{"paper_id":"0912bcca-2481-4b5d-a4e0-7f905c0927bc","body_text":"Nicotine Administration Exacerbates Lipid Profile Alterations in a Wistar Rat Model of Liver Fibrosis Through Fatty Acid Synthesis Modulation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Nicotine Administration Exacerbates Lipid Profile Alterations in a Wistar Rat Model of Liver Fibrosis Through Fatty Acid Synthesis Modulation Narges Dastmalchi, Khalil Hajiasgharzadeh, Hooria Amooji, Mohammad Reza Alipour, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6646003/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Dyslipidemia is characterized by abnormal lipid levels in the bloodstream and can be influenced by liver diseases and smoking. Nicotine exposure and liver damage are linked to lipid metabolism impairments. This study investigated the effects of nicotine on dyslipidemia in a cholestasis rat model using bile duct ligation (BDL) to establish liver fibrosis. Wistar rats received intraperitoneal nicotine at doses of 10 mg/kg (high) and 1 mg/kg (low) for three weeks. Serum levels of triglycerides (TG), cholesterol (Chol), low-density lipoprotein (LDL), and high-density lipoprotein (HDL) were quantified via a standard colorimetric kit (Pars Azmoon). Liver fibrosis confirmed through histological investigation. Additionally, the mRNA and protein expression of fatty acid synthase (FAS) were assessed using quantitative RT-PCR and immunofluorescence. Results showed that nicotine administration in healthy rats significantly increased TG, Chol, and LDL levels while decreasing HDL. In BDL rats, nicotine further reduced HDL and increased TG levels without affecting Chol and LDL. Histological analysis confirmed hepatic fibrosis, and both nicotine exposure and liver fibrosis elevated FAS expression in liver tissues. These findings indicate that BDL-induced liver fibrosis causes dyslipidemia in rats, and nicotine exposure exacerbates serum lipid profile alterations, potentially through increased FAS expression. Therefore, it is recommended that individuals with liver disease avoid nicotine to manage dyslipidemia. Biological sciences/Physiology Health sciences/Diseases/Metabolic disorders Health sciences/Diseases/Gastrointestinal diseases/Liver diseases Liver fibrosis Bile duct ligation Fatty acid synthase Dyslipidemia Nicotine Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Liver fibrosis is a progressive condition marked by the excessive accumulation of extracellular matrix proteins due to chronic liver injury [ 1 ]. This condition represents a critical intermediary stage in liver disease that can lead to cirrhosis and hepatocellular carcinoma if left untreated [ 2 ]. Recent research has highlighted the cellular and molecular mechanisms involved in the progression of fibrosis and its consequences, focusing particularly on the roles of hepatic stellate cells, inflammatory mediators, and the microbiome. For instance, emerging research highlights how hepatic stellate cells contribute to fibrosis via activation and interaction with inflammatory pathways [ 3 , 4 ]. Additionally, alterations in gut microbiota have been implicated in liver disease progression, suggesting a complex interplay between the liver and the microbiome [ 5 , 6 ]. The global prevalence of advanced liver fibrosis is approximately 3%, with an increasing trend observed in recent years [ 7 ]. Understanding these interactions is essential for developing effective treatments and improving patient outcomes in liver disease [ 8 ]. The liver is the primary site for lipid metabolism, and liver injury is closely associated with disturbances in this process [ 9 ]. Alterations in lipid and lipoprotein content in the blood can lead to the development of various diseases and significantly increase the risk of cardiovascular conditions [ 10 , 11 ]. About 40% of individuals over the age of 30 are affected by dyslipidemia, with severity notably higher in men [ 12 ]. Dyslipidemia is recognized as one of the most critical risk factors for liver diseases, and the bidirectional relationship between liver diseases and dyslipidemia is well established [ 13 ]. Notably, changes in the blood lipid profile are among the primary modifiable risk factors for the progression of advanced liver fibrosis and cirrhosis [ 14 , 15 ]. Moreover, exposure to nicotine among smokers can lead to significant alterations in normal lipid metabolism, contributing to various lipid metabolic disorders [ 16 ]. The administration of nicotine has been documented to exacerbate liver damage, raising concerns about its role in hepatic health [ 17 – 19 ]. This relationship is particularly alarming given the rising prevalence of smoking-related liver conditions. Several studies have demonstrated that nicotine administration significantly increases markers of hepatic inflammation, lipid peroxidation, and DNA damage-related biomarkers [ 20 , 21 ]. Simultaneously, it has been shown to reduce the activities of antioxidant enzymes, thereby highlighting its potential to induce oxidative stress within the liver [ 22 , 23 ]. Such oxidative stress is a critical factor in the progression of liver diseases, as it can lead to further cellular injury and inflammation, creating a vicious cycle of damage and dysfunction. The enzyme fatty acid synthase (FAS) is one of the most important modulators of hepatic lipid metabolism. It acts as a key regulatory element in fatty acid synthesis, converting excess carbohydrates into fatty acids for storage or energy use. Importantly, FAS is a primary target for various transcription factors involved in lipid metabolism, influencing how the liver responds to metabolic demands and stresses[ 24 ]. Dysregulation of FAS due to nicotine exposure could disrupt normal lipid homeostasis, potentially leading to an increased risk of metabolic syndrome, fatty liver disease, and other complications associated with impaired lipid metabolism. Understanding the intricate relationship between nicotine exposure, liver health, and lipid metabolism is crucial for identifying potential therapeutic targets and developing effective interventions aimed at mitigating the adverse effects of smoking on liver function. Further research is warranted to unravel these complex interactions and establish comprehensive strategies to protect against the lipid metabolic disorders associated with nicotine exposure, especially in individuals with pre-existing liver conditions. Despite considerable existing research on nicotine and liver disease, the specific impact of nicotine on lipid profiles within the context of liver fibrosis remains largely underexplored. Notably, previous studies have produced inconsistent findings, leaving a critical gap in understanding. This study is novel in its focused investigation of how nicotine administration influences lipid profiles specifically through the modulation of FAS expression in an animal model of liver fibrosis. It uniquely examines the interplay between nicotine exposure and liver fibrosis on lipid indices, addressing an overlooked aspect of the disease mechanism. The findings could significantly advance current knowledge by clarifying the role of nicotine in dyslipidemia associated with liver fibrosis, potentially informing new clinical strategies and public health policies for managing such liver-related metabolic disturbances. 2. Material and Methods 2.1. Establishment of liver fibrosis model In this study, a total of 36 male Wistar rats, each weighing between 220 and 250 grams and aged eight weeks, were acquired from the animal facility at Tabriz University of Medical Sciences. Following a period of acclimatization, the rats underwent a bile duct ligation (BDL) procedure under anesthesia induced by ketamine (at a dosage of 100 mg/kg) and xylazine (10 mg/kg) [ 25 ]. During the surgical intervention, an incision was made in the peritoneal cavity, allowing for the careful isolation of the bile duct, which was then securely ligated in three separate locations to prevent bile flow [ 25 ]. Figure 1 illustrates the isolation of the bile duct in sham-operated rats alongside the ligation of the duct in BDL rats. Additionally, it presents the gross morphology of the livers from both groups of rats, highlighting the differences in liver appearance resulting from the surgical procedures. This visual representation provides important context for understanding the impact of bile duct ligation on liver structure and function. Previous research has shown that nicotine has the potential to worsen liver fibrosis [ 17 ]. Based on this information, we anticipated that the groups exposed to nicotine would exhibit an exacerbation of hepatic fibrosis. In earlier studies using the BDL model, it has been noted that the severity of liver fibrosis peaks around four weeks post-surgery [ 26 ]. Consequently, we opted to use a three-week BDL model for our experiment. This timeframe allows for the observation of liver fibrosis at a submaximal stage, enabling us to effectively assess both the possible protective effects and the potential aggravating influence of nicotine on lipid profile alterations in the treated groups. By studying the effects at this specific time point, we aim to gain insights into the interactions between nicotine exposure, liver damage, and potential alterations in lipid profile indices. In this research, we employed a method of euthanasia during deep anesthesia achieved with ketamine and xylazine, which involved the surgical opening of the abdominal and thoracic cavities. At the end of the experimental procedures, we collected blood samples directly from the heart, and liver tissue samples were obtained for subsequent analysis of immunofluorescence and gene expression. Specifically, a section of liver tissue from the middle lobe was preserved in formalin, which is essential for conducting immunofluorescence studies. Simultaneously, another portion of liver tissue, taken from the lower segment of the right lateral lobe, was stored at -80°C to facilitate measurements of FAS gene expression. This approach allows for a comprehensive evaluation of the biochemical changes occurring in the liver, contributing valuable insights into our understanding of the underlying mechanisms of lipid metabolism alterations during nicotine exposure and the progression of liver damage. The body weights of the rats in the various treatment groups provide important insights into the effects of bile duct ligation and nicotine treatment (Fig. 2 ). To track these changes, the rats' weights were measured every other day. Our analysis revealed no significant differences in body weight following either bile duct ligation or nicotine administration. This suggests that, under the experimental conditions of this study, these treatments did not substantially affect the body weight of the rats. 2.2. Study protocol and nicotine administration The animals were randomly divided into six groups of six each: 1) Sham + Saline; 2) Sham + Nicotine (1 mg/kg); 3) Sham + Nicotine (10 mg/kg); 4) BDL + Saline; 5) BDL + Nicotine (1 mg/kg); 5) BDL + Nicotine (10 mg/kg). Nicotine (Sigma-Aldrich, product number N3876) was administered via intraperitoneal injection at two different dosage levels: a lower dose and a higher dose. Nicotine administration was initiated the day following the BDL surgical procedure. The dosing regimen involved administering either 1 mg/kg or 10 mg/kg of nicotine every other day for a total duration of three weeks [ 18 , 27 ]. This dosing schedule was designed to evaluate the effects of both low and high doses of nicotine, allowing for a comparative analysis of the physiological changes associated with each dosage level over the specified timeframe. Through this method, we aimed to gain insights into the dose-dependent impacts of nicotine on lipid metabolism during liver fibrosis and assess any related alterations in FAS expression and lipid profiles. 2.3. Lipid profile measurement The evaluation of lipid profiles serves as a vital diagnostic tool for assessing an individual's cardiovascular health and metabolic condition. This analysis generally includes the measurement of several key lipid metrics, such as total cholesterol (Chol), low-density lipoprotein (LDL) cholesterol, high-density lipoprotein (HDL) cholesterol, and triglycerides (TG). In this study, blood samples were obtained from rats for lipid profile assessment. Following collection, the serum samples were processed and analyzed in a laboratory setting using commercial assay kits sourced from Pars Azmoon (Pars Azmoon, Tehran, Iran). This quantitative assessment provides insights into lipid metabolism and serves as an important indicator of potential cardiovascular risks. By understanding the lipid profiles of the subjects involved in this research, we can explore the relationships between lipid levels, nicotine exposure, and the progression of liver fibrosis, contributing to a more comprehensive understanding of lipid metabolism alterations during these conditions. 