{"paper_id":"09606596-dd18-40fc-93a8-7fb0f281d45e","body_text":"Molecular phylogenetics suggest Osmiopsis (Asteraceae) is a rare inter-subtribal hybrid genus on Hispaniola | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report Molecular phylogenetics suggest Osmiopsis (Asteraceae) is a rare inter-subtribal hybrid genus on Hispaniola Rogério N. Ribeiro, Vanessa L. Rivera, Christina C. Vinson Williams, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6938723/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Osmiopsis (Asteraceae, Eupatorieae) is endemic to Hispaniola and one of the seven genera of subtribe Praxelinae. When Osmiopsis was established in 1975, the authors hypothesized it was a hybrid and proposed Chromolaena (subtribe Praxelinae) and Koanophyllon (subtribe Critoniinae) as putative parent genera. Phylogenetic investigation of subtribe Praxelinae, reconstructed within a matrix of 202 species of tribe Eupatorieae has clarified its origin. An ILD test showed significant incongruity between the nuclear and chloroplast trees ( p = 0.001). Based on Bayesian analysis of ITS, O. plumieri emerged in a strongly supported clade (PP = 0.98) of 23 species of Critoniinae, closely allied to six Koanophyllon species. Based on Bayesian analysis of ndhF , O. plumieri emerged in a strongly supported clade (PP = 1) of 20 species of Praxelinae with Chromolaena , Praxelis and three other genera. These results suggest Osmiopsis is hybrid between Chromolaena and Koanophyllon . Osmiopsis shares with Koanophyllon : Infundibuliform corolla with a cylindrical base, triangular corolla lobes, and anther appendages wider than longer. O. plumieri shares with Chromolaena and Praxelis : semi-scandent habit and deciduous involucral bracts. As far as we are aware, this is the first case of a possible inter-subtribal nothogenus in the Asteraceae. In the Asteraceae, Koanophyllon has more Caribbean island endemics than any other genus. This raises the question if hybridization has played a significant role in the diversification of the Caribbean flora, as has been shown in species-rich genera from volcanic archipelagos. Taxonomically, it raises the question if sister subtribes Praxelinae and Critoniinae should be united. Caribbean Compositae Critoniinae Praxelinae Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Osmiopsis R.M.King & H.Robinson (Asteraceae) was described as a monotypic genus endemic to the Caribbean Island of Hispaniola. It is one of the seven genera that comprise subtribe Praxelinae R.M.King & H.Robinson and the only genus of the subtribe that does not occur in South America. Subtribe Praxelinae has been considered monophyletic (Rivera et al. 2016) and is one of the 17 subtribes of tribe Eupatorieae. Osmiopsis plumieri , the single species of the genus, was described by Urban and Ekman in the genus Eupatorium (Urban 1931) based on several Haitian Ekman collections made in the early twentieth century. The epithet that appears in the original publication was spelled plumeri but this has been corrected following Article 60.1 of the International Code of Nomenclature for algae, fungi, and plants, as it is almost certainly a reference to the French monk and botanist Charles Plumier (1646–1704), one of the first Europeans to collect plants in Haiti. A new combination Chromolaena plumieri (Urban & Ekman) R.M.King & H.Robinson was published in 1970 (King and Robinson 1970). However, five years later, King and Robinson revised the taxonomic position of this species and proposed the genus Osmiopsis to accommodate it (King and Robinson 1975). Publication of Osmiopsis was unusual in that the authors stated that the genus was probably an intergeneric hybrid. They argued that a scandent habit and 4–5-seriate, imbricate, deciduous, involucral bracts were characteristic of Chromolaena DC. (subtribe Praxelinae), whilst wide, glandulose corolla lobes, short anther appendages and enlarged tips to stylar branches were typical of Koanophyllon Arruda (subtribe Critoniinae). Moreover, they stated that the hybrid origin was: ‘based on circumstantial evidence of character distribution’ and that ‘evidence would indicate further that such hybrids were totally viable and capable of further evolution, but that the hybridizations all apparently date from some earlier period and are not continuing at this time’ (King and Robinson 1975: 250). These statements were not supported by any further discussion, nor by any numerical analysis or molecular data. The putative Koanophyllon parent proposed by King and Robinson was either K. selleanum (Urb.) R.M.King & H.Robinson or K. phanioides (Krug & Urb.) R.M.King & H.Robinson; both of which are endemic to Hispaniola (POWO 2024). King and Robinson did not propose a putative parent in Chromolaena . Osmiopsis plumieri is known from at least 12 collections made between 1924 and 1929 in Haiti. King and Robinson (1975) observed that Osmiopsis plumieri is frequently misidentified in herbaria as K. selleanum (which has 8 to 12 florets per capitulum) or as K. phanioides (which has basally persistent involucral bracts), a fact that presumably led them to propose either one of these species as putative parents in Koanophyllon . Despite its monophyletic status, the relationships between the genera of subtribe Praxelinae have not yet been fully clarified (Rivera et al. 2016). During our phylogenetic studies of subtribe Praxelinae (Ribeiro 2023), strong incongruence was found between chloroplast ( ndhF ) and nuclear (ITS) trees in the positioning of Osmiopsis . The purpose of this paper is to further investigate the origin of Osmiopsis . Material and Methods Phylogenetic Trees DNA was extracted from a paratype of Osmiopsis plumieri ( Ekman 6490 , LL) and other members of subtribe Praxelinae (Fig. 1 ; see also Suppl. Table 1 for all other vouchers). Molecular analysis was performed in the Plant Molecular Biology Laboratory, University of Brasilia. The extraction of total genomic DNA was performed from other specimens of Praxelinae usually from silica-dried leaf material using the Riahi et al. (2010) protocol, which proved more efficient than the traditional CTAB protocol (Doyle and Doyle 1987). The ITS marker of the 18S-26S ribosomal RNA genes, including the 5.8S gene (nuclear marker), and the ndhF (chloroplast marker) were amplified using standard PCR protocols and primers ITS-4 (TCCTCCGCTTATTGATATGC) and ITS-5 (GGAAGTAAAAGTCGTAACAAGG), ndhF 52 (AGGTAAGATCCGGTGAATCGGAAA) and ndhF 1212 (GGTGGAATACCACAAAGA), respectively. PCRs were carried out in a final volume of 20 µL (Suppl. Table 2). Amplicons were sequenced using the DNA sequencing services of BPI Biotecnologia in Botucatu, Brazil. Sequences were imported into the program Geneious v.11, and were aligned with MUSCLE (Edgar 2004) followed by visual inspection and manual alignment, when appropriate. The Osmiopsis ITS and ndhF sequences were then added to a matrix of ITS and ndhF sequences of 202 species of tribe Eupatorieae and realigned as described above. Each genetic marker was run on jModeltest 2.1.10 (Guindon and Gascuel 2003; Darriba et al. 2012); the model GTR (with gamma-distributed rate variation across sites) was selected as the best evolutionary model under the Akaike Information Criteria (AIC). Each genetic marker was also analyzed as a single partition with the above chosen model of evolution A third matrix with additional markers was also constructed to improve resolution and test the position of Osmiopsis (Ribeiro 2023). This matrix contained the following molecular data from nuclear and chloroplast markers: ITS and ETS (nuclear) and ndhF , ndhI , and the ndhI - ndhG intergenic spacer (chloroplast). Bayesian inference analysis was undertaken on these three matrices using MrBayes 3.2.7a (Ronquist and Huelsenbeck 2012) on the CIPRES science gateway (Miller et al. 2010); all sequences are available in Genbank (Clark et al. 2016) except for the following five, donated by the authors of the cited unpublished doctoral theses: Acritopappus connatifolius (Soares Nunes) R.M. King & H. Rob., A. diamantinicus H. Bautista, A. pereirae H. Bautista, and A. teixeirae R.M. King & H. Rob. (Bautista 2000); and Parapiqueria cavalcantei R.M. King & H. Rob. (Fernandes 2014). Evidence of hybrid origin We evaluated the incongruence between the nuclear marker tree (ITS) and the chloroplast marker tree ( ndhF) (for which sequences of Osmiopsis were available) using the incongruence length difference test (ILD test; Farris et al. 1995). Both these markers were highly informative in reconstructing the phylogeny of the Eupatorieae (Rivera et al. 2016). The ILD test has been criticized because of a high false positive rate (Cunningham 1997; Darlu and Lecointre 2002; Hipp et al. 2004), therefore, to reduce false positives we followed the recommendations of Cunningham (1997) and Pelser et al. (2010) and only considered ILD p-values below 0.01 as evidence of significant incongruence. We implemented the ILD test in PAUP (Swofford 2002) on the CIPRES platform (Miller et al. 2010) as a partition-homogeneity test with a heuristic search of 1000 replicates and random addition of sequences. Geographic distribution Geographic distribution was obtained from the literature (Acevedo-Rodríguez and Strong 2012), Plants of the World Online (POWO 2024) and online herbaria in GBIF; the map was produced with QGIS 3.10.14 software ( https://www.qgis.org ). Morphology and Chromosome counts We also analysed Osmiopsis plumieri morphologically and compared its habit, leaf shape and floral characters to all possible parental species that occur on Hispaniola (Acevedo-Rodríguez and Strong 2012) by analysing images of herbarium specimens available online; the identification of all such herbarium specimens were checked. The I-Naturalist site ( www.inaturalist.org ) was searched for images of plants identified as Chromolaena , Praxelis or Koanophyllon from Hispaniola, with two main objectives: 1) to detect if Osmiopsis still occurs on the island; and 2) to detect if any other genera of the Praxelinae outside of Chromolaena occurs on the island. In addition, chromosome numbers in Chromolaena , Koanophyllon and Praxelis were investigated in CCDB - The Chromosome Counts Database (Rice et al. 2015) to evaluate the potential of successful hybridization. Results Phylogenetic trees The reconstructed phylogeny of the whole of tribe Eupatorieae based on the nuclear matrix of ITS + ETS and the chloroplast matrix of ndhF + ndhI + ndhI-G IGS showed good resolution (Suppl. Figure 1). O. plumieri appeared nested in a highly supported clade (PP = 0.97) among all sampled species of Koanophyllon , allied to Idiothamnus lilloi (B.L.Rob.) R.M.King & H.Rob. and Chromolaena collina (DC.) R.M.King & H.Rob. Evidence of hybrid origin The ILD test results showed significant incongruence between the ITS and the ndhF data matrices ( p -value of 0.001). The phylogenetic tree of the nuclear ITS marker recovered a clade of 25 species of Praxelinae; however, Osmiopsis did not group with this clade (Ribeiro, 2023). Instead, Osmiopsis emerged in a highly supported clade (PP = 0.99) that included most sampled taxa of the Critoniinae (but not Critonia P.Browne), as well as genera from two other subtribes, namely Ageratum L. (subtribe Ageratinae) and Fleischmannia Sch.Bip. (subtribe Fleischmanniinae) (Fig. 2 ). Within this clade, Osmiopsis emerged in a subclade (subclade A; PP = 0.83) that included five species of Koanophyllon (Critoniinae), Idiothamnus lilloi (B.L.Rob.) R.M.King & H.Rob. (Critoniinae) and Chromolaena collina (DC.) R.M.King & H.Rob. (Praxelinae). The phylogenetic tree of the chloroplast ndhF marker (Fig. 3 ) recovered a Praxelinae clade with suboptimal support (PP = 0.83); if Chromolaena sagittata , (A.Gray) R.M.King, which is sister to the rest of the Praxelinae, is disconsidered, the remaining clade has maximum support (subclade A; Fig. 3 ; PP = 1). Osmiopsis plumieri emerged within this clade, and was nested within the “ Praxelis” suclade B. This “ Praxelis ” subclade B included eight species: four species of Praxelis Cass., Eitenia praxelioides R.M.King & H.Rob, Eupatoriopsis hoffmanniana Hieron., Praxeliopsis matogrossensis G.M.Barroso and Osmiopsis plumieri . Geographic distribution Osmiopsis plumieri has been recorded from both northern and southern Haiti and in Montfleury (GBIF 2023) near Port au Prince (Fig. 4 ). In northern Haiti, it was recorded from the vicinity of St. Michel de l'Atalaye and around Môle Saint-Nicolas. In southern Haiti, it was recorded from the Massifs des Matheux, des Cahos, de la Selle, and de la Hotte. In the Massif de la Selle and de la Hotte it was recorded from several mountains: Morne à Cabrits; Morne Rochelois; Morne Sentier; and Morne de l'Hôpital. The 