{"paper_id":"08fca111-2c19-4b61-878e-abf8457d4033","body_text":"Prevalence and Clinical Significance of Autoantibodies to Sulphite Oxidase and Glycogen Phosphorylase in Chinese Primary Biliary Cholangitis Patients | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report Prevalence and Clinical Significance of Autoantibodies to Sulphite Oxidase and Glycogen Phosphorylase in Chinese Primary Biliary Cholangitis Patients Rohil Jawed This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6373642/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 14 Jun, 2025 Read the published version in Molecular Biology Reports → Version 1 posted 7 You are reading this latest preprint version Abstract Objective To evaluate the prevalence and clinical significance of autoantibodies to mitochondrial sulphite oxidase (SUOX) and glycogen phosphorylase (PYGL) in Chinese PBC patients. METHODS Enzyme-linked immunosorbent assays (ELISA) were developed with purified SUOX and PYGL proteins. Serum samples from 780 PBC patients and 352 healthy controls were used for antibody detection. Statistical analysis was performed with antibody results and biochemical data from PBC patients. RESULTS Antibodies to SUOX and PYGL were found in 14.23% and 22.94% of PBC patients, but also in 6.53% and 9.37% of healthy controls. There is a significant positive correlation between anti-SUOX and -PYGL with anti-M2, -sp100 and -gp210. Anti-SUOX and -PYGL positivity does not correlate with ursodeoxycholic acid (UDCA) response. Time course analysis found no specific change of anti-SUOX or -PYGL antibody titers in positive patients before and after UDCA treatment. CONCLUSIONS The data concluded that anti-SUOX and -PYGL autoantibodies are not serological markers in PBC diagnosis due to a lack of sensitivity and specificity. With the existence of PBC specific autoantibodies in PBC diagnosis and treatment, anti-SUOX and -PYGL status in PBC patients have no significant value. PBC autoantibody AMA SUOX PYGL M2 sp100 gp210 Figures Figure 1 Introduction Primary Biliary Cholangitis (PBC) is an autoimmune disorder of obscure etiology defined by the presence of serum anti-mitochondrial antibodies (AMA), progressive destruction of the interlobular bile ducts, and liver cirrhosis( 1 ). Clinical presentations vary considerably among patients and nearly half of the cases remain asymptomatic at the time of diagnosis( 2 ). PBC disease progression may be triggered by exposure to environmental factors in genetically susceptible individuals( 3 ). PBC-specific antibodies are AMA (PDC-E2, BCOADC-E2, and OGDC-E2), which are detected in 90–95% of PBC patients, and antinuclear antibodies (ANA) (sp100 and gp210), frequently present in AMA-negative individuals and are detected in 30–50% of PBC patients( 4 ). Among other AMAs, sulphite oxidase (SUOX), an enzyme of the inter-mitochondrial space, and glycogen phosphorylase (PYGL), an enzyme associated with the outer mitochondrial membrane of the liver, were previously considered PBC-specific but later observed in non-PBC conditions( 5 – 8 ). It has been suggested before that PBC cases positive for anti-SUOX antibodies follow a more progressive course, whereas those positive for anti-PYGL antibodies can expect more benign outcomes( 5 , 9 , 10 ). However, results among different studies were inconsistent( 11 ). In this study, we attempted to examine the prevalence and clinical significance of anti-SUOX and -PYGL by using Enzyme-linked immunosorbent assay (ELISA) analysis and investigate the association of these autoantibodies’ status with the clinical and biochemical features in a large cohort of Chinese PBC patients and healthy controls. Methods Collection of PBC patients and healthy controls The samples were collected from the member hospitals of the Jiangsu Provincial PBC Collaboration Group (JSPPCG) as a part of our genetic analysis study( 12 ). All patients were recruited following the approval of the research ethics committee of university hospital and in accordance with the guidelines of the Declaration of Helsinki (2008). PBC diagnosis was established according to the criteria of the American Association for the Study of Liver Diseases (AASLD)( 13 ): 1-AMA-M2 positive with increased alkaline phosphatase; 2- AMA-M2 negative but with histological evidence and increased alkaline phosphatase. A total of 780 PBC patients were used for antibody detection. Biochemical test records at disease diagnosis for the study subjects were summarized in supplementary table 1. Of the 780 patients, 666 were female (85.38%) and 114 were male (14.62%). The median age of the patients was 55.9 years. To evaluate the response to ursodeoxycholic acid (UDCA) treatment, we only selected those patients who have complete medical records available and followed UDCA treatment at a daily dose of 13 to 15 mg/kg of body weight for more than a year. The Barcelona (BA) and Paris I (PA) criteria were used to conduct the biochemical response to UDCA treatment( 14 , 15 ). Expression and purification of SUOX and PYGL cDNA prepared from human liver cells (Hep G2) served as the template to amplify SUOX and PYGL coding sequences. For SUOX , the forward primer (FP) was 5′- GTTCCAGGGGCCCCTGGGATCC GAGTCAACACACATATACAC, and the reverse primer (RP) was 5′- AGTCACGATGCGGCCGCTCGAG TCATGGGGAGACATAGACAT. For PYGL N-terminal region (1-340aa), FP was 5′- GTTCCAGGGGCCCCTGGGATCC GCGAAGCCCCTGACGGACCA, and RP was 5′- AGTCACGATGCGGCCGCTCGAG TCAGTCATTCAGCTGGATGGCCA). For the PYGL C-terminal region (341-847aa), the FP was 5′- GTTCCAGGGGCCCCTGGGATCC ACTCACCCTGCACTCGCGAT, and the RP was 5′- AGTCACGATGCGGCCGCTCGAG TCAATTTCCATTGACTTTGTTAG. ET cloning method was used to insert genes into the pGEX vector with glutathione-S-transferase (GST) tag ( 16 ). The transformed BL21 cells containing SUOX or PYGL construct were grown at 37°C overnight in a Luria-Bertani medium containing 50 µg/mL ampicillin and induced with 1 mM isopropylthiogalactoside overnight at 25°C. SUOX and PYGL proteins were first purified with glutathione sepharose 4B beads (GE Healthcare, Sweden), and then digested with GST-tagged Protease 3C. The GST and tagged protease were removed by further mixing with glutathione sepharose 4B beads. The supernatant was subjected to ion-change purification using a HiTrap Q HP column (GE Healthcare, Sweden) and eluted with 100 to 1000 mM of NaCl. The fractions containing the target proteins were loaded to the HiLoad 26/600 Superdex 75 PG column for the final purification of SUOX and PYGL. ELISA analysis Purified SUOX and PYGL (both N- and C-terminal) antigens (2 µg/mL) were suspended in 50 mM carbonate buffer (pH 9.6) and coated onto 96 well microtiter plates (Thermo-Fisher, USA) overnight at 4°C. After blocking with 1% bovine serum albumin (BSA) in phosphate-buffered saline (PBS), the plate was incubated with 100 µL of serum sample (1:2,000 dilution) for 2 hours at room temperature and then washed with PBS buffer containing 0.1% tween-20 (PBST) for five times. The plate was further incubated with 100 µL/well of peroxidase-conjugated anti-human IgG antibody (Millipore, Temecula, USA) followed with PBST wash six times. After washing, 3, 3’, 5, 5’-tetramethyl-benzidine was added as substrate and 2 M sulfuric acid was added as a stop solution. Optical Density (OD) was read by an ELISA plate reader (BIO-RAD, USA) with an absorbance of 450 nm. The anti-M2 (PDC-E2) reactivity was measured using our in house developed ELISA analysis method ( 17 ). Also, a 25 amino acid peptide (SPNALPPARKASPPSGLWSPAYASH) of gp210 in the carboxyl-terminal domain was synthesized (Genscript, China) and used as the autoepitope( 18 ). Three non-overlapping domains of the sp100, sixteen amino acids (IKKEKPFSNSKVECQA) at position 296–311, ten amino acids (EVFISAPRSE) at position 342–351 and eighteen amino acids (QEATCSRPQIVPEPMDFR) at position 369–386 were synthesized (Genscript, China) and used as the autoepitope ( 19 ). These antigens were prepared and then coated onto a 96 well microtiter plates for ELISA analysis. For each ELISA plate, we tested 36 samples, 11 negative controls and 1 blank in duplicate. The average absorbance in negative controls was calculated and then compared with the absorbance of test samples. Each sample was repeated at least four times. Samples that had at least 3-fold greater absorbance than that of average absorbance for negative controls were declared positive. Test samples with between 2- and 3- folds of absorbance over the average absorbance of negative controls were subjected to verification with dot-blotting and Western blotting analysis to confirm the results. Immunoblotting analysis For dot-blot analysis, non-denatured SUOX, PYGL, and control proteins (1µg) were spotted to the membrane (Pure Nitrocellulose, Life Sciences) using Bio-Dot SF Microfiltration apparatus (Bio-Rad, USA). For western blotting, 1µg of purified proteins were boiled for 5 minutes in an SDS-sample buffer and separated electrophoretically on a 10% SDS-PAGE gel. Separated proteins were either stained with Coomassie Brilliant Blue R or transferred onto a nitrocellulose membrane. The membrane was blocked by 5% milk in PBST (phosphate buffer saline with 