2.4. quantitative real-time PCR analysis of FAS To determine amount of FAS mRNA level in the liver samples, total RNA was extracted from these samples and complementary DNA (cDNA) was produced as previously described [ 18 ]. Briefly, total RNA was obtained after Trizol treatment (Invitrogen, Carlsbad, CA); this was performed according to the manufacturer’s guidelines. After Trizol treatment, all RNAs of the liver tissues were obtained and the Prime Script Kit (TaKaRa Bio Inc., Japan) was applied for cDNA synthesis. The purity of extracted RNA was assessed using a NanoDrop Spectrophotometer (Thermo Scientific, USA). qRT-PCR was performed on a ViiATM7 RT-PCR system (Applied Biosystems, Carlsbad, CA) using SYBR Green fluorescent-based assay (638320, TaKaRa Bio Inc. Japan). Beta-actin gene was used as an internal standard and after normalizing to its expression level, the relative expression level of FAS was quantified by the 2 −(ΔΔCt) method [ 28 ]. The reaction parameters were set as 50 ℃ for 2 min, 95 ℃ for 15 s, 95 ℃ for 15 s, and 60 ℃ for 1 min for 40 cycles. The primers of FAS and β-actin were synthesized by Sinaclon (Tehran, Iran) and reported in Table 1 . All RT-qPCR tests were performed in duplicate from six samples taken from each group. Table 1 The primers sequences for target genes. Genes Sequences Accession number Product size (bp) FAS Forward 5´ CACAGCATTCAGTCCTATCCACAGA 3´ NM_017332.2 148 Reverse 5´ CACAGCCAACCAGATGCTTCA 3´ β-actin Forward 5´ CCGCGAGTACAACCTTCTTG 3´ NM_031144.3 81 Reverse 5´ GCAGCGATATCGTCATCCAT 3´ 2.5. Immunofluorescence analysis of FAS Immunofluorescence analysis for FAS was performed as previously described [ 26 ]. In brief, the tissue processing begins with immersion in distilled water for one hour, followed by a series of ethanol solutions for one hour each. This is followed by two changes of xylene and paraffin baths, also for one hour each, to prepare paraffin blocks, which are then sectioned to a thickness of 5 micrometers. The sections are rehydrated through two changes of xylene and several ethanol dilutions, ultimately returning to distilled water. After washing with TBS plus 0.03% Triton X-100, slides undergo antigen retrieval in citrate buffer using a microwave for 20 minutes, ensuring to replace any lost buffer. Following another wash, slides are blocked with 10% normal serum or 1% BSA in TBS for two hours, then washed again. Primary antibody (Fatty Acid Synthase (A-5): sc-55580) (purchased from Santa Cruz Biotechnology, Inc.) incubation is performed at 37ºC for four hours and overnight at 4ºC before another wash. Fluorescent dye-labeled secondary antibody was Goat Anti-Mouse IgG(H + L) (CY3 conjugated) (Catalog No. E-AB-1011) is uptake for 10 minutes, followed by washes, and counterstaining with DAPI for 15 minutes. Finally, slides are dehydrated in ethanol, treated with xylene, and mounted with a coverslip. The sections were then counterstained with DAPI and were monitored by fluorescence microscopy (Olympus BX50) and evaluated using a DP72 digital camera. 2.6. Statistical analysis The data were processed with GraphPad Prism 6 software (GraphPad Software, La Jolla, California, USA) and presented as Mean ± SEM. A One-way ANOVA followed by Tukey's post-test was used for normally distributed data. For variables that did not follow a normal distribution, the Kruskal-Wallis test was applied, with post hoc analysis conducted using Dunn's test. The normality of the data was assessed via the Kolmogorov-Smirnov test, and a p-value of less than 0.05 was deemed statistically significant. 3. Results 3.1. Both nicotine administration and liver fibrosis lead to changes in lipid profile indexes Serum lipid profile (triglyceride, total cholesterol, HDL-cholesterol, and LDL cholesterol) levels were measured and are shown in Fig. 3 . As shown in this Figure, there are significant elevations in triglyceride (Fig. 3 A), total cholesterol (Fig. 3 B), and LDL-cholesterol (Fig. 3 B) values in both nicotine-received and BDL rats compared with the saline-received sham group. Regarding serum HDL-cholesterol level, it was significantly decreased in the nicotine and BDL groups compared with the controls (Fig. 3 D). However, nicotine administration exacerbates the increases of triglyceride and reduction of HDL in liver fibrotic groups, but had no additional effect on total cholesterol and LDL-cholesterol levels. 3.2. Nicotine alters hepatic fatty acid synthesis expression in the rats with fibrosis The impact of nicotine administration on the expression of FAS in the liver of rats was evaluated using RT-qPCR. Chronic liver injury is known to significantly affect lipid metabolism, resulting in alterations to the lipid profile. In our study, bile duct ligation (BDL) induced liver fibrosis, leading to dyslipidemia characterized by elevated triglycerides, cholesterol, and LDL levels, alongside reduced HDL levels in the bloodstream. Our findings indicate that FAS expression was markedly higher in BDL rats compared to sham-operated controls. Furthermore, nicotine administration in bile duct-ligated rats further amplified FAS expression levels (**P < 0.01) relative to the bile duct ligated-saline group (Fig. 4 ). This suggests that FAS upregulation is linked to nicotine-induced dyslipidemia in BDL rats. Smoking negatively influences plasma lipid concentrations, and our lipid profile assessment revealed that increased nicotine concentrations corresponded with a pronounced rise in FAS expression across nearly all experimental groups. 3.3. The results of immunofluorescent staining Our histopathological analysis revealed that BDL surgery and the subsequent development of liver fibrosis induced significant histological alterations in the liver (Fig. 5 ). Notably, the livers of nicotine-treated rats exhibited portal tract expansion, a hallmark of BDL-induced changes. A distinctive feature observed in the BDL group was the formation of portal-to-portal linkages, indicative of advanced fibrotic remodeling. Furthermore, the livers of nicotine-treated BDL rats demonstrated more severe pathological damage compared to sham-operated animals. This was characterized by an increased proliferation of biliary epithelial cells, which manifested as prominent tube-like structures in the periportal regions (Fig. 5 ). The intensity of these changes was markedly greater in nicotine-treated BDL rats than in saline-treated BDL liver samples, suggesting that nicotine exacerbates the fibrotic and proliferative responses following bile duct ligation. These findings highlight the potential role of nicotine in aggravating liver injury and fibrosis in the context of cholestatic liver disease. Additionally, using fluorescence microscopy, we observed a notable elevation in the expression of FAS protein within the liver tissues of rats exposed to nicotine, in contrast to sham-operated rats that were administered normal saline (Fig. 6 ). This finding suggests that nicotine exposure considerably enhances FAS protein levels, indicating a potential mechanism through which nicotine may influence lipid metabolism and contribute to hepatic changes. The observed increase in FAS expression in nicotine-treated rats underscores the role of nicotine as a significant factor in liver pathology, particularly concerning lipid dysregulation. Immunofluorescence analysis revealed that FAS expression was elevated in the groups exhibiting liver fibrosis when compared to those with healthy liver tissue. Another finding from this study was the further enhancement of FAS protein expression following nicotine administration in rats with liver fibrosis (Fig. 7 ). Given the crucial role that FAS plays in the biosynthesis of fatty acids, which serve as precursors for triglycerides, the increased expression of FAS in fibrotic rats following nicotine exposure may help elucidate how nicotine affects lipid profiles in the context of liver fibrosis. This suggests that nicotine not only exacerbates existing liver injuries but also significantly modifies lipid metabolism, potentially contributing to further metabolic disturbances in these individuals. Future research could delve deeper into the mechanisms underpinning these changes and their implications for managing lipid-related disorders in patients with liver fibrosis. 4. Discussion The liver plays a central role in lipid synthesis, storage, and catabolism; therefore, persistent liver damage can disrupt these processes. In the present study, the detrimental effect of intraperitoneally administered nicotine on the dyslipidemia in animal model of liver fibrosis was observed clearly. The interaction between liver damage and lipid profile changes has been reported in various studies [ 29 – 31 ]. Moreover, previous studies suggested that cigarette smoking has extensive effects on lipid profile [ 32 , 33 ]. Despite the wealth of research on liver fibrosis and its metabolic implications, there has been no study specifically investigating the effects of concurrent nicotine exposure in an animal model of liver fibrosis. This gap in the literature presents an important opportunity to explore how nicotine might influence the pathophysiology of liver fibrosis and associated metabolic disturbances. Given that nicotine is known to affect lipid metabolism and potentially exacerbate liver damage, understanding its impact within the context of liver fibrosis could reveal significant insights. FAS is an enzyme that plays a crucial role in the biosynthesis of fatty acids by catalyzing the final step in this metabolic pathway [ 34 ]. This enzyme is responsible for the synthesis of long-chain fatty acids, which are essential components of various lipid molecules, including triglycerides and phospholipids. The activity of FAS is tightly regulated and is influenced by various factors, making it a key player in the regulation of lipid metabolism. Dysregulation of FAS has been implicated in several metabolic disorders, including obesity, diabetes, and fatty liver disease [ 35 ]. Understanding the precise mechanisms by which FAS operates and is regulated could provide valuable insights into potential therapeutic targets for these conditions, highlighting its importance in both normal physiology and disease states. Liver fibrosis is among the most significant conditions affecting the liver [ 36 ]. This progressive disease occurs when healthy liver tissue is replaced by scar tissue, often as a result of chronic liver injury due to factors like cholestasis. Over time, fibrosis can lead to severe complications, such as cirrhosis or liver cancer, significantly impacting overall health. The ligation of bile ducts results in a gradual cholestatic injury, which ultimately causes liver fibrosis and various associated complications [ 18 , 26 ]. Over time, this condition can lead to significant damage to liver tissue, impairing its function and increasing the risk of further health issues. In addition to fibrosis, the progression of this injury may trigger inflammatory responses, portal hypertension, and potentially the development of cirrhosis. Additionally, a control group of sham-operated rats underwent an identical surgical procedure, but the common bile duct was not ligated, allowing for comparisons between the two groups. This experimental design aims to investigate the physiological and biochemical effects of bile duct obstruction in this animal model [ 25 , 37 ]. Liver fibrosis is a long-term result of damage and inflammation in the liver tissue. In our experiment, the findings from the immunofluorescent study indicated notable alterations in liver tissue in the BDL groups compared to the healthy sham groups (Fig. 6 and Fig. 7 ). These changes were characterized by portal extension and the accumulation of fibrous tissue. Liver fibrosis is characterized by the excessive accumulation of extracellular matrix proteins, driven by a complex interplay of cellular and molecular factors. Central to these processes are HSCs, inflammatory mediators, and the microbiome [ 38 ]. Recently, nicotine has emerged as a significant factor influencing liver health and disease progression. Understanding their interactions is crucial for identifying effective therapeutic targets and strategies in managing liver fibrosis. The activation of HSCs is driven by various inflammatory mediators, including cytokines such as transforming growth factor-beta (TGF-β) and platelet-derived growth factor (PDGF) [ 39 ]. These cytokines, often released by activated Kupffer cells and infiltrating macrophages, facilitate HSC activation and promote fibrogenesis [ 40 ]. Conversely, activated HSCs can also secrete pro-inflammatory cytokines like interleukin-1 (IL-1) and tumor necrosis factor-alpha (TNF-α), which further recruit and activate immune cells, creating a feedback loop that exacerbates inflammation and fibrosis. Recent studies suggest that nicotine can exacerbate this process by increasing the release of pro-inflammatory cytokines and inducing oxidative stress, which further amplifies HSC activation and fibrogenesis [ 4 , 21 ]. Nicotine exposure has been shown to enhance the inflammatory response in the liver, contributing to the worsening of fibrosis through increased levels of inflammatory cytokines. Additionally, emerging evidence suggests that the gut microbiome significantly impacts liver health and disease, particularly through the gut-liver axis. Dysbiosis—an imbalance in the gut microbiota—can lead to increased intestinal permeability, allowing microbial products such as lipopolysaccharides (LPS) to enter the bloodstream. This translocation of gut-derived inflammatory mediators can activate hepatic inflammation, further stimulating HSC activation [ 41 ]. The interaction between the microbiome and liver fibrosis is bidirectional; not only does the state of the liver influence microbiome composition, but dysbiosis can exacerbate liver pathology. Studies have shown that restoring a healthy gut microbiota through probiotics or dietary interventions may mitigate liver inflammation and fibrosis by stabilizing the gut barrier and reducing systemic inflammation [ 42 ]. Additionally, nicotine has been associated with alterations in gut microbiota composition, further complicating its role in liver health [ 43 , 44 ]. On the other hand, Shaik et