1968 collection made by Alain Liogier in the Dominican Republic ( Liogier 12804 ; P), identified by an unknown person as Osmiopsis plumieri , is in fact a specimen of Koanophyllon selleanum . We did not find any herbarium image or any field image in I-naturalist that might prove the recent presence of either Osmiopsis or of any other genus of subtribe Praxelinae on Hispaniola except Chromolaena . Morphology and chromosome counts Osmiopsis plumieri shows characters that are often present in Chromolaena/Praxelis , such as the imbricate involucre and the deciduous involucral bracts (Table 1 ). However, some species within subtribe Critoniinae rarely also show an imbricate involucre and deciduous internal involucral bracts. The reproductive characters, however, namely the shape of the corolla, of the corolla lobes and the anther appendages, are very similar to those found in Koanophyllon and are never found in the Praxelinae. Hypothetical parent species are compared morphologically in Table 2 . Chromosome counts for potential parental taxa are variable. Chromolaena and Praxelis are both apomictic with base numbers of x = 10 (King and Robinson,1987; Robinson 2009). Within the Praxelinae, there are records of n = 10, 20, and 30 in the invasive species Praxelis clematidea R.M.King & H.Rob. and of a polyploid series in Chromolaena odorata (L.) R.M. King & H.Rob. (Table 2 ). Within Koanophyllon , n = 10 is the most common count, recorded in nine species; other counts recorded are n = 15 ( K. longifolia (B.L.Rob.) R.M.King & H.Rob.; Watanabe et al. 1995), n = 20 ( K. sciatraphes (B.L.Rob.) R.M.King & H.Rob. and K. tatei (B.L.Rob.) R.M.King & H.Rob.; Torres and Liogier 1970) and n = 30 ( K. pittieri (Klatt) R.M. King & H.Rob.; Robinson et al. 1989). Chromosome counts for either of the most likely parent plants based on morphology ( Koanophyllon phanioides or K. selleanus ) were not found. Two species of Koanophyllon that occur on Hispaniola have chromosome counts: K. sciatraphes (n = 20; Torres and Liogier 1970) and K. villosum (Sw.) R. M. King & H. Rob. (n = 10; Keil et al. 1988). The count of K. sciatraphes is based on material from Hispaniola (Dominican Republic) and the count of K. villosum is based on material from Jamaica (Torres and Liogier 1970; Keil et al. 1988). Table 1 Differences and similarities in vegetative and reproductive characteristics between Osmiopsis , Chromolaena , Praxelis and Koanophyllon . Terminology follows King and Robinson (1987). Character Chromolaena and Praxelis Koanophyllon Osmiopsis Involucral bract persistence None persistent or only internal bracts persistent All persistent or at least external bracts persistent None persistent Involucre shape Imbricate Eximbricate Imbricate Corolla shape Cylindrical with slightly narrowed base Funnelform with cylindrical base Funnelform with cylindrical base Corolla lobes Oblong or ovate (longer than broad) Triangular (broader than long) Triangular (broader than long) Anther appendices Oblong (longer than broader) Emarginate (broader than longer) Semicircular (broader than longer) Discussion Phylogenetic Trees Our phylogenetic tree shows improved sampling within the Praxelinae (compared to the most recent tree; Rivera et al. 2016), with all genera represented by their type species. However, sampling within the large genus Chromolaena (160 species; POWO 2024) is still poor. Only 15 species (< 10%) had sequences in Genbank ( https://www.ncbi.nlm.nih.gov/ - search details \"Chromolaena\"[Organism]), to which the present study has added another 10 species (Suppl. Table 1). Evidence of hybrid origin Robinson et al. (1989) stated that much more hybridization probably occurred in the Asteraceae than believed by botanists, and that hybridization was likely to be an important contributing factor to the family’s evolutionary success. This view has been supported by later studies (Arnold 1997; Stace et al. 2015). Hybridization facilitated ecological transitions to extreme habitats in the genus Helianthus , Asteraceae (Rieseberg et al. 2003). Francisco-Ortega et al. (1996), studying Argyranthemum , the most diverse genus of Asteraceae in the Macaronesian islands (Madeira, Canary Islands, etc.) postulated that hybridrization played an important part in its diversification: different chloroplast lineages occupied different habitats. Inter-generic hybrids, however, are uncommon in nature; in the British flora, where hybrids have been well studied, only four inter-generic hybrids (nothogenera) have been recorded, out of 57 hybrid Asteraceae (Stace et al. 2015). These nothogenera are usually morphologically intermediate between the parent taxa and sterile, with one of the parents native and the other an introduced alien (Suppl. Table 3). The ndhF phylogenetic tree grouped Osmiopsis in a clade with Praxelis , Eitenia , Eupatoriopsis and Praxeliopsis (Fig. 3 ). Since in most angiosperms chloroplasts are maternally inherited (Greiner et al. 2015) it appeared likely that the maternal parent of Osmiopsis would be found in this clade. However, no species of Praxelis , Eitenia , Eupatoriopsis or Praxeliopsis have ever been recorded on Hispaniola (Acevedo-Rodrigues and Strong 2012; this study). This suggests two possibilities: 1) the maternal plant could be Praxelis clematidea (Hieron. ex Kuntze) R.M.King & H.Rob., a widespread invasive, now established in Australia, China, Southeast Asia, and Florida (Salgado et al. 2022), that may occur in Hispaniola (or may have occurred); or 2) the maternal parent is a Chromolaena species closely related to the Praxelis clade, since the Praxelis clade is nested within Chromolaena. The ndhF marker is a highly conserved, coding gene and the ndhF sequence of C. laevigata (Lam.) R.M.King & H.Rob., for example, is identical to that of the Praxelis clade (although all other Chromolaena species with available sequence data differed by at least one base). C. laevigata , however, is not known to occur on Hispaniola (Acevedo-Rodriguez and Strong, 2012). Five Chromolaena species are known from Hispaniola: C. corymbosa (widely distributed in the Caribbean), C. heterosquamea (Urb. & Ekman) R.M.King & H.Rob. (endemic to Hispaniola); C. sinuata (Lam.) R.M.King & H.Rob. (endemic to Hispaniola), C. ivifolia (L.) R.M.King & H.Rob. (widely distributed in the Caribbean, North and South America), and C. odorata (L.) R.M.King & H.Rob., an aggressive, widely distributed alien (Acevedo-Rodriguez and Strong, 2012; POWO, 2023). C. heterosquamea can be discarded as maternal plant as it appears to belong to another genus: it has 2–3 series of involucral bracts that are subimbricate and the corolla broadens towards the apex, with triangular lobes. C. odorata can probably be excluded as its ndhF marker differs from Osmiopsis by two bases. The ndhF sequences of C. corymbosa , C. ivifolia and C. sinuata are unknown. Other cases of hybrid status detected by incongruence between the chloroplast and nuclear phylogenetic trees are known in the Asteraceae, but these are either within a single genus ( Hieracium ; Fehrer et al. 2007) or different genera of the same subtribe (Liatrinae: Schilling, 2011; Lactucinae: Wang et al., 2013; Fehrer et al., 2007; Kilian et al., 2017; Anthemidinae: Stace, 2015). Schilling (2011) proposed a hybrid origin for two monotypic genera within subtribe Liatrinae: Hartwrightia A.Gray ( H. floridana A.Gray ex S.Watson) and Litrisa Small ( L. carnosa Small). Schilling’s hypothesis of a hybrid origin used the same principle and method adopted in our study, i.e., incongruence between the nuclear and chloroplast phylogenetic trees. The Liatrinae phylogenetic tree showed two major clades. Schilling (2011) found that the nuclear markers (ITS and ETS) placed Hartwrightia and Litrisa in the ‘ Trilisa clade’ (PP = 1; BS = 88), while the chloroplast markers placed them in its sister clade (PP = 0.74; BS < 50) with Carphephorus Cass. and Liatris Gaertn. ex Schreb. Litrisa is morphologically intermediate between the putative parent genera Trilisa and Carphephorus . Hartwrightia , however, is morphologically transgressive, showing a loss of several features present in either one or both of the parental genera (Schilling 2011), such as leaf punctuation, paleae, floral pigment, anther appendages, pappus bristles, and simple cypselae hairs, as well as changes in involucral bract series and cypselae rib number. Geographic distribution Recent Asteraceae collections from the Dominican Republic and Haiti are only available as physical specimens for in loco examination, and we have not been able to visit Hispaniola, so we do not know if × Osmiopsis plumieri persists in the Hispaniola flora. However, in the 1920s it had a widespread distribution in Haiti (Fig. 4 ). This suggests that it was either an established, successful fertile hybrid (or species of hybrid origin) or that the parental taxa were common enough for independent hybridizations to be regular events. Evidence that Praxelis (the most likely maternal parent genus) does not occur on Hispaniola [obtained from GBIF, I-Naturalist and its absence from Acevedo-Rodríguez and Strong (2012) in their Catalogue of Seed Plants of the West Indies] is suboptimal, so botanists collecting on Hispaniola are urged to look for species of this genus. Morphology and chromosome counts Morphologically, C. sinuata appears most similar to Osmiopsis plumieri (see Table 2 ). Identifying a hypothetical paternal taxon based on the nuclear ITS tree (Fig. 2 ) that positioned Osmiopsis with Koanophyllon is more challenging, as Koanophyllon is very species-rich genus on Hispaniola (c. 35 species; Acevedo-Rodríguez and Strong 2012). Among these 35 species, K. phanioide s, one of the putative parents suggested by King and Robinson (1975), is morphologically most similar to O. plumieri (Table 2 ). In addition to the reproductive characteristics cited by King and Robinson, we would add the leaf shape, that is lobed at the base and entire in the upper half, and the long petioles (Fig. 5 ). Koanophyllon is the genus with more species endemic to the Caribbean than any other genus of Asteraceae (Francisco-Ortega et al. 2008). Within tribe Eupatorieae, Robinson et al. (2009) hypothesized that species belonging to the subtribes with a chromosome base count x = 10, that are usually more derived, would be more likely to cross than those belonging to subtribes with other counts, and might result in inter-generic or inter-subtribal hybrids. This hypothesis is supported by our results. Future chromosome counts together with experimental artificial hybridization between putative parents would be desirable. Table 2 Comparison of Osmiopsis with possible parental taxa occurring on Hispaniola. Chromosome counts obtained from the CCDB (Rice & Mayrose 2023). Characters present in Osmiopsis in bold underlined . Species / chromosome counts Habit Leaf shape Leaf base and margin Involucral bracts (series) Involucre length (mm) Involucre width (mm) Osmiopsis plumieri n=? Scandent shrubs Ovate to lanceolate Base often lobed, margin distally entire 4–5 3–5 2–3 C. corymbosa (M?) n = 20 Shrubs Deltoid to cordate Base round, margin often crenate 6–7 7 to 9 3.3 to 4 C. ivifolia (M?) n = 25 Shrubs Lanceolate Base often acute, margin entire or serrate 6–7 5.5–7.8 2.7 to 4 C. odorata (M?) n = 20,29,30,31 40,51,60 Scandent shrubs Ovate to lanceolate Base often round, margin serrate 5–7 8.2–9.6 2.6 to 3.5 C. sinuata (M?) (n=?) Shrubs Ovate Base truncate to cuneate, margin sinuate- lobed 3–5 3–4 2 K. selleanum (P?) (n=?) Scandent Shrubs Ovate to elliptical Base subcordate, margin entire 3 3–5 2–3 K. phanioides (P?) (n=?) Scandent Shrubs Ovate to lanceolate Base often lobed, distal margins entire 3 2–4 2–3 C. = Chromolaena ; K. = Koanophyllon ; P? = paternal; M? = maternal. n = haploid chromosome count. Conclusion Our work adds further evidence to the theory that reticulate evolution is common in the Asteraceae, and that a simple combined molecular marker phylogenetic tree should not trusted, even if clades are highly supported, to correctly assess relationships (see Suppl. Figure 1). Testing for incongruence between nuclear and chloroplast phylogenetic trees is essential in this family. Studies in the volcanic Macaronesian islands have suggested that in locally diverse genera, hybridization has played a significant role (Franciso-Ortega et al. 1996; Barber et al. 2007); these authors also found that chloroplast “clades” showed geographic structuring (a phenomenon not restricted to islands; Riesberg and Soltis 1991; Schuster et al. 2018) suggesting chloroplast capture. Koanophyllon , the richest Asteraceae genus in Caribbean endemics, with species in Cuba, Jamaica, Hispaniola, and Puerto Rico, appears a promising taxon to investigate hybridization