0.1% Tween-20), pH 7.4, and then incubated with 1:2000 PBST-diluted sera of different PBC patients. After washing in PBST, the bound antibodies were detected by an anti-human IgG antibody (Millipore, Eschborn, Germany) diluted at 1:20,000 in PBST. Staining was performed using an ECL Western blotting detection system (Beyotime Institute of Biotechnology, Haimen, China). Statistical analysis Data were expressed as mean ± SD. All statistical analyses were performed using SPSS version 19.0 for Windows (SPSS, Inc., Chicago, IL). Statistical significance was set at < 0.05 for all tests. The chi-square test was used to compare categorical variables and the Mann-Whitney U test was performed to compare continuous variables from two groups. Results Prevalence of AMAs to SUOX and PYGL in Chinese PBC patients and healthy controls Among 780 PBC patients analyzed, we found 14.23% (111/780) and 22.94% (179/780) cases positive for anti-SUOX and -PYGL, respectively. To analyze the specificity of these two antibodies in PBC diagnosis, we further examined the serum samples from 352 healthy controls. We found that 6.53% (23/352) and 9.37% (33/352) of control samples were positive for anti-SUOX and -PYGL, respectively. Thus, anti-SUOX and -PYGL antibodies showed moderate specificity (93.47% and 90.62%, respectively) and low sensitivity (14.23% and 22.94%, respectively), indicating that AMA to SUOX and PYGL were not disease-specific (Table 1 ). Moreover, significantly higher prevalence of anti-SUOX and -PYGL were found between PBC patients and healthy control groups ( P < 0.001). Table 1 Prevalence of anti-SUOX and -PYGL in Chinese PBC patients and healthy controls Patients (n = 780) controls (n = 352) Positive Negative Positive Negative P value Sensitivity Specificity Anti-SUOX 111 669 23 329 < 0.001* 14.23% 93.47% Anti-PYGL 179 601 33 319 < 0.001* 22.94% 90.62% * P < 0.01, SUOX: Sulphite Oxidase; PYGL: Glycogen Phosphorylase, χ2 test was used to calculate P values. Association of anti-SUOX and/or -PYGL with PBC specific autoantibodies Anti-M2, -sp100 and -gp210 autoantibodies have been broadly used in PBC diagnosis. To further analyze the correlation of PBC-specific autoantibodies with anti-SUOX or -PYGL, we measured anti-M2, -sp100 and -gp210 autoantibodies in 780 PBC patients. We found 673 (86.28%), 212 (27.17%) and 344 (44.1%) cases positive for anti-M2, anti-sp100 and anti-gp210, respectively. Statistical analysis showed a strong positive correlation between anti-SUOX/PYGL and PBC specific autoantibodies (Table 2 ). Table 2 Association of SUOX and PYGL antibodies according to the presence of sp100 and gp210 antibodies in 780 patients Anti-SUOX Anti-PYGL Positive(n = 111) Negative(n = 669) P value Positive(n = 179) Negative(n = 601) P value Anti-M2(+/-) 106/05(95.49%) 567/102(84.75%) < 0.001* 169/10(94.41%) 504/97(83.86%) < 0.001* Anti-sp100(+/-) 59/52(53.15%) 153/516(22.87%) < 0.001* 74/105(41.34%) 138/463(22.96%) < 0.001* Anti-gp210(+/-) 66/45(59.46%) 278/391(41.55%) < 0.001* 101/78(56.42%) 243/358(40.43%) < 0.001* * P < 0.01, SUOX: Sulphite Oxidase; PYGL: Glycogen Phosphorylase, χ2 test was used to calculate P values. Anti-gp210 positivity is associated with non-response to the UDCA treatment In this cohort, only 184 patients have complete medical records showing continuously treated with UDCA for more than twelve months at the time of analysis. No difference was observed between anti-SUOX or anti-PYGL status and UDCA responses based on both BA and PA criteria (Table 3 ). But anti-gp210 positivity was found associated with non-response to UDCA treatment. This result was in line with the report published by Yang et al., that the gp210 antibody was co-related with more severe disease progress in Chinese PBC patients( 20 ). Table 3 Correlation of autoantibody status with UDCA response in 184 PBC Patients after UDCA treatment Response according to BA Response according to PA Features Response (n = 115) Non-response (n = 69) P value Response (n = 85) Non-response (n = 99) P value Age 57.0 ± 10.8 55.6 ± 11.8 0.512 56.2 ± 10.8 56.7 ± 11.5 0.771 Sex (F/M) 98/17 53/16 0.151 68/17 83/16 0.500 TB (µmol/L) 47.7 ± 114.8 77.4 ± 123.9 < 0.001* 13.0 ± 3.8 98.2 ± 151.6 < 0.001* DB (µmol/L) 32.7 ± 93.5 53.4 ± 91.8 < 0.001* 5.3 ± 2.5 70.3 ± 118.9 < 0.001* ALT (IU/L) 50.1 ± 50.4 84.6 ± 98.6 < 0.001* 38.7 ± 26.2 83.9 ± 93.2 < 0.001* AST (IU/L) 52.6 ± 39.2 99.4 ± 70.6 < 0.001* 38.4 ± 16.7 97.4 ± 65.9 < 0.001* GGT (U/L) 113.2 ± 152.3 278.2 ± 310.6 < 0.001* 119.5 ± 171.7 222.8 ± 275.1 < 0.001* ALP (U/L) 136.4 ± 83.1 325.1 ± 200.5 < 0.001* 137.0 ± 69.6 267.4 ± 198.8 < 0.001* TP (g/L) 69.4 ± 10.4 70.5 ± 10.5 0.574 70.7 ± 9.6 69.1 ± 11.1 0.275 ALB (g/L) 37.1 ± 7.2 36.1 ± 7.2 0.251 39.5 ± 5.3 34.4 ± 7.7 < 0.001* Anti-SUOX (+/-) 15/100 9/60 1.000 10/75 14/85 0.633 Anti-PYGL (+/-) 29/86 12/57 0.216 14/71 27/72 0.079 Anti-M2 (+/-) 104/11 65/4 0.366 79/6 90/9 0.616 Anti-sp100 (+/-) 38/77 16/53 0.155 23/62 31/68 0.528 Anti-gp210 (+/-) 44/71 36/33 0.065 21/64 59/40 < 0.001* * P < 0.01. Mann-Whitney U test and χ2 test were performed to calculate P values. ALP: alkaline phosphatase; ALT: alanine aminotransferase; AST: aspartate aminotransferase; GGT: gamma-glutamyl transferase; TB: total bilirubin; DB: direct bilirubin; TP: total protein; ALB: albumin. SUOX: Sulphite Oxidase; PYGL: Glycogen Phosphorylase. Values are mean ± SD. BA: Barcelona criteria; PA: Paris I criteria. No correlation between anti-SUOX and -PYGL titer with the UDCA treatment In the course of evaluating our antibody ELISA assay, we accidentally found inconsistent antibody titers for a patient’s blood samples collected at two different times. To analyze if antibody titer can be affected by the UDCA treatment, we performed semi-quantitative analysis of antibody titers in PBC patients during the course of UDCA treatment. A total of six PBC patients were included with blood sample collections before and after UDCA treatment at different time points. Of the six patients, two patients were positive for anti-SUOX, two patients were positive for anti-PYGL and two patients were positive for both anti-SUOX and -PYGL. No significant difference was observed between the titers of anti-SUOX and/or -PYGL during the time course analysis with UDCA treatment (Fig. 1 ). Discussion Antibodies to mitochondrial SUOX and -PYGL (previously known as M4 and M9) were first detected by Klein et al. in PBC patients ( 5 , 9 , 21 ). Subsequent efforts were made to assess their values as diagnostic markers, which were found to occur with low frequencies in PBC and some chronic liver disease patients ( 8 , 22 ). So far, their diagnostic value remains inconclusive. There has been no previous report on the prevalence of anti-SUOX and -PYGL in Chinese PBC patients, although anti-SUOX and -PYGL diagnostic products have been used in clinical diagnosis at some hospitals in China. Evidently, there is a pressing need to determine the clinical significance and necessity of anti-SUOX and -PYGL tests in Chinese patients. Our report is the first to address this issue in a large cohort of Chinese PBC patients. In this report, we demonstrated that autoantibodies directed to SUOX and PYGL were found in 14.23% and 22.94% of PBC patients, but also seen in 6.53% and 9.37% of healthy controls. This result revealed that anti-SUOX and -PYGL are not disease-specific, but higher prevalence exists in PBC patients than in healthy controls. Our results reported here also pointed out that AMA diagnosis based on in situ immunofluorescence analysis may introduce false positive results due to reactivity to SUOX and PYGL observed in healthy individuals. In the present study, we also performed a series of tests using different concentrations of antigens against different PBC serum dilutions and constructed a standard curve to check the precision of our ELISA data. We noticed that the sensitivity of anti-SUOX and -PYGL ELISA detection were relatively low, compared to anti-M2, -sp100 and -gp210. We speculate that the lack of dominant epitopes in both SUOX and PYGL proteins may be the reason for low titers of antibodies to anti-SUOX and -PYGL, as suspected by other researchers( 8 , 11 ). In our anti-PYGL analysis, the full length of PYGL coupled with the GST tag generated very low-level protein expression. Therefore, N-terminal (1-340aa) and C-terminal (341-847aa) proteins were purified separately and combined for ELISA analysis. We also noticed that N-terminal PYGL were reactive to anti-PYGL positive samples in both ELISA and dot blotting (native protein), but not in SDS-PAGE based Western blotting, while C-terminal of PYGL was reactive to anti-PYGL serum in both native and denatured form (data not shown). These results indicate that N-terminal epitopes in anti-PYGL are conformation-dependent, while C-terminal epitopes are not. Anti-M2, -sp100 and -gp210 have been considered as PBC-specific autoantibodies and broadly used in PBC diagnosis. The specific role of these autoantibodies in PBC disease progress have been under debate for some time. It is more convincing now that anti-gp210 is associated with more severe forms of PBC, based on several recent studies( 20 , 23 ). Therefore, we