{"paper_id":"08a1c4e9-ba84-4349-b85a-6ab497c084bf","body_text":"Int J Endocrinol Metab. 2026 October; 24(4): e171933 https://doi.org/10.5812/ijem-171933\nPublished Online: 2026 June 23 Research Article\nCopyright © 2026, Matouri et al. This open-access article is available under the Creative Commons Attribution 4.0 (CC BY 4.0) International License\n(https://creativecommons.org/licenses/by/4.0/), which allows for unrestricted use, distribution, and reproduction in any medium, provided that the original\nwork is properly cited.\nHow to Cite: Matouri M, Koochaki A, Noori Ardebili S, Haji Molla Hoseini M, Saei Ghare Naz M, et al. Inflammatory Markers in Women with Endometriosis\nBefore and After the COVID-19 Pandemic: A Matched Cohort Study from the Tehran Lipid and Glucose Study. Int J Endocrinol Metab. 2026;24(4):e171933. doi:\nhttps://doi.org/10.5812/ijem-171933\nInflammatory Markers in Women with Endometriosis Before and After\nthe COVID-19 Pandemic: A Matched Cohort Study from the Tehran\nLipid and Glucose Study\nMaryam Matouri \n 1 , Ameneh Koochaki \n 1 , Shahla Noori Ardebili \n 2 , Mostafa Haji Molla Hoseini\n1 , Marzieh Saei Ghare Naz \n 2 , Moein Malekzadeh \n 3 , Maryam Mousavi \n 2 , Fahimeh Ramezani\nTehrani \n 2 , 4 , * , Nariman Mosaffa \n 1 , **\n1 Department of Immunology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran\n2 Reproductive Endocrinology Research Center, Research Institute for Endocrine Molecular Biology, Research Institute for Endocrine Sciences,\nShahid Beheshti University of Medical Sciences, Tehran, Iran\n3 Department of Immunology, Golestan University of Medical Sciences, Gorgan, Iran\n4 Foundation for Research and Education Excellence, Vestavia Hills, Al, USA\n*Corresponding Author: Reproductive Endocrinology Research Center, Research Institute for Endocrine Sciences and Metabolism, Shahid Beheshti University of\nMedical Sciences, Tehran, Iran. Email: fah.tehrani@gmail.com\n**Corresponding Author: Department of Immunology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Email:mosaffanariman88@gmail.com\nReceived:13May, 2026;Revised:20June, 2026;Accepted:21June, 2026\nAbstract\nBackground: Endometriosis (EM) is a common chronic inflammatory disorder affecting women. The coronavirus disease 2019 (COVID-19) pandemic may have\nbeen associated with changes in systemic inflammatory regulation.\nO bjectives: This study aimed to measure and compare serum interleukin-6 (IL-6) levels, mRNA levels of vascular endothelial growth factor (VEGF), C-X-C motif\nchemokine 5 (CXCL5), and substance P (SP), as well as markers of neutrophil extracellular trap formation (NETosis), in patients with EM before and after the\nonset of the COVID-19 pandemic.\nMethods: We used data from the Tehran Lipid and Glucose Study (TLGS). Among 2558 women in the TLGS, 465 had a diagnosis of endometriosis. Of these, 13\nwomen had biobanked samples available from both the pre-pandemic (Phase 6, 2016 - 2018) and post-pandemic (Phase 7, 2021 - 2023) periods and were included\nas matched pairs within the same individuals. The primary exposure was the post-pandemic calendar period; individual COVID-19 infection data were not\ncollected. Real-time PCR was used to quantify the expression of genes associated with SP (TAC1), neurokinin 1 receptor (TACR1), VEGF, and CXCL5 in peripheral\nblood mononuclear cells. Markers of NETosis, including neutrophil elastase (NE), myeloperoxidase (MPO), peptidyl arginine deiminase 4 (PAD4), and matrix\nmetallopeptidase 9 (MMP9), were assessed. Serum IL-6 concentrations were measured by enzyme-linked immunosorbent assay.\nResults: Gene expression analysis showed no significant changes in TAC1, TACR1, VEGF, or CXCL5; all 95% confidence intervals (CIs) included unity, and the\nstudy was underpowered to detect small differences. Evaluation of NETosis-related genes in neutrophils stimulated with patient sera showed no significant\ndifferences in PAD4, MMP9, or MPO expression; however, NE expression was significantly elevated after the pandemic (fold change = 1.5; 95% CI, 1.01 to 2.25; P =\n0.048). Other NETosis markers and IL-6 did not differ significantly (eg, IL-6 median paired difference, +0.58 pg/mL; 95% CI, -0.89 to +2.34 pg/mL; P = 0.750); thus,\nall non-significant results are inconclusive.\nConclusions: A preliminary signal of increased neutrophil elastase expression was observed after the pandemic, whereas other inflammatory and NETosis\nmarkers remained inconclusive. In this small investigation, the relative contributions of COVID-19 infection, vaccination, psychosocial stress, and lifestyle\nchanges could not be disentangled. These hypothesis-generating findings require confirmation in larger, well-characterized cohorts.