (2008). Unnarmicins A and C, new antibacterial depsipeptides produced by marine bacterium Photobacterium sp. MBIC06485. The Journal of Antibiotics, 61, 11\\u0026ndash;17. doi.org/10.1038/ja.2008.103\\u003c/li\\u003e\\n\\u003cli\\u003eOliveira, H.A.C. (2004). Determination of histamine by reversed-phase high-performance liquid chromatography in canned tuna and sardines. Revista Ci\\u0026ecirc;ncia Agron\\u0026ocirc;mica, 35(Special issue), 179-188.\\u003c/li\\u003e\\n\\u003cli\\u003eParrilli, E., Tedesco, P., Fondi, M., Tutino, M.L., Giudice, A., Pascale, D., Fani, R. (2021). The art of adapting to extreme environments: The model system Pseudoalteromonas. Physics of Life Reviews, 36, 137-161. doi.org/10.1016/j.plrev.2019.04.003\\u003c/li\\u003e\\n\\u003cli\\u003eRossano, R., Mastrangelo, L., Ungaro, N., Riccio, P. (2006). Influence of storage temperature and freezing time on histamine level in the European anchovy Engraulis encrasicholus (L., 1758): a study by capillary electrophoresis. Journal of Chromatography B, 830(1), 161-164. https://doi.org/10.1016/j.jchromb.2005.10.026\\u003c/li\\u003e\\n\\u003cli\\u003eShiliang, J., Yiming, L., Shuai, Z., Xiaohui, S., Yan, L., Hui, H., Yuanmeng, L., Yongkang, L. (2019). Effect of \\u0026epsilon;-polylysine and ice storage on microbiota composition and quality of Pacific white shrimp (Litopenaeus vannamei) stored at 0 \\u0026deg;C. Food Microbiology, 83, 27-35. https://doi.org/10.1016/j.fm.2019.04.007\\u003c/li\\u003e\\n\\u003cli\\u003eTakahashi, H., Ogai M., Miya S., Kuda T., Kimura B. (2015). Effects of environmental factors on histamine production in the psychrophilic histamine-producing bacterium Photobacterium iliopiscarium. Food Control, 52, 39-42. https://doi.org/10.1016/j.foodcont.2014.12.023\\u003c/li\\u003e\\n\\u003cli\\u003eThompson, F.L., Swings, J. (2006). Taxonomy of the Vibrios. In: F.L. Thompson, B. Austin, \\u0026amp; J. Swings (Eds.), The Biology of Vibrios (pp. 29-43). Washington DC: ASM Press. https://doi.org/10.1128/9781555815714\\u003c/li\\u003e\\n\\u003cli\\u003eWang, Y., Naumann, U., Eddelbuettel, D., Wilshire, J., Warton, D., Byrnes, J., Silva V. S., Niku, J., Renner, I., Wright, S. (2022). mvabund: Statistical Methods for Analysing Multivariate Abundance Data. R package version 4.0.1. https://CRAN.R-project.org/package=mvabund\\u003c/li\\u003e\\n\\u003cli\\u003eWickham, H. (2016). ggplot2: Elegant Graphics for Data Analysis. Springer-Verlag, New York.\\u003c/li\\u003e\\n\\u003cli\\u003eWidder, E.A. (2010). Bioluminescence in the ocean: Origins of biological, chemical, and ecological diversity. Science, 328, 704-708.\\u003c/li\\u003e\\n\\u003cli\\u003eYang, X. (2014). Moraxellaceae. In Encyclopedia of Food Microbiology (Second Edition) (pp. 826-833). Academic Press. https://doi.org/10.1016/B978-0-12-384730-0.00441-9.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Histamine, Canned Fish, Scombrotoxin, Fish Poisoing, Fishing Industry\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3195309/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3195309/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eIn some fish species, such as tuna, mackerel, and sardines, improper handling after fishing promotes the growth of histamine-forming bacteria. If consumed, histamine-contaminated fish can cause various symptoms, including vomiting, diarrhea, erythema, urticaria, and even anaphylaxis in severe cases. Understanding the main bacteria responsible for histamine production is crucial for public health. This study utilized next-generation sequencing to analyze the bacterial community in histamine-contaminated sardines. For this study, 1000 g of muscle samples were collected from 40\\u0026ndash;45 sardines per batch, all obtained from the same supplier, fishing area, and time period, for histamine analysis. Samples from five different batches with \\u0026ge;\\u0026thinsp;200 ppm of histamine (contaminated) and five with \\u0026lt;\\u0026thinsp;1 ppm (non-contaminated) underwent microbial analysis. Histamine-contaminated sardines exhibited lower microbial diversity and a higher abundance of the genera \\u003cem\\u003ePhotobacteria\\u003c/em\\u003e and \\u003cem\\u003eShewanellae\\u003c/em\\u003e. These bacteria thrive under mild temperatures and indicate fish spoilage and the production of biogenic amines. In contrast, \\u003cem\\u003ePsychobacter\\u003c/em\\u003e and \\u003cem\\u003ePseudoalteromonas\\u003c/em\\u003e, known to withstand harsh conditions, including low temperatures, were more prevalent in non-contaminated sardines. Our findings suggest that contaminated sardines experienced inadequate refrigeration during transportation and processing, indicating the potential use of \\u003cem\\u003ePsychobacter\\u003c/em\\u003e and \\u003cem\\u003ePseudoalteromonas\\u003c/em\\u003e as quality indicators for fish.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Bacterial community in sardines condemned for histamine contamination: a case study in the canned fish industry\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2023-08-01 22:46:54\",\"doi\":\"10.21203/rs.3.rs-3195309/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"7da8db17-47a4-4e3f-bd62-9ee0ac18adc8\",\"owner\":[],\"postedDate\":\"August 1st, 2023\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2023-11-08T14:29:37+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2023-08-01 22:46:54\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3195309\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3195309\",\"identity\":\"rs-3195309\",\"version\":[\"v1\"]},\"buildId\":\"FbvkV6FR0MCFSLy54lSbu\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}