{"paper_id":"083d429a-c029-44eb-a13f-e02a606b0c7e","body_text":"1\n1 Development of a floxed Gabbr2 gene allows for widespread conditional disruption of \n2 GABBR2 and recapitulates the phenotype of germline Gabbr2 knockout mice.  \n3\n4 Julie R. Hens1*, Stacey Brown1, Pawel Licznerski1, Jacqueline Suarez1, Elizabeth Jonas1, and \n5 John J. Wysolmerski1.\n6\n7 1Department of Internal Medicine, Endocrinology and Metabolism Section, Yale University, \n8 New Haven, Connecticut, United States of America.\n9\n10 * Corresponding author\n11\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n2\n12 ABSTRACT\n13 GABBR1 and GABBR2 are widely expressed in the brain and genetic inhibition of their \n14 function leads to widespread neurologic dysfunction and premature death in mice.    Given \n15 that GABBR1 and GABBR2 heterodimerize to form a functional receptor, global knockout of \n16 GABBR1 or GABBR2 results in a similar phenotype, characterized by spontaneous \n17 epileptiform activity, hyperlocomotor activity, hyperalgesia, impaired memory and \n18 premature death. It is now known that both GABBR1 and GABBR2 are expressed in a \n19 variety of tissues outside the nervous system and that GABA-B receptors can \n20 heterodimerize with other class C GPCRs, including the extracellular calcium-sensing \n21 receptor (CaSR). Studies in vitro have demonstrated that interactions with GABBR1 and \n22 GABBR2 can alter CaSR signaling in human embryonic kidney cells and breast cancer cells. \n23 The neurologic consequences of global loss of function of GABBR1 or GABBR2 has made it \n24 difficult to study the effects of loss of GABBR function in other organs.  While a conditional \n25 knockout for GABBR1 is available, the GABBR2 gene had not been “floxed”.  We have used \n26 CRISPR to insert loxP sites into the GABBR2 locus in mice.  These mice are normal at \n27 baseline but when bred with mice expressing Cre-recombinase under the control of the \n28 ubiquitously expressed Actin gene promoter, they recapitulate the phenotype of global \n29 GABBR2 knockout mice. Phenotypic changes through the brain, including the cortex, \n30 hippocampus and cerebellum. Evidence of abnormal neuronal function, increase cell death, \n31 and changes in neuronal architecture are seen throughout the brain of CRISPR knockout \n32 mice. These mice should be useful tools to study cell type-specific loss of GABBR2 function \n33 in the brain and other organs.\n34\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n3\n35 INTRODUCTION\n36 The GABA-B receptors (GABBR1 and GABBR2) are class C, G-protein-coupled \n37 receptors (GPCRs) that heterodimerize to form a receptor complex responding to gamma-\n38 aminobutyric acid (gaba), the major inhibitory neurotransmitter in the brain.  The GABBR1 \n39 subunit contains the gaba-binding site, whereas the GABBR2 subunit is responsible for \n40 interacting with G-proteins.  Furthermore, GABBR1 contains an endoplasmic reticulum \n41 (ER) retention site, which prevents its trafficking to the plasma membrane.  However, \n42 heterodimerization with GABBR2 allows interactions between the coiled-coil sequences of \n43 each subunit, masking the ER retention site in GABBR1, and allowing translocation of the \n44 heterodimeric complex to the plasma membrane.   Most commonly, the heterodimeric \n45 receptor couples to Gi or Go, leading to inhibition of adenylate cyclase activity, inositol \n46 triphosphate synthesis, voltage-gated calcium channels, and potassium channels (1, 2).  As \n47 a result, GABABRs hyperpolarize neurons and inhibit the release of several \n48 neurotransmitters, resulting in the suppression of neuronal activity in many brain areas.\n49 GABBR1 and GABBR2 are widely expressed in the brain and genetic inhibition of \n50 their function leads to widespread neurologic dysfunction and premature death in mice.    \n51 Given that GABBR1 and GABBR2 heterodimerize to form a functional receptor, global \n52 knockout of GABBR1 or GABBR2 results in a similar phenotype, characterized by \n53 spontaneous epileptiform activity, hyperlocomotor activity, hyperalgesia, impaired \n54 memory and premature death (3).  As these results demonstrate, GABA-B receptors clearly \n55 have important functions in the brain.  However, it is now known that both GABBR1 and \n56 GABBR2 are expressed in a variety of tissues outside the nervous system (3-6). \n57 Furthermore, it has been shown that the GABA-B receptors can heterodimerize with other \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n4\n58 class C GPCRs, including the extracellular calcium-sensing receptor (CaSR)(7, 8). Studies in \n59 vitro have demonstrated that interactions with GABBR1 and GABBR2 can alter CaSR \n60 signaling in human embryonic kidney (HEK) cells and breast cancer cells (5, 9). \n61 Furthermore, the CASR and GABBR1 interact in chondrocytes in the growth plate and in \n62 parathyroid cells in vivo (4).  Recent studies have demonstrated that heterodimerization of \n63 GABBR1 and the CaSR in the parathyroid glands modulates calcium-mediated PTH \n64 secretion and systemic calcium metabolism (10), demonstrating that GABBR’s can regulate \n65 signaling from other receptors.\n66 The neurologic consequences of global loss of function of GABBR1 or GABBR2 has \n67 made it difficult to study the effects of loss of GABBR function in other organs.  While a \n68 conditional knockout for GABBR1 is available, the GABBR2 gene had not been “floxed”.  \n69 Therefore, to study the interactions between the CaSR and GABBR2 in organs other than \n70 the brain, we have used gene editing techniques to insert loxP sites into the GABBR2 locus \n71 in mice.  These mice are normal at baseline but when crossed with mice expressing Cre-\n72 recombinase under the control of the ubiquitously expressed Actin gene promoter, they \n73 recapitulate the phenotype of global GABBR2 knockout mice.  These mice should be useful \n74 tools to study cell type-specific loss of GABBR2 function in the brain and other organs.\n75\n76\n77 METHODS\n78 Generation and breeding of Gabbr2 cKO Mice \n79 The GABBR2 cKO mouse model was generated via CRISPR-Cas9 genome editing (11, 12) \n80 (13).  Potential Cas9 target guide (protospacer) sequences in introns 9 and 10 were \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n5\n81 screened using the online tool CRISPOR http://crispor.tefor.net (14) and candidates were \n82 selected.  Templates for sgRNA synthesis were generated by PCR, sgRNAs were transcribed \n83 in vitro and purified (Megashortscript, MegaClear; ThermoFisher).  sgRNA/Cas9 RNPs were \n84 complexed and tested for activity by zygote electroporation, incubation of embryos to \n85 blastocyst stage, and genotype scoring of indel creation at the target sites.  The sgRNAs that \n86 demonstrated the highest activity were selected for creating the floxed allele.  Guide RNA \n87 (gRNA) sequences are as follows: intron 9, 5’ guide:  ACTAGATCCTCTCACCCAGT and intron \n88 10, 3’ guide CTGCCATGCTGTGACCCCAT.  Accordingly, a 615 base long single-stranded DNA \n89 (lssDNA) recombination template incorporating the 5’ and 3’ loxP sites was synthesized \n90 (IDT).   The C57Bl6 3 SJL F2 or FVB/NJ zygote embryos were transferred to the oviducts of \n91 pseudopregnant CD-1 foster females using standard techniques(13, 15). Genotype \n92 screening of tissue biopsies from founder pups was performed by PCR amplification and \n93 Sanger sequencing to verify the floxed allele.  Germline transmission of the correctly \n94 targeted allele (i.e., both loxP sites in cis) was confirmed by breeding and sequence analysis.  \n95 Seven potential founders with a floxed Gabbr2 gene were identified, and three (#33, #14, \n96 #19) true-breeding FVB lines were generated. We also generated two true-breeding lines \n97 on a C57bl/6 mouse background.  The studies described herein were performed on animals \n98 derived from lines 33 and 19. The two lines were maintained separately, but because of \n99 their similar biochemical phenotypes, data from the two lines have been pooled except \n100 where indicated. \n101 We crossed GabbR2 lox/lox mice with B6.FVB-Tmem163Tg(ACTB-cre)2Mrt/EmsJ (Actin-cre) to \n102 verify the effectiveness of the CRISPR-generated lox sites on GabbR2. The resulting \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n6\n103 offspring were then crossed again to GABBR2 lox/lox mice (control) to generate Actin-Cre/ \n104 GABBR2 lox/lox mice (cKO).    \n105 All studies described in this manuscript were performed on animals between the \n106 ages of 3 and 15 weeks unless specifically indicated. All procedures were per Yale \n107 University Animal Care and Use Committee and U.S. National Institutes of Health standards.\n108\n109 RNA and protein analysis\n110 Brains from 3-week-old mice were removed and total RNA was isolated. One g of \n111 RNA was converted to cDNA using Applied Biosystems high-capacity cDNA reverse \n112 transcription kit (Thermo Fisher Scientific, Waltham, MA).  Taqman probes were used to \n113 measure GABBR1(Mm00444578_m1), GABBR2(Mm01352554_m1), CASR \n114 (Mm00443375_m1), and GAPDH (#4352339E) (Thermo Fisher Scientific, Waltham, MA). \n115 Real-time PCR was performed using TaqMan TM Fast Universal PCR Master Mix reagents \n116 (Thermo Fisher Scientific, Waltham, MA) and Applied Biosystems StepOne Plus Real-Time \n117 PCR System.  Ct values were analyzed using the ΔΔ – Ct method (16). \n118 For protein isolation, half the brain cut in the coronal mid-line was added to 1 ml of \n119 RIPA buffer (50 mM Tris HCl pH 8, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, \n120 0.1% SDS) with complete mini protease inhibitors (Roche Diagnostics, Mannheim, \n121 Germany). Using a TissueLyser II (Qiagen, Germantown, MD) with a 5 mm bead, tissue was \n122 lysed for 2 minutes at 30 rotations per second.  Lysates were incubated on ice for an hour, \n123 before being centrifuged at 12,000 g, for 20 minutes. Thirty micrograms of protein were \n124 loaded in a well. Samples were not heated, and after the transfer, blots were blocked for 1 \n125 hour in 5% milk with 0.1 % Tween-20. Primary antibodies were added at 1/1000 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n7\n126 overnight at 40C while rocking. Blots were washed with PBS, and then goat-anti rabbit or \n127 goat-anti mouse secondary antibody was added for an hour, samples were washed in PBS. \n128 Blots were imaged using Odyssey Li-Cor system.  Results were normalized to actin.\n129 We used antibodies to Gabbr1 (#ab55051, Abcam, Waltham, MA), Gabbr2 \n130 (#ab181736, Abcam, Waltham, MA), Casr (#ACR-004, Alomone, Limerick, PA), actin \n131 (#MA5-11869, Invitrogen, Rockford Illinois) ,  IRDye® 800CW Goat anti-Mouse IgG (H + L) \n132 (Li-Cor, Lincoln, Nebraska)  IRDye®, 680RD Goat anti-Rabbit IgG Secondary Antibody (Li-\n133 Cor, Lincoln, Nebraska)\n134\n135 Histology \n136 Brains were paraffin-embedded and 5-micron sections were acquired. Sections \n137 were stained with hematoxylin and eosin, Luxol fast (17), or immunohistochemistry was \n138 performed with S100 antibody to examine changes in myelination in the central nervous \n139 system. Embedding and staining of mice brain tissue was done through Yale Pathology \n140 Tissue services. \n141\n142 Motor agility\n143 To examine motor changes in cKO compared to control mice, we assessed rotarod \n144 performance. Mice