\nKeyw ords:Endometriosis, COVID-19, Inflammation\n1. Background\nEndometriosis (EM) is an inflammatory disorder with\nan estimated prevalence of 10%–15% among women of\nreproductive age and is characterized by the ectopic\ngrowth of endometrial-like tissue (1). EM causes\ndebilitating symptoms, including chronic pelvic pain,\ndysmenorrhea, and infertility (2). Its pathogenesis\ninvolves complex interactions among immune\ndysfunction, angiogenesis, and neurogenic processes.\nAlthough retrograde menstruation is the primary\nmechanism for the dispersal of endometrial cells,\nsuccessful ectopic implantation requires additional\n\nM atouri M  et al. Brieflands\n2 Int J Endocrinol Metab. 2026; 24(4): e171933\nfactors, including angiogenesis, lymphangiogenesis,\nand neurogenesis (3).\nInterleukin-6 (IL-6) enhances angiogenesis and pain\nsignaling, whereas interleukin-1 beta (IL-1 β ) stimulates\nthe production of inflammatory factors involved in\nneuroangiogenesis (4). Tumor necrosis factor alpha\n(TNF- α ) and IL-6 increase the secretion of vascular\nendothelial growth factor (VEGF) from immune cells,\nthereby enhancing angiogenesis, which is essential for\nlesion survival. Chemokines also contribute\nsubstantially to disease pathogenesis by inducing pain\nand recruiting neutrophils to inflammatory sites during\nthe early stages of lesion formation (4).\nNeuropeptides are crucial in the pathophysiology of\nEM, particularly in pain mechanisms and disease\nprogression. Calcitonin gene-related peptide (CGRP) and\nsubstance P (SP) are key mediators that, via their\nreceptors, neurokinin 1 receptor (NK1R), calcitonin\nreceptor-like receptor (CRLR), and receptor activity-\nmodifying protein 1 (RAMP-1), accelerate the\ndevelopment and fibrogenesis of EM by inducing\nepithelial–mesenchymal transition and promoting\nfibroblast differentiation into myofibroblasts (5).\nRecently, Velho et al. reported that endometriotic\nlesions show increased innervation, with higher nerve\nfiber density and elevated SP expression compared with\ncontrol tissues (6).\nRecent research has also identified neutrophil\nextracellular traps (NETs), structures formed when\nneutrophils release decondensed chromatin and\ngranular proteins to trap pathogens, as key molecular\nmediators in the pathogenesis of EM (7). Angiogenesis is\nenhanced by these inflammatory mediators, which also\ninteract with sensory neurons to trigger pain signaling,\nsuggesting that they may represent potential\ntherapeutic targets (4, 8).\nThe COVID-19 pandemic has shown that COVID-19\ninfection can trigger severe inflammatory responses\nbeyond the acute illness. This virus induces a cytokine\nstorm characterized by dysregulated immune activation\nand excessive production of pro-inflammatory\ncytokines, particularly IL-6, leading to acute respiratory\ndistress syndrome and multiorgan damage (9). COVID-\n19 infection also promotes excessive NET formation\nthrough NETosis, a major mechanism contributing to\nCOVID-19 disease progression and subsequent chronic\ncomplications (10). Increased NET formation is linked to\nworse clinical outcomes, coagulopathy, and\nimmunothrombosis in patients with COVID-19 (11).\nCOVID-19 infection may exacerbate existing EM\nsymptoms. Recent studies have reported worsening EM\nsymptoms after COVID-19 infection (12, 13). Evidence\nsuggests that COVID-19 can aggravate EM symptoms,\nincluding persistent pelvic pain, menstrual pain,\ndyspareunia, gastrointestinal complaints, profound\nfatigue, and increased stress, anxiety, and depression\n(12).\n2. O bjectives\nGiven the overlapping inflammatory pathways\ninvolved in COVID-19 and EM, we hypothesized that\ncomplications of the COVID-19 pandemic, whether due\nto direct viral infection, increased psychosocial stress, or\nenvironmental changes, could exacerbate the\ninflammatory milieu in individuals with underlying EM.\nThis study compared levels of key inflammatory factors,\nincluding IL-6, VEGF, C-X-C motif chemokine 5 (CXCL5),\nSP, and NETosis markers, in patients with EM before and\nafter the COVID-19 pandemic.\n3. Methods\n3.1. Study Design and Sam ple Collection\nWe conducted a secondary analysis using data from\nthe prospective TLGS cohort to compare inflammatory\nmarkers in women with EM before and after the onset of\nthe COVID-19 pandemic. The TLGS includes multiple\nfollow-up phases. Phase 6, conducted during 2016 - 2018,\nrepresented the pre-pandemic period, and Phase 7, with\nsamples collected after March 2020 and specifically\nduring 2021 - 2023, represented the post-pandemic\nperiod.