compared the status of PBC specific autoantibodies based on anti-SUOX and -PYGL positivity, and we found that patients who tested positive for anti-SUOX and/or -PYGL had significantly higher positivity. Currently, we did not observe any correlation between anti-SUOX/PYGL biochemical status with response to UDCA treatment. In an attempt to further analyze whether anti-SUOX/PYGL titer was associated with UDCA treatment, we were able to identify six anti-SUOX and/or PYGL positive patients with blood samples available for time course analysis and did not identify any significant correlation. A limited sample size increases the likelihood of sampling bias, as the participants may not adequately represent the broader population. Additionally, a small number of patients can result in reduced statistical power, making it more difficult to detect meaningful differences or associations. Future research with larger, more diverse cohorts is necessary to validate these findings and ensure that they are applicable to the general population. In conclusion, this study assessed the sensitivity and clinical relevance of anti-SUOX and -PYGL in Chinese PBC patients. Anti-SUOX and -PYGL is not a disease-specific autoantibody marker, but their presence was significantly associated with PBC specific autoantibodies in PBC patients. However, a clinical test of anti-SUOX and -PYGL antibodies added no specific value in PBC diagnosis with the existence of anti-M2, -sp100 and -gp210 already available. Declarations Acknowledgments: We thank all participating members of the Jiangsu Provincial PBC Collaboration Group for providing patient samples and clinical information. We would like to thank the patients for their participation in Funding: This work was supported by grants from the National Natural Science Foundation of China (No. 81270295; No. 81770381, Key R&D Program of Jiangsu Province (SBE2017740378), the Natural Science Foundation of Jiangsu Province (No. SBK2015020697), and the Fundamental Research Funds for the Central Universities. Conflict of interest: The author declares that they have no conflict of interest. Disclosure of interests: The funding organizations played no role in the study design; in the collection, analysis, and interpretation of data; in the writing of the report; or in the decision to submit the report for publication. Ethics approvals: This study was approved by the Ethics Committee at of university hospital and in accordance with the guidelines of the Declaration of Helsinki (2008). Written informed consent was obtained from each patient prior to screening on the approved informed consent form. Consent for publication : Not applicable. All authors approved the final manuscript and its submission. References Kaplan MM, Gershwin ME (2005) Primary biliary cirrhosis. N Engl J Med 353(12):1261–1273 Gonzalez RS, Washington K (2018) Primary Biliary Cholangitis and Autoimmune Hepatitis. Surg Pathol Clin 11(2):329–349 Joshita S, Umemura T, Tanaka E, Ota M (2018) Genetics and epigenetics in the pathogenesis of primary biliary cholangitis. Clin J Gastroenterol 11(1):11–18 Rigopoulou EI, Bogdanos DP (2023) Role of autoantibodies in the clinical management of primary biliary cholangitis. World J Gastroenterol 29(12):1795–1810 Klein R, Berg PA (1991) Anti-M4 antibodies in primary biliary cirrhosis react with sulphite oxidase, an enzyme of the mitochondrial inter-membrane space. Clin Exp Immunol 84(3):445–448 Klein R, Berg PA (1990) Anti-M9 antibodies in sera from patients with primary biliary cirrhosis recognize an epitope of glycogen phosphorylase. Clin Exp Immunol 81(1):65–71 Dubel L, Boulay-Stref N, Poupon R, Farges O, Homberg JC, Johanet C (1995) The Hopital Saint Antoine and Hopital Paul Brousse experience of anti-M4 and anti-M9 antibodies as markers of severity of primary biliary cirrhosis. J Hepatol 23(5):627–628 Palmer JM, Yeaman SJ, Bassendine MF, James OF (1993) M4 and M9 autoantigens in primary biliary cirrhosis–a negative study. J Hepatol 18(2):251–254 Klein R, Kloppel G, Fischer R, Fintelmann V, Muting D, Berg PA (1988) The antimitochondrial antibody anti-M9. A marker for the diagnosis of early primary biliary cirrhosis. J Hepatol 6(3):299–306 Flisiak R, Pelszynska M, Prokopowicz D, Rogalska M, Grygoruk U (2005) High concentration of antimitochondrial antibodies predicts progressive primary biliary cirrhosis. World J Gastroenterol 11(36):5706–5709 Davis PA, Leung P, Manns M, Kaplan M, Munoz SJ, Gorin FA et al (1992) M4 and M9 antibodies in the overlap syndrome of primary biliary cirrhosis and chronic active hepatitis: epitopes or epiphenomena? Hepatology 16(5):1128–1136 Jawed R, Zhang M, Wang C, Yang SH, Jiang P, Wu Q et al (2020) Replication study and meta-analysis indicate a suggestive association of RUNX3 locus with primary biliary cholangitis. Immunogenetics 72(9–10):467–474 Lindor KD, Gershwin ME, Poupon R, Kaplan M, Bergasa NV, Heathcote EJ et al (2009) Primary biliary cirrhosis. Hepatology 50(1):291–308 Pares A, Caballeria L, Rodes J (2006) Excellent long-term survival in patients with primary biliary cirrhosis and biochemical response to ursodeoxycholic Acid. Gastroenterology 130(3):715–720 Corpechot C, Abenavoli L, Rabahi N, Chretien Y, Andreani T, Johanet C et al (2008) Biochemical response to ursodeoxycholic acid and long-term prognosis in primary biliary cirrhosis. Hepatology 48(3):871–877 Zhang Y, Muyrers JP, Testa G, Stewart AF (2000) DNA cloning by homologous recombination in Escherichia coli. Nat Biotechnol 18(12):1314–1317 Qiu F, Tang R, Zuo X, Shi X, Wei Y, Zheng X et al (2017) A genome-wide association study identifies six novel risk loci for primary biliary cholangitis. Nat Commun 8:14828 Bandin O, Courvalin JC, Poupon R, Dubel L, Homberg JC, Johanet C (1996) Specificity and sensitivity of gp210 autoantibodies detected using an enzyme-linked immunosorbent assay and a synthetic polypeptide in the diagnosis of primary biliary cirrhosis. Hepatology 23(5):1020–1024 Xie K, Snyder M (1995) Two short autoepitopes on the nuclear dot antigen are similar to epitopes encoded by the Epstein-Barr virus. Proc Natl Acad Sci U S A 92(5):1639–1643 Yang F, Yang Y, Wang Q, Wang Z, Miao Q, Xiao X et al (2017) The risk predictive values of UK-PBC and GLOBE scoring system in Chinese patients with primary biliary cholangitis: the additional effect of anti-gp210. Aliment Pharmacol Ther 45(5):733–743 Klein R, Berg PA (1988) Characterization of a new mitochondrial antigen-antibody system (M9/anti-M9) in patients with anti-M2 positive and anti-M2 negative primary biliary cirrhosis. Clin Exp Immunol 74(1):68–74 Preuss B, Berg C, Altenberend F, Gregor M, Stevanovic S, Klein R (2007) Demonstration of autoantibodies to recombinant human sulphite oxidase in patients with chronic liver disorders and analysis of their clinical relevance. Clin Exp Immunol 150(2):312–321 Nakamura M, Kondo H, Mori T, Komori A, Matsuyama M, Ito M et al (2007) Anti-gp210 and anti-centromere antibodies are different risk factors for the progression of primary biliary cirrhosis. Hepatology 45(1):118–127 Additional Declarations No competing interests reported. Supplementary Files SupplementaryTable1.docx Cite Share Download PDF Status: Published Journal Publication published 14 Jun, 2025 Read the published version in Molecular Biology Reports → Version 1 posted Editorial decision: Revision requested 22 Apr, 2025 Reviews received at journal 21 Apr, 2025 Reviewers agreed at journal 17 Apr, 2025 Reviewers invited by journal 07 Apr, 2025 Editor assigned by journal 05 Apr, 2025 Submission checks completed at journal 05 Apr, 2025 First submitted to journal 04 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6373642\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Short Report\",\"associatedPublications\":[],\"authors\":[{\"id\":439766477,\"identity\":\"a405ff5c-fe09-422f-8783-b1ddf6f5af13\",\"order_by\":0,\"name\":\"Rohil Jawed\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA50lEQVRIiWNgGAWjYFACHgaGhAI2EMvwAYjLR5wWA7AWYwMQl40oLQwGYJaZBIgkqMW8vffghwcGfPIGx5u3VX7NsZNhY2B++OgGHi0yZ84lSwAdZrjhzLGy27LbkoEOYzM2zsGjRUIixwCkhXHbjRyz25LbmIFaeNikCWgx/gHUYr/t/huzYslt9URpMQPZkrjtBo8Z48dth4nQwnPGzAKoJXn/mbRiacZtx3nYmAn5hb3H+OaPimO2M9sPb/z4c1u1PT9788PH+LRAwTEwycwDJgkrB4EaMMn4gzjVo2AUjIJRMMIAAFeqQpnyh9qxAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Nanjing University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Rohil\",\"middleName\":\"\",\"lastName\":\"Jawed\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-04-04 06:23:15\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6373642/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6373642/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1007/s11033-025-10646-5\",\"type\":\"published\",\"date\":\"2025-06-14T15:56:53+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":80293286,\"identity\":\"bc36a699-a755-443f-a1b4-445778975774\",\"added_by\":\"auto\",\"created_at\":\"2025-04-10 08:16:55\",\"extension\":\"jpeg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":463391,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eTime course analysis of anti-SUOX and -PYGL status in PBC patients treated with UDCA. Optical Density (OD450) value of serum samples of PBC patients before (0 month) and after UDCA treatment were plotted against the time after treatment (months). All samples were diluted to 2000 times after optimal test and analyzed in triplicates in the same plate. Serum samples of PBC patients (A) 1, 2, 3, and 4 were analyzed for anti-SUOX and (B) 1, 2, 5, and 6 were analyzed for anti-PYGL before UDCA treatment and at different time point after treatment.\\u003c/p\\u003e\\n\\u003cp\\u003eNote: Patient 1 and 2 were positive for both SUOX and PYGL antibodies. Patient 3 and 4 were only positive for SUOX antibody. Patient 5 and 6 were only positive for PYGL antibody.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6373642/v1/cd958c235ee59cb529e7868d.jpeg\"},{\"id\":84726445,\"identity\":\"b30ae20c-10e1-48e2-ad4a-6f99d0e49f08\",\"added_by\":\"auto\",\"created_at\":\"2025-06-16 16:03:38\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1316200,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6373642/v1/befad093-fa4e-431f-a909-8599ebbe499b.pdf\"},{\"id\":80292537,\"identity\":\"962743a9-47ef-4932-a1c6-dcfe10670624\",\"added_by\":\"auto\",\"created_at\":\"2025-04-10 08:08:55\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":15678,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryTable1.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6373642/v1/ccb984aed1976322cce9afbd.docx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Prevalence and Clinical Significance of Autoantibodies to Sulphite Oxidase and Glycogen Phosphorylase in Chinese Primary Biliary Cholangitis Patients\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003ePrimary Biliary Cholangitis (PBC) is an autoimmune disorder of obscure etiology defined by the presence of serum anti-mitochondrial antibodies (AMA), progressive destruction of the interlobular bile ducts, and liver cirrhosis(\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e). Clinical presentations vary considerably among patients and nearly half of the cases remain asymptomatic at the time of diagnosis(\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e). PBC disease progression may be triggered by exposure to environmental factors in genetically susceptible individuals(\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003ePBC-specific antibodies are AMA (PDC-E2, BCOADC-E2, and OGDC-E2), which are detected in 90\\u0026ndash;95% of PBC patients, and antinuclear antibodies (ANA) (sp100 and gp210), frequently present in AMA-negative individuals and are detected in 30\\u0026ndash;50% of PBC patients(\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e). Among other AMAs, sulphite oxidase (SUOX), an enzyme of the inter-mitochondrial space, and glycogen phosphorylase (PYGL), an enzyme associated with the outer mitochondrial membrane of the liver, were previously considered PBC-specific but later observed in non-PBC conditions(\\u003cspan additionalcitationids=\\\"CR6 CR7\\\" citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e). It has been suggested before that PBC cases positive for anti-SUOX antibodies follow a more progressive course, whereas those positive for anti-PYGL antibodies can expect more benign outcomes(\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e). However, results among different studies were inconsistent(\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eIn this study, we attempted to examine the prevalence and clinical significance of anti-SUOX and -PYGL by using Enzyme-linked immunosorbent assay (ELISA) analysis and investigate the association of these autoantibodies\\u0026rsquo; status with the clinical and biochemical features in a large cohort of Chinese PBC patients and healthy controls.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCollection of PBC patients and healthy controls\\u003c/h2\\u003e \\u003cp\\u003eThe samples were collected from the member hospitals of the Jiangsu Provincial PBC Collaboration Group (JSPPCG) as a part of our genetic analysis study(\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e). All patients were recruited following the approval of the research ethics committee of university hospital and in accordance with the guidelines of the Declaration of Helsinki (2008). PBC diagnosis was established according to the criteria of the American Association for the Study of Liver Diseases (AASLD)(\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e): 1-AMA-M2 positive with increased alkaline phosphatase; 2- AMA-M2 negative but with histological evidence and increased alkaline phosphatase. A total of 780 PBC patients were used for antibody detection. Biochemical test records at disease diagnosis for the study subjects were summarized in supplementary table 1. Of the 780 patients, 666 were female (85.38%) and 114 were male (14.62%). The median age of the patients was 55.9 years. To evaluate the response to ursodeoxycholic acid (UDCA) treatment, we only selected those patients who have complete medical records available and followed UDCA treatment at a daily dose of 13 to 15 mg/kg of body weight for more than a year. The Barcelona (BA) and Paris I (PA) criteria were used to conduct the biochemical response to UDCA treatment(\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e).\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eExpression and purification of SUOX and PYGL\\u003c/h3\\u003e\\n\\u003cp\\u003ecDNA prepared from human liver cells (Hep G2) served as the template to amplify \\u003cem\\u003eSUOX\\u003c/em\\u003e and \\u003cem\\u003ePYGL\\u003c/em\\u003e coding sequences. For \\u003cem\\u003eSUOX\\u003c/em\\u003e, the forward primer (FP) was 5\\u0026prime;-\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eGTTCCAGGGGCCCCTGGGATCC\\u003c/span\\u003eGAGTCAACACACATATACAC, and the reverse primer (RP) was 5\\u0026prime;-\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eAGTCACGATGCGGCCGCTCGAG\\u003c/span\\u003eTCATGGGGAGACATAGACAT. For PYGL N-terminal region (1-340aa), FP was 5\\u0026prime;-\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eGTTCCAGGGGCCCCTGGGATCC\\u003c/span\\u003eGCGAAGCCCCTGACGGACCA, and RP was 5\\u0026prime;-\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eAGTCACGATGCGGCCGCTCGAG\\u003c/span\\u003eTCAGTCATTCAGCTGGATGGCCA). For the PYGL C-terminal region (341-847aa), the FP was 5\\u0026prime;- \\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eGTTCCAGGGGCCCCTGGGATCC\\u003c/span\\u003eACTCACCCTGCACTCGCGAT, and the RP was 5\\u0026prime;-\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eAGTCACGATGCGGCCGCTCGAG\\u003c/span\\u003eTCAATTTCCATTGACTTTGTTAG. ET cloning method was used to insert genes into the pGEX vector with glutathione-S-transferase (GST) tag (\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e). The transformed BL21 cells containing \\u003cem\\u003eSUOX\\u003c/em\\u003e or \\u003cem\\u003ePYGL\\u003c/em\\u003e construct were grown at 37\\u0026deg;C overnight in a Luria-Bertani medium containing 50 \\u0026micro;g/mL ampicillin and induced with 1 mM isopropylthiogalactoside overnight at 25\\u0026deg;C. SUOX and PYGL proteins were first purified with glutathione sepharose 4B beads (GE Healthcare, Sweden), and then digested with GST-tagged Protease 3C. The GST and tagged protease were removed by further mixing with glutathione sepharose 4B beads. The supernatant was subjected to ion-change purification using a HiTrap Q HP column (GE Healthcare, Sweden) and eluted with 100 to 1000 mM of NaCl. The fractions containing the target proteins were loaded to the HiLoad 26/600 Superdex 75 PG column for the final purification of SUOX and PYGL.\\u003c/p\\u003e\\n\\u003ch3\\u003eELISA analysis\\u003c/h3\\u003e\\n\\u003cp\\u003ePurified SUOX and PYGL (both N- and C-terminal) antigens (2 \\u0026micro;g/mL) were suspended in 50 mM carbonate buffer (pH 9.6) and coated onto 96 well microtiter plates (Thermo-Fisher, USA) overnight at 4\\u0026deg;C. After blocking with 1% bovine serum albumin (BSA) in phosphate-buffered saline (PBS), the plate was incubated with 100 \\u0026micro;L of serum sample (1:2,000 dilution) for 2 hours at room temperature and then washed with PBS buffer containing 0.1% tween-20 (PBST) for five times. The plate was further incubated with 100 \\u0026micro;L/well of peroxidase-conjugated anti-human IgG antibody (Millipore, Temecula, USA) followed with PBST wash six times. After washing, 3, 3\\u0026rsquo;, 5, 5\\u0026rsquo;-tetramethyl-benzidine was added as substrate and 2 M sulfuric acid was added as a stop solution. Optical Density (OD) was read by an ELISA plate reader (BIO-RAD, USA) with an absorbance of 450 nm.\\u003c/p\\u003e \\u003cp\\u003eThe anti-M2 (PDC-E2) reactivity was measured using our in house developed ELISA analysis method (\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e). Also, a 25 amino acid peptide (SPNALPPARKASPPSGLWSPAYASH) of gp210 in the carboxyl-terminal domain was synthesized (Genscript, China) and used as the autoepitope(\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e). Three non-overlapping domains of the sp100, sixteen amino acids (IKKEKPFSNSKVECQA) at position 296\\u0026ndash;311, ten amino acids (EVFISAPRSE) at position 342\\u0026ndash;351 and eighteen amino acids (QEATCSRPQIVPEPMDFR) at position 369\\u0026ndash;386 were synthesized (Genscript, China) and used as the autoepitope (\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e). These antigens were prepared and then coated onto a 96 well microtiter plates for ELISA analysis.