in the Caribbean flora. As far as we are aware, our study is also the first to suggest an inter-subtribal generic hybrid supported by molecular data in the Asteraceae. Further sampling of the nuclear and chloroplast genomes of Osmiopsis , and of the species of Koanophyllon and Chromolaena that occur in Hispaniola, are needed to definitely confirm hybrid status, and identify the parental species. The current subtribal circumscription (Susanna et al. 2020) does not allow Osmiopsis plumieri to be assigned to any subtribe, only to tribe Eupatorieae; this raises the interesting question if subtribes Praxelinae and Critoniinae - that are sisters (Rivera et al. 2016; Baker et al. 2022) should be combined. Declarations Author Contribution R.N.R., V.L.R. and C.E.B.P. conceived the idea and experimental design for the study. R.N.R. and A.L.C. collected material in the field and examined herbarium material to gather morphological and molecular data. R.N.R., C.C.V.W. and A.L.C. did laboratory work (DNA extraction and amplification). R.N.R. measured of plant parts. A.L.C. produced the map. R.N.R. and V.L.R. curated and analysed the data. R.N.R. wrote the first draft of the manuscript and produced the tables, illustrations and figures. C.E.B.P. supervised, wrote the Abstract, and provided significant contributions to the manuscript. All authors provided comments that improved the final version of the manuscript. Acknowledgement We thank the University of Brasília for institutional and financial support (Edital DPG Nº0011/2022), Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brazil (CAPES) – Finance Code 001 for a Ph. D. scholarship to the first author. CEBP thanks CNPq for a PQ2 Produtividade em Pesquisa 2021-2023 grant. We are most grateful to José Panero for sending us the Koanoxelis plumieri samples to be sequenced, and for exhaustive searching of the TEX collections for the voucher specimen of Chromolaena collina. Thanks are also due to Nigel Barker and Costas Zachariades for kindly answering queries regarding Chromolaena collina, and to Cynthia Sothers (K) for sending us the description of Chromolaena heterosquamea. Aristônio Teles (UFG), Eric Hattori (UFVJM) and Jimi Nakajima (HUFU) provided several helpful comments. Data Availability The newly generated sequences (cited as ‘In submission’ in Supplementary Material Table 1) will be uploaded to GenBank upon acceptance. References Acevedo-Rodríguez P, Strong MT (2012) Catalogue of seed plants of the West Indies. Smithsonian Institution Scholarly Press, Washington Baker WJ, Bailey P, Barber V, et al (2022) A Comprehensive Phylogenomic Platform for Exploring the Angiosperm Tree of Life. Syst Biol 71:301–319. https://doi.org/10.1093/sysbio/syab035 Barber JC, Finch CC, Francisco-Ortega J, et al (2007) Hybridization in Macaronesian Sideritis (Lamiaceae): Evidence from incongruence of multiple independent nuclear and chloroplast sequence datasets. Taxon 56:74–88 Bautista HP (2000) Sistemática e filogenia de um género endémico de Brasil: Acritopappus R.M. King & H. Rob. (Asteraceae, Eupatorieae). Universidad de Santiago de Compostela Clark K, Karsch-Mizrachi, I. Lipman DJ, Ostell J, Sayers E. (2016) Genbank. Nucleic Acids Res 44:D67–D72 Cunningham CW (1997) Can three incongruence tests predict when data should be combined? Mol Biol Evol 14:733–740. https://doi.org/10.1093/oxfordjournals.molbev.a025813 Darlu P, Lecointret G (2002) When does the incongruence length difference test fail? Mol Biol Evol 19:432–437. https://doi.org/10.1093/oxfordjournals.molbev.a004098 Darriba D, Taboada GL, Doallo R, Posada D (2012) JModelTest 2: More models, new heuristics and parallel computing. Nat Methods 9:772. https://doi.org/10.1038/nmeth.2109 Doyle JJ, Doyle JL (1987) Isolation of plant DNA from fresh tissue. Focus (Madison) 12:13–15 Edgar RC (2004) MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32:1792–1797. https://doi.org/10.1093/nar/gkh340 Farris JS, Källersjö M, Kluge AG, Bult C (1994) Testing Significance of Incongruence. Cladistics 10:315–319 Fehrer J, Gemeinholzer B, Chrtek J, Bräutigam S (2007) Incongruent plastid and nuclear DNA phylogenies reveal ancient intergeneric hybridization in Pilosella hawkweeds ( Hieracium , Cichorieae, Asteraceae). Mol Phylogenet Evol 42:347–361. https://doi.org/10.1016/j.ympev.2006.07.004 Fernandes AC (2014) Sistemática de Heterocondylus R.M. King & H. Rob. (Eupatorieae, Asteraceae). Universidade Federal de Minas Gerais Francisco-Ortega J, Jansen RK, Santos-Guerra A (1996) Chloroplast DNA evidence of colonization, adaptive radiation, and hybridization in the evolution of the Macaronesian flora. Proc Natl Acad Sci USA 93:4085–4090. https://doi.org/10.1073/pnas.93.9.4085 Francisco-Ortega J, Ventosa I, Oviedo R, et al (2008) Caribbean Island Asteraceae: Systematics, molecules, and conservation on a biodiversity hotspot. Bot Rev 74:112–131. https://doi.org/10.1007/s12229-008-9008-6 Greiner S, Sobanski J, Bock R (2015) Why are most organelle genomes transmitted maternally? BioEssays 37:80–94. https://doi.org/10.1002/bies.201400110 Guindon S, Gascuel O (2003) A Simple, Fast, and Accurate Algorithm to Estimate Large Phylogenies by Maximum Likelihood. Syst Biol 52:696–704. https://doi.org/10.1080/10635150390235520 Hipp AL, Hall JC, Sytsma KJ (2004) Congruence versus phylogenetic accuracy: Revisiting the incongruence length difference test. Syst Biol 53:81–89. https://doi.org/10.1080/10635150490264752 Keil DJ, Luckow MA, Pinkava DJ (1988) Chromosome Studies in Asteraceae from the United States, Mexico, the West Indies, and South America. Am J Bot 75:652. https://doi.org/10.2307/2444199 Kilian N, Sennikov A, Wang ZH, et al (2017) Sub-paratethyan origin and middle to late miocene principal diversification of the Lactucinae (Compositae: Cichorieae) inferred from molecular phylogenetics, divergence-dating and biogeographic analysis. Taxon 66:675–703. https://doi.org/10.12705/663.9 King RM, Robinson H (1975) Studies in the Eupatorieae (Asteraceae). CXLIX. A new genus, Osmiopsis . Phytologia 32:250–251 King RM, Robinson HE (1987) The genera of the Eupatorieae (Asteraceae). Missouri Botanical Garden, [St. Louis] King RM, Robinson HE (1970) Studies in the Eupatorieae (Compositae). XXIX. The genus Chromolaena . Phytologia 20:196–209. https://doi.org/10.5962/bhl.part.7118 Miller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In: 2010 Gateway Computing Environments Workshop, GCE 2010. New Orleans, pp 1–8 Pelser PB, Kennedy AH, Tepe EJ, et al (2010) Patterns and causes of incongruence between plastid and nuclear Senecioneae (Asteraceae) phylogenies. Am J Bot 97:856–873. https://doi.org/10.3732/ajb.0900287 POWO (2024) Plants of the World Online. Facilitated by the Royal Botanic Gardens, Kew. In: Http://Www.Plantsoftheworldonline.Org/. http://www.plantsoftheworldonline.org/. Accessed 1 Apr 2024 Riahi M, Zarre S, Maassoumi AA, et al (2010) An inexpensive and rapid method for extracting papilionoid genomic DNA from herbarium specimens. Genet Mol Res GMR 9:1334–1342. https://doi.org/10.4238/vol9-3gmr839 Ribeiro RN (2023) Sistemática e Filogenia da subtribo Praxelinae R.M.King & H.Rob. (Asteraceae, Eupatorieae) [Systematics and Phylogeny of the subtribe Praxelinae R.M.King & H.Rob. (Asteraceae, Eupatorieae)]. Universidade de Brasília Rice A, Glick L, Abadi S, et al (2015) The Chromosome Counts Database (CCDB) - a community resource of plant chromosome numbers. New Phytol 206:19–26. https://doi.org/10.1111/nph.13191 Rieseberg LH, Soltis DE (1991) Phylogenetic consequences of cytoplasmic gene flow in plants. Evol Trends Plants 5:65–84 Rieseberg LH, Raymond O, Rosenthal DM, et al (2003) Major ecological transitions in wild sunflowers facilitated by hybridization. Science (80- ) 301:1211–1216. https://doi.org/10.1126/science.1086949 Rivera VL, Panero JL, Schilling EE, et al (2016) Origins and recent radiation of Brazilian Eupatorieae (Asteraceae) in the eastern Cerrado and Atlantic Forest. Mol Phylogenet Evol 97:90–100. https://doi.org/10.1016/j.ympev.2015.11.013 Robinson HE, Powell AM, Carr GD, et al (1989) Chromosome numbers in Compositae, XVI: Eupatorieae II. Ann Missouri Bot Gard 76:1004–1011 Robinson HE, Schilling EE, Panero JL (2009) Eupatorieae. In: Funk VA, Suzana A, Stuessy TF, Bayer RJ (eds) Systematics, Evolution, and Biogeography of Compositae. IAPT – International Association of Plant Taxonomy, Vienna, p 731−744 Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–1574. https://doi.org/10.1093/bioinformatics/btg180 Salgado VG, Grossi MA, Ribeiro RN, et al (2022) Understanding Praxelis (Asteraceae, Eupatorieae): an updated taxonomy with lectotypifications and morphological and distributional clarifications. Aust Syst Bot 35:296–316. https://doi.org/10.1071/sb21027_co Schilling EE (2011) Hybrid genera in Liatrinae (Asteraceae: Eupatorieae). Mol Phylogenet Evol 59:158–167. https://doi.org/10.1016/j.ympev.2011.01.011 Schuster TM, Setaro SD, Tibbits JFG, et al (2018) Chloroplast variation is incongruent with classification of the Australian bloodwood eucalypts (genus Corymbia , family Myrtaceae). PLoS One 13:1–28. https://doi.org/10.1371/journal.pone.0195034 Stace C, Preston CD, Pearman DA, Abbott RJ (2015) Hybrid Flora of the British Isles. Botanical Society of Britain and Ireland, Bristol Susanna A, Baldwin BG, Bayer RJ, et al (2020) The classification of the Compositae: A tribute to Vicki Ann Funk (1947–2019). Taxon 69:807–814. https://doi.org/10.1002/tax.12235 Swofford DL (2002) PAUP* Phylogenetic analysis using parsimony (*and other methods). v. 4.0. Sinauer Associates, Sunderland, MA Torres AM, Liogier AH (1970) Chromosome numbers of Dominican Compositae. Brittonia 22:240–245. https://doi.org/10.2307/2805906 Urban I (1931) Plantae Haitienses et Dominguenses novae vel rariores IX a cl. E. L. Ekman 1924-1930 lectae. Ark för Bot 23A:1–103 Wang ZH, Peng H, Kilian N (2013) Molecular phylogeny of the Lactuca alliance (Cichorieae subtribe Lactucinae, Asteraceae) with focus on their Chinese centre of diversity detects potential events of reticulation and chloroplast capture. PLoS One 8:. https://doi.org/10.1371/journal.pone.0082692 Watanabe K, King RM, Yahara T, et al (1995) Chromosomal Cytology and Evolution in Eupatorieae (Asteraceae). Ann Missouri Bot Gard 82:581–592. https://doi.org/10.2307/2399838 Additional Declarations No competing interests reported. Supplementary Files Suppl.FigureS1.pdf Supplementary Figure 1. Bayesian 50% majority rule consensus phylogenetic tree (based on the ITS, ETS, ndh F, ndh I, and ndh I-G IGS markers). Suppl.TableS1Vouchers.xlsx Supplementary Table 1. Vouchers for molecular markers with Genbank accessions. Suppl.TableS2.docx Supplementary Table 2.Protocol for the PCR reactions. Suppl.TableS3.docx Supplementary Table 3.Intergeneric Asteraceae hybrids in the British Isles. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6938723\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Short Report\",\"associatedPublications\":[],\"authors\":[{\"id\":484205276,\"identity\":\"18fa0b0e-715e-4ac3-8704-db4092ec7dd7\",\"order_by\":0,\"name\":\"Rogério N. Ribeiro\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Universidade de Brasília\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Rogério\",\"middleName\":\"N.\",\"lastName\":\"Ribeiro\",\"suffix\":\"\"},{\"id\":484205277,\"identity\":\"300933f5-6014-4d58-8f3f-2c44853ca749\",\"order_by\":1,\"name\":\"Vanessa L. Rivera\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Universidade de Brasília\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Vanessa\",\"middleName\":\"L.\",\"lastName\":\"Rivera\",\"suffix\":\"\"},{\"id\":484205280,\"identity\":\"540fbde7-59eb-4b1c-856f-b15ddaa6a689\",\"order_by\":2,\"name\":\"Christina C. Vinson Williams\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Universidade de Brasília\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Christina\",\"middleName\":\"C. Vinson\",\"lastName\":\"Williams\",\"suffix\":\"\"},{\"id\":484205282,\"identity\":\"6aa6352b-b8e9-4f66-849b-1dd76be812fb\",\"order_by\":3,\"name\":\"Anderson L. Christ\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Instituto Federal de Educação, Ciência e Tecnologia Catarinense\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Anderson\",\"middleName\":\"L.\",\"lastName\":\"Christ\",\"suffix\":\"\"},{\"id\":484205283,\"identity\":\"bfcc57d2-5905-4c46-91f5-1d983ceaf397\",\"order_by\":4,\"name\":\"Carolyn E. B. Proença\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAApklEQVRIiWNgGAWjYDADfgYGNgbGBlK0SDaQrMXgALFa+Gf3PnzwcYedvPGN3GMPGHfcI6xF4s5xY8OZZ5INt93ISzdgPFNMhHsk0tikedsOMG67kWMmwdiWQKSWv20H7DfPIEkLY9uBxA0SxGqRuHOM2bC3LTl5xpk35gaJZ4jQwj+7jfHBzzY72/72HDNg0BGhhUECmUOMBjQto2AUjIJRMAqwAQCi+jaCifQVLAAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"Universidade de Brasília\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Carolyn\",\"middleName\":\"E. B.\",\"lastName\":\"Proença\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-06-20 12:08:17\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6938723/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6938723/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":87032263,\"identity\":\"74897eaa-e2ca-485a-814a-4b426433010f\",\"added_by\":\"auto\",\"created_at\":\"2025-07-18 12:55:01\",\"extension\":\"jpeg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":138954,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eParatype of \\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e (Urb. \\u0026amp; Ekman) R.M.King \\u0026amp; H.Rob. \\u0026nbsp;collected by Erik L. Ekman (Ekman herbarium n. 6490), originally from the Lundell Herbarium (LL) now incorporated into TEX.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image1.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6938723/v1/2fd45515f91481c089f23058.jpeg\"},{\"id\":87030916,\"identity\":\"ecf2fa7e-abde-4aff-8ce5-320e4ac5a1ec\",\"added_by\":\"auto\",\"created_at\":\"2025-07-18 12:47:01\",\"extension\":\"jpeg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":158997,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eBayesian 50% majority rule\\u003cstrong\\u003e \\u003c/strong\\u003econsensus\\u003cem\\u003e \\u003c/em\\u003eITS (nuclear region) phylogenetic tree. Posterior probabilities are indicated at the nodes. \\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e is highlighted in blue.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image2.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6938723/v1/1dd63bce56d758a2e97c708d.jpeg\"},{\"id\":87032264,\"identity\":\"da68e954-96ba-4cf0-85b4-056984315f45\",\"added_by\":\"auto\",\"created_at\":\"2025-07-18 12:55:01\",\"extension\":\"jpeg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":216683,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eBayesian 50% majority rule consensus \\u003cem\\u003endh\\u003c/em\\u003eF (chloroplast region) phylogenetic tree. Posterior probabilities are indicated at the nodes. \\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e is highlighted in blue.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image3.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6938723/v1/c59925afbaa30d4bfa4ca5f3.jpeg\"},{\"id\":87032268,\"identity\":\"b4b28675-1292-41e7-93ff-0ce4db4f214e\",\"added_by\":\"auto\",\"created_at\":\"2025-07-18 12:55:01\",\"extension\":\"jpeg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":137013,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eDistribution map of \\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e (Urb. \\u0026amp; Ekman) R.M.King \\u0026amp; H.Rob. in Haiti (represented by white diamonds). A. Caribbean Region with Haiti shown in dark grey. B. Hispaniola with Haiti shown in dark grey Dom. Rep. = Dominican Republic. Plotted with QGIS 3.10.14 software; records from GBIF; coordinates inferred from Google Earth.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image4.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6938723/v1/ecef540355498cba3d2149f6.jpeg\"},{\"id\":87030926,\"identity\":\"98e3a997-fcc5-4aa8-ae10-8aca414eac8e\",\"added_by\":\"auto\",\"created_at\":\"2025-07-18 12:47:01\",\"extension\":\"jpeg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":479618,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eIllustration of morphological terms used in the text. \\u003cstrong\\u003eA,\\u003c/strong\\u003e Imbricate involucral bracts. \\u003cstrong\\u003eB,\\u003c/strong\\u003e Eximbricate involucral bracts. \\u003cstrong\\u003eC,\\u003c/strong\\u003e Involucral bracts not persisting in fruiting capitula (receptacle exposed). \\u003cstrong\\u003eD,\\u003c/strong\\u003e Semi-scandent habit. \\u003cstrong\\u003eE-G,\\u003c/strong\\u003e Leaves. \\u003cstrong\\u003eVouchers:\\u003c/strong\\u003e (A) \\u003cem\\u003eChromolaena arrayana \\u003c/em\\u003e(Gardner) R.M.King \\u0026amp; H.Rob., \\u003cem\\u003eBringel \\u0026amp; Moreira 930\\u003c/em\\u003e (UB)\\u003cem\\u003e; \\u003c/em\\u003e(B) \\u003cem\\u003eKoanophyllon myrtilloides\\u003c/em\\u003e (DC.) R.M.King \\u0026amp; Rob., \\u003cem\\u003eSobral\\u003c/em\\u003e 16036 (HUFSJ); (C) \\u0026amp; (D) \\u003cem\\u003eC. odorata\\u003c/em\\u003e (L.) R.M.King \\u0026amp; H.Rob., not vouchered; (E) \\u003cem\\u003eKoanophyllon phanioides\\u003c/em\\u003e (Urb. \\u0026amp; Ekman) R.M.King \\u0026amp; H.Rob., \\u003cem\\u003eEkman 3955\\u003c/em\\u003e (S); (F) \\u003cem\\u003eOsmiopsis plumieri \\u003c/em\\u003e(Urb. \\u0026amp; Ekman) R.M.King \\u0026amp; H.Rob., \\u003cem\\u003eEkman 6490\\u003c/em\\u003e (LL); (G) \\u003cem\\u003eChromolaena sinuata\\u003c/em\\u003e(Lam.) R.M.King \\u0026amp; H.Rob., \\u003cem\\u003eEkman 1914\\u003c/em\\u003e (S). Photo credits \\u0026amp; image rights: (A) Henrique J.C. Moreira; (B) Marcos E.G. Sobral; (C) Vijayan Rajapuram; (D) Steve Collins; (E-G) copyright belongs to the cited herbaria.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image5.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6938723/v1/84fe8102eac5b39f061c45a6.jpeg\"},{\"id\":88625460,\"identity\":\"730f67de-6dd9-4c5e-a569-131e6d4c08ea\",\"added_by\":\"auto\",\"created_at\":\"2025-08-08 12:47:37\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1941461,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6938723/v1/7dcf7e20-edc1-4755-b633-84d217b06424.pdf\"},{\"id\":87030914,\"identity\":\"8e77dbe6-8c9c-4ed1-a3df-c6056fe33086\",\"added_by\":\"auto\",\"created_at\":\"2025-07-18 12:47:01\",\"extension\":\"pdf\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":11611,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Figure 1.\\u003c/strong\\u003e Bayesian 50% majority rule consensus phylogenetic tree (based on the ITS, ETS, \\u003cem\\u003endh\\u003c/em\\u003eF, \\u003cem\\u003endh\\u003c/em\\u003eI, and \\u003cem\\u003endh\\u003c/em\\u003eI-G IGS markers).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Suppl.FigureS1.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6938723/v1/2fce2944e69c65e527fda741.pdf\"},{\"id\":87030918,\"identity\":\"05c9569c-cd41-4c89-94ac-20bc4f6cb360\",\"added_by\":\"auto\",\"created_at\":\"2025-07-18 12:47:01\",\"extension\":\"xlsx\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":52463,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Table 1.\\u003c/strong\\u003e Vouchers for molecular markers with Genbank accessions.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Suppl.TableS1Vouchers.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6938723/v1/dc4a89665b5b8218c801bbe0.xlsx\"},{\"id\":87030920,\"identity\":\"91929aad-329e-4adf-b323-8ff2ba0ec59e\",\"added_by\":\"auto\",\"created_at\":\"2025-07-18 12:47:01\",\"extension\":\"docx\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":15776,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Table 2.\\u003c/strong\\u003eProtocol for the PCR reactions.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Suppl.TableS2.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6938723/v1/05948074b226ff53380c8eb9.docx\"},{\"id\":87030922,\"identity\":\"24aed769-6401-48ae-b8fd-8d7f190a505a\",\"added_by\":\"auto\",\"created_at\":\"2025-07-18 12:47:01\",\"extension\":\"docx\",\"order_by\":4,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":15730,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Table 3.\\u003c/strong\\u003eIntergeneric Asteraceae hybrids in the British Isles.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Suppl.TableS3.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6938723/v1/528ee15ab9a677dd8c61ddd8.docx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Molecular phylogenetics suggest Osmiopsis (Asteraceae) is a rare inter-subtribal hybrid genus on Hispaniola\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003e\\u003cem\\u003eOsmiopsis\\u003c/em\\u003e R.M.King \\u0026amp; H.Robinson (Asteraceae) was described as a monotypic genus endemic to the Caribbean Island of Hispaniola. It is one of the seven genera that comprise subtribe Praxelinae R.M.King \\u0026amp; H.Robinson and the only genus of the subtribe that does not occur in South America. Subtribe Praxelinae has been considered monophyletic (Rivera et al. 2016) and is one of the 17 subtribes of tribe Eupatorieae.\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e, the single species of the genus, was described by Urban and Ekman in the genus \\u003cem\\u003eEupatorium\\u003c/em\\u003e (Urban 1931) based on several Haitian Ekman collections made in the early twentieth century. The epithet that appears in the original publication was spelled \\u003cem\\u003eplumeri\\u003c/em\\u003e but this has been corrected following Article 60.1 of the International Code of Nomenclature for algae, fungi, and plants, as it is almost certainly a reference to the French monk and botanist Charles Plumier (1646\\u0026ndash;1704), one of the first Europeans to collect plants in Haiti. A new combination \\u003cem\\u003eChromolaena plumieri\\u003c/em\\u003e (Urban \\u0026amp; Ekman) R.M.King \\u0026amp; H.Robinson was published in 1970 (King and Robinson 1970). However, five years later, King and Robinson revised the taxonomic position of this species and proposed the genus \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e to accommodate it (King and Robinson 1975).\\u003c/p\\u003e\\u003cp\\u003ePublication of \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e was unusual in that the authors stated that the genus was probably an intergeneric hybrid. They argued that a scandent habit and 4\\u0026ndash;5-seriate, imbricate, deciduous, involucral bracts were characteristic of \\u003cem\\u003eChromolaena\\u003c/em\\u003e DC. (subtribe Praxelinae), whilst wide, glandulose corolla lobes, short anther appendages and enlarged tips to stylar branches were typical of \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e Arruda (subtribe Critoniinae). Moreover, they stated that the hybrid origin was: \\u0026lsquo;based on circumstantial evidence of character distribution\\u0026rsquo; and that \\u0026lsquo;evidence would indicate further that such hybrids were totally viable and capable of further evolution, but that the hybridizations all apparently date from some earlier period and are not continuing at this time\\u0026rsquo; (King and Robinson 1975: 250). These statements were not supported by any further discussion, nor by any numerical analysis or molecular data. The putative \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e parent proposed by King and Robinson was either \\u003cem\\u003eK. selleanum\\u003c/em\\u003e (Urb.) R.M.King \\u0026amp; H.Robinson or \\u003cem\\u003eK. phanioides\\u003c/em\\u003e (Krug \\u0026amp; Urb.) R.M.King \\u0026amp; H.Robinson; both of which are endemic to Hispaniola (POWO 2024). King and Robinson did not propose a putative parent in \\u003cem\\u003eChromolaena\\u003c/em\\u003e.\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e is known from at least 12 collections made between 1924 and 1929 in Haiti. King and Robinson (1975) observed that \\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e is frequently misidentified in herbaria as \\u003cem\\u003eK. selleanum\\u003c/em\\u003e (which has 8 to 12 florets per capitulum) or as \\u003cem\\u003eK. phanioides\\u003c/em\\u003e (which has basally persistent involucral bracts), a fact that presumably led them to propose either one of these species as putative parents in \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e.\\u003c/p\\u003e\\u003cp\\u003eDespite its monophyletic status, the relationships between the genera of subtribe Praxelinae have not yet been fully clarified (Rivera et al. 2016). During our phylogenetic studies of subtribe Praxelinae (Ribeiro 2023), strong incongruence was found between chloroplast (\\u003cem\\u003endhF\\u003c/em\\u003e) and nuclear (ITS) trees in the positioning of \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e. The purpose of this paper is to further investigate the origin of \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e.\\u003c/p\\u003e\"},{\"header\":\"Material and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003ePhylogenetic Trees\\u003c/h2\\u003e\\u003cp\\u003eDNA was extracted from a paratype of \\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e (\\u003cem\\u003eEkman 6490\\u003c/em\\u003e, LL) and other members of subtribe Praxelinae (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e; see also Suppl. Table\\u0026nbsp;1 for all other vouchers). Molecular analysis was performed in the Plant Molecular Biology Laboratory, University of Brasilia. The extraction of total genomic DNA was performed from other specimens of Praxelinae usually from silica-dried leaf material using the Riahi et al. (2010) protocol, which proved more efficient than the traditional CTAB protocol (Doyle and Doyle 1987). The ITS marker of the 18S-26S ribosomal RNA genes, including the 5.8S gene (nuclear marker), and the \\u003cem\\u003endhF\\u003c/em\\u003e (chloroplast marker) were amplified using standard PCR protocols and primers ITS-4 (TCCTCCGCTTATTGATATGC) and ITS-5 (GGAAGTAAAAGTCGTAACAAGG), \\u003cem\\u003endhF\\u003c/em\\u003e 52 (AGGTAAGATCCGGTGAATCGGAAA) and \\u003cem\\u003endhF\\u003c/em\\u003e 1212 (GGTGGAATACCACAAAGA), respectively. PCRs were carried out in a final volume of 20 \\u0026micro;L (Suppl. Table\\u0026nbsp;2). Amplicons were sequenced using the DNA sequencing services of BPI Biotecnologia in Botucatu, Brazil. Sequences were imported into the program Geneious v.11, and were aligned with MUSCLE (Edgar 2004) followed by visual inspection and manual alignment, when appropriate.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e ITS and \\u003cem\\u003endhF\\u003c/em\\u003e sequences were then added to a matrix of ITS and \\u003cem\\u003endhF\\u003c/em\\u003e sequences of 202 species of tribe Eupatorieae and realigned as described above. Each genetic marker was run on jModeltest 2.1.10 (Guindon and Gascuel 2003; Darriba et al. 2012); the model GTR (with gamma-distributed rate variation across sites) was selected as the best evolutionary model under the Akaike Information Criteria (AIC). Each genetic marker was also analyzed as a single partition with the above chosen model of evolution A third matrix with additional markers was also constructed to improve resolution and test the position of \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e (Ribeiro 2023). This matrix contained the following molecular data from nuclear and chloroplast markers: ITS and ETS (nuclear) and \\u003cem\\u003endhF\\u003c/em\\u003e, \\u003cem\\u003endhI\\u003c/em\\u003e, and the \\u003cem\\u003endhI\\u003c/em\\u003e-\\u003cem\\u003endhG\\u003c/em\\u003e intergenic spacer (chloroplast). Bayesian inference analysis was undertaken on these three matrices using MrBayes 3.2.7a (Ronquist and Huelsenbeck 2012) on the CIPRES science gateway (Miller et al. 2010); all sequences are available in Genbank (Clark et al. 2016) except for the following five, donated by the authors of the cited unpublished doctoral theses: \\u003cem\\u003eAcritopappus connatifolius\\u003c/em\\u003e (Soares Nunes) R.M. King \\u0026amp; H. Rob., \\u003cem\\u003eA. diamantinicus\\u003c/em\\u003e H. Bautista, \\u003cem\\u003eA. pereirae\\u003c/em\\u003e H. Bautista, and \\u003cem\\u003eA. teixeirae\\u003c/em\\u003e R.M. King \\u0026amp; H. Rob. (Bautista 2000); and \\u003cem\\u003eParapiqueria cavalcantei\\u003c/em\\u003e R.M. King \\u0026amp; H. Rob. (Fernandes 2014).\\u003c/p\\u003e\\u003c/div\\u003e\\n\\u003ch3\\u003eEvidence of hybrid origin\\u003c/h3\\u003e\\n\\u003cp\\u003eWe evaluated the incongruence between the nuclear marker tree (ITS) and the chloroplast marker tree (\\u003cem\\u003endhF)\\u003c/em\\u003e (for which sequences of \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e were available) using the incongruence length difference test (ILD test; Farris et al. 1995). Both these markers were highly informative in reconstructing the phylogeny of the Eupatorieae (Rivera et al. 2016). The ILD test has been criticized because of a high false positive rate (Cunningham 1997; Darlu and Lecointre 2002; Hipp et al. 2004), therefore, to reduce false positives we followed the recommendations of Cunningham (1997) and Pelser et al. (2010) and only considered ILD \\u003cem\\u003ep-values\\u003c/em\\u003e below 0.01 as evidence of significant incongruence. We implemented the ILD test in PAUP (Swofford 2002) on the CIPRES platform (Miller et al. 2010) as a partition-homogeneity test with a heuristic search of 1000 replicates and random addition of sequences.\\u003c/p\\u003e\\n\\u003ch3\\u003eGeographic distribution\\u003c/h3\\u003e\\n\\u003cp\\u003eGeographic distribution was obtained from the literature (Acevedo-Rodr\\u0026iacute;guez and Strong 2012), Plants of the World Online (POWO 2024) and online herbaria in GBIF; the map was produced with QGIS 3.10.14 software (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.qgis.org\\u003c/span\\u003e\\u003cspan address=\\\"https://www.qgis.org\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e).\\u003c/p\\u003e\\n\\u003ch3\\u003eMorphology and Chromosome counts\\u003c/h3\\u003e\\n\\u003cp\\u003eWe also analysed \\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e morphologically and compared its habit, leaf shape and floral characters to all possible parental species that occur on Hispaniola (Acevedo-Rodr\\u0026iacute;guez and Strong 2012) by analysing images of herbarium specimens available online; the identification of all such herbarium specimens were checked. The I-Naturalist site (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ewww.inaturalist.org\\u003c/span\\u003e\\u003cspan address=\\\"http://www.inaturalist.org\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) was searched for images of plants identified as \\u003cem\\u003eChromolaena\\u003c/em\\u003e, \\u003cem\\u003ePraxelis\\u003c/em\\u003e or \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e from Hispaniola, with two main objectives: 1) to detect if \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e still occurs on the island; and 2) to detect if any other genera of the Praxelinae outside of \\u003cem\\u003eChromolaena\\u003c/em\\u003e occurs on the island. In addition, chromosome numbers in \\u003cem\\u003eChromolaena\\u003c/em\\u003e, \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e and \\u003cem\\u003ePraxelis\\u003c/em\\u003e were investigated in CCDB - The Chromosome Counts Database (Rice et al. 2015) to evaluate the potential of successful hybridization.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003ePhylogenetic trees\\u003c/h2\\u003e\\u003cp\\u003eThe reconstructed phylogeny of the whole of tribe Eupatorieae based on the nuclear matrix of ITS\\u0026thinsp;+\\u0026thinsp;ETS and the chloroplast matrix of \\u003cem\\u003endhF\\u003c/em\\u003e\\u0026thinsp;+\\u0026thinsp;\\u003cem\\u003endhI\\u003c/em\\u003e\\u0026thinsp;+\\u0026thinsp;ndhI-G IGS showed good resolution (Suppl. Figure\\u0026nbsp;1). \\u003cem\\u003eO. plumieri\\u003c/em\\u003e appeared nested in a highly supported clade (PP\\u0026thinsp;=\\u0026thinsp;0.97) among all sampled species of \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e, allied to \\u003cem\\u003eIdiothamnus lilloi\\u003c/em\\u003e (B.L.Rob.) R.M.King \\u0026amp; H.Rob. and \\u003cem\\u003eChromolaena collina\\u003c/em\\u003e (DC.) R.M.King \\u0026amp; H.Rob.\\u003c/p\\u003e\\u003c/div\\u003e\\n\\u003ch3\\u003eEvidence of hybrid origin\\u003c/h3\\u003e\\n\\u003cp\\u003eThe ILD test results showed significant incongruence between the ITS and the \\u003cem\\u003endhF\\u003c/em\\u003e data matrices (\\u003cem\\u003ep\\u003c/em\\u003e-value of 0.001).\\u003c/p\\u003e\\u003cp\\u003eThe phylogenetic tree of the nuclear ITS marker recovered a clade of 25 species of Praxelinae; however, \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e did not group with this clade (Ribeiro, 2023). Instead, \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e emerged in a highly supported clade (PP\\u0026thinsp;=\\u0026thinsp;0.99) that included most sampled taxa of the Critoniinae (but not \\u003cem\\u003eCritonia\\u003c/em\\u003e P.Browne), as well as genera from two other subtribes, namely \\u003cem\\u003eAgeratum\\u003c/em\\u003e L. (subtribe Ageratinae) and \\u003cem\\u003eFleischmannia\\u003c/em\\u003e Sch.Bip. (subtribe Fleischmanniinae) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). Within this clade, \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e emerged in a subclade (subclade A; PP\\u0026thinsp;=\\u0026thinsp;0.83) that included five species of \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e (Critoniinae), \\u003cem\\u003eIdiothamnus lilloi\\u003c/em\\u003e (B.L.Rob.) R.M.King \\u0026amp; H.Rob. (Critoniinae) and \\u003cem\\u003eChromolaena collina\\u003c/em\\u003e (DC.) R.M.King \\u0026amp; H.Rob. (Praxelinae).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe phylogenetic tree of the chloroplast \\u003cem\\u003endhF\\u003c/em\\u003e marker (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e) recovered a Praxelinae clade with suboptimal support (PP\\u0026thinsp;=\\u0026thinsp;0.83); if \\u003cem\\u003eChromolaena sagittata\\u003c/em\\u003e, (A.Gray) R.M.King, which is sister to the rest of the Praxelinae, is disconsidered, the remaining clade has maximum support (subclade A; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e; PP\\u0026thinsp;=\\u0026thinsp;1). \\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e emerged within this clade, and was nested within the \\u0026ldquo;\\u003cem\\u003ePraxelis\\u0026rdquo;\\u003c/em\\u003e suclade B. This \\u0026ldquo;\\u003cem\\u003ePraxelis\\u003c/em\\u003e\\u0026rdquo; subclade B included eight species: four species of \\u003cem\\u003ePraxelis\\u003c/em\\u003e Cass., \\u003cem\\u003eEitenia praxelioides\\u003c/em\\u003e R.M.King \\u0026amp; H.Rob, \\u003cem\\u003eEupatoriopsis hoffmanniana\\u003c/em\\u003e Hieron., \\u003cem\\u003ePraxeliopsis matogrossensis\\u003c/em\\u003e G.M.Barroso and \\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\n\\u003ch3\\u003eGeographic distribution\\u003c/h3\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e has been recorded from both northern and southern Haiti and in Montfleury (GBIF 2023) near Port au Prince (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). In northern Haiti, it was recorded from the vicinity of St. Michel de l'Atalaye and around M\\u0026ocirc;le Saint-Nicolas. In southern Haiti, it was recorded from the Massifs des Matheux, des Cahos, de la Selle, and de la Hotte. In the Massif de la Selle and de la Hotte it was recorded from several mountains: Morne \\u0026agrave; Cabrits; Morne Rochelois; Morne Sentier; and Morne de l'H\\u0026ocirc;pital. The 1968 collection made by Alain Liogier in the Dominican Republic (\\u003cem\\u003eLiogier 12804\\u003c/em\\u003e; P), identified by an unknown person as \\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e, is in fact a specimen of \\u003cem\\u003eKoanophyllon selleanum\\u003c/em\\u003e. We did not find any herbarium image or any field image in I-naturalist that might prove the recent presence of either \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e or of any other genus of subtribe Praxelinae on Hispaniola except \\u003cem\\u003eChromolaena\\u003c/em\\u003e.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eMorphology and chromosome counts\\u003c/h2\\u003e\\u003cp\\u003e\\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e shows characters that are often present in \\u003cem\\u003eChromolaena/Praxelis\\u003c/em\\u003e, such as the imbricate involucre and the deciduous involucral bracts (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). However, some species within subtribe Critoniinae rarely also show an imbricate involucre and deciduous internal involucral bracts. The reproductive characters, however, namely the shape of the corolla, of the corolla lobes and the anther appendages, are very similar to those found in \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e and are never found in the Praxelinae. Hypothetical parent species are compared morphologically in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e.