al. discusses the impact of nicotine on lipid peroxidation and the activities of antioxidant enzymes, highlighting its role in exacerbating oxidative stress and inflammation in both the cardiovascular system and the liver [ 45 ]. In this study, increased levels of oxidative and nitrosative stress markers, such as nitric oxide, lipid peroxidation, and protein carbonyls, were also observed. Elevated nicotine and cotinine levels suggest nicotine contributes to oxidative damage and cardiovascular risk [ 45 ]. Strong correlations between nicotine and markers of oxidative stress, cholesterol, and creatinine further highlight the cardiovascular risks due to nicotine-induced free radicals and oxidative stress [ 45 ]. Additionally, other studies further elucidates how nicotine contributes to hepatic inflammation and oxidative damage, linking these effects to increased cardiovascular risk [ 46 ]. Understanding the interactions between hepatic stellate cells, inflammatory mediators, the microbiome, and nicotine is essential for developing effective treatments for liver fibrosis. In the current study, our analysis of FAS expression reveals a mechanistic pathway by which nicotine may affect lipid levels, deepening our understanding of relevant biological targets for therapeutic interventions. This study highlights the risks linked to nicotine exposure, particularly for individuals with liver disease—insights that are vital for shaping effective smoking cessation strategies and public health messaging related to the management of dyslipidemia. By investigating both high and low doses of nicotine, we gained important insights into how different exposure levels influence lipid metabolism and liver function, which will guide future research and treatment approaches. Our findings indicate a clear correlation between higher concentrations of nicotine and significant changes in both the gene and protein expression of FAS. Consequently, greater nicotine exposure leads to more pronounced alterations in lipid profiles. These results underscore an additional health benefit from smoking cessation, particularly for heavy smokers (those consuming more than 20 cigarettes per day) who have liver disease. Understanding the interaction between chronic liver injury and lipid metabolism is critical for developing targeted therapies to address these metabolic disturbances and enhance overall liver health. Declarations Funding The grant for this study was provided by the Stem Cell Research Center of Tabriz University of Medical Sciences, Tabriz, Iran [grant number: 73585]. Acknowledgments The authors would like to thank the Stem Cell Research Center, Tabriz University of Medical Sciences for their support. Conflicts of interest/Competing interests The authors have no conflicts of interest to declare. Availability of data and materials The data that support the findings of this study are available from the corresponding authors upon reasonable request. Authors' contributions KH and SMBK provided biological materials and reagents. ND, KH, HA, and SMBK performed the experiments, wrote the initial draft of the manuscript, and performed data analysis. MRA, MA, BM, and HHN participated in the design of the work and reviewed and edited the manuscript. All of the authors have read and approved the final version of the manuscript. Ethics approval The study is reported in accordance with ARRIVE guidelines. All experiments were performed in compliance with the ethical principles of Tabriz University of Medical Sciences and approved by the Regional Medical Research Ethics Committee (Ethical code: IR.TBZMED.AEC.1403.017). Consent to participate Not Applicable Consent for publication Not Applicable References Oyelade, T., Moore, K. P. & Mani, A. R. Physiological network approach to prognosis in cirrhosis: A shifting paradigm. Physiol. Rep. 12 https://doi.org/10.14814/phy2.16133 (2024). Chen, Y-H., Wu, W-K. & Wu, M-S. Microbiota-Associated Therapy for Non-Alcoholic Steatohepatitis-Induced Liver Cancer: A Review. Int. J. Mol. Sci. 21 , 5999. https://doi.org/10.3390/ijms21175999 (2020). Zhang, Y. et al. Signaling pathways that activate hepatic stellate cells during liver fibrosis. Front. Med. https://doi.org/10.3389/fmed.2024.1454980 (2024). 11:. Soeda, J. et al. Nicotine induces fibrogenic changes in human liver via nicotinic acetylcholine receptors expressed on hepatic stellate cells. Biochem. Biophys. Res. Commun. 417 , 17–22. https://doi.org/10.1016/j.bbrc.2011.10.151 (2012). Xie, G. et al. Distinctly altered gut microbiota in the progression of liver disease. Oncotarget 7 , 19355–19366. https://doi.org/10.18632/oncotarget.8466 (2016). Zazueta, A. et al. Alteration of Gut Microbiota Composition in the Progression of Liver Damage in Patients with Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD). Int. J. Mol. Sci. 25 , 4387. https://doi.org/10.3390/ijms25084387 (2024). Zamani, M. et al. Global Prevalence of Advanced Liver Fibrosis and Cirrhosis in the General Population: A Systematic Review and Meta-analysis. Clin. Gastroenterol. Hepatol. https://doi.org/10.1016/j.cgh.2024.08.020 (2024). Elrazik, N. A. A., El-Mesery, M. & El-Shishtawy, M. M. Sesamol protects against liver fibrosis induced in rats by modulating lysophosphatidic acid receptor expression and TGF-β/Smad3 signaling pathway. Naunyn Schmiedebergs Arch. Pharmacol. 395 , 1003–1016. https://doi.org/10.1007/s00210-022-02259-7 (2022). Ren, X. et al. TMT-based quantitative proteomics analysis of Sprague-Dawley rats liver reveals Triphenyltin induced liver damage and lipid metabolism disorders. Pestic Biochem. Physiol. 198 , 105739. https://doi.org/10.1016/j.pestbp.2023.105739 (2024). Rai, S. & Bhatnagar, S. Novel Lipidomic Biomarkers in Hyperlipidemia and Cardiovascular Diseases: An Integrative Biology Analysis. Omi J. Integr. Biol. 21 , 132–142. https://doi.org/10.1089/omi.2016.0178 (2017). Castelli, W. P. Incidence of Coronary Heart Disease and Lipoprotein Cholesterol Levels. JAMA 256 , 2835. https://doi.org/10.1001/jama.1986.03380200073024 (1986). Hasan, H. M. A., Arhouma, T. A., Khanfar, M. M. A. & Azzam, M. A. Study the Relationship between the Nicotine and Lipid Profile with Some Hematology Parameters in Serum of Smoker and Non-Smoker Blood Samples. J. Biosci. Med. 10 , 20–36. https://doi.org/10.4236/jbm.2022.106003 (2022). Speliotes, E. K., Balakrishnan, M., Friedman, L. S. & Corey, K. E. Treatment of Dyslipidemia in Common Liver Diseases. Clin. Gastroenterol. Hepatol. 16 , 1189–1196. https://doi.org/10.1016/j.cgh.2018.04.023 (2018). Méndez-Sánchez, N. et al. Dyslipidemia as a risk factor for liver fibrosis progression in a multicentric population with non-alcoholic steatohepatitis. F1000Research 9 , 56. https://doi.org/10.12688/f1000research.21918.1 (2020). Yu, W. et al. Four-way decomposition of effect of cigarette smoking and body mass index on serum lipid profiles. PLoS One . 17 , e0270486. https://doi.org/10.1371/journal.pone.0270486 (2022). Momayyezi, M., Jambarsang, S., Fallahzadeh, H. & Sefidkar, R. Association between lipid profiles and cigarette smoke among adults in the Persian cohort (Shahedieh) study. BMC Public. Health . 24 , 1256. https://doi.org/10.1186/s12889-024-18734-0 (2024). Hajiasgharzadeh, K., Shahabi, P., Karimi-Sales, E. & Alipour, M. R. Nicotine promotes development of bile duct ligationinduced liver fibrosis by increasing expression of nicotinic acetylcholine receptors in rats. Clin. Exp. Hepatol. 10 , 62–71. https://doi.org/10.5114/ceh.2024.136227 (2024). Hajiasgharzadeh, K., Shahabi, P., Karimi-Sales, E. & Alipour, M. R. Effects of nicotine on microRNA-124 expression in bile duct ligation-induced liver fibrosis in rats. BMC Pharmacol. Toxicol. 25 , 27. https://doi.org/10.1186/s40360-024-00749-3 (2024). El-Sherbeeny, N. A., Nader, M. A., Attia, G. M. & Ateyya, H. Agmatine protects rat liver from nicotine-induced hepatic damage via antioxidative, antiapoptotic, and antifibrotic pathways. Naunyn Schmiedebergs Arch. Pharmacol. 389 , 1341–1351. https://doi.org/10.1007/s00210-016-1284-9 (2016). Xu, J., Li, Y., Feng, Z. & Chen, H. Cigarette Smoke Contributes to the Progression of MASLD: From the Molecular Mechanisms to Therapy. Cells 14 , 221. https://doi.org/10.3390/cells14030221 (2025). Mihara, T. & Hori, M. Nicotine aggravates liver fibrosis via α7 nicotinic acetylcholine receptor expressed on activated hepatic stellate cells in mice. Hepatol. Commun. 8 https://doi.org/10.1097/HC9.0000000000000457 (2024). Hamza, R. Z. & El-Shenawy, N. S. Anti-inflammatory and antioxidant role of resveratrol on nicotine-induced lung changes in male rats. Toxicol. Rep. 4 , 399–407. https://doi.org/10.1016/j.toxrep.2017.07.003 (2017). Caliri, A. W., Tommasi, S. & Besaratinia, A. Relationships among smoking, oxidative stress, inflammation, macromolecular damage, and cancer. Mutat. Res. Mutat. Res. 787 , 108365. https://doi.org/10.1016/j.mrrev.2021.108365 (2021). Karimi-Sales, E., Ebrahimi-Kalan, A. & Alipour, M. R. Preventive effect of trans-chalcone on non-alcoholic steatohepatitis: Improvement of hepatic lipid metabolism. Biomed. Pharmacother . 109 , 1306–1312. https://doi.org/10.1016/j.biopha.2018.10.196 (2019). Mani, A. R., Ippolito, S., Ollosson, R. & Moore, K. P. Nitration of cardiac proteins is associated with abnormal cardiac chronotropic responses in rats with biliary cirrhosis. Hepatology 43 , 847–856. https://doi.org/10.1002/hep.21115 (2006). Hajiasgharzadeh, K. et al. Does hepatic vagus nerve modulate the progression of biliary fibrosis in rats? Auton. Neurosci. Basic. Clin. 185 , 67–75. https://doi.org/10.1016/j.autneu.2014.07.005 (2014). Khaled, S., Makled, M. N. & Nader, M. A. Tiron protects against nicotine-induced lung and liver injury through antioxidant and anti-inflammatory actions in rats in vivo. Life Sci. 260 , 118426. https://doi.org/10.1016/j.lfs.2020.118426 (2020). Eftekhari, G. et al. Activation of central muscarinic receptor type 1 prevents development of endotoxin tolerance in rat liver. Eur. J. Pharmacol. 740 , 436–441. https://doi.org/10.1016/j.ejphar.2014.06.050 (2014). Nemes, K. & Åberg, F. Interpreting lipoproteins in nonalcoholic fatty liver disease. Curr. Opin. Lipidol. 28 , 355–360. https://doi.org/10.1097/MOL.0000000000000427 (2017). Martin, A. et al. Management of Dyslipidemia in Patients with Non-Alcoholic Fatty Liver Disease. Curr. Atheroscler Rep. 24 , 533–546. https://doi.org/10.1007/s11883-022-01028-4 (2022). Amor, A. J. & Perea, V. Dyslipidemia in nonalcoholic fatty liver disease. Curr. Opin. Endocrinol. Diabetes Obes. 26 , 103–108. https://doi.org/10.1097/MED.0000000000000464 (2019). Chimura, Y., Daimon, T. & Wakabayashi, I. Proneness to high blood lipid-related indices in female smokers. Lipids Health Dis. 18 , 113. https://doi.org/10.1186/s12944-019-1050-3 (2019). Behl, T. A., Stamford, B. A. & Moffatt, R. J. The Effects of Smoking on the Diagnostic Characteristics of Metabolic Syndrome: A Review. Am. J. Lifestyle Med. 17 , 397–412. https://doi.org/10.1177/15598276221111046 (2023). Jensen-Urstad, A. P. L. & Semenkovich, C. F. Fatty acid synthase and liver triglyceride metabolism: Housekeeper or messenger? Biochim Biophys Acta -. Mol. Cell. Biol. Lipids . 1821 , 747–753. https://doi.org/10.1016/j.bbalip.2011.09.017 (2012). Nagarajan, S. R., Cross, E., Sanna, F. & Hodson, L. Dysregulation of hepatic metabolism with obesity: factors influencing glucose and lipid metabolism. Proc. Nutr. Soc. 81 , 1–11. https://doi.org/10.1017/S0029665121003761 (2022). Di Maira, G., Pastore, M. & Marra, F. Liver fibrosis in the context of nonalcoholic steatohepatitis: the role of adipokines. Minerva Gastroenterol 64:. (2017). https://doi.org/10.23736/S1121-421X.17.02427-8 Haddadian, Z. et al. Effect of endotoxin on heart rate dynamics in rats with cirrhosis. Auton. Neurosci. Basic. Clin. 177 , 104–113. https://doi.org/10.1016/j.autneu.2013.02.022 (2013). Liu, B. et al. Hepatic stellate cell activation and senescence induced by intrahepatic microbiota disturbances drive progression of liver cirrhosis toward hepatocellular carcinoma. J. Immunother Cancer . 10 , e003069. https://doi.org/10.1136/jitc-2021-003069 (2022). Tsuchida, T. & Friedman, S. L. Mechanisms of hepatic stellate cell activation. Nat. Rev. Gastroenterol. Hepatol. 14 , 397–411. https://doi.org/10.1038/nrgastro.2017.38 (2017). Akkız, H., Gieseler, R. K. & Canbay, A. Liver Fibrosis: From Basic Science towards Clinical Progress, Focusing on the Central Role of Hepatic Stellate Cells. Int. J. Mol. Sci. 25 , 7873. https://doi.org/10.3390/ijms25147873 (2024). Seki, E. & Schnabl, B. Role of innate immunity and the microbiota in liver fibrosis: crosstalk between the liver and gut. J. Physiol. 590 , 447–458. https://doi.org/10.1113/jphysiol.2011.219691 (2012). Meng, X. et al. Gut Microbiota’s Relationship with Liver Disease and Role in Hepatoprotection by Dietary Natural Products and Probiotics. Nutrients 10 , 1457. https://doi.org/10.3390/nu10101457 (2018). Chi, L. et al. Nicotine Alters the Gut Microbiome and Metabolites of Gut–Brain Interactions in a Sex-Specific Manner. Chem. Res. Toxicol. 30 , 2110–2119. https://doi.org/10.1021/acs.chemrestox.7b00162 (2017). Zubcevic, J. et al. Nicotine Exposure during Rodent Pregnancy Alters the Composition of Maternal Gut Microbiota and Abundance of Maternal and Amniotic Short Chain Fatty Acids. Metabolites 12 , 735. https://doi.org/10.3390/metabo12080735 (2022). Shaik, F. B. et al. Correlation between smokeless tobacco (Gutkha) and biomarkers of oxidative stress in plasma with cardiovascular effects. Heliyon 7 , e05487. https://doi.org/10.1016/j.heliyon.2020.e05487 (2021). Begum, S. F. et al. Smokeless tobacco induced biophysical and biochemical alterations in the plasma, erythrocytes, and platelets of panmasala users: Subsequent biological effects. Toxicol. Rep. 7 , 963–978. https://doi.org/10.1016/j.toxrep.2020.07.017 (2020). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6646003\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":457221516,\"identity\":\"01cb56fe-c52d-46e3-8dc6-1a48b8323d75\",\"order_by\":0,\"name\":\"Narges Dastmalchi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University College of Nabi Akram\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Narges\",\"middleName\":\"\",\"lastName\":\"Dastmalchi\",\"suffix\":\"\"},{\"id\":457221518,\"identity\":\"6ca1cf88-5645-4921-98a4-e89b03266dc5\",\"order_by\":1,\"name\":\"Khalil Hajiasgharzadeh\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABNUlEQVRIie2RMUvDQBTHXwhcloSukaj9ChYHKSh+lXcE7GJdCsWhlkDgskRcAy36FeIn8MpBuoS6pqRDS7FTh7gVjGLaQQcT6Ohwv+F/9+74wbt3ABLJP+QEAHmx4q7SgR+Dud2RbSjOXsqpvoey40eh/q9SzpnGF3yT393UBuNFtr6dtV4s7y3MulCvOSrLSpSmjzi6Z+OOOUH7YBiv2v4hv5oGE2gEXHGDssY4IjeciDoxcMtgou2bGKUGAyUExS19y+scR3ke0adYcT+ML9HSTcrSTwaXlUqCKHTSo2GsEstwBOqmTVKFAa1W5iiOGKfPMSHNYSQa/iwiU39i2oGoauzafl/nffoYa8tk3RN1beCtkk33/OLB85blY9axCPHnuPgdtVwA0HgR/apbiUQikQB8A93idguz98fOAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Tabriz University of Medical Sciences\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Khalil\",\"middleName\":\"\",\"lastName\":\"Hajiasgharzadeh\",\"suffix\":\"\"},{\"id\":457221519,\"identity\":\"13270152-b2b9-4360-a36f-4f32659b6412\",\"order_by\":2,\"name\":\"Hooria Amooji\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Tabriz\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hooria\",\"middleName\":\"\",\"lastName\":\"Amooji\",\"suffix\":\"\"},{\"id\":457221520,\"identity\":\"b77480d4-9d92-46af-adb7-0aa7f3b4bfc4\",\"order_by\":3,\"name\":\"Mohammad Reza Alipour\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tabriz University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mohammad\",\"middleName\":\"Reza\",\"lastName\":\"Alipour\",\"suffix\":\"\"},{\"id\":457221521,\"identity\":\"2a024a81-a985-470f-b9ef-6c94f6ce4b9d\",\"order_by\":4,\"name\":\"Majid Ahmadi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tabriz University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Majid\",\"middleName\":\"\",\"lastName\":\"Ahmadi\",\"suffix\":\"\"},{\"id\":457221522,\"identity\":\"efb68d57-8884-4f92-bd6f-e0913088d4ae\",\"order_by\":5,\"name\":\"Behzad Mansoori\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Wistar Institute\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Behzad\",\"middleName\":\"\",\"lastName\":\"Mansoori\",\"suffix\":\"\"},{\"id\":457221523,\"identity\":\"42bc8369-f096-4493-9186-d0973906ad0f\",\"order_by\":6,\"name\":\"Homeira Hatami Nemati\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Tabriz\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Homeira\",\"middleName\":\"Hatami\",\"lastName\":\"Nemati\",\"suffix\":\"\"},{\"id\":457221524,\"identity\":\"5c190644-908f-4712-b377-4db3a19b210d\",\"order_by\":7,\"name\":\"Seyed Mahdi Banan Khojasteh\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Tabriz\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Seyed\",\"middleName\":\"Mahdi Banan\",\"lastName\":\"Khojasteh\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-05-12 11:08:45\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6646003/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6646003/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":83077458,\"identity\":\"89bb2f24-4cc4-413c-8f4b-8536de82f9e4\",\"added_by\":\"auto\",\"created_at\":\"2025-05-19 18:29:34\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":15340302,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe bile duct isolation in sham-operated rats and its ligation in BDL rats, along with the liver morphology of both groups. This illustration highlights the differences caused by the surgical procedures and shows the effects of bile duct ligation on liver structure and function.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6646003/v1/493d96592d15dba16e5704e6.png\"},{\"id\":83077451,\"identity\":\"6db17a2a-e99e-49c9-942e-088c85c94dd2\",\"added_by\":\"auto\",\"created_at\":\"2025-05-19 18:29:33\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":5152768,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe body weights of rats in the various treated groups reflect any changes resulting from bile duct ligation or nicotine treatment. The analysis of the results indicates that neither BDL nor nicotine administration led to a statistically significant change in the body weight of the rats.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6646003/v1/1e3c721ba120019856bf643a.png\"},{\"id\":83077452,\"identity\":\"a4f9649f-5506-45db-9e8b-1a66388baf73\",\"added_by\":\"auto\",\"created_at\":\"2025-05-19 18:29:33\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":6195298,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe effects of nicotine administration at two doses (1 mg/kg and 10 mg/kg) on the serum lipid profile in an animal model of liver fibrosis. The findings reveal that injecting nicotine into healthy sham-operated rats results in a significant increase in triglycerides, low-density lipoprotein (LDL), and cholesterol levels, while concurrently causing a significant decrease in serum high-density lipoprotein (HDL) levels. Furthermore, when comparing healthy rats receiving saline with fibrotic rats also receiving saline, it becomes evident that the progression of liver fibrosis itself significantly alters triglyceride, cholesterol, and LDL levels, alongside a reduction in HDL levels. Additionally, a comparison between fibrotic rats treated with saline and those treated with nicotine shows that nicotine injection induces more substantial changes in triglyceride and HDL levels. Data are shown as Mean ± SEM and analyzed by one-way ANOVA and Tukey's post-test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6646003/v1/fe91e6f3ca321c59ef4216b2.png\"},{\"id\":83077684,\"identity\":\"ee593333-a6fb-4c53-9eeb-1f27b3fe6b53\",\"added_by\":\"auto\",\"created_at\":\"2025-05-19 18:37:33\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1869400,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe expression of fatty acid synthesis (FAS) in sham and bile duct ligated rats that received normal saline or nicotine (1 mg/kg and 10 mg/kg) about beta-actin as an internal standard. Bile duct ligation has increased this enzyme expression. ****P \\u0026lt; 0.001 in comparison with the sham-operated group. Nicotine administration caused a further increase in its expression. ** P \\u0026lt; 0.01 in comparison with the bile duct ligated-saline group. Data are shown as Mean ± SEM and analyzed by one-way ANOVA and Tukey's post-test. All RT-qPCR tests were performed in duplicate from six samples taken from each group (N = 6). The Y-axis represents the relative level of transcriptional difference (fatty acid synthesis/beta-actin).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6646003/v1/83341b6de2d9f5455e9b7a70.png\"},{\"id\":83077471,\"identity\":\"ccb92d58-ad9e-47ef-ad01-79c37fab194e\",\"added_by\":\"auto\",\"created_at\":\"2025-05-19 18:29:34\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":21042432,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHistopathological analysis was conducted on liver tissues obtained from sham-operated and bile duct-ligated (BDL) rats, with and without nicotine treatment. Liver samples were collected 21 days post-surgery. The BDL procedure resulted in extensive bridging fibrosis, marked by the formation of fibrotic bands creating portal-to-portal and portal-to-central connections. Importantly, fibrotic tissue deposition was significantly more pronounced in BDL rats treated with nicotine, suggesting that nicotine may exacerbate the progression of fibrosis. To ensure the reproducibility and reliability of the findings, all experiments were performed in triplicate.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6646003/v1/ce7da1e8c110c7512fedb533.png\"},{\"id\":83077688,\"identity\":\"dfceaa3b-63f2-4bda-87b6-0d3efdd2b211\",\"added_by\":\"auto\",\"created_at\":\"2025-05-19 18:37:34\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":20875934,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eImmunohistofluorescent study using an anti-FAS antibody (red) in a representative rat liver obtained low and high doses of nicotine (1 mg/kg and 10 mg/kg) from sham-operated rats. Nuclei were stained with DAPI (×200 magnification). Nicotine leads to increased protein expression of FAS in the liver.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6646003/v1/3183364a213e36c8b10859c5.png\"},{\"id\":83077689,\"identity\":\"9ab417b7-ea96-4493-baec-ea01d6fe6e56\",\"added_by\":\"auto\",\"created_at\":\"2025-05-19 18:37:34\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":23759109,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThis immunohistofluorescent study employed an anti-FAS antibody (depicted in red) to analyze liver tissue from fibrotic rats obtained through bile duct ligation, comparing those treated with normal saline and those exposed to nicotine. The nuclei of the cells were stained using DAPI, and images were captured at a magnification of 200x. The findings indicate that liver fibrosis induced by bile duct ligation is associated with elevated protein expression levels of FAS in the liver tissue. Moreover, in the livers of fibrotic rats that were treated with nicotine, there was a notable increase in FAS expression compared to those treated with saline. These results highlight the effects of nicotine on FAS expression in the context of liver fibrosis, suggesting that nicotine may exacerbate the metabolic disturbances associated with this condition.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6646003/v1/842b0a2b99dba878febae12d.png\"},{\"id\":83602043,\"identity\":\"67b211a0-c6ec-4c6e-8e1d-948685484435\",\"added_by\":\"auto\",\"created_at\":\"2025-05-29 09:32:48\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":82475578,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6646003/v1/588cafb9-839a-4c77-a413-4a0aea48d9af.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Nicotine Administration Exacerbates Lipid Profile Alterations in a Wistar Rat Model of Liver Fibrosis Through Fatty Acid Synthesis Modulation\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003eLiver fibrosis is a progressive condition marked by the excessive accumulation of extracellular matrix proteins due to chronic liver injury [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. This condition represents a critical intermediary stage in liver disease that can lead to cirrhosis and hepatocellular carcinoma if left untreated [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. Recent research has highlighted the cellular and molecular mechanisms involved in the progression of fibrosis and its consequences, focusing particularly on the roles of hepatic stellate cells, inflammatory mediators, and the microbiome. For instance, emerging research highlights how hepatic stellate cells contribute to fibrosis via activation and interaction with inflammatory pathways [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Additionally, alterations in gut microbiota have been implicated in liver disease progression, suggesting a complex interplay between the liver and the microbiome [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. The global prevalence of advanced liver fibrosis is approximately 3%, with an increasing trend observed in recent years [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. Understanding these interactions is essential for developing effective treatments and improving patient outcomes in liver disease [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eThe liver is the primary site for lipid metabolism, and liver injury is closely associated with disturbances in this process [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. Alterations in lipid and lipoprotein content in the blood can lead to the development of various diseases and significantly increase the risk of cardiovascular conditions [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. About 40% of individuals over the age of 30 are affected by dyslipidemia, with severity notably higher in men [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. Dyslipidemia is recognized as one of the most critical risk factors for liver diseases, and the bidirectional relationship between liver diseases and dyslipidemia is well established [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. Notably, changes in the blood lipid profile are among the primary modifiable risk factors for the progression of advanced liver fibrosis and cirrhosis [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. Moreover, exposure to nicotine among smokers can lead to significant alterations in normal lipid metabolism, contributing to various lipid metabolic disorders [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. The administration of nicotine has been documented to exacerbate liver damage, raising concerns about its role in hepatic health [\\u003cspan additionalcitationids=\\\"CR18\\\" citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. This relationship is particularly alarming given the rising prevalence of smoking-related liver conditions. Several studies have demonstrated that nicotine administration significantly increases markers of hepatic inflammation, lipid peroxidation, and DNA damage-related biomarkers [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Simultaneously, it has been shown to reduce the activities of antioxidant enzymes, thereby highlighting its potential to induce oxidative stress within the liver [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. Such oxidative stress is a critical factor in the progression of liver diseases, as it can lead to further cellular injury and inflammation, creating a vicious cycle of damage and dysfunction.