\\u003c/p\\u003e \\u003cp\\u003eFor each ELISA plate, we tested 36 samples, 11 negative controls and 1 blank in duplicate. The average absorbance in negative controls was calculated and then compared with the absorbance of test samples. Each sample was repeated at least four times. Samples that had at least 3-fold greater absorbance than that of average absorbance for negative controls were declared positive. Test samples with between 2- and 3- folds of absorbance over the average absorbance of negative controls were subjected to verification with dot-blotting and Western blotting analysis to confirm the results.\\u003c/p\\u003e\\n\\u003ch3\\u003eImmunoblotting analysis\\u003c/h3\\u003e\\n\\u003cp\\u003eFor dot-blot analysis, non-denatured SUOX, PYGL, and control proteins (1\\u0026micro;g) were spotted to the membrane (Pure Nitrocellulose, Life Sciences) using Bio-Dot SF Microfiltration apparatus (Bio-Rad, USA). For western blotting, 1\\u0026micro;g of purified proteins were boiled for 5 minutes in an SDS-sample buffer and separated electrophoretically on a 10% SDS-PAGE gel. Separated proteins were either stained with Coomassie Brilliant Blue R or transferred onto a nitrocellulose membrane. The membrane was blocked by 5% milk in PBST (phosphate buffer saline with 0.1% Tween-20), pH 7.4, and then incubated with 1:2000 PBST-diluted sera of different PBC patients. After washing in PBST, the bound antibodies were detected by an anti-human IgG antibody (Millipore, Eschborn, Germany) diluted at 1:20,000 in PBST. Staining was performed using an ECL Western blotting detection system (Beyotime Institute of Biotechnology, Haimen, China).\\u003c/p\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eData were expressed as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD. All statistical analyses were performed using SPSS version 19.0 for Windows (SPSS, Inc., Chicago, IL). Statistical significance was set at \\u0026lt;\\u0026thinsp;0.05 for all tests. The chi-square test was used to compare categorical variables and the Mann-Whitney \\u003cem\\u003eU\\u003c/em\\u003e test was performed to compare continuous variables from two groups.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePrevalence of AMAs to SUOX and PYGL in Chinese PBC patients and healthy controls\\u003c/h2\\u003e \\u003cp\\u003eAmong 780 PBC patients analyzed, we found 14.23% (111/780) and 22.94% (179/780) cases positive for anti-SUOX and -PYGL, respectively. To analyze the specificity of these two antibodies in PBC diagnosis, we further examined the serum samples from 352 healthy controls. We found that 6.53% (23/352) and 9.37% (33/352) of control samples were positive for anti-SUOX and -PYGL, respectively. Thus, anti-SUOX and -PYGL antibodies showed moderate specificity (93.47% and 90.62%, respectively) and low sensitivity (14.23% and 22.94%, respectively), indicating that AMA to SUOX and PYGL were not disease-specific (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). Moreover, significantly higher prevalence of anti-SUOX and -PYGL were found between PBC patients and healthy control groups (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePrevalence of anti-SUOX and -PYGL in Chinese PBC patients and healthy controls\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"9\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c8\\\" colnum=\\\"8\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c9\\\" colnum=\\\"9\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"3\\\" nameend=\\\"c4\\\" namest=\\\"c2\\\"\\u003e \\u003cp\\u003ePatients (n\\u0026thinsp;=\\u0026thinsp;780)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"4\\\" nameend=\\\"c8\\\" namest=\\\"c5\\\"\\u003e \\u003cp\\u003econtrols (n\\u0026thinsp;=\\u0026thinsp;352)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ePositive\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eNegative\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003ePositive\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eNegative\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eP\\u003c/em\\u003e value\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003eSensitivity\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003eSpecificity\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eAnti-SUOX\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e111\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e669\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e23\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e329\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e14.23%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e93.47%\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eAnti-PYGL\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e179\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e601\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e33\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e319\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e22.94%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e90.62%\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003ctfoot\\u003e \\u003ctr\\u003e\\u003ctd colspan=\\\"9\\\"\\u003e*\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, SUOX: Sulphite Oxidase; PYGL: Glycogen Phosphorylase, χ2 test was used to calculate \\u003cem\\u003eP\\u003c/em\\u003e values.\\u003c/td\\u003e\\u003c/tr\\u003e \\u003c/tfoot\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eAssociation of anti-SUOX and/or -PYGL with PBC specific autoantibodies\\u003c/h3\\u003e\\n\\u003cp\\u003eAnti-M2, -sp100 and -gp210 autoantibodies have been broadly used in PBC diagnosis. To further analyze the correlation of PBC-specific autoantibodies with anti-SUOX or -PYGL, we measured anti-M2, -sp100 and -gp210 autoantibodies in 780 PBC patients. We found 673 (86.28%), 212 (27.17%) and 344 (44.1%) cases positive for anti-M2, anti-sp100 and anti-gp210, respectively. Statistical analysis showed a strong positive correlation between anti-SUOX/PYGL and PBC specific autoantibodies (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eAssociation of SUOX and PYGL antibodies according to the presence of sp100 and gp210 antibodies in 780 patients\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"8\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c8\\\" colnum=\\\"8\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c3\\\" namest=\\\"c2\\\"\\u003e \\u003cp\\u003eAnti-SUOX\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c7\\\" namest=\\\"c6\\\"\\u003e \\u003cp\\u003eAnti-PYGL\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c8\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ePositive(n\\u0026thinsp;=\\u0026thinsp;111)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eNegative(n\\u0026thinsp;=\\u0026thinsp;669)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eP\\u003c/em\\u003e value\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c6\\\" namest=\\\"c5\\\"\\u003e \\u003cp\\u003ePositive(n\\u0026thinsp;=\\u0026thinsp;179)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eNegative(n\\u0026thinsp;=\\u0026thinsp;601)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eP\\u003c/em\\u003e value\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eAnti-M2(+/-)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e106/05(95.49%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e567/102(84.75%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e169/10(94.41%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e504/97(83.86%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eAnti-sp100(+/-)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e59/52(53.15%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e153/516(22.87%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e74/105(41.34%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e138/463(22.96%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eAnti-gp210(+/-)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e66/45(59.46%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e278/391(41.55%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e101/78(56.42%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e243/358(40.43%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003ctfoot\\u003e \\u003ctr\\u003e\\u003ctd colspan=\\\"8\\\"\\u003e*\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, SUOX: Sulphite Oxidase; PYGL: Glycogen Phosphorylase, χ2 test was used to calculate \\u003cem\\u003eP\\u003c/em\\u003e values.