\nAmong 2558 women in the TLGS, 465 had a diagnosis\nof endometriosis. Of these, only 13 women had\nbiobanked samples available from both Phase 6 and\nPhase 7 and were included as 13 matched pairs from the\nsame individuals. No additional eligible women with\nmatched samples were excluded because of missing\nlaboratory data; therefore, all available eligible pairs\nwere analyzed. Each participant served as her own\ncontrol, constituting a paired repeated-measures\ndesign.\nThe primary exposure was the post-pandemic\ncalendar period (Phase 7, 2021 - 2023), which\nencompassed potential direct viral exposure,\nvaccination, pandemic-related psychosocial stress, and\nassociated lifestyle changes. Individual COVID-19\ninfection status was not an inclusion criterion or an\nexposure variable because such data were not collected\nfor this subcohort. Detailed information on COVID-19\ninfection history, vaccination status, COVID-19 severity,\nlong-COVID symptoms, or quantified pandemic-related\nstress exposure was not available. Consequently, the\n\nM atouri M  et al. Brieflands\nInt J Endocrinol Metab. 2026; 24(4): e171933 3\nTable 1. Characteristics of Women Participating in the Study (N = 13 Matched Pairs) a\nVariables Pre-CO VID-19 Pandem ic (Phase 6) Post-CO VID-19 Pandem ic (Phase 7)\nAge, y 43.42 ± 9.80 46.73 ± 10.45\nBMI, kg/m 2 27.66 ± 5.94 27.67 ± 6.26\nEducation\nIlliterate 8 (61.54) 6 (46.15)\nLess than a high school diploma or diploma 1 (7.69) 1 (7.69)\nAbove diploma 4 (30.77) 6 (46.15)\na Values are expressed as mean ± SD or No. (%). The mean age increased by approximately 3.3 years between phases, whereas BMI remained essentially unchanged (mean\ndifference, +0.01 kg/m2). Because each participant served as her own control, formal paired significance tests for these variables were not performed.\nexposure reflects only the post-pandemic time period\nand cannot be attributed solely to infection with the\nvirus.\nThe diagnosis of EM was based on clinical symptoms\nand transvaginal or abdominal ultrasound findings,\nincluding the presence of endometriomas and/or deep\ninfiltrating endometriosis, with surgical confirmation\nwhere available. Severity was classified according to the\nrevised American Society for Reproductive Medicine\n(rASRM) staging system (stages I - IV); however, complete\nindividual stage data could not be retrieved for all\nparticipants because surgical records were not\nuniformly available. Information on menstrual-cycle\nphase at blood sampling, hormonal therapy, anti-\ninflammatory or analgesic use, prior EM-related surgery,\nand other treatments was not systematically collected\nfor this subcohort and was therefore unavailable.\nBeyond age, body mass index (BMI), and education\n(Table 1), no additional endometriosis-specific clinical\nvariables, such as infertility status or comorbid\ninflammatory conditions, were available.\nAmong potential confounders, age, BMI, and\neducation level were available from the TLGS database.\nData on EM treatment, hormonal medications, surgical\nhistory, menstrual phase, comorbidities, vaccination\nstatus, COVID-19 infection history, and potential\nlaboratory batch effects were not available for this\nsubcohort.\n3.2. Evaluation of SP, NK1R, VEGF, and CXCL5 Expression\nLevels\nPeripheral blood mononuclear cells (PBMCs) were\nused to quantify the expression of the target genes. The\ngene encoding SP is tachykinin precursor 1 (TAC1), and\ntachykinin receptor 1 (TACR1) encodes NK1R.\n3.3. RNA Extraction and Quantitative Polym erase Chain\nReaction\nTotal RNA was isolated by phenol-chloroform\nextraction, quantified by NanoDrop spectrophotometry,\nand reverse-transcribed into complementary DNA\n(cDNA) using a commercial cDNA synthesis kit (Yekta\nTajhiz Azma, Iran), according to the manufacturer's\nprotocol. Quantitative PCR with SYBR Green was\nperformed on an ABI StepOne Plus Real-Time PCR System\n(Thermo Fisher Scientific, USA) under the following\ncycling conditions: 95°C for 10 minutes, followed by 40\ncycles of 95°C for 20 seconds, 60°C for 30 seconds, and\n72°C for 30 seconds. Relative expression was normalized\nagainst glyceraldehyde-3-phosphate dehydrogenase\n(GAPDH). All reactions were performed in duplicate, and\nrelative expression was calculated using the 2- ΔΔ Ct\nmethod.\n3.4. Induction of NETosis\n3.4.1. Isolation of Hum an Neutrophils\nFor this study, multiple samples were collected from\na single eligible donor. Neutrophils were isolated using\na 2-step dextran-Ficoll gradient centrifugation. Giemsa\nstaining was used to assess the purity of isolated\nneutrophils by examining nuclear morphology under a\nlight microscope. The purity of the isolated cells was\ngreater than 95%. Neutrophil viability was assessed by\ntrypan blue exclusion and exceeded 90%.