\\u003c/p\\u003e\\u003cp\\u003eChromosome counts for potential parental taxa are variable. \\u003cem\\u003eChromolaena\\u003c/em\\u003e and \\u003cem\\u003ePraxelis\\u003c/em\\u003e are both apomictic with base numbers of x\\u0026thinsp;=\\u0026thinsp;10 (King and Robinson,1987; Robinson 2009). Within the Praxelinae, there are records of n\\u0026thinsp;=\\u0026thinsp;10, 20, and 30 in the invasive species \\u003cem\\u003ePraxelis clematidea\\u003c/em\\u003e R.M.King \\u0026amp; H.Rob. and of a polyploid series in \\u003cem\\u003eChromolaena odorata\\u003c/em\\u003e (L.) R.M. King \\u0026amp; H.Rob. (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). Within \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e, n\\u0026thinsp;=\\u0026thinsp;10 is the most common count, recorded in nine species; other counts recorded are n\\u0026thinsp;=\\u0026thinsp;15 (\\u003cem\\u003eK. longifolia\\u003c/em\\u003e (B.L.Rob.) R.M.King \\u0026amp; H.Rob.; Watanabe et al. 1995), n\\u0026thinsp;=\\u0026thinsp;20 (\\u003cem\\u003eK. sciatraphes\\u003c/em\\u003e (B.L.Rob.) R.M.King \\u0026amp; H.Rob. and \\u003cem\\u003eK. tatei\\u003c/em\\u003e (B.L.Rob.) R.M.King \\u0026amp; H.Rob.; Torres and Liogier 1970) and n\\u0026thinsp;=\\u0026thinsp;30 (\\u003cem\\u003eK. pittieri\\u003c/em\\u003e (Klatt) R.M. King \\u0026amp; H.Rob.; Robinson et al. 1989). Chromosome counts for either of the most likely parent plants based on morphology (\\u003cem\\u003eKoanophyllon phanioides\\u003c/em\\u003e or \\u003cem\\u003eK. selleanus\\u003c/em\\u003e) were not found. Two species of \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e that occur on Hispaniola have chromosome counts: \\u003cem\\u003eK. sciatraphes\\u003c/em\\u003e (n\\u0026thinsp;=\\u0026thinsp;20; Torres and Liogier 1970) and \\u003cem\\u003eK. villosum\\u003c/em\\u003e (Sw.) R. M. King \\u0026amp; H. Rob. (n\\u0026thinsp;=\\u0026thinsp;10; Keil et al. 1988). The count of \\u003cem\\u003eK. sciatraphes\\u003c/em\\u003e is based on material from Hispaniola (Dominican Republic) and the count of \\u003cem\\u003eK. villosum\\u003c/em\\u003e is based on material from Jamaica (Torres and Liogier 1970; Keil et al. 1988).\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eDifferences and similarities in vegetative and reproductive characteristics between \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e, \\u003cem\\u003eChromolaena\\u003c/em\\u003e, \\u003cem\\u003ePraxelis\\u003c/em\\u003e and \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e. Terminology follows King and Robinson (1987).\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"4\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCharacter\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eChromolaena\\u003c/em\\u003e and \\u003cem\\u003ePraxelis\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eKoanophyllon\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eOsmiopsis\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eInvolucral bract persistence\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eNone persistent or only internal bracts persistent\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eAll persistent or at least external bracts persistent\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eNone persistent\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eInvolucre shape\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eImbricate\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eEximbricate\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eImbricate\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCorolla shape\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCylindrical with slightly narrowed base\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eFunnelform with cylindrical base\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eFunnelform with cylindrical base\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCorolla lobes\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eOblong or ovate (longer than broad)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eTriangular (broader than long)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eTriangular\\u003c/p\\u003e\\u003cp\\u003e(broader than long)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eAnther appendices\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eOblong (longer than broader)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eEmarginate (broader than longer)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eSemicircular (broader than longer)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003ePhylogenetic Trees\\u003c/h2\\u003e\\u003cp\\u003eOur phylogenetic tree shows improved sampling within the Praxelinae (compared to the most recent tree; Rivera et al. 2016), with all genera represented by their type species. However, sampling within the large genus \\u003cem\\u003eChromolaena\\u003c/em\\u003e (160 species; POWO 2024) is still poor. Only 15 species (\\u0026lt;\\u0026thinsp;10%) had sequences in Genbank (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.ncbi.nlm.nih.gov/\\u003c/span\\u003e\\u003cspan address=\\\"https://www.ncbi.nlm.nih.gov/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e - search details \\\"Chromolaena\\\"[Organism]), to which the present study has added another 10 species (Suppl. Table\\u0026nbsp;1).\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eEvidence of hybrid origin\\u003c/h2\\u003e\\u003cp\\u003eRobinson et al. (1989) stated that much more hybridization probably occurred in the Asteraceae than believed by botanists, and that hybridization was likely to be an important contributing factor to the family\\u0026rsquo;s evolutionary success. This view has been supported by later studies (Arnold 1997; Stace et al. 2015). Hybridization facilitated ecological transitions to extreme habitats in the genus \\u003cem\\u003eHelianthus\\u003c/em\\u003e, Asteraceae (Rieseberg et al. 2003). Francisco-Ortega et al. (1996), studying \\u003cem\\u003eArgyranthemum\\u003c/em\\u003e, the most diverse genus of Asteraceae in the Macaronesian islands (Madeira, Canary Islands, etc.) postulated that hybridrization played an important part in its diversification: different chloroplast lineages occupied different habitats.\\u003c/p\\u003e\\u003cp\\u003eInter-generic hybrids, however, are uncommon in nature; in the British flora, where hybrids have been well studied, only four inter-generic hybrids (nothogenera) have been recorded, out of 57 hybrid Asteraceae (Stace et al. 2015). These nothogenera are usually morphologically intermediate between the parent taxa and sterile, with one of the parents native and the other an introduced alien (Suppl. Table\\u0026nbsp;3).\\u003c/p\\u003e\\u003cp\\u003eThe \\u003cem\\u003endhF\\u003c/em\\u003e phylogenetic tree grouped \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e in a clade with \\u003cem\\u003ePraxelis\\u003c/em\\u003e, \\u003cem\\u003eEitenia\\u003c/em\\u003e, \\u003cem\\u003eEupatoriopsis\\u003c/em\\u003e and \\u003cem\\u003ePraxeliopsis\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). Since in most angiosperms chloroplasts are maternally inherited (Greiner et al. 2015) it appeared likely that the maternal parent of \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e would be found in this clade. However, no species of \\u003cem\\u003ePraxelis\\u003c/em\\u003e, \\u003cem\\u003eEitenia\\u003c/em\\u003e, \\u003cem\\u003eEupatoriopsis\\u003c/em\\u003e or \\u003cem\\u003ePraxeliopsis\\u003c/em\\u003e have ever been recorded on Hispaniola (Acevedo-Rodrigues and Strong 2012; this study). This suggests two possibilities: 1) the maternal plant could be \\u003cem\\u003ePraxelis clematidea\\u003c/em\\u003e (Hieron. ex Kuntze) R.M.King \\u0026amp; H.Rob., a widespread invasive, now established in Australia, China, Southeast Asia, and Florida (Salgado et al. 2022), that may occur in Hispaniola (or may have occurred); or 2) the maternal parent is a \\u003cem\\u003eChromolaena\\u003c/em\\u003e species closely related to the \\u003cem\\u003ePraxelis\\u003c/em\\u003e clade, since the \\u003cem\\u003ePraxelis\\u003c/em\\u003e clade is nested within \\u003cem\\u003eChromolaena.\\u003c/em\\u003e The \\u003cem\\u003endhF\\u003c/em\\u003e marker is a highly conserved, coding gene and the \\u003cem\\u003endhF\\u003c/em\\u003e sequence of \\u003cem\\u003eC. laevigata\\u003c/em\\u003e (Lam.) R.M.King \\u0026amp; H.Rob., for example, is identical to that of the \\u003cem\\u003ePraxelis\\u003c/em\\u003e clade (although all other \\u003cem\\u003eChromolaena\\u003c/em\\u003e species with available sequence data differed by at least one base). \\u003cem\\u003eC. laevigata\\u003c/em\\u003e, however, is not known to occur on Hispaniola (Acevedo-Rodriguez and Strong, 2012). Five \\u003cem\\u003eChromolaena\\u003c/em\\u003e species are known from Hispaniola: \\u003cem\\u003eC. corymbosa\\u003c/em\\u003e (widely distributed in the Caribbean), \\u003cem\\u003eC. heterosquamea\\u003c/em\\u003e (Urb. \\u0026amp; Ekman) R.M.King \\u0026amp; H.Rob. (endemic to Hispaniola); \\u003cem\\u003eC. sinuata\\u003c/em\\u003e (Lam.) R.M.King \\u0026amp; H.Rob. (endemic to Hispaniola), \\u003cem\\u003eC. ivifolia\\u003c/em\\u003e (L.) R.M.King \\u0026amp; H.Rob. (widely distributed in the Caribbean, North and South America), and \\u003cem\\u003eC. odorata\\u003c/em\\u003e (L.) R.M.King \\u0026amp; H.Rob., an aggressive, widely distributed alien (Acevedo-Rodriguez and Strong, 2012; POWO, 2023). \\u003cem\\u003eC. heterosquamea\\u003c/em\\u003e can be discarded as maternal plant as it appears to belong to another genus: it has 2\\u0026ndash;3 series of involucral bracts that are subimbricate and the corolla broadens towards the apex, with triangular lobes. \\u003cem\\u003eC. odorata\\u003c/em\\u003e can probably be excluded as its \\u003cem\\u003endhF\\u003c/em\\u003e marker differs from \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e by two bases. The \\u003cem\\u003endhF\\u003c/em\\u003e sequences of \\u003cem\\u003eC. corymbosa\\u003c/em\\u003e, \\u003cem\\u003eC. ivifolia\\u003c/em\\u003e and \\u003cem\\u003eC. sinuata\\u003c/em\\u003e are unknown.\\u003c/p\\u003e\\u003cp\\u003eOther cases of hybrid status detected by incongruence between the chloroplast and nuclear phylogenetic trees are known in the Asteraceae, but these are either within a single genus (\\u003cem\\u003eHieracium\\u003c/em\\u003e; Fehrer et al. 2007) or different genera of the same subtribe (Liatrinae: Schilling, 2011; Lactucinae: Wang et al., 2013; Fehrer et al., 2007; Kilian et al., 2017; Anthemidinae: Stace, 2015). Schilling (2011) proposed a hybrid origin for two monotypic genera within subtribe Liatrinae: \\u003cem\\u003eHartwrightia\\u003c/em\\u003e A.Gray (\\u003cem\\u003eH. floridana\\u003c/em\\u003e A.Gray ex S.Watson) and \\u003cem\\u003eLitrisa\\u003c/em\\u003e Small (\\u003cem\\u003eL. carnosa\\u003c/em\\u003e Small). Schilling\\u0026rsquo;s hypothesis of a hybrid origin used the same principle and method adopted in our study, i.e., incongruence between the nuclear and chloroplast phylogenetic trees. The Liatrinae phylogenetic tree showed two major clades. Schilling (2011) found that the nuclear markers (ITS and ETS) placed \\u003cem\\u003eHartwrightia\\u003c/em\\u003e and \\u003cem\\u003eLitrisa\\u003c/em\\u003e in the \\u0026lsquo;\\u003cem\\u003eTrilisa\\u003c/em\\u003e clade\\u0026rsquo; (PP\\u0026thinsp;=\\u0026thinsp;1; BS\\u0026thinsp;=\\u0026thinsp;88), while the chloroplast markers placed them in its sister clade (PP\\u0026thinsp;=\\u0026thinsp;0.74; BS\\u0026thinsp;\\u0026lt;\\u0026thinsp;50) with \\u003cem\\u003eCarphephorus\\u003c/em\\u003e Cass. and \\u003cem\\u003eLiatris\\u003c/em\\u003e Gaertn. ex Schreb. \\u003cem\\u003eLitrisa\\u003c/em\\u003e is morphologically intermediate between the putative parent genera \\u003cem\\u003eTrilisa\\u003c/em\\u003e and \\u003cem\\u003eCarphephorus\\u003c/em\\u003e. \\u003cem\\u003eHartwrightia\\u003c/em\\u003e, however, is morphologically transgressive, showing a loss of several features present in either one or both of the parental genera (Schilling 2011), such as leaf punctuation, paleae, floral pigment, anther appendages, pappus bristles, and simple cypselae hairs, as well as changes in involucral bract series and cypselae rib number.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eGeographic distribution\\u003c/h2\\u003e\\u003cp\\u003eRecent Asteraceae collections from the Dominican Republic and Haiti are only available as physical specimens for \\u003cem\\u003ein loco\\u003c/em\\u003e examination, and we have not been able to visit Hispaniola, so we do not know if \\u003cb\\u003e\\u0026times;\\u003c/b\\u003e \\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e persists in the Hispaniola flora. However, in the 1920s it had a widespread distribution in Haiti (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). This suggests that it was either an established, successful fertile hybrid (or species of hybrid origin) or that the parental taxa were common enough for independent hybridizations to be regular events. Evidence that \\u003cem\\u003ePraxelis\\u003c/em\\u003e (the most likely maternal parent genus) does not occur on Hispaniola [obtained from GBIF, I-Naturalist and its absence from Acevedo-Rodr\\u0026iacute;guez and Strong (2012) in their Catalogue of Seed Plants of the West Indies] is suboptimal, so botanists collecting on Hispaniola are urged to look for species of this genus.