\\u003c/td\\u003e\\u003c/tr\\u003e \\u003c/tfoot\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAnti-gp210 positivity is associated with non-response to the UDCA treatment\\u003c/h2\\u003e \\u003cp\\u003eIn this cohort, only 184 patients have complete medical records showing continuously treated with UDCA for more than twelve months at the time of analysis. No difference was observed between anti-SUOX or anti-PYGL status and UDCA responses based on both BA and PA criteria (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). But anti-gp210 positivity was found associated with non-response to UDCA treatment. This result was in line with the report published by Yang et al., that the gp210 antibody was co-related with more severe disease progress in Chinese PBC patients(\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab3\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 3\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eCorrelation of autoantibody status with UDCA response in 184 PBC Patients after UDCA treatment\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"8\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c8\\\" colnum=\\\"8\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"3\\\" nameend=\\\"c4\\\" namest=\\\"c2\\\"\\u003e \\u003cp\\u003eResponse according to BA\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"3\\\" nameend=\\\"c8\\\" namest=\\\"c6\\\"\\u003e \\u003cp\\u003eResponse according to PA\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eFeatures\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eResponse (n\\u0026thinsp;=\\u0026thinsp;115)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eNon-response (n\\u0026thinsp;=\\u0026thinsp;69)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eP\\u003c/em\\u003e value\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eResponse (n\\u0026thinsp;=\\u0026thinsp;85)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eNon-response (n\\u0026thinsp;=\\u0026thinsp;99)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eP\\u003c/em\\u003e value\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eAge\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e57.0\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;10.8\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e55.6\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;11.8\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e0.512\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e56.2\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;10.8\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e56.7\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;11.5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.771\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eSex (F/M)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e98/17\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e53/16\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e0.151\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e68/17\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e83/16\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.500\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eTB (\\u0026micro;mol/L)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e47.7\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;114.8\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e77.4\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;123.9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e13.0\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.8\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e98.2\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;151.6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eDB (\\u0026micro;mol/L)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e32.7\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;93.5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e53.4\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;91.8\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e5.3\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e70.3\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;118.9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eALT (IU/L)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e50.1\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;50.4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e84.6\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;98.6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e38.7\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;26.2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e83.9\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;93.2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eAST (IU/L)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e52.6\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;39.2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e99.4\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;70.6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e38.4\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;16.7\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e97.4\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;65.9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eGGT (U/L)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e113.2\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;152.3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e278.2\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;310.6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e119.5\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;171.7\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e222.8\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;275.1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eALP (U/L)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e136.4\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;83.1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e325.1\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;200.5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e137.0\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;69.6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e267.4\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;198.8\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eTP (g/L)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e69.4\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;10.4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e70.5\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;10.5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e0.574\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e70.7\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;9.6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e69.1\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;11.1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.275\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eALB (g/L)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e37.1\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;7.2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e36.1\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;7.2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e0.251\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e39.5\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;5.3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e34.4\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;7.7\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eAnti-SUOX (+/-)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e15/100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e9/60\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e1.000\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e10/75\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e14/85\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.633\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eAnti-PYGL (+/-)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e29/86\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e12/57\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e0.216\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e14/71\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e27/72\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.079\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eAnti-M2 (+/-)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e104/11\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e65/4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e0.366\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e79/6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e90/9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.616\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eAnti-sp100 (+/-)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e38/77\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e16/53\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e0.155\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e23/62\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e31/68\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.528\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eAnti-gp210 (+/-)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e44/71\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e36/33\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e0.065\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e21/64\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e59/40\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003ctfoot\\u003e \\u003ctr\\u003e\\u003ctd colspan=\\\"8\\\"\\u003e*\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01. Mann-Whitney \\u003cem\\u003eU\\u003c/em\\u003e test and χ2 test were performed to calculate \\u003cem\\u003eP\\u003c/em\\u003e values. ALP: alkaline phosphatase; ALT: alanine aminotransferase; AST: aspartate aminotransferase; GGT: gamma-glutamyl transferase; TB: total bilirubin; DB: direct bilirubin; TP: total protein; ALB: albumin. SUOX: Sulphite Oxidase; PYGL: Glycogen Phosphorylase. Values are mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD.\\u003c/td\\u003e\\u003c/tr\\u003e \\u003ctr\\u003e\\u003ctd colspan=\\\"8\\\"\\u003eBA: Barcelona criteria; PA: Paris I criteria.\\u003c/td\\u003e\\u003c/tr\\u003e \\u003c/tfoot\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eNo correlation between anti-SUOX and -PYGL titer with the UDCA treatment\\u003c/h2\\u003e \\u003cp\\u003eIn the course of evaluating our antibody ELISA assay, we accidentally found inconsistent antibody titers for a patient\\u0026rsquo;s blood samples collected at two different times. To analyze if antibody titer can be affected by the UDCA treatment, we performed semi-quantitative analysis of antibody titers in PBC patients during the course of UDCA treatment. A total of six PBC patients were included with blood sample collections before and after UDCA treatment at different time points. Of the six patients, two patients were positive for anti-SUOX, two patients were positive for anti-PYGL and two patients were positive for both anti-SUOX and -PYGL. No significant difference was observed between the titers of anti-SUOX and/or -PYGL during the time course analysis with UDCA treatment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e).\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eAntibodies to mitochondrial SUOX and -PYGL (previously known as M4 and M9) were first detected by Klein et al. in PBC patients (\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e). Subsequent efforts were made to assess their values as diagnostic markers, which were found to occur with low frequencies in PBC and some chronic liver disease patients (\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e). So far, their diagnostic value remains inconclusive. There has been no previous report on the prevalence of anti-SUOX and -PYGL in Chinese PBC patients, although anti-SUOX and -PYGL diagnostic products have been used in clinical diagnosis at some hospitals in China. Evidently, there is a pressing need to determine the clinical significance and necessity of anti-SUOX and -PYGL tests in Chinese patients. Our report is the first to address this issue in a large cohort of Chinese PBC patients. In this report, we demonstrated that autoantibodies directed to SUOX and PYGL were found in 14.23% and 22.94% of PBC patients, but also seen in 6.53% and 9.37% of healthy controls. This result revealed that anti-SUOX and -PYGL are not disease-specific, but higher prevalence exists in PBC patients than in healthy controls. Our results reported here also pointed out that AMA diagnosis based on \\u003cem\\u003ein situ\\u003c/em\\u003e immunofluorescence analysis may introduce false positive results due to reactivity to SUOX and PYGL observed in healthy individuals.\\u003c/p\\u003e \\u003cp\\u003eIn the present study, we also performed a series of tests using different concentrations of antigens against different PBC serum dilutions and constructed a standard curve to check the precision of our ELISA data. We noticed that the sensitivity of anti-SUOX and -PYGL ELISA detection were relatively low, compared to anti-M2, -sp100 and -gp210. We speculate that the lack of dominant epitopes in both SUOX and PYGL proteins may be the reason for low titers of antibodies to anti-SUOX and -PYGL, as suspected by other researchers(\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e). In our anti-PYGL analysis, the full length of PYGL coupled with the GST tag generated very low-level protein expression. Therefore, N-terminal (1-340aa) and C-terminal (341-847aa) proteins were purified separately and combined for ELISA analysis. We also noticed that N-terminal PYGL were reactive to anti-PYGL positive samples in both ELISA and dot blotting (native protein), but not in SDS-PAGE based Western blotting, while C-terminal of PYGL was reactive to anti-PYGL serum in both native and denatured form (data not shown). These results indicate that N-terminal epitopes in anti-PYGL are conformation-dependent, while C-terminal epitopes are not.\\u003c/p\\u003e \\u003cp\\u003eAnti-M2, -sp100 and -gp210 have been considered as PBC-specific autoantibodies and broadly used in PBC diagnosis. The specific role of these autoantibodies in PBC disease progress have been under debate for some time. It is more convincing now that anti-gp210 is associated with more severe forms of PBC, based on several recent studies(\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e). Therefore, we compared the status of PBC specific autoantibodies based on anti-SUOX and -PYGL positivity, and we found that patients who tested positive for anti-SUOX and/or -PYGL had significantly higher positivity.\\u003c/p\\u003e \\u003cp\\u003eCurrently, we did not observe any correlation between anti-SUOX/PYGL biochemical status with response to UDCA treatment. In an attempt to further analyze whether anti-SUOX/PYGL titer was associated with UDCA treatment, we were able to identify six anti-SUOX and/or PYGL positive patients with blood samples available for time course analysis and did not identify any significant correlation. A limited sample size increases the likelihood of sampling bias, as the participants may not adequately represent the broader population. Additionally, a small number of patients can result in reduced statistical power, making it more difficult to detect meaningful differences or associations. Future research with larger, more diverse cohorts is necessary to validate these findings and ensure that they are applicable to the general population.\\u003c/p\\u003e \\u003cp\\u003eIn conclusion, this study assessed the sensitivity and clinical relevance of anti-SUOX and -PYGL in Chinese PBC patients. Anti-SUOX and -PYGL is not a disease-specific autoantibody marker, but their presence was significantly associated with PBC specific autoantibodies in PBC patients. However, a clinical test of anti-SUOX and -PYGL antibodies added no specific value in PBC diagnosis with the existence of anti-M2, -sp100 and -gp210 already available.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments:\\u003c/strong\\u003e We thank all participating members of the Jiangsu Provincial PBC Collaboration Group for providing patient samples and clinical information. We would like to thank the patients for their participation in\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding:\\u003c/strong\\u003e This work was supported by\\u0026nbsp;grants from the National Natural Science Foundation of China (No. 81270295; No. 81770381, Key R\\u0026amp;D Program of Jiangsu Province (SBE2017740378), the Natural Science Foundation of Jiangsu Province (No. SBK2015020697), and the Fundamental Research Funds for the Central Universities.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of interest:\\u003c/strong\\u003e The author declares that they have no conflict of interest.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eDisclosure of interests:\\u003c/strong\\u003e The funding organizations played no role in the study design; in the collection, analysis, and interpretation of data; in the writing of the report; or in the decision to submit the report for publication.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics approvals:\\u0026nbsp;\\u003c/strong\\u003eThis study was approved by the Ethics Committee at of university hospital and in accordance with the guidelines of the Declaration of Helsinki (2008). Written informed consent was obtained from each patient prior to screening on the approved informed consent form.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e: Not applicable. All authors approved the final manuscript and its submission.