\n3.4.2. Stim ulation of Neutrophils\nNeutrophils were plated at 2 × 106 cells/mL in a 24-\nwell plate and incubated for 1 hour at 37°C under 5% CO2\nto allow adhesion. Then, 400 µL of RPMI culture\nmedium containing 10% fetal bovine serum (FBS) was\nadded to each well. Next, 100 µL of patient serum was\ngently added to each well to avoid disrupting cell\nadhesion. A positive control was included in which\nneutrophils were activated by 100 nM phorbol myristate\n\nM atouri M  et al. Brieflands\n4 Int J Endocrinol Metab. 2026; 24(4): e171933\nTable 2. Primer Sequences Used for the Real-time PCR Assay a\nGenes Forward Reverse\nVEGFA CCCATGGCAGAAGGAGGAG GATGGCTTGAAGATGTACTCG\nTACR1 CCACATCTGTGTGACTGTGC TCATCATTTTGACCACCTTGCG\nTAC1 GACCAGATCAAGGAGGAACTGC CATGTCCAGCATCCCGTTTG\nCXCL5 TGTGCAATTAACAAAGCTACTGC AGGCATCTAAAAAGCTCAGCA\nGAPDH CCACTCCTCCACCTTTGACG CCACCACCCTGTTGCTGTAG\nPAD4 CCATCCTGCTGGTGAACTGT GTCCTTGGGGGTCTTCGTG\nMMP9 GCCACTACTGTGCCTTTGAGTC CCCTCAGAGAATCGCCAGTACT\na Abbreviations: VEGFA, vascular endothelial growth factor A; TACR1, tachykinin receptor 1; TAC1, tachykinin precursor 1; CXCL5, C-X-C motif chemokine 5; GAPDH, glyceraldehyde-\n3-phosphate dehydrogenase; PAD4, peptidyl arginine deiminase 4; MMP9, matrix metallopeptidase 9; NE, neutrophil elastase; MPO, myeloperoxidase.\nacetate (PMA), a known NETosis inducer (14), and a\nnegative control received RPMI alone. Plates were\nincubated at 37°C under 5% CO2 for 2 hours to induce\nNETosis.\n3.4.3. NETosis Form ation Assay\nTo investigate the induction of genes involved in\nNETosis, the expression of 4 key NETosis-related genes,\npeptidyl arginine deiminase 4 (PAD4), matrix\nmetallopeptidase 9 (MMP9), neutrophil elastase (NE),\nand myeloperoxidase (MPO), was assessed using real-\ntime PCR (Table 2), as described for PBMC samples.\n3.5. IL-6 Concentrations\nSerum IL-6 concentrations were determined using a\ncommercial enzyme-linked immunosorbent assay\n(ELISA) kit (IL E-3200, LDN Labor Diagnostika Nord,\nGermany). All assays were performed according to the\nmanufacturer's protocol, and concentrations were\ncalculated based on the provided standard curve.\nTo minimize selection bias, we aimed to include all\npatients with EM from the TLGS who had available\nmatched samples from both study periods.\nMeasurement bias was mitigated by using standardized,\nvalidated laboratory protocols, including quantitative\nPCR (qPCR) and ELISA, for all assays. All laboratory\npersonnel were blinded to the sample phase (pre- or\npost-pandemic) during RNA extraction, qPCR, ELISA, and\nneutrophil stimulation experiments. For both qPCR and\nELISA, paired pre- and post-pandemic samples from the\nsame individual were always assayed simultaneously in\nthe same analytical batch. No formal batch-effect\ncorrection algorithm was applied; paired simultaneous\nassaying was used as the primary strategy to reduce\nsystematic batch effects.\nAll blood samples were processed within 2 hours of\ncollection, and serum aliquots were stored at -80°C.\nPhase 6 samples (2016 - 2018) had a longer storage\nduration than Phase 7 samples (2021 - 2023), but no\nadditional freeze-thaw cycles were applied beyond the\ninitial aliquoting.\n3.6. Ethical Approval\nAll TLGS participants provided written informed\nconsent at enrollment for the collection, biobanking,\nand future research use of their samples, including this\nsecondary analysis. Ethical approval was obtained from\nthe Ethics Committee of Shahid Beheshti University of\nMedical Sciences (code:\nIR.SBMU.ENDOCRINE.REC.1403.015). All procedures were\nperformed in accordance with the committee's\nguidelines.\n3.7. Statistical Analysis\nNormality of the data distribution was assessed\nusing the Shapiro-Wilk test. Given the non-normal\ndistribution of gene-expression data, group\ncomparisons were performed using the Wilcoxon test.\nContinuous variables are presented as the median and\ninterquartile range (IQR). No adjustment for potential\nconfounders, such as age, BMI, or batch effects, was\nperformed in the primary analysis because the limited\nsample size precluded multivariable modeling, and\nformal sensitivity analyses were not feasible given the\nnon-normal distributions and small number of pairs.\nThe likely direction of residual confounding is\nuncertain.\nBecause of the small sample size, no formal power\ncalculation was performed. To provide a precision\ncontext, we estimated that with 13 pairs, a Wilcoxon\nsigned-rank test (2-sided α  = 0.05) achieves 80% power to\ndetect a standardized effect size, defined as the median\nof paired differences divided by their standard\ndeviation, of approximately 1.1 or larger, assuming a\n\nM atouri M  et al. Brieflands\nInt J Endocrinol Metab. 2026; 24(4): e171933 5\nFigure 1. Relative expression of TAC1, TACR1, VEGFA, and CXCL5 genes in peripheral blood samples collected before (Phase 6, pre-pandemic) and after (Phase 7, post-pandemic) the\nCOVID-19 pandemic. Gene expression was quantified by real-time PCR; values are normalized relative expression values (2- Δ Ct, scaled per gene). No statistically significant\ndifferences were observed: TAC1 (fold change = 1.12; 95% CI, 0.81 - 1.55; P = 0.375), TACR1 (fold change = 1.02; 95% CI, 0.75 - 1.39; P = 0.786), VEGFA (fold change = 1.03; 95% CI, 0.72 - 1.48; P\n= 0.414), and CXCL5 (fold change = 0.74; 95% CI, 0.45 - 1.20; P = 0.635). Because of the small sample size, these results do not rule out true differences. Each row represents an\nindividual sample; paired samples are not linked in this display.\nmoderate-to-strong correlation between paired\nobservations. This corresponds to a fold change of\napproximately 2.0 or greater in genes with typical pre-\npandemic interindividual variability observed in our\ndata. Observed fold changes considerably smaller than\nthis, such as those for TAC1 (1.12), VEGFA (1.03), and MPO\n(1.02), should therefore be interpreted with caution.\nBecause of the exploratory nature of the study, no\nformal correction for multiple testing, such as\nBonferroni correction, was applied; all P values are\ndescriptive and hypothesis-generating.\nData were analyzed for completeness, and no missing\nvalues were present for the laboratory variables\nmeasured in this subset. All analyses were conducted\nusing GraphPad Prism version 10 and SPSS version 20,\nwith a 2-sided P value < 0.05 considered statistically\nsignificant.\nThis study was reported in accordance with the\nStrengthening the Reporting of Observational Studies in\nEpidemiology (STROBE) guidelines for cohort studies\n(15) and its explanation and elaboration document (16).\n4. Results\n4.1. Dem ographic Characteristics\nThe baseline characteristics of the 13 matched\nwomen are presented in Table 1. The mean age increased\nby approximately 3.3 years, from 43.4 to 46.7 years,\nbetween phases, whereas BMI remained essentially\nunchanged (mean difference, +0.01 kg/m2). Because\neach participant served as her own control, formal\npaired significance tests for these variables were not\nperformed.\n\nM atouri M  et al. Brieflands\n6 Int J Endocrinol Metab. 2026; 24(4): e171933\nFigure 2. Expression of NETosis-related genes in neutrophils stimulated with sera from individuals with endometriosis before (Phase 6, pre-pandemic) and after (Phase 7, post-\npandemic) the COVID-19 pandemic. Values are normalized relative expression values (2- Δ Ct, scaled per gene). PAD4 (fold change = 1.23; 95% CI, 0.76 - 2.00; P = 0.921), MMP9 (fold\nchange = 1.40; 95% CI, 0.93 - 2.12; P = 0.084), and MPO (fold change = 1.02; 95% CI, 0.68 - 1.53; P = 0.695) did not differ significantly; however, the study had low power for changes <\n2.0. NE was significantly elevated (fold change = 1.50; 95% CI, 1.01 - 2.25; P = 0.048), but borderline significance warrants caution. Each row represents an individual sample; paired\nsamples are not linked.\n4.2. Expression Levels of SP, NK1R, VEGF, and CXCL5\nTo examine changes in the expression of TAC1 (SP),\nTACR1 (NK1R), VEGF, and CXCL5 after the COVID-19\npandemic, 13 samples from TLGS Phase 6 (pre-pandemic)\nand Phase 7 (post-pandemic) were analyzed using real-\ntime PCR (Figure 1). No statistically significant\ndifferences were detected for any of these genes;\nhowever, the small sample size does not exclude true\ndifferences (all P > 0.05). Specifically, TAC1 showed a fold\nchange of 1.12 (95% CI, 0.81 - 1.55; P = 0.375), TACR1 showed\na fold change of 1.02 (95% CI, 0.75 - 1.39; P = 0.786), VEGFA\nshowed a fold change of 1.03 (95% CI, 0.72 - 1.48; P =\n0.414), and CXCL5 showed a fold change of 0.74 (95% CI,\n0.45 - 1.20; P = 0.635). These findings are inconclusive.\n4.3. NETosis-Related Gene Expression\nTo assess NETosis induction by serum from patients\nwith EM after the COVID-19 pandemic, serum samples\nfrom TLGS Phases 6 and 7 were used to stimulate\nneutrophils. The expression of NETosis-related genes,\nincluding PAD4, MMP9, MPO, and NE, was then\nevaluated (Figure 2). No significant differences were\nobserved for PAD4 (fold change = 1.23; 95% CI, 0.76 - 2.00;\nP = 0.921), MMP9 (fold change = 1.40; 95% CI, 0.93 - 2.12; P\n= 0.084), or MPO (fold change = 1.02; 95% CI, 0.68 - 1.53; P\n= 0.695). The study had low power to detect fold changes\n< 2.0; therefore, these non-significant results are\ninconclusive. In contrast, NE expression was\nsignificantly elevated in neutrophils stimulated with\npost-pandemic serum (fold change = 1.50; 95% CI, 1.01 -\n\nM atouri M  et al. Brieflands\nInt J Endocrinol Metab. 2026; 24(4): e171933 7\nFigure 3. IL-6 concentrations (pg/mL) in serum samples collected before and after the COVID-19 pandemic. The median paired increase was +0.58 pg/mL (95% CI, -0.89 to +2.34\npg/mL; P = 0.750). The difference was not statistically significant, but the confidence interval does not rule out a meaningful change. ns, not significant.\n2.25; P = 0.048). This borderline significance should be\ninterpreted cautiously given the small sample size and\nthe multiplicity of tests.\n4.4. Serum  IL-6 Levels\nSerum IL-6 levels were numerically higher in Phase 7\nthan in Phase 6, but the difference was not statistically\nsignificant (median paired increase, +0.58 pg/mL; 95% CI\nfor the median paired difference, -0.89 to +2.34 pg/mL; P\n= 0.750). The wide confidence interval does not exclude\na clinically meaningful change; therefore, this finding is\ninconclusive (Figure 3).\n5. Discussion\nThis study examined inflammatory markers in\nwomen with EM before and after the COVID-19 pandemic\nto assess the impact of the pandemic period on the\ninflammatory profile. Comparison of the pre- and post-\npandemic periods revealed a selective increase in\nneutrophil elastase expression, whereas results for\nother NETosis markers and IL-6 remained inconclusive.\nThe observed change in NE may reflect composite\nexposures during the pandemic period, including\npossible undiagnosed or mild COVID-19 infections,\nchronic stress, or lifestyle alterations, rather than\nconfirmed infection alone.\nThe COVID-19 pandemic substantially affected\nwomen with EM through multiple pathways involving\npsychological stress and lifestyle changes. Studies have\nshown that pandemic-related stress led to worsening\nEM symptoms, with patients reporting increased pelvic\npain, heavy menstrual bleeding, and dysmenorrhea (12).\nWomen experienced high levels of peritraumatic stress\nand substantial lifestyle modifications, including\ndecreased physical activity and disturbed sleep patterns.\nThe underlying mechanism involves activation of the\nsympathetic nervous system by psychological stress and\nincreased cortisol levels, which contribute to\nheightened inflammation and pain sensitivity (17). In\naddition, anxiety and depression, which became more\nprevalent during the pandemic, can lower pain\ntolerance and intensify patients’ subjective experience\nof symptom severity (18). These findings underscore the\nimportance of a multidimensional approach to EM\nmanagement, including psychological interventions\n\nM atouri M  et al. Brieflands\n8 Int J Endocrinol Metab. 2026; 24(4): e171933\nand lifestyle modifications alongside pharmacological\nand surgical treatments.\nThe most notable finding was increased expression\nof NETosis-related genes in neutrophils stimulated with\npost-pandemic patient serum, with NE showing a\nsignificant increase (P = 0.048). These findings indicate a\nshift toward heightened neutrophil activity in the post-\npandemic period. These changes could be attributed to\npandemic-related environmental factors, such as\nchronic psychosocial stress. Chronic stress alters\nneutrophil function and, through the release of\nglucocorticoids, enhances NET formation (19). Moreover,\nchronic stress can disrupt anti-inflammatory signaling\nand reduce the ability of glucocorticoids to suppress\npro-inflammatory cytokine production. In contrast,\nother factors, including NK1R, VEGF, and CXCL5, showed\nno significant differences, suggesting a selective impact\non neutrophil-associated pathways.\nHowever, the observed increase in NE expression may\nalso be partially confounded by age, as participants\nwere, on average, 3.3 years older in Phase 7; age-related\nimmune changes can influence neutrophil activity.\nWithout adjusted analyses, we cannot separate\npandemic-era effects from aging. Therefore, the\nobserved neutrophil activation could stem from\nmultiple pandemic-related influences rather than\nconfirmed infection alone. Patients with EM, because of\ntheir underlying chronic inflammation, may be\nparticularly vulnerable to pandemic-related stimuli,\nwhether viral or non-viral, that activate neutrophils.\nThis could have implications for the disease course and\nmanagement. Because multiple biomarkers were\nevaluated and only NE reached borderline significance\n(P = 0.048), this finding may represent a chance finding\ndue to multiple comparisons and should be interpreted\nas exploratory until replicated in larger, independent\ncohorts.\nAlthough serum IL-6 levels were numerically higher\nafter the pandemic, this increase was not statistically\nsignificant (P = 0.750), and the wide confidence interval\ndoes not exclude a clinically meaningful difference. This\nfinding is inconclusive. As a pivotal pro-inflammatory\ncytokine, IL-6 is known to play a central role in the\npathogenesis of EM by promoting angiogenesis, pain\nsignaling, and lesion survival. Future studies with larger\nsample sizes are needed to clarify the role of IL-6.