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eMorphology and chromosome counts\\u003c/h2\\u003e\\u003cp\\u003eMorphologically, \\u003cem\\u003eC. sinuata\\u003c/em\\u003e appears most similar to \\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e (see Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). Identifying a hypothetical paternal taxon based on the nuclear ITS tree (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e) that positioned \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e with \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e is more challenging, as \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e is very species-rich genus on Hispaniola (c. 35 species; Acevedo-Rodr\\u0026iacute;guez and Strong 2012). Among these 35 species, \\u003cem\\u003eK. phanioide\\u003c/em\\u003es, one of the putative parents suggested by King and Robinson (1975), is morphologically most similar to \\u003cem\\u003eO. plumieri\\u003c/em\\u003e (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). In addition to the reproductive characteristics cited by King and Robinson, we would add the leaf shape, that is lobed at the base and entire in the upper half, and the long petioles (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e). \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e is the genus with more species endemic to the Caribbean than any other genus of Asteraceae (Francisco-Ortega et al. 2008).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eWithin tribe Eupatorieae, Robinson et al. (2009) hypothesized that species belonging to the subtribes with a chromosome base count x\\u0026thinsp;=\\u0026thinsp;10, that are usually more derived, would be more likely to cross than those belonging to subtribes with other counts, and might result in inter-generic or inter-subtribal hybrids. This hypothesis is supported by our results. Future chromosome counts together with experimental artificial hybridization between putative parents would be desirable.\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eComparison of \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e with possible parental taxa occurring on Hispaniola. Chromosome counts obtained from the CCDB (Rice \\u0026amp; Mayrose 2023). Characters present in \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e in \\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003ebold underlined\\u003c/span\\u003e.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"7\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eSpecies /\\u003c/p\\u003e\\u003cp\\u003echromosome counts\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eHabit\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eLeaf shape\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eLeaf base and margin\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003eInvolucral bracts (series)\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003eInvolucre\\u003c/p\\u003e\\u003cp\\u003elength (mm)\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003eInvolucre\\u003c/p\\u003e\\u003cp\\u003ewidth (mm)\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003en=?\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003eScandent shrubs\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003eOvate to lanceolate\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003eBase often lobed, margin distally entire\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003e4\\u0026ndash;5\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003e3\\u0026ndash;5\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003e2\\u0026ndash;3\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eC. corymbosa\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003e(M?)\\u003c/p\\u003e\\u003cp\\u003en\\u0026thinsp;=\\u0026thinsp;20\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eShrubs\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eDeltoid to cordate\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003eBase round, margin often crenate\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e6\\u0026ndash;7\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e7 to 9\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e3.3 to 4\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eC. ivifolia\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003e(M?)\\u003c/p\\u003e\\u003cp\\u003en\\u0026thinsp;=\\u0026thinsp;25\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eShrubs\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003eLanceolate\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eBase often acute, \\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003emargin entire\\u003c/span\\u003e or serrate\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e6\\u0026ndash;7\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e5.5\\u0026ndash;7.8\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e2.7 to 4\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eC. odorata\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003e(M?)\\u003c/p\\u003e\\u003cp\\u003en\\u0026thinsp;=\\u0026thinsp;20,29,30,31\\u003c/p\\u003e\\u003cp\\u003e40,51,60\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eScandent shrubs\\u003c/b\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003eOvate to lanceolate\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eBase often round, margin serrate\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e5\\u0026ndash;7\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e8.2\\u0026ndash;9.6\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e2.6 to 3.5\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eC. sinuata\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003e(M?)\\u003c/p\\u003e\\u003cp\\u003e(n=?)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eShrubs\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003eOvate\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eBase truncate to cuneate, margin sinuate- lobed\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003e3\\u0026ndash;5\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003e3\\u0026ndash;4\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003e2\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eK. selleanum\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003e(P?)\\u003c/p\\u003e\\u003cp\\u003e(n=?)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003eScandent Shrubs\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eOvate\\u003c/b\\u003e to elliptical\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eBase subcordate, margin entire\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003e3\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003e3\\u0026ndash;5\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003e2\\u0026ndash;3\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eK. phanioides\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003e(P?)\\u003c/p\\u003e\\u003cp\\u003e(n=?)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003eScandent Shrubs\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003eOvate to lanceolate\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003eBase often lobed, distal margins entire\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003e3\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003e2\\u0026ndash;4\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e\\u003cspan type=\\\"BoldUnderline\\\" class=\\\"BoldUnderline\\\" name=\\\"Emphasis\\\"\\u003e2\\u0026ndash;3\\u003c/span\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eC.\\u003c/em\\u003e = \\u003cem\\u003eChromolaena\\u003c/em\\u003e; \\u003cem\\u003eK.\\u003c/em\\u003e = \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e; P? = paternal; M? = maternal. n\\u0026thinsp;=\\u0026thinsp;haploid chromosome count.\\u003c/p\\u003e\\u003c/div\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eOur work adds further evidence to the theory that reticulate evolution is common in the Asteraceae, and that a simple combined molecular marker phylogenetic tree should not trusted, even if clades are highly supported, to correctly assess relationships (see Suppl. Figure\\u0026nbsp;1). Testing for incongruence between nuclear and chloroplast phylogenetic trees is essential in this family.\\u003c/p\\u003e\\u003cp\\u003eStudies in the volcanic Macaronesian islands have suggested that in locally diverse genera, hybridization has played a significant role (Franciso-Ortega et al. 1996; Barber et al. 2007); these authors also found that chloroplast \\u0026ldquo;clades\\u0026rdquo; showed geographic structuring (a phenomenon not restricted to islands; Riesberg and Soltis 1991; Schuster et al. 2018) suggesting chloroplast capture. \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e, the richest Asteraceae genus in Caribbean endemics, with species in Cuba, Jamaica, Hispaniola, and Puerto Rico, appears a promising taxon to investigate hybridization in the Caribbean flora.\\u003c/p\\u003e\\u003cp\\u003eAs far as we are aware, our study is also the first to suggest an inter-subtribal generic hybrid supported by molecular data in the Asteraceae. Further sampling of the nuclear and chloroplast genomes of \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e, and of the species of \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e and \\u003cem\\u003eChromolaena\\u003c/em\\u003e that occur in Hispaniola, are needed to definitely confirm hybrid status, and identify the parental species. The current subtribal circumscription (Susanna et al. 2020) does not allow \\u003cem\\u003eOsmiopsis plumieri\\u003c/em\\u003e to be assigned to any subtribe, only to tribe Eupatorieae; this raises the interesting question if subtribes Praxelinae and Critoniinae - that are sisters (Rivera et al. 2016; Baker et al. 2022) should be combined.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\u003cp\\u003eR.N.R., V.L.R. and C.E.B.P. conceived the idea and experimental design for the study. R.N.R. and A.L.C. collected material in the field and examined herbarium material to gather morphological and molecular data. R.N.R., C.C.V.W. and A.L.C. did laboratory work (DNA extraction and amplification). R.N.R. measured of plant parts. A.L.C. produced the map. R.N.R. and V.L.R. curated and analysed the data. R.N.R. wrote the first draft of the manuscript and produced the tables, illustrations and figures. C.E.B.P. supervised, wrote the Abstract, and provided significant contributions to the manuscript. All authors provided comments that improved the final version of the manuscript.\\u003c/p\\u003e\\u003ch2\\u003eAcknowledgement\\u003c/h2\\u003e\\u003cp\\u003eWe thank the University of Bras\\u0026iacute;lia for institutional and financial support (Edital DPG N\\u0026ordm;0011/2022), Coordena\\u0026ccedil;\\u0026atilde;o de Aperfei\\u0026ccedil;oamento de Pessoal de N\\u0026iacute;vel Superior - Brazil (CAPES) \\u0026ndash; Finance Code 001 for a Ph. D. scholarship to the first author. CEBP thanks CNPq for a PQ2 Produtividade em Pesquisa 2021-2023 grant. We are most grateful to Jos\\u0026eacute; Panero for sending us the Koanoxelis plumieri samples to be sequenced, and for exhaustive searching of the TEX collections for the voucher specimen of Chromolaena collina. Thanks are also due to Nigel Barker and Costas Zachariades for kindly answering queries regarding Chromolaena collina, and to Cynthia Sothers (K) for sending us the description of Chromolaena heterosquamea. Arist\\u0026ocirc;nio Teles (UFG), Eric Hattori (UFVJM) and Jimi Nakajima (HUFU) provided several helpful comments.\\u003c/p\\u003e\\u003ch2\\u003eData Availability\\u003c/h2\\u003e\\u003cp\\u003eThe newly generated sequences (cited as \\u0026lsquo;In submission\\u0026rsquo; in Supplementary Material Table 1) will be uploaded to GenBank upon acceptance.