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eKaplan MM, Gershwin ME (2005) Primary biliary cirrhosis. N Engl J Med 353(12):1261\\u0026ndash;1273\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGonzalez RS, Washington K (2018) Primary Biliary Cholangitis and Autoimmune Hepatitis. Surg Pathol Clin 11(2):329\\u0026ndash;349\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJoshita S, Umemura T, Tanaka E, Ota M (2018) Genetics and epigenetics in the pathogenesis of primary biliary cholangitis. Clin J Gastroenterol 11(1):11\\u0026ndash;18\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRigopoulou EI, Bogdanos DP (2023) Role of autoantibodies in the clinical management of primary biliary cholangitis. World J Gastroenterol 29(12):1795\\u0026ndash;1810\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKlein R, Berg PA (1991) Anti-M4 antibodies in primary biliary cirrhosis react with sulphite oxidase, an enzyme of the mitochondrial inter-membrane space. Clin Exp Immunol 84(3):445\\u0026ndash;448\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKlein R, Berg PA (1990) Anti-M9 antibodies in sera from patients with primary biliary cirrhosis recognize an epitope of glycogen phosphorylase. Clin Exp Immunol 81(1):65\\u0026ndash;71\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDubel L, Boulay-Stref N, Poupon R, Farges O, Homberg JC, Johanet C (1995) The Hopital Saint Antoine and Hopital Paul Brousse experience of anti-M4 and anti-M9 antibodies as markers of severity of primary biliary cirrhosis. J Hepatol 23(5):627\\u0026ndash;628\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePalmer JM, Yeaman SJ, Bassendine MF, James OF (1993) M4 and M9 autoantigens in primary biliary cirrhosis\\u0026ndash;a negative study. J Hepatol 18(2):251\\u0026ndash;254\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKlein R, Kloppel G, Fischer R, Fintelmann V, Muting D, Berg PA (1988) The antimitochondrial antibody anti-M9. A marker for the diagnosis of early primary biliary cirrhosis. J Hepatol 6(3):299\\u0026ndash;306\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFlisiak R, Pelszynska M, Prokopowicz D, Rogalska M, Grygoruk U (2005) High concentration of antimitochondrial antibodies predicts progressive primary biliary cirrhosis. World J Gastroenterol 11(36):5706\\u0026ndash;5709\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDavis PA, Leung P, Manns M, Kaplan M, Munoz SJ, Gorin FA et al (1992) M4 and M9 antibodies in the overlap syndrome of primary biliary cirrhosis and chronic active hepatitis: epitopes or epiphenomena? Hepatology 16(5):1128\\u0026ndash;1136\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJawed R, Zhang M, Wang C, Yang SH, Jiang P, Wu Q et al (2020) Replication study and meta-analysis indicate a suggestive association of RUNX3 locus with primary biliary cholangitis. Immunogenetics 72(9\\u0026ndash;10):467\\u0026ndash;474\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLindor KD, Gershwin ME, Poupon R, Kaplan M, Bergasa NV, Heathcote EJ et al (2009) Primary biliary cirrhosis. Hepatology 50(1):291\\u0026ndash;308\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePares A, Caballeria L, Rodes J (2006) Excellent long-term survival in patients with primary biliary cirrhosis and biochemical response to ursodeoxycholic Acid. Gastroenterology 130(3):715\\u0026ndash;720\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCorpechot C, Abenavoli L, Rabahi N, Chretien Y, Andreani T, Johanet C et al (2008) Biochemical response to ursodeoxycholic acid and long-term prognosis in primary biliary cirrhosis. Hepatology 48(3):871\\u0026ndash;877\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang Y, Muyrers JP, Testa G, Stewart AF (2000) DNA cloning by homologous recombination in Escherichia coli. Nat Biotechnol 18(12):1314\\u0026ndash;1317\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eQiu F, Tang R, Zuo X, Shi X, Wei Y, Zheng X et al (2017) A genome-wide association study identifies six novel risk loci for primary biliary cholangitis. Nat Commun 8:14828\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBandin O, Courvalin JC, Poupon R, Dubel L, Homberg JC, Johanet C (1996) Specificity and sensitivity of gp210 autoantibodies detected using an enzyme-linked immunosorbent assay and a synthetic polypeptide in the diagnosis of primary biliary cirrhosis. Hepatology 23(5):1020\\u0026ndash;1024\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXie K, Snyder M (1995) Two short autoepitopes on the nuclear dot antigen are similar to epitopes encoded by the Epstein-Barr virus. Proc Natl Acad Sci U S A 92(5):1639\\u0026ndash;1643\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYang F, Yang Y, Wang Q, Wang Z, Miao Q, Xiao X et al (2017) The risk predictive values of UK-PBC and GLOBE scoring system in Chinese patients with primary biliary cholangitis: the additional effect of anti-gp210. Aliment Pharmacol Ther 45(5):733\\u0026ndash;743\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKlein R, Berg PA (1988) Characterization of a new mitochondrial antigen-antibody system (M9/anti-M9) in patients with anti-M2 positive and anti-M2 negative primary biliary cirrhosis. Clin Exp Immunol 74(1):68\\u0026ndash;74\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePreuss B, Berg C, Altenberend F, Gregor M, Stevanovic S, Klein R (2007) Demonstration of autoantibodies to recombinant human sulphite oxidase in patients with chronic liver disorders and analysis of their clinical relevance. Clin Exp Immunol 150(2):312\\u0026ndash;321\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNakamura M, Kondo H, Mori T, Komori A, Matsuyama M, Ito M et al (2007) Anti-gp210 and anti-centromere antibodies are different risk factors for the progression of primary biliary cirrhosis. Hepatology 45(1):118\\u0026ndash;127\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"molecular-biology-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"mole\",\"sideBox\":\"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)\",\"snPcode\":\"11033\",\"submissionUrl\":\"https://submission.nature.com/new-submission/11033/3\",\"title\":\"Molecular Biology Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"PBC, autoantibody, AMA, SUOX, PYGL, M2, sp100, gp210\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6373642/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6373642/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eObjective\\u003c/h2\\u003e \\u003cp\\u003eTo evaluate the prevalence and clinical significance of autoantibodies to mitochondrial sulphite oxidase (SUOX) and glycogen phosphorylase (PYGL) in Chinese PBC patients.\\u003c/p\\u003e\\u003ch2\\u003eMETHODS\\u003c/h2\\u003e \\u003cp\\u003eEnzyme-linked immunosorbent assays (ELISA) were developed with purified SUOX and PYGL proteins. Serum samples from 780 PBC patients and 352 healthy controls were used for antibody detection. Statistical analysis was performed with antibody results and biochemical data from PBC patients.\\u003c/p\\u003e\\u003ch2\\u003eRESULTS\\u003c/h2\\u003e \\u003cp\\u003eAntibodies to SUOX and PYGL were found in 14.23% and 22.94% of PBC patients, but also in 6.53% and 9.37% of healthy controls. There is a significant positive correlation between anti-SUOX and -PYGL with anti-M2, -sp100 and -gp210. Anti-SUOX and -PYGL positivity does not correlate with ursodeoxycholic acid (UDCA) response. Time course analysis found no specific change of anti-SUOX or -PYGL antibody titers in positive patients before and after UDCA treatment.\\u003c/p\\u003e\\u003ch2\\u003eCONCLUSIONS\\u003c/h2\\u003e \\u003cp\\u003eThe data concluded that anti-SUOX and -PYGL autoantibodies are not serological markers in PBC diagnosis due to a lack of sensitivity and specificity. With the existence of PBC specific autoantibodies in PBC diagnosis and treatment, anti-SUOX and -PYGL status in PBC patients have no significant value.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Prevalence and Clinical Significance of Autoantibodies to Sulphite Oxidase and Glycogen Phosphorylase in Chinese Primary Biliary Cholangitis Patients\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-04-10 08:08:41\",\"doi\":\"10.21203/rs.3.rs-6373642/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2025-04-22T11:39:53+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-04-21T14:26:23+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"147201988889497421337922145401198215380\",\"date\":\"2025-04-18T02:23:02+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2025-04-07T10:50:26+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2025-04-05T09:41:12+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2025-04-05T09:38:19+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Molecular Biology Reports\",\"date\":\"2025-04-04T06:11:37+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"molecular-biology-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"mole\",\"sideBox\":\"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)\",\"snPcode\":\"11033\",\"submissionUrl\":\"https://submission.nature.com/new-submission/11033/3\",\"title\":\"Molecular Biology Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"a4939a1e-bfe2-423b-819e-c561fabb1641\",\"owner\":[],\"postedDate\":\"April 10th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-06-16T15:58:48+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-6373642\",\"link\":\"https://doi.org/10.1007/s11033-025-10646-5\",\"journal\":{\"identity\":\"molecular-biology-reports\",\"isVorOnly\":false,\"title\":\"Molecular Biology Reports\"},\"publishedOn\":\"2025-06-14 15:56:53\",\"publishedOnDateReadable\":\"June 14th, 2025\"},\"versionCreatedAt\":\"2025-04-10 08:08:41\",\"video\":\"\",\"vorDoi\":\"10.1007/s11033-025-10646-5\",\"vorDoiUrl\":\"https://doi.org/10.1007/s11033-025-10646-5\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6373642\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6373642\",\"identity\":\"rs-6373642\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}