\\u003c/p\\u003e \\u003cp\\u003eThe enzyme fatty acid synthase (FAS) is one of the most important modulators of hepatic lipid metabolism. It acts as a key regulatory element in fatty acid synthesis, converting excess carbohydrates into fatty acids for storage or energy use. Importantly, FAS is a primary target for various transcription factors involved in lipid metabolism, influencing how the liver responds to metabolic demands and stresses[\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. Dysregulation of FAS due to nicotine exposure could disrupt normal lipid homeostasis, potentially leading to an increased risk of metabolic syndrome, fatty liver disease, and other complications associated with impaired lipid metabolism. Understanding the intricate relationship between nicotine exposure, liver health, and lipid metabolism is crucial for identifying potential therapeutic targets and developing effective interventions aimed at mitigating the adverse effects of smoking on liver function. Further research is warranted to unravel these complex interactions and establish comprehensive strategies to protect against the lipid metabolic disorders associated with nicotine exposure, especially in individuals with pre-existing liver conditions.\\u003c/p\\u003e \\u003cp\\u003eDespite considerable existing research on nicotine and liver disease, the specific impact of nicotine on lipid profiles within the context of liver fibrosis remains largely underexplored. Notably, previous studies have produced inconsistent findings, leaving a critical gap in understanding. This study is novel in its focused investigation of how nicotine administration influences lipid profiles specifically through the modulation of FAS expression in an animal model of liver fibrosis. It uniquely examines the interplay between nicotine exposure and liver fibrosis on lipid indices, addressing an overlooked aspect of the disease mechanism. The findings could significantly advance current knowledge by clarifying the role of nicotine in dyslipidemia associated with liver fibrosis, potentially informing new clinical strategies and public health policies for managing such liver-related metabolic disturbances.\\u003c/p\\u003e\"},{\"header\":\"2. Material and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1. Establishment of liver fibrosis model\\u003c/h2\\u003e \\u003cp\\u003eIn this study, a total of 36 male Wistar rats, each weighing between 220 and 250 grams and aged eight weeks, were acquired from the animal facility at Tabriz University of Medical Sciences. Following a period of acclimatization, the rats underwent a bile duct ligation (BDL) procedure under anesthesia induced by ketamine (at a dosage of 100 mg/kg) and xylazine (10 mg/kg) [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. During the surgical intervention, an incision was made in the peritoneal cavity, allowing for the careful isolation of the bile duct, which was then securely ligated in three separate locations to prevent bile flow [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. Figure\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e illustrates the isolation of the bile duct in sham-operated rats alongside the ligation of the duct in BDL rats. Additionally, it presents the gross morphology of the livers from both groups of rats, highlighting the differences in liver appearance resulting from the surgical procedures. This visual representation provides important context for understanding the impact of bile duct ligation on liver structure and function.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003ePrevious research has shown that nicotine has the potential to worsen liver fibrosis [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. Based on this information, we anticipated that the groups exposed to nicotine would exhibit an exacerbation of hepatic fibrosis. In earlier studies using the BDL model, it has been noted that the severity of liver fibrosis peaks around four weeks post-surgery [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. Consequently, we opted to use a three-week BDL model for our experiment. This timeframe allows for the observation of liver fibrosis at a submaximal stage, enabling us to effectively assess both the possible protective effects and the potential aggravating influence of nicotine on lipid profile alterations in the treated groups. By studying the effects at this specific time point, we aim to gain insights into the interactions between nicotine exposure, liver damage, and potential alterations in lipid profile indices.\\u003c/p\\u003e \\u003cp\\u003eIn this research, we employed a method of euthanasia during deep anesthesia achieved with ketamine and xylazine, which involved the surgical opening of the abdominal and thoracic cavities. At the end of the experimental procedures, we collected blood samples directly from the heart, and liver tissue samples were obtained for subsequent analysis of immunofluorescence and gene expression. Specifically, a section of liver tissue from the middle lobe was preserved in formalin, which is essential for conducting immunofluorescence studies. Simultaneously, another portion of liver tissue, taken from the lower segment of the right lateral lobe, was stored at -80\\u0026deg;C to facilitate measurements of FAS gene expression. This approach allows for a comprehensive evaluation of the biochemical changes occurring in the liver, contributing valuable insights into our understanding of the underlying mechanisms of lipid metabolism alterations during nicotine exposure and the progression of liver damage. The body weights of the rats in the various treatment groups provide important insights into the effects of bile duct ligation and nicotine treatment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). To track these changes, the rats' weights were measured every other day. Our analysis revealed no significant differences in body weight following either bile duct ligation or nicotine administration. This suggests that, under the experimental conditions of this study, these treatments did not substantially affect the body weight of the rats.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2. Study protocol and nicotine administration\\u003c/h2\\u003e \\u003cp\\u003eThe animals were randomly divided into six groups of six each: 1) Sham\\u0026thinsp;+\\u0026thinsp;Saline; 2) Sham\\u0026thinsp;+\\u0026thinsp;Nicotine (1 mg/kg); 3) Sham\\u0026thinsp;+\\u0026thinsp;Nicotine (10 mg/kg); 4) BDL\\u0026thinsp;+\\u0026thinsp;Saline; 5) BDL\\u0026thinsp;+\\u0026thinsp;Nicotine (1 mg/kg); 5) BDL\\u0026thinsp;+\\u0026thinsp;Nicotine (10 mg/kg). Nicotine (Sigma-Aldrich, product number N3876) was administered via intraperitoneal injection at two different dosage levels: a lower dose and a higher dose. Nicotine administration was initiated the day following the BDL surgical procedure. The dosing regimen involved administering either 1 mg/kg or 10 mg/kg of nicotine every other day for a total duration of three weeks [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. This dosing schedule was designed to evaluate the effects of both low and high doses of nicotine, allowing for a comparative analysis of the physiological changes associated with each dosage level over the specified timeframe. Through this method, we aimed to gain insights into the dose-dependent impacts of nicotine on lipid metabolism during liver fibrosis and assess any related alterations in FAS expression and lipid profiles.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3. Lipid profile measurement\\u003c/h2\\u003e \\u003cp\\u003eThe evaluation of lipid profiles serves as a vital diagnostic tool for assessing an individual's cardiovascular health and metabolic condition. This analysis generally includes the measurement of several key lipid metrics, such as total cholesterol (Chol), low-density lipoprotein (LDL) cholesterol, high-density lipoprotein (HDL) cholesterol, and triglycerides (TG). In this study, blood samples were obtained from rats for lipid profile assessment. Following collection, the serum samples were processed and analyzed in a laboratory setting using commercial assay kits sourced from Pars Azmoon (Pars Azmoon, Tehran, Iran). This quantitative assessment provides insights into lipid metabolism and serves as an important indicator of potential cardiovascular risks. By understanding the lipid profiles of the subjects involved in this research, we can explore the relationships between lipid levels, nicotine exposure, and the progression of liver fibrosis, contributing to a more comprehensive understanding of lipid metabolism alterations during these conditions.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4. quantitative real-time PCR analysis of FAS\\u003c/h2\\u003e \\u003cp\\u003eTo determine amount of FAS mRNA level in the liver samples, total RNA was extracted from these samples and complementary DNA (cDNA) was produced as previously described [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. Briefly, total RNA was obtained after Trizol treatment (Invitrogen, Carlsbad, CA); this was performed according to the manufacturer\\u0026rsquo;s guidelines. After Trizol treatment, all RNAs of the liver tissues were obtained and the Prime Script Kit (TaKaRa Bio Inc., Japan) was applied for cDNA synthesis. The purity of extracted RNA was assessed using a NanoDrop Spectrophotometer (Thermo Scientific, USA). qRT-PCR was performed on a ViiATM7 RT-PCR system (Applied Biosystems, Carlsbad, CA) using SYBR Green fluorescent-based assay (638320, TaKaRa Bio Inc. Japan). Beta-actin gene was used as an internal standard and after normalizing to its expression level, the relative expression level of FAS was quantified by the 2\\u003csup\\u003e\\u0026minus;(ΔΔCt)\\u003c/sup\\u003e method [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. The reaction parameters were set as 50 ℃ for 2 min, 95 ℃ for 15 s, 95 ℃ for 15 s, and 60 ℃ for 1 min for 40 cycles. The primers of FAS and β-actin were synthesized by Sinaclon (Tehran, Iran) and reported in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. All RT-qPCR tests were performed in duplicate from six samples taken from each group.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eThe primers sequences for target genes.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"5\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGenes\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eSequences\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eAccession number\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eProduct size (bp)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eFAS\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026acute; CACAGCATTCAGTCCTATCCACAGA 3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eNM_017332.2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e148\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eReverse\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026acute; CACAGCCAACCAGATGCTTCA 3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eβ-actin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026acute; CCGCGAGTACAACCTTCTTG 3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eNM_031144.3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e81\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eReverse\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026acute; GCAGCGATATCGTCATCCAT 3\\u0026acute;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5. Immunofluorescence analysis of FAS\\u003c/h2\\u003e \\u003cp\\u003eImmunofluorescence analysis for FAS was performed as previously described [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. In brief, the tissue processing begins with immersion in distilled water for one hour, followed by a series of ethanol solutions for one hour each. This is followed by two changes of xylene and paraffin baths, also for one hour each, to prepare paraffin blocks, which are then sectioned to a thickness of 5 micrometers. The sections are rehydrated through two changes of xylene and several ethanol dilutions, ultimately returning to distilled water. After washing with TBS plus 0.03% Triton X-100, slides undergo antigen retrieval in citrate buffer using a microwave for 20 minutes, ensuring to replace any lost buffer. Following another wash, slides are blocked with 10% normal serum or 1% BSA in TBS for two hours, then washed again. Primary antibody (Fatty Acid Synthase (A-5): sc-55580) (purchased from Santa Cruz Biotechnology, Inc.) incubation is performed at 37\\u0026ordm;C for four hours and overnight at 4\\u0026ordm;C before another wash. Fluorescent dye-labeled secondary antibody was Goat Anti-Mouse IgG(H\\u0026thinsp;+\\u0026thinsp;L) (CY3 conjugated) (Catalog No. E-AB-1011) is uptake for 10 minutes, followed by washes, and counterstaining with DAPI for 15 minutes. Finally, slides are dehydrated in ethanol, treated with xylene, and mounted with a coverslip. The sections were then counterstained with DAPI and were monitored by fluorescence microscopy (Olympus BX50) and evaluated using a DP72 digital camera.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.6. Statistical analysis\\u003c/h2\\u003e \\u003cp\\u003eThe data were processed with GraphPad Prism 6 software (GraphPad Software, La Jolla, California, USA) and presented as Mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM. A One-way ANOVA followed by Tukey's post-test was used for normally distributed data. For variables that did not follow a normal distribution, the Kruskal-Wallis test was applied, with post hoc analysis conducted using Dunn's test. The normality of the data was assessed via the Kolmogorov-Smirnov test, and a p-value of less than 0.05 was deemed statistically significant.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.1. Both nicotine administration and liver fibrosis lead to changes in lipid profile indexes\\u003c/h2\\u003e \\u003cp\\u003eSerum lipid profile (triglyceride, total cholesterol, HDL-cholesterol, and LDL cholesterol) levels were measured and are shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e. As shown in this Figure, there are significant elevations in triglyceride (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA), total cholesterol (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB), and LDL-cholesterol (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB) values in both nicotine-received and BDL rats compared with the saline-received sham group. Regarding serum HDL-cholesterol level, it was significantly decreased in the nicotine and BDL groups compared with the controls (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). However, nicotine administration exacerbates the increases of triglyceride and reduction of HDL in liver fibrotic groups, but had no additional effect on total cholesterol and LDL-cholesterol levels.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.2. Nicotine alters hepatic fatty acid synthesis expression in the rats with fibrosis\\u003c/h2\\u003e \\u003cp\\u003eThe impact of nicotine administration on the expression of FAS in the liver of rats was evaluated using RT-qPCR. Chronic liver injury is known to significantly affect lipid metabolism, resulting in alterations to the lipid profile. In our study, bile duct ligation (BDL) induced liver fibrosis, leading to dyslipidemia characterized by elevated triglycerides, cholesterol, and LDL levels, alongside reduced HDL levels in the bloodstream. Our findings indicate that FAS expression was markedly higher in BDL rats compared to sham-operated controls. Furthermore, nicotine administration in bile duct-ligated rats further amplified FAS expression levels (**P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01) relative to the bile duct ligated-saline group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). This suggests that FAS upregulation is linked to nicotine-induced dyslipidemia in BDL rats. Smoking negatively influences plasma lipid concentrations, and our lipid profile assessment revealed that increased nicotine concentrations corresponded with a pronounced rise in FAS expression across nearly all experimental groups.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.3. The results of immunofluorescent staining\\u003c/h2\\u003e \\u003cp\\u003eOur histopathological analysis revealed that BDL surgery and the subsequent development of liver fibrosis induced significant histological alterations in the liver (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e). Notably, the livers of nicotine-treated rats exhibited portal tract expansion, a hallmark of BDL-induced changes. A distinctive feature observed in the BDL group was the formation of portal-to-portal linkages, indicative of advanced fibrotic remodeling. Furthermore, the livers of nicotine-treated BDL rats demonstrated more severe pathological damage compared to sham-operated animals. This was characterized by an increased proliferation of biliary epithelial cells, which manifested as prominent tube-like structures in the periportal regions (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e). The intensity of these changes was markedly greater in nicotine-treated BDL rats than in saline-treated BDL liver samples, suggesting that nicotine exacerbates the fibrotic and proliferative responses following bile duct ligation. These findings highlight the potential role of nicotine in aggravating liver injury and fibrosis in the context of cholestatic liver disease. Additionally, using fluorescence microscopy, we observed a notable elevation in the expression of FAS protein within the liver tissues of rats exposed to nicotine, in contrast to sham-operated rats that were administered normal saline (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e). This finding suggests that nicotine exposure considerably enhances FAS protein levels, indicating a potential mechanism through which nicotine may influence lipid metabolism and contribute to hepatic changes. The observed increase in FAS expression in nicotine-treated rats underscores the role of nicotine as a significant factor in liver pathology, particularly concerning lipid dysregulation. Immunofluorescence analysis revealed that FAS expression was elevated in the groups exhibiting liver fibrosis when compared to those with healthy liver tissue. Another finding from this study was the further enhancement of FAS protein expression following nicotine administration in rats with liver fibrosis (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003e). Given the crucial role that FAS plays in the biosynthesis of fatty acids, which serve as precursors for triglycerides, the increased expression of FAS in fibrotic rats following nicotine exposure may help elucidate how nicotine affects lipid profiles in the context of liver fibrosis. This suggests that nicotine not only exacerbates existing liver injuries but also significantly modifies lipid metabolism, potentially contributing to further metabolic disturbances in these individuals. Future research could delve deeper into the mechanisms underpinning these changes and their implications for managing lipid-related disorders in patients with liver fibrosis.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"4. Discussion\",\"content\":\"\\u003cp\\u003eThe liver plays a central role in lipid synthesis, storage, and catabolism; therefore, persistent liver damage can disrupt these processes. In the present study, the detrimental effect of intraperitoneally administered nicotine on the dyslipidemia in animal model of liver fibrosis was observed clearly. The interaction between liver damage and lipid profile changes has been reported in various studies [\\u003cspan additionalcitationids=\\\"CR30\\\" citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. Moreover, previous studies suggested that cigarette smoking has extensive effects on lipid profile [\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eDespite the wealth of research on liver fibrosis and its metabolic implications, there has been no study specifically investigating the effects of concurrent nicotine exposure in an animal model of liver fibrosis. This gap in the literature presents an important opportunity to explore how nicotine might influence the pathophysiology of liver fibrosis and associated metabolic disturbances. Given that nicotine is known to affect lipid metabolism and potentially exacerbate liver damage, understanding its impact within the context of liver fibrosis could reveal significant insights. FAS is an enzyme that plays a crucial role in the biosynthesis of fatty acids by catalyzing the final step in this metabolic pathway [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. This enzyme is responsible for the synthesis of long-chain fatty acids, which are essential components of various lipid molecules, including triglycerides and phospholipids. The activity of FAS is tightly regulated and is influenced by various factors, making it a key player in the regulation of lipid metabolism. Dysregulation of FAS has been implicated in several metabolic disorders, including obesity, diabetes, and fatty liver disease [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]. Understanding the precise mechanisms by which FAS operates and is regulated could provide valuable insights into potential therapeutic targets for these conditions, highlighting its importance in both normal physiology and disease states.\\u003c/p\\u003e \\u003cp\\u003eLiver fibrosis is among the most significant conditions affecting the liver [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. This progressive disease occurs when healthy liver tissue is replaced by scar tissue, often as a result of chronic liver injury due to factors like cholestasis. Over time, fibrosis can lead to severe complications, such as cirrhosis or liver cancer, significantly impacting overall health. The ligation of bile ducts results in a gradual cholestatic injury, which ultimately causes liver fibrosis and various associated complications [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. Over time, this condition can lead to significant damage to liver tissue, impairing its function and increasing the risk of further health issues. In addition to fibrosis, the progression of this injury may trigger inflammatory responses, portal hypertension, and potentially the development of cirrhosis. Additionally, a control group of sham-operated rats underwent an identical surgical procedure, but the common bile duct was not ligated, allowing for comparisons between the two groups. This experimental design aims to investigate the physiological and biochemical effects of bile duct obstruction in this animal model [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]. Liver fibrosis is a long-term result of damage and inflammation in the liver tissue. In our experiment, the findings from the immunofluorescent study indicated notable alterations in liver tissue in the BDL groups compared to the healthy sham groups (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e and Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003e). These changes were characterized by portal extension and the accumulation of fibrous tissue.\\u003c/p\\u003e \\u003cp\\u003eLiver fibrosis is characterized by the excessive accumulation of extracellular matrix proteins, driven by a complex interplay of cellular and molecular factors. Central to these processes are HSCs, inflammatory mediators, and the microbiome [\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e]. Recently, nicotine has emerged as a significant factor influencing liver health and disease progression. Understanding their interactions is crucial for identifying effective therapeutic targets and strategies in managing liver fibrosis. The activation of HSCs is driven by various inflammatory mediators, including cytokines such as transforming growth factor-beta (TGF-β) and platelet-derived growth factor (PDGF) [\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e]. These cytokines, often released by activated Kupffer cells and infiltrating macrophages, facilitate HSC activation and promote fibrogenesis [\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e]. Conversely, activated HSCs can also secrete pro-inflammatory cytokines like interleukin-1 (IL-1) and tumor necrosis factor-alpha (TNF-α), which further recruit and activate immune cells, creating a feedback loop that exacerbates inflammation and fibrosis. Recent studies suggest that nicotine can exacerbate this process by increasing the release of pro-inflammatory cytokines and inducing oxidative stress, which further amplifies HSC activation and fibrogenesis [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Nicotine exposure has been shown to enhance the inflammatory response in the liver, contributing to the worsening of fibrosis through increased levels of inflammatory cytokines. Additionally, emerging evidence suggests that the gut microbiome significantly impacts liver health and disease, particularly through the gut-liver axis. Dysbiosis\\u0026mdash;an imbalance in the gut microbiota\\u0026mdash;can lead to increased intestinal permeability, allowing microbial products such as lipopolysaccharides (LPS) to enter the bloodstream. This translocation of gut-derived inflammatory mediators can activate hepatic inflammation, further stimulating HSC activation [\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e]. The interaction between the microbiome and liver fibrosis is bidirectional; not only does the state of the liver influence microbiome composition, but dysbiosis can exacerbate liver pathology. Studies have shown that restoring a healthy gut microbiota through probiotics or dietary interventions may mitigate liver inflammation and fibrosis by stabilizing the gut barrier and reducing systemic inflammation [\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e]. Additionally, nicotine has been associated with alterations in gut microbiota composition, further complicating its role in liver health [\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e]. On the other hand, Shaik et al. discusses the impact of nicotine on lipid peroxidation and the activities of antioxidant enzymes, highlighting its role in exacerbating oxidative stress and inflammation in both the cardiovascular system and the liver [\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e]. In this study, increased levels of oxidative and nitrosative stress markers, such as nitric oxide, lipid peroxidation, and protein carbonyls, were also observed. Elevated nicotine and cotinine levels suggest nicotine contributes to oxidative damage and cardiovascular risk [\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e]. Strong correlations between nicotine and markers of oxidative stress, cholesterol, and creatinine further highlight the cardiovascular risks due to nicotine-induced free radicals and oxidative stress [\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e]. Additionally, other studies further elucidates how nicotine contributes to hepatic inflammation and oxidative damage, linking these effects to increased cardiovascular risk [\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e]. Understanding the interactions between hepatic stellate cells, inflammatory mediators, the microbiome, and nicotine is essential for developing effective treatments for liver fibrosis.\\u003c/p\\u003e \\u003cp\\u003eIn the current study, our analysis of FAS expression reveals a mechanistic pathway by which nicotine may affect lipid levels, deepening our understanding of relevant biological targets for therapeutic interventions. This study highlights the risks linked to nicotine exposure, particularly for individuals with liver disease\\u0026mdash;insights that are vital for shaping effective smoking cessation strategies and public health messaging related to the management of dyslipidemia. By investigating both high and low doses of nicotine, we gained important insights into how different exposure levels influence lipid metabolism and liver function, which will guide future research and treatment approaches. Our findings indicate a clear correlation between higher concentrations of nicotine and significant changes in both the gene and protein expression of FAS. Consequently, greater nicotine exposure leads to more pronounced alterations in lipid profiles. These results underscore an additional health benefit from smoking cessation, particularly for heavy smokers (those consuming more than 20 cigarettes per day) who have liver disease. Understanding the interaction between chronic liver injury and lipid metabolism is critical for developing targeted therapies to address these metabolic disturbances and enhance overall liver health.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe grant for this study was provided by the Stem Cell Research Center of Tabriz University of Medical Sciences, Tabriz, Iran [grant number: 73585].\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors would like to thank the Stem Cell Research Center, Tabriz University of Medical Sciences for their support.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflicts of interest/Competing interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors have no conflicts of interest to declare.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe data that support the findings of this study are available from the corresponding authors upon reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors' contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eKH and SMBK provided biological materials and reagents. ND, KH, HA, and SMBK performed the experiments, wrote the initial draft of the manuscript, and performed data analysis. MRA, MA, BM, and HHN participated in the design of the work and reviewed and edited the manuscript. All of the authors have read and approved the final version of the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics approval\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe study is reported in accordance with ARRIVE guidelines. All experiments were performed in compliance with the ethical principles of Tabriz University of Medical Sciences and approved by the Regional Medical Research Ethics Committee (Ethical code: IR.TBZMED.AEC.1403.017).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot Applicable\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot Applicable\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eOyelade, T., Moore, K. P. \\u0026amp; Mani, A. R. Physiological network approach to prognosis in cirrhosis: A shifting paradigm. \\u003cem\\u003ePhysiol. Rep.\\u003c/em\\u003e \\u003cb\\u003e12\\u003c/b\\u003e \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.14814/phy2.16133\\u003c/span\\u003e\\u003cspan address=\\\"10.14814/phy2.16133\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen, Y-H., Wu, W-K. \\u0026amp; Wu, M-S. Microbiota-Associated Therapy for Non-Alcoholic Steatohepatitis-Induced Liver Cancer: A Review. \\u003cem\\u003eInt. J. Mol. Sci.\\u003c/em\\u003e \\u003cb\\u003e21\\u003c/b\\u003e, 5999. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3390/ijms21175999\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/ijms21175999\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang, Y. et al. Signaling pathways that activate hepatic stellate cells during liver fibrosis. \\u003cem\\u003eFront. Med.\\u003c/em\\u003e \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3389/fmed.2024.1454980\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fmed.2024.1454980\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024). 11:.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSoeda, J. et al. Nicotine induces fibrogenic changes in human liver via nicotinic acetylcholine receptors expressed on hepatic stellate cells. \\u003cem\\u003eBiochem. Biophys. Res. Commun.\\u003c/em\\u003e \\u003cb\\u003e417\\u003c/b\\u003e, 17\\u0026ndash;22. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.bbrc.2011.10.151\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.bbrc.2011.10.151\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXie, G. et al. Distinctly altered gut microbiota in the progression of liver disease. \\u003cem\\u003eOncotarget\\u003c/em\\u003e \\u003cb\\u003e7\\u003c/b\\u003e, 19355\\u0026ndash;19366. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.18632/oncotarget.8466\\u003c/span\\u003e\\u003cspan address=\\\"10.18632/oncotarget.8466\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2016).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZazueta, A. et al. Alteration of Gut Microbiota Composition in the Progression of Liver Damage in Patients with Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD). \\u003cem\\u003eInt. J. Mol. Sci.\\u003c/em\\u003e \\u003cb\\u003e25\\u003c/b\\u003e, 4387. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3390/ijms25084387\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/ijms25084387\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZamani, M. et al. Global Prevalence of Advanced Liver Fibrosis and Cirrhosis in the General Population: A Systematic Review and Meta-analysis. \\u003cem\\u003eClin. Gastroenterol. Hepatol.\\u003c/em\\u003e \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.cgh.2024.08.020\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.cgh.2024.08.020\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eElrazik, N. A. A., El-Mesery, M. \\u0026amp; El-Shishtawy, M. M. Sesamol protects against liver fibrosis induced in rats by modulating lysophosphatidic acid receptor expression and TGF-β/Smad3 signaling pathway. \\u003cem\\u003eNaunyn Schmiedebergs Arch. Pharmacol.\\u003c/em\\u003e \\u003cb\\u003e395\\u003c/b\\u003e, 1003\\u0026ndash;1016. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s00210-022-02259-7\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00210-022-02259-7\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRen, X. et al. TMT-based quantitative proteomics analysis of Sprague-Dawley rats liver reveals Triphenyltin induced liver damage and lipid metabolism disorders. \\u003cem\\u003ePestic Biochem. Physiol.\\u003c/em\\u003e \\u003cb\\u003e198\\u003c/b\\u003e, 105739. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.pestbp.2023.105739\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.pestbp.2023.105739\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRai, S. \\u0026amp; Bhatnagar, S. Novel Lipidomic Biomarkers in Hyperlipidemia and Cardiovascular Diseases: An Integrative Biology Analysis. \\u003cem\\u003eOmi J. Integr. Biol.\\u003c/em\\u003e \\u003cb\\u003e21\\u003c/b\\u003e, 132\\u0026ndash;142. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1089/omi.2016.0178\\u003c/span\\u003e\\u003cspan address=\\\"10.1089/omi.2016.0178\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCastelli, W. P. Incidence of Coronary Heart Disease and Lipoprotein Cholesterol Levels. \\u003cem\\u003eJAMA\\u003c/em\\u003e \\u003cb\\u003e256\\u003c/b\\u003e, 2835. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1001/jama.1986.03380200073024\\u003c/span\\u003e\\u003cspan address=\\\"10.1001/jama.1986.03380200073024\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (1986).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHasan, H. M. A., Arhouma, T. A., Khanfar, M. M. A. \\u0026amp; Azzam, M. A. Study the Relationship between the Nicotine and Lipid Profile with Some Hematology Parameters in Serum of Smoker and Non-Smoker Blood Samples. \\u003cem\\u003eJ. Biosci. Med.\\u003c/em\\u003e \\u003cb\\u003e10\\u003c/b\\u003e, 20\\u0026ndash;36. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.4236/jbm.2022.106003\\u003c/span\\u003e\\u003cspan address=\\\"10.4236/jbm.2022.106003\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSpeliotes, E. K., Balakrishnan, M., Friedman, L. S. \\u0026amp; Corey, K. E. Treatment of Dyslipidemia in Common Liver Diseases. \\u003cem\\u003eClin. Gastroenterol. Hepatol.\\u003c/em\\u003e \\u003cb\\u003e16\\u003c/b\\u003e, 1189\\u0026ndash;1196. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.cgh.2018.04.023\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.cgh.2018.04.023\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eM\\u0026eacute;ndez-S\\u0026aacute;nchez, N. et al. Dyslipidemia as a risk factor for liver fibrosis progression in a multicentric population with non-alcoholic steatohepatitis. \\u003cem\\u003eF1000Research\\u003c/em\\u003e \\u003cb\\u003e9\\u003c/b\\u003e, 56. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.12688/f1000research.21918.1\\u003c/span\\u003e\\u003cspan address=\\\"10.12688/f1000research.21918.1\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYu, W. et al. Four-way decomposition of effect of cigarette smoking and body mass index on serum lipid profiles. \\u003cem\\u003ePLoS One\\u003c/em\\u003e. \\u003cb\\u003e17\\u003c/b\\u003e, e0270486. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1371/journal.pone.0270486\\u003c/span\\u003e\\u003cspan address=\\\"10.1371/journal.pone.0270486\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMomayyezi, M., Jambarsang, S., Fallahzadeh, H. \\u0026amp; Sefidkar, R. Association between lipid profiles and cigarette smoke among adults in the Persian cohort (Shahedieh) study. \\u003cem\\u003eBMC Public. Health\\u003c/em\\u003e. \\u003cb\\u003e24\\u003c/b\\u003e, 1256. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1186/s12889-024-18734-0\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s12889-024-18734-0\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHajiasgharzadeh, K., Shahabi, P., Karimi-Sales, E. \\u0026amp; Alipour, M. R. Nicotine promotes development of bile duct ligationinduced liver fibrosis by increasing expression of nicotinic acetylcholine receptors in rats. \\u003cem\\u003eClin. Exp. Hepatol.\\u003c/em\\u003e \\u003cb\\u003e10\\u003c/b\\u003e, 62\\u0026ndash;71. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.5114/ceh.2024.136227\\u003c/span\\u003e\\u003cspan address=\\\"10.5114/ceh.2024.136227\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHajiasgharzadeh, K., Shahabi, P., Karimi-Sales, E. \\u0026amp; Alipour, M. R. Effects of nicotine on microRNA-124 expression in bile duct ligation-induced liver fibrosis in rats. \\u003cem\\u003eBMC Pharmacol. Toxicol.\\u003c/em\\u003e \\u003cb\\u003e25\\u003c/b\\u003e, 27. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1186/s40360-024-00749-3\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s40360-024-00749-3\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEl-Sherbeeny, N. A., Nader, M. A., Attia, G. M. \\u0026amp; Ateyya, H. Agmatine protects rat liver from nicotine-induced hepatic damage via antioxidative, antiapoptotic, and antifibrotic pathways. \\u003cem\\u003eNaunyn Schmiedebergs Arch. Pharmacol.\\u003c/em\\u003e \\u003cb\\u003e389\\u003c/b\\u003e, 1341\\u0026ndash;1351. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s00210-016-1284-9\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00210-016-1284-9\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2016).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXu, J., Li, Y., Feng, Z. \\u0026amp; Chen, H. Cigarette Smoke Contributes to the Progression of MASLD: From the Molecular Mechanisms to Therapy. \\u003cem\\u003eCells\\u003c/em\\u003e \\u003cb\\u003e14\\u003c/b\\u003e, 221. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3390/cells14030221\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/cells14030221\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2025).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMihara, T. \\u0026amp; Hori, M. Nicotine aggravates liver fibrosis via α7 nicotinic acetylcholine receptor expressed on activated hepatic stellate cells in mice. \\u003cem\\u003eHepatol. Commun.\\u003c/em\\u003e \\u003cb\\u003e8\\u003c/b\\u003e \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1097/HC9.0000000000000457\\u003c/span\\u003e\\u003cspan address=\\\"10.1097/HC9.0000000000000457\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHamza, R. Z. \\u0026amp; El-Shenawy, N. S. Anti-inflammatory and antioxidant role of resveratrol on nicotine-induced lung changes in male rats. \\u003cem\\u003eToxicol. Rep.