\nIn summary, our data provide preliminary,\nhypothesis-generating evidence that the post-pandemic\nperiod may be associated with increased neutrophil\nelastase expression in women with EM. Confirmation in\nlarger, well-characterized cohorts is required.\n5.1. Lim itations and Conclusions\nThis study has several limitations. The small sample\nsize of 13 matched pairs limits the generalizability of the\nresults and the statistical power to detect differences\nsmaller than approximately 2-fold. Consequently, all\nnon-significant comparisons should be considered\ninconclusive rather than evidence of no change. The\nborderline significance of NE (P = 0.048) should be\ninterpreted with caution given the multiplicity of tests\nperformed and the small sample size. Although\nmeasuring NETosis-related genes in blood provides\nevidence of activation, it does not directly demonstrate\nNET presence in endometriotic lesions. Therefore, future\nimmunohistochemistry or immunofluorescence\nstudies on patient tissue samples are recommended to\nquantify NETosis using specific markers, such as\ncitrullinated histone H3 (CitH3). Future studies should\nalso confirm increased inflammatory marker gene\nexpression in the study groups using other tests, such as\nELISA.\nIt remains challenging to distinguish direct\nconsequences of COVID-19 infection from indirect\npandemic-related effects, such as stress and lifestyle\nchanges, on the observed increase in NETosis. Detailed\nindividual-level data on COVID-19 infection history,\nvaccination status, and pandemic-related stress\nexposure were not available; therefore, exposure reflects\nonly the post-pandemic time period and cannot be\nascribed solely to infection with the virus. The findings\nshould be interpreted in the context of these\nlimitations. Future larger, multicenter studies in diverse\npopulations are needed to confirm these preliminary\nobservations.\nThis exploratory study identified a preliminary signal\nof increased neutrophil elastase expression in women\nwith EM during the post-pandemic period, whereas\nother inflammatory and NETosis markers remained\ninconclusive. The relative contributions of COVID-19\ninfection, vaccination, psychosocial stress, and aging\ncannot be disentangled in this small investigation.\nThese hypothesis-generating findings underscore the\nneed for larger, well-characterized studies that collect\nindividual-level exposure data and account for potential\nconfounders.\nFootnotes\nAI U se Disclosure: The authors declare that no\ngenerative AI tools were used in the creation of this\narticle.\n\nM atouri M  et al. Brieflands\nInt J Endocrinol Metab. 2026; 24(4): e171933 9\nAuthors' Contribution: Proposal design/manuscript\ndrafting, sample collection, laboratory execution,\nstatistical arrangements, and findings review: Maryam\nM.; Proposal supervision/manuscript editing: N. M.;\nClinical design/implementation and clinical data\nsupervision: F. R. T.; Laparoscopic procedures and\nsample transfer: Sh. N. A.; Immunology consultation and\nresearch-plan validation: M. H. M. H. and Moein M.;\nMolecular laboratory design, primer design, test\ncalibration, and methods editing: A. K.; Patient\nforms/questionnaires and control group selection: M. S.\nGh. N.; Statistical test assignment: Maryam M.\nConflict of Interests Statem ent: The authors do not\ndeclare any conflicts of interests for this study.\nData Availability: The dataset presented in the study\nis available on request from the corresponding author\nduring submission or after publication.\nEthical Approval: Ethical approval was obtained from\nthe Ethics Committee of the Shahid Beheshti University\nof Medical Science (Ethics number:\nIR.SBMU.ENDOCRINE.REC.1403.015)\nFunding/Support: No funding was received for this\nstudy.\nInform ed Consent: All TLGS participants provided\nwritten informed consent at enrollment for the\ncollection, biobanking, and future research use of their\nsamples, including this secondary analysis.\nReferences\n1. Ahn SH, Monsanto SP, Miller C, Singh SS, Thomas R, Tayade C.\nPathophysiology and Immune Dysfunction in Endometriosis. Biom ed\nRes Int. 2015;2015:795976-12. [PubMed ID: 26247027]. [PubMed Central\nID: PMC4515278]. https://doi.org/10.1155/2015/795976.\n2. Velho RV, Taube E, Sehouli J, Mechsner S. Neurogenic inflammation in\nthe context of endometriosis-what do we know? International\njournal of molecular sciences. International Journal of M olecular\nSciences. 2021;22(23):13102. [PubMed ID: 34884907]. [PubMed Central\nID: PMC8658724]. https://doi.org/10.3390/ijms222313102.\n3. Hey-Cunningham AJ, Peters KM, Zevallos HB, Berbic M, Markham R,\nFraser IS. Angiogenesis, lymphangiogenesis and neurogenesis in\nendometriosis. Front Biosci (Elite Ed). 