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eAcevedo-Rodr\\u0026iacute;guez P, Strong MT (2012) Catalogue of seed plants of the West Indies. Smithsonian Institution Scholarly Press, Washington\\u003c/li\\u003e\\n\\u003cli\\u003eBaker WJ, Bailey P, Barber V, et al (2022) A Comprehensive Phylogenomic Platform for Exploring the Angiosperm Tree of Life. Syst Biol 71:301\\u0026ndash;319. https://doi.org/10.1093/sysbio/syab035\\u003c/li\\u003e\\n\\u003cli\\u003eBarber JC, Finch CC, Francisco-Ortega J, et al (2007) Hybridization in Macaronesian \\u003cem\\u003eSideritis\\u003c/em\\u003e (Lamiaceae): Evidence from incongruence of multiple independent nuclear and chloroplast sequence datasets. Taxon 56:74\\u0026ndash;88\\u003c/li\\u003e\\n\\u003cli\\u003eBautista HP (2000) Sistem\\u0026aacute;tica e filogenia de um g\\u0026eacute;nero end\\u0026eacute;mico de Brasil: \\u003cem\\u003eAcritopappus\\u003c/em\\u003e R.M. King \\u0026amp; H. Rob. (Asteraceae, Eupatorieae). Universidad de Santiago de Compostela\\u003c/li\\u003e\\n\\u003cli\\u003eClark K, Karsch-Mizrachi, I. Lipman DJ, Ostell J, Sayers E. (2016) Genbank. Nucleic Acids Res 44:D67\\u0026ndash;D72\\u003c/li\\u003e\\n\\u003cli\\u003eCunningham CW (1997) Can three incongruence tests predict when data should be combined? Mol Biol Evol 14:733\\u0026ndash;740. https://doi.org/10.1093/oxfordjournals.molbev.a025813\\u003c/li\\u003e\\n\\u003cli\\u003eDarlu P, Lecointret G (2002) When does the incongruence length difference test fail? Mol Biol Evol 19:432\\u0026ndash;437. https://doi.org/10.1093/oxfordjournals.molbev.a004098\\u003c/li\\u003e\\n\\u003cli\\u003eDarriba D, Taboada GL, Doallo R, Posada D (2012) JModelTest 2: More models, new heuristics and parallel computing. Nat Methods 9:772. https://doi.org/10.1038/nmeth.2109\\u003c/li\\u003e\\n\\u003cli\\u003eDoyle JJ, Doyle JL (1987) Isolation of plant DNA from fresh tissue. Focus (Madison) 12:13\\u0026ndash;15\\u003c/li\\u003e\\n\\u003cli\\u003eEdgar RC (2004) MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32:1792\\u0026ndash;1797. https://doi.org/10.1093/nar/gkh340\\u003c/li\\u003e\\n\\u003cli\\u003eFarris JS, K\\u0026auml;llersj\\u0026ouml; M, Kluge AG, Bult C (1994) Testing Significance of Incongruence. Cladistics 10:315\\u0026ndash;319\\u003c/li\\u003e\\n\\u003cli\\u003eFehrer J, Gemeinholzer B, Chrtek J, Br\\u0026auml;utigam S (2007) Incongruent plastid and nuclear DNA phylogenies reveal ancient intergeneric hybridization in Pilosella hawkweeds (\\u003cem\\u003eHieracium\\u003c/em\\u003e, Cichorieae, Asteraceae). Mol Phylogenet Evol 42:347\\u0026ndash;361. https://doi.org/10.1016/j.ympev.2006.07.004\\u003c/li\\u003e\\n\\u003cli\\u003eFernandes AC (2014) Sistem\\u0026aacute;tica de \\u003cem\\u003eHeterocondylus\\u003c/em\\u003e R.M. King \\u0026amp; H. Rob. (Eupatorieae, Asteraceae). Universidade Federal de Minas Gerais\\u003c/li\\u003e\\n\\u003cli\\u003eFrancisco-Ortega J, Jansen RK, Santos-Guerra A (1996) Chloroplast DNA evidence of colonization, adaptive radiation, and hybridization in the evolution of the Macaronesian flora. Proc Natl Acad Sci USA 93:4085\\u0026ndash;4090. https://doi.org/10.1073/pnas.93.9.4085\\u003c/li\\u003e\\n\\u003cli\\u003eFrancisco-Ortega J, Ventosa I, Oviedo R, et al (2008) Caribbean Island Asteraceae: Systematics, molecules, and conservation on a biodiversity hotspot. Bot Rev 74:112\\u0026ndash;131. https://doi.org/10.1007/s12229-008-9008-6\\u003c/li\\u003e\\n\\u003cli\\u003eGreiner S, Sobanski J, Bock R (2015) Why are most organelle genomes transmitted maternally? BioEssays 37:80\\u0026ndash;94. https://doi.org/10.1002/bies.201400110\\u003c/li\\u003e\\n\\u003cli\\u003eGuindon S, Gascuel O (2003) A Simple, Fast, and Accurate Algorithm to Estimate Large Phylogenies by Maximum Likelihood. Syst Biol 52:696\\u0026ndash;704. https://doi.org/10.1080/10635150390235520\\u003c/li\\u003e\\n\\u003cli\\u003eHipp AL, Hall JC, Sytsma KJ (2004) Congruence versus phylogenetic accuracy: Revisiting the incongruence length difference test. Syst Biol 53:81\\u0026ndash;89. https://doi.org/10.1080/10635150490264752\\u003c/li\\u003e\\n\\u003cli\\u003eKeil DJ, Luckow MA, Pinkava DJ (1988) Chromosome Studies in Asteraceae from the United States, Mexico, the West Indies, and South America. Am J Bot 75:652. https://doi.org/10.2307/2444199\\u003c/li\\u003e\\n\\u003cli\\u003eKilian N, Sennikov A, Wang ZH, et al (2017) Sub-paratethyan origin and middle to late miocene principal diversification of the Lactucinae (Compositae: Cichorieae) inferred from molecular phylogenetics, divergence-dating and biogeographic analysis. Taxon 66:675\\u0026ndash;703. https://doi.org/10.12705/663.9\\u003c/li\\u003e\\n\\u003cli\\u003eKing RM, Robinson H (1975) Studies in the Eupatorieae (Asteraceae). CXLIX. A new genus, \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e. Phytologia 32:250\\u0026ndash;251\\u003c/li\\u003e\\n\\u003cli\\u003eKing RM, Robinson HE (1987) The genera of the Eupatorieae (Asteraceae). Missouri Botanical Garden, [St. Louis]\\u003c/li\\u003e\\n\\u003cli\\u003eKing RM, Robinson HE (1970) Studies in the Eupatorieae (Compositae). XXIX. The genus \\u003cem\\u003eChromolaena\\u003c/em\\u003e. Phytologia 20:196\\u0026ndash;209. https://doi.org/10.5962/bhl.part.7118\\u003c/li\\u003e\\n\\u003cli\\u003eMiller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In: 2010 Gateway Computing Environments Workshop, GCE 2010. New Orleans, pp 1\\u0026ndash;8\\u003c/li\\u003e\\n\\u003cli\\u003ePelser PB, Kennedy AH, Tepe EJ, et al (2010) Patterns and causes of incongruence between plastid and nuclear Senecioneae (Asteraceae) phylogenies. Am J Bot 97:856\\u0026ndash;873. https://doi.org/10.3732/ajb.0900287\\u003c/li\\u003e\\n\\u003cli\\u003ePOWO (2024) Plants of the World Online. Facilitated by the Royal Botanic Gardens, Kew. In: Http://Www.Plantsoftheworldonline.Org/. http://www.plantsoftheworldonline.org/. Accessed 1 Apr 2024\\u003c/li\\u003e\\n\\u003cli\\u003eRiahi M, Zarre S, Maassoumi AA, et al (2010) An inexpensive and rapid method for extracting papilionoid genomic DNA from herbarium specimens. Genet Mol Res GMR 9:1334\\u0026ndash;1342. https://doi.org/10.4238/vol9-3gmr839\\u003c/li\\u003e\\n\\u003cli\\u003eRibeiro RN (2023) Sistem\\u0026aacute;tica e Filogenia da subtribo Praxelinae R.M.King \\u0026amp; H.Rob. (Asteraceae, Eupatorieae) [Systematics and Phylogeny of the subtribe Praxelinae R.M.King \\u0026amp; H.Rob. (Asteraceae, Eupatorieae)]. Universidade de Bras\\u0026iacute;lia\\u003c/li\\u003e\\n\\u003cli\\u003eRice A, Glick L, Abadi S, et al (2015) The Chromosome Counts Database (CCDB) - a community resource of plant chromosome numbers. New Phytol 206:19\\u0026ndash;26. https://doi.org/10.1111/nph.13191\\u003c/li\\u003e\\n\\u003cli\\u003eRieseberg LH, Soltis DE (1991) Phylogenetic consequences of cytoplasmic gene flow in plants. Evol Trends Plants 5:65\\u0026ndash;84\\u003c/li\\u003e\\n\\u003cli\\u003eRieseberg LH, Raymond O, Rosenthal DM, et al (2003) Major ecological transitions in wild sunflowers facilitated by hybridization. Science (80- ) 301:1211\\u0026ndash;1216. https://doi.org/10.1126/science.1086949\\u003c/li\\u003e\\n\\u003cli\\u003eRivera VL, Panero JL, Schilling EE, et al (2016) Origins and recent radiation of Brazilian Eupatorieae (Asteraceae) in the eastern Cerrado and Atlantic Forest. Mol Phylogenet Evol 97:90\\u0026ndash;100. https://doi.org/10.1016/j.ympev.2015.11.013\\u003c/li\\u003e\\n\\u003cli\\u003eRobinson HE, Powell AM, Carr GD, et al (1989) Chromosome numbers in Compositae, XVI: Eupatorieae II. Ann Missouri Bot Gard 76:1004\\u0026ndash;1011\\u003c/li\\u003e\\n\\u003cli\\u003eRobinson HE, Schilling EE, Panero JL (2009) Eupatorieae. In: Funk VA, Suzana A, Stuessy TF, Bayer RJ (eds) Systematics, Evolution, and Biogeography of Compositae. IAPT \\u0026ndash; International Association of Plant Taxonomy, Vienna, p 731\\u0026minus;744\\u003c/li\\u003e\\n\\u003cli\\u003eRonquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572\\u0026ndash;1574. https://doi.org/10.1093/bioinformatics/btg180\\u003c/li\\u003e\\n\\u003cli\\u003eSalgado VG, Grossi MA, Ribeiro RN, et al (2022) Understanding \\u003cem\\u003ePraxelis\\u003c/em\\u003e (Asteraceae, Eupatorieae): an updated taxonomy with lectotypifications and morphological and distributional clarifications. Aust Syst Bot 35:296\\u0026ndash;316. https://doi.org/10.1071/sb21027_co\\u003c/li\\u003e\\n\\u003cli\\u003eSchilling EE (2011) Hybrid genera in Liatrinae (Asteraceae: Eupatorieae). Mol Phylogenet Evol 59:158\\u0026ndash;167. https://doi.org/10.1016/j.ympev.2011.01.011\\u003c/li\\u003e\\n\\u003cli\\u003eSchuster TM, Setaro SD, Tibbits JFG, et al (2018) Chloroplast variation is incongruent with classification of the Australian bloodwood eucalypts (genus \\u003cem\\u003eCorymbia\\u003c/em\\u003e, family Myrtaceae). PLoS One 13:1\\u0026ndash;28. https://doi.org/10.1371/journal.pone.0195034\\u003c/li\\u003e\\n\\u003cli\\u003eStace C, Preston CD, Pearman DA, Abbott RJ (2015) Hybrid Flora of the British Isles. Botanical Society of Britain and Ireland, Bristol\\u003c/li\\u003e\\n\\u003cli\\u003eSusanna A, Baldwin BG, Bayer RJ, et al (2020) The classification of the Compositae: A tribute to Vicki Ann Funk (1947\\u0026ndash;2019). Taxon 69:807\\u0026ndash;814. https://doi.org/10.1002/tax.12235\\u003c/li\\u003e\\n\\u003cli\\u003eSwofford DL (2002) PAUP* Phylogenetic analysis using parsimony (*and other methods). v. 4.0. Sinauer Associates, Sunderland, MA\\u003c/li\\u003e\\n\\u003cli\\u003eTorres AM, Liogier AH (1970) Chromosome numbers of Dominican Compositae. Brittonia 22:240\\u0026ndash;245. https://doi.org/10.2307/2805906\\u003c/li\\u003e\\n\\u003cli\\u003eUrban I (1931) Plantae Haitienses et Dominguenses novae vel rariores IX a cl. E. L. Ekman 1924-1930 lectae. Ark f\\u0026ouml;r Bot 23A:1\\u0026ndash;103\\u003c/li\\u003e\\n\\u003cli\\u003eWang ZH, Peng H, Kilian N (2013) Molecular phylogeny of the \\u003cem\\u003eLactuca\\u003c/em\\u003e alliance (Cichorieae subtribe Lactucinae, Asteraceae) with focus on their Chinese centre of diversity detects potential events of reticulation and chloroplast capture. PLoS One 8:. https://doi.org/10.1371/journal.pone.0082692\\u003c/li\\u003e\\n\\u003cli\\u003eWatanabe K, King RM, Yahara T, et al (1995) Chromosomal Cytology and Evolution in Eupatorieae (Asteraceae). Ann Missouri Bot Gard 82:581\\u0026ndash;592. https://doi.org/10.2307/2399838\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Caribbean, Compositae, Critoniinae, Praxelinae\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6938723/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6938723/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cem\\u003eOsmiopsis\\u003c/em\\u003e (Asteraceae, Eupatorieae) is endemic to Hispaniola and one of the seven genera of subtribe Praxelinae. When \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e was established in 1975, the authors hypothesized it was a hybrid and proposed \\u003cem\\u003eChromolaena\\u003c/em\\u003e (subtribe Praxelinae) and \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e (subtribe Critoniinae) as putative parent genera. Phylogenetic investigation of subtribe Praxelinae, reconstructed within a matrix of 202 species of tribe Eupatorieae has clarified its origin. An ILD test showed significant incongruity between the nuclear and chloroplast trees (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.001). Based on Bayesian analysis of ITS, \\u003cem\\u003eO. plumieri\\u003c/em\\u003e emerged in a strongly supported clade (PP\\u0026thinsp;=\\u0026thinsp;0.98) of 23 species of Critoniinae, closely allied to six \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e species. Based on Bayesian analysis of \\u003cem\\u003endhF\\u003c/em\\u003e, \\u003cem\\u003eO. plumieri\\u003c/em\\u003e emerged in a strongly supported clade (PP\\u0026thinsp;=\\u0026thinsp;1) of 20 species of Praxelinae with \\u003cem\\u003eChromolaena\\u003c/em\\u003e, \\u003cem\\u003ePraxelis\\u003c/em\\u003e and three other genera. These results suggest \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e is hybrid between \\u003cem\\u003eChromolaena\\u003c/em\\u003e and \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e. \\u003cem\\u003eOsmiopsis\\u003c/em\\u003e shares with \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e: Infundibuliform corolla with a cylindrical base, triangular corolla lobes, and anther appendages wider than longer. \\u003cem\\u003eO. plumieri\\u003c/em\\u003e shares with \\u003cem\\u003eChromolaena\\u003c/em\\u003e and \\u003cem\\u003ePraxelis\\u003c/em\\u003e: semi-scandent habit and deciduous involucral bracts. As far as we are aware, this is the first case of a possible inter-subtribal nothogenus in the Asteraceae. In the Asteraceae, \\u003cem\\u003eKoanophyllon\\u003c/em\\u003e has more Caribbean island endemics than any other genus. This raises the question if hybridization has played a significant role in the diversification of the Caribbean flora, as has been shown in species-rich genera from volcanic archipelagos. Taxonomically, it raises the question if sister subtribes Praxelinae and Critoniinae should be united.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Molecular phylogenetics suggest Osmiopsis (Asteraceae) is a rare inter-subtribal hybrid genus on Hispaniola\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-07-18 12:46:56\",\"doi\":\"10.21203/rs.3.rs-6938723/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"b0c19d3b-b83c-4c2d-827d-744186173fe4\",\"owner\":[],\"postedDate\":\"July 18th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-08-08T12:39:25+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-07-18 12:46:56\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6938723\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6938723\",\"identity\":\"rs-6938723\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}