\\u003c/em\\u003e \\u003cb\\u003e4\\u003c/b\\u003e, 399\\u0026ndash;407. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.toxrep.2017.07.003\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.toxrep.2017.07.003\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCaliri, A. W., Tommasi, S. \\u0026amp; Besaratinia, A. Relationships among smoking, oxidative stress, inflammation, macromolecular damage, and cancer. \\u003cem\\u003eMutat. Res. Mutat. Res.\\u003c/em\\u003e \\u003cb\\u003e787\\u003c/b\\u003e, 108365. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.mrrev.2021.108365\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.mrrev.2021.108365\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKarimi-Sales, E., Ebrahimi-Kalan, A. \\u0026amp; Alipour, M. R. Preventive effect of trans-chalcone on non-alcoholic steatohepatitis: Improvement of hepatic lipid metabolism. \\u003cem\\u003eBiomed. Pharmacother\\u003c/em\\u003e. \\u003cb\\u003e109\\u003c/b\\u003e, 1306\\u0026ndash;1312. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.biopha.2018.10.196\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.biopha.2018.10.196\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMani, A. R., Ippolito, S., Ollosson, R. \\u0026amp; Moore, K. P. Nitration of cardiac proteins is associated with abnormal cardiac chronotropic responses in rats with biliary cirrhosis. \\u003cem\\u003eHepatology\\u003c/em\\u003e \\u003cb\\u003e43\\u003c/b\\u003e, 847\\u0026ndash;856. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1002/hep.21115\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/hep.21115\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2006).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHajiasgharzadeh, K. et al. Does hepatic vagus nerve modulate the progression of biliary fibrosis in rats? \\u003cem\\u003eAuton. Neurosci. Basic. Clin.\\u003c/em\\u003e \\u003cb\\u003e185\\u003c/b\\u003e, 67\\u0026ndash;75. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.autneu.2014.07.005\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.autneu.2014.07.005\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKhaled, S., Makled, M. N. \\u0026amp; Nader, M. A. Tiron protects against nicotine-induced lung and liver injury through antioxidant and anti-inflammatory actions in rats in vivo. \\u003cem\\u003eLife Sci.\\u003c/em\\u003e \\u003cb\\u003e260\\u003c/b\\u003e, 118426. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.lfs.2020.118426\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.lfs.2020.118426\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEftekhari, G. et al. Activation of central muscarinic receptor type 1 prevents development of endotoxin tolerance in rat liver. \\u003cem\\u003eEur. J. Pharmacol.\\u003c/em\\u003e \\u003cb\\u003e740\\u003c/b\\u003e, 436\\u0026ndash;441. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.ejphar.2014.06.050\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.ejphar.2014.06.050\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNemes, K. \\u0026amp; \\u0026Aring;berg, F. Interpreting lipoproteins in nonalcoholic fatty liver disease. \\u003cem\\u003eCurr. Opin. Lipidol.\\u003c/em\\u003e \\u003cb\\u003e28\\u003c/b\\u003e, 355\\u0026ndash;360. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1097/MOL.0000000000000427\\u003c/span\\u003e\\u003cspan address=\\\"10.1097/MOL.0000000000000427\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMartin, A. et al. Management of Dyslipidemia in Patients with Non-Alcoholic Fatty Liver Disease. \\u003cem\\u003eCurr. Atheroscler Rep.\\u003c/em\\u003e \\u003cb\\u003e24\\u003c/b\\u003e, 533\\u0026ndash;546. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s11883-022-01028-4\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s11883-022-01028-4\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAmor, A. J. \\u0026amp; Perea, V. Dyslipidemia in nonalcoholic fatty liver disease. \\u003cem\\u003eCurr. Opin. Endocrinol. Diabetes Obes.\\u003c/em\\u003e \\u003cb\\u003e26\\u003c/b\\u003e, 103\\u0026ndash;108. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1097/MED.0000000000000464\\u003c/span\\u003e\\u003cspan address=\\\"10.1097/MED.0000000000000464\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChimura, Y., Daimon, T. \\u0026amp; Wakabayashi, I. Proneness to high blood lipid-related indices in female smokers. \\u003cem\\u003eLipids Health Dis.\\u003c/em\\u003e \\u003cb\\u003e18\\u003c/b\\u003e, 113. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1186/s12944-019-1050-3\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s12944-019-1050-3\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBehl, T. A., Stamford, B. A. \\u0026amp; Moffatt, R. J. The Effects of Smoking on the Diagnostic Characteristics of Metabolic Syndrome: A Review. \\u003cem\\u003eAm. J. Lifestyle Med.\\u003c/em\\u003e \\u003cb\\u003e17\\u003c/b\\u003e, 397\\u0026ndash;412. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1177/15598276221111046\\u003c/span\\u003e\\u003cspan address=\\\"10.1177/15598276221111046\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJensen-Urstad, A. P. L. \\u0026amp; Semenkovich, C. F. Fatty acid synthase and liver triglyceride metabolism: Housekeeper or messenger? Biochim Biophys Acta -. \\u003cem\\u003eMol. Cell. Biol. Lipids\\u003c/em\\u003e. \\u003cb\\u003e1821\\u003c/b\\u003e, 747\\u0026ndash;753. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.bbalip.2011.09.017\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.bbalip.2011.09.017\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNagarajan, S. R., Cross, E., Sanna, F. \\u0026amp; Hodson, L. Dysregulation of hepatic metabolism with obesity: factors influencing glucose and lipid metabolism. \\u003cem\\u003eProc. Nutr. Soc.\\u003c/em\\u003e \\u003cb\\u003e81\\u003c/b\\u003e, 1\\u0026ndash;11. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1017/S0029665121003761\\u003c/span\\u003e\\u003cspan address=\\\"10.1017/S0029665121003761\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDi Maira, G., Pastore, M. \\u0026amp; Marra, F. Liver fibrosis in the context of nonalcoholic steatohepatitis: the role of adipokines. Minerva Gastroenterol 64:. (2017). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.23736/S1121-421X.17.02427-8\\u003c/span\\u003e\\u003cspan address=\\\"10.23736/S1121-421X.17.02427-8\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHaddadian, Z. et al. Effect of endotoxin on heart rate dynamics in rats with cirrhosis. \\u003cem\\u003eAuton. Neurosci. Basic. Clin.\\u003c/em\\u003e \\u003cb\\u003e177\\u003c/b\\u003e, 104\\u0026ndash;113. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.autneu.2013.02.022\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.autneu.2013.02.022\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2013).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu, B. et al. Hepatic stellate cell activation and senescence induced by intrahepatic microbiota disturbances drive progression of liver cirrhosis toward hepatocellular carcinoma. \\u003cem\\u003eJ. Immunother Cancer\\u003c/em\\u003e. \\u003cb\\u003e10\\u003c/b\\u003e, e003069. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1136/jitc-2021-003069\\u003c/span\\u003e\\u003cspan address=\\\"10.1136/jitc-2021-003069\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTsuchida, T. \\u0026amp; Friedman, S. L. Mechanisms of hepatic stellate cell activation. \\u003cem\\u003eNat. Rev. Gastroenterol. Hepatol.\\u003c/em\\u003e \\u003cb\\u003e14\\u003c/b\\u003e, 397\\u0026ndash;411. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1038/nrgastro.2017.38\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/nrgastro.2017.38\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAkkız, H., Gieseler, R. K. \\u0026amp; Canbay, A. Liver Fibrosis: From Basic Science towards Clinical Progress, Focusing on the Central Role of Hepatic Stellate Cells. \\u003cem\\u003eInt. J. Mol. Sci.\\u003c/em\\u003e \\u003cb\\u003e25\\u003c/b\\u003e, 7873. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3390/ijms25147873\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/ijms25147873\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSeki, E. \\u0026amp; Schnabl, B. Role of innate immunity and the microbiota in liver fibrosis: crosstalk between the liver and gut. \\u003cem\\u003eJ. Physiol.\\u003c/em\\u003e \\u003cb\\u003e590\\u003c/b\\u003e, 447\\u0026ndash;458. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1113/jphysiol.2011.219691\\u003c/span\\u003e\\u003cspan address=\\\"10.1113/jphysiol.2011.219691\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMeng, X. et al. Gut Microbiota\\u0026rsquo;s Relationship with Liver Disease and Role in Hepatoprotection by Dietary Natural Products and Probiotics. \\u003cem\\u003eNutrients\\u003c/em\\u003e \\u003cb\\u003e10\\u003c/b\\u003e, 1457. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3390/nu10101457\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/nu10101457\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChi, L. et al. Nicotine Alters the Gut Microbiome and Metabolites of Gut\\u0026ndash;Brain Interactions in a Sex-Specific Manner. \\u003cem\\u003eChem. Res. Toxicol.\\u003c/em\\u003e \\u003cb\\u003e30\\u003c/b\\u003e, 2110\\u0026ndash;2119. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1021/acs.chemrestox.7b00162\\u003c/span\\u003e\\u003cspan address=\\\"10.1021/acs.chemrestox.7b00162\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZubcevic, J. et al. Nicotine Exposure during Rodent Pregnancy Alters the Composition of Maternal Gut Microbiota and Abundance of Maternal and Amniotic Short Chain Fatty Acids. \\u003cem\\u003eMetabolites\\u003c/em\\u003e \\u003cb\\u003e12\\u003c/b\\u003e, 735. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3390/metabo12080735\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/metabo12080735\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShaik, F. B. et al. Correlation between smokeless tobacco (Gutkha) and biomarkers of oxidative stress in plasma with cardiovascular effects. \\u003cem\\u003eHeliyon\\u003c/em\\u003e \\u003cb\\u003e7\\u003c/b\\u003e, e05487. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.heliyon.2020.e05487\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.heliyon.2020.e05487\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBegum, S. F. et al. Smokeless tobacco induced biophysical and biochemical alterations in the plasma, erythrocytes, and platelets of panmasala users: Subsequent biological effects. \\u003cem\\u003eToxicol. Rep.\\u003c/em\\u003e \\u003cb\\u003e7\\u003c/b\\u003e, 963\\u0026ndash;978. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.toxrep.2020.07.017\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.toxrep.2020.07.017\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Liver fibrosis, Bile duct ligation, Fatty acid synthase, Dyslipidemia, Nicotine\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6646003/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6646003/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eDyslipidemia is characterized by abnormal lipid levels in the bloodstream and can be influenced by liver diseases and smoking. Nicotine exposure and liver damage are linked to lipid metabolism impairments. This study investigated the effects of nicotine on dyslipidemia in a cholestasis rat model using bile duct ligation (BDL) to establish liver fibrosis. Wistar rats received intraperitoneal nicotine at doses of 10 mg/kg (high) and 1 mg/kg (low) for three weeks. Serum levels of triglycerides (TG), cholesterol (Chol), low-density lipoprotein (LDL), and high-density lipoprotein (HDL) were quantified via a standard colorimetric kit (Pars Azmoon). Liver fibrosis confirmed through histological investigation. Additionally, the mRNA and protein expression of fatty acid synthase (FAS) were assessed using quantitative RT-PCR and immunofluorescence. Results showed that nicotine administration in healthy rats significantly increased TG, Chol, and LDL levels while decreasing HDL. In BDL rats, nicotine further reduced HDL and increased TG levels without affecting Chol and LDL. Histological analysis confirmed hepatic fibrosis, and both nicotine exposure and liver fibrosis elevated FAS expression in liver tissues. These findings indicate that BDL-induced liver fibrosis causes dyslipidemia in rats, and nicotine exposure exacerbates serum lipid profile alterations, potentially through increased FAS expression. Therefore, it is recommended that individuals with liver disease avoid nicotine to manage dyslipidemia.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Nicotine Administration Exacerbates Lipid Profile Alterations in a Wistar Rat Model of Liver Fibrosis Through Fatty Acid Synthesis Modulation\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-05-19 18:29:29\",\"doi\":\"10.21203/rs.3.rs-6646003/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"a13f7a2c-2e2b-4aa9-aa3d-738cbeae224e\",\"owner\":[],\"postedDate\":\"May 19th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":48595540,\"name\":\"Biological sciences/Physiology\"},{\"id\":48595541,\"name\":\"Health sciences/Diseases/Metabolic disorders\"},{\"id\":48595542,\"name\":\"Health sciences/Diseases/Gastrointestinal diseases/Liver diseases\"}],\"tags\":[],\"updatedAt\":\"2025-05-29T09:24:02+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-05-19 18:29:29\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6646003\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6646003\",\"identity\":\"rs-6646003\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}