2013;5(3). E682. [PubMed ID:\n23747918]. https://doi.org/10.2741/E682.\n4. Machairiotis N, Vasilakaki S, Thomakos N. Inflammatory Mediators\nand Pain in Endometriosis: A Systematic Review. Biom edicines.\n2021;9(1):54. [PubMed ID: 33435569]. [PubMed Central ID:\nPMC7826862]. https://doi.org/10.3390/biomedicines9010054.\n5. Yan D, Liu X, Guo SW. Neuropeptides Substance P and Calcitonin\nGene Related Peptide Accelerate the Development and Fibrogenesis\nof Endometriosis. Sci Rep. 2019;9(1). 2698. [PubMed ID: 30804432].\n[PubMed Central ID: PMC6389969]. https://doi.org/10.1038/s41598-\n019-39170-w.\n6. Velho RV, Sehouli J, Mechsner S. Mechanisms of peripheral\nsensitization in endometriosis patients with peritoneal lesions and\nacyclical pain. Arch Gynecol Obstet. 2023;308(4):1327-40. [PubMed ID:\n37405438]. [PubMed Central ID: PMC10435658].\nhttps://doi.org/10.1007/s00404-023-07110-9.\n7. Berkes E, Oehmke F, Tinneberg HR, Preissner KT, Saffarzadeh M.\nAssociation of neutrophil extracellular traps with endometriosis-\nrelated chronic inflammation. Eur J Obstet Gynecol Reprod Biol.\n2014;183:193-200. [PubMed ID: 25461378].\nhttps://doi.org/10.1016/j.ejogrb.2014.10.040.\n8. Nothnick W, Alali Z. Recent advances in the understanding of\nendometriosis: the role of inflammatory mediators in disease\npathogenesis and treatment. F1000Res. 2016;5:186. [PubMed ID:\n26949527]. [PubMed Central ID: PMC4760268].\nhttps://doi.org/10.12688/f1000research.7504.1.\n9. Sahoo OS, Pethusamy K, Nayek A, Minocha R, Dhar R, Karmakar S.\nParadigm of immune dysregulation in coronavirus disease-2019\ninfection. Exploration of Im m unology. 2024;4(1):1-33.\nhttps://doi.org/10.37349/ei.2024.00126.\n10. Monsalve DM, Acosta-Ampudia Y, Acosta NG, Celis-Andrade M, Şahin\nA, Yilmaz AM, et al. NETosis: A key player in autoimmunity, COVID-19,\nand long COVID. J Transl Autoim m un. 2025;10. 100280. [PubMed ID:\n40071133]. [PubMed Central ID: PMC11894324].\nhttps://doi.org/10.1016/j.jtauto.2025.100280.\n11. Sharma V, Aden D, Zaheer S, Ranga S. The role of the formation of\nneutrophil extracellular traps (NETosis) in the pathophysiology and\nthe complications of COVID-19: A review of the literature. Saudi\nJournal for Health Sciences. 2023;12(2):91-113. [PubMed ID: 38197748].\n[PubMed Central ID: PMC10789533].\nhttps://doi.org/10.4103/sjhs.sjhs_65_23.\n12. Kabani Z, Ramos-Nino ME, Ramdass PVAK. Endometriosis and COVID-\n19: A Systematic Review and Meta-Analysis. Int J M ol Sci.\n2022;23(21):12951. [PubMed ID: 36361745]. [PubMed Central ID:\nPMC9657778]. https://doi.org/10.3390/ijms232112951.\n13. Nicolás I, Martínez-Zamora MÁ, Gracia M, Feixas G, Rius M, Carmona\nF. Impact of SARS-COV2 Pandemic on Patients with Endometriosis\nand Their Health Care. J W om ens Health (Larchm t). 2022;31(4):480-6.\n[PubMed ID: 35148487]. https://doi.org/10.1089/jwh.2021.0323.\n14. Hoppenbrouwers T, Autar ASA, Sultan AR, Abraham TE, van Cappellen\nWA, Houtsmuller AB, et al. in vitro induction of NETosis:\nComprehensive live imaging comparison and systematic review.\nPLOS ONE. 2017;12(5). e0176472. [PubMed ID: 28486563]. [PubMed\nCentral ID: PMC5423591]. https://doi.org/10.1371/journal.pone.0176472.\n15. von Elm E, Altman DG, Egger M, Pocock SJ, Gøtzsche PC,\nVandenbroucke JP. The Strengthening the Reporting of\nObservational Studies in Epidemiology (STROBE) statement:\nguidelines for reporting observational studies. J Clin Epidem iol.\n2008;61(4):344-9. [PubMed ID: 18313558].\nhttps://doi.org/10.1016/j.jclinepi.2007.11.008.\n16. Vandenbroucke JP, von Elm E, Altman DG, Gøtzsche PC, Mulrow CD,\nPocock SJ, et al. Strengthening the Reporting of Observational\nStudies in Epidemiology (STROBE): explanation and elaboration. PLoS\nM ed. 2007;4(10). e297. [PubMed ID: 18049195].\nhttps://doi.org/10.1097/EDE.0b013e3181577511.\n17. Miller GE, Cohen S, Ritchey AK. Chronic psychological stress and the\nregulation of pro-inflammatory cytokines: a glucocorticoid-\nresistance model. Health Psychol. 2002;21(6):531-41. [PubMed ID:\n12433005]. https://doi.org/10.1037/0278-6133.21.6.531.\n18. Black PH. Stress and the inflammatory response: a review of\nneurogenic inflammation. Brain Behav Im m un. 2002;16(6):622-53.\n[PubMed ID: 12480495]. https://doi.org/10.1016/S0889-1591(02)00021-1.\n19. He XY, Gao Y, Ng D, Michalopoulou E, George S, Adrover JM, et al.\nChronic stress increases metastasis via neutrophil-mediated changes\nto the microenvironment. Cancer cell. 2024;42(3):474-486.e12.\n\nM atouri M  et al. Brieflands\n10 Int J Endocrinol Metab. 2026; 24(4): e171933\n[PubMed ID: 38402610]. [PubMed Central ID: PMC11300849].\nhttps://doi.org/10.1016/j.ccell.2024.01.013.","source_license":"CC0","license_restricted":false}