were trained to stay on the rotarod (AccuScan Instruments) (12 rpm) \n145 for 300 sec over two separate sessions the day before the experiment. During the test day, \n146 the length of time each mouse remained on the cylinder (“endurance time”; a maximal \n147 score of 300 sec) was measured immediately before (time 0) and 1, 2, and 4 hours after the \n148 application of L-baclofen (12.5 mg/kg) or vehicle (saline). The dose of baclofen that \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n8\n149 showed maximal effects on rotarod performance was determined in previous studies (3, \n150 18). \n151  \n152 Behavioral experiments \n153 We examined hyperactivity and unsupported rearing to analyze activity in the mice. \n154 Male cKO mice between 6 and 8 weeks of age were used for all experiments. Before \n155 behavioral testing, the investigator individually handled mice (3 times over 72 hours \n156 before the test day) to decrease anxiety. Next, mice were placed in a new, empty home cage \n157 where unsupported rearing and locomotor activity were monitored for 10-minute sessions, \n158 video recorded, and the last 5 minutes were scored manually. Unsupported rearing was \n159 defined as rearing without any contact with the walls of the test cage. The investigator was \n160 blinded as to the genetic variant during scoring.\n161\n162 Statistical analysis  \n163 Data are presented as mean± standard error (SE). Comparisons between two groups \n164 were conducted using Student's unpaired two-tailed t-tests. Where appropriate, two-way \n165 ANOVA with Sidak multiple comparison tests were used. All analyses were performed \n166 using Prism 10 (GraphPad Software, La Jolla, CA).\n167\n168\n169 RESULTS\n170 Insertion of LoxP sites and reduction in GABBR2 expression.\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n9\n171 Using CRISPR we inserted loxP sites into 5’ and 3’ sites flanking exon 10 of the \n172 Gabbr2 gene, which encodes the first transmembrane domain of the receptor (Figure 1a).  \n173 We targeted this exon for several reasons.  First, it was predicted to result in the loss of the \n174 first transmembrane domain.  Second excision of this portion of DNA was predicted to \n175 result in a frameshift and mistranslation of all downstream exons when the primary \n176 transcript was spliced.  Both of these characteristics are likely to result in a nonfunctional \n177 protein that would be degraded.  Finally, targeting this relatively small exon allowed both \n178 flanking loxP sites to be targeted with one oligomer, allowing for more efficient editing.   \n179 Primers were designed to detect wild-type and loxP sites at the 5’ and 3’ end of exon 10 to \n180 detect the appropriately floxed alleles (Figure 1b).  Using these primers, we identified 5 \n181 potential founder lines in a FVB background that contained both loxP sites, three of which \n182 passed on the correct allele in a Mendelian fashion.  We also identified 2 founder lines in a \n183 C57Bl/6 background, both of which passed on the correct genotype to offspring in \n184 Mendelian fashion (Figure 1c).  We used lines 19 and 33 in an FVB background, (referred to \n185 as Gabbr2lox/lox mice) in the following experiments.\n186 Gabbr2lox/lox mice were bred to B6.FVB-Tmem163Tg(ACTB-cre)2Mrt/EmsJ (Actin-cre) \n187 mice to generate Gabbr2 cKO mice with widespread loss of GABBR2 expression.  In order to \n188 verify the loss of GABBR2, we examined Gabbr2 mRNA levels in whole brains from 21-day-\n189 old mice.  Gabbr2 mRNA expression was reduced by 80% in the Gabbr2 cKO mice as \n190 compared to Gabbr2lox/lox (control) mice, lacking Cre expression.  Loss of Gabbr2 mRNA \n191 expression did not affect either Gabbr1mRNA or Casr mRNA levels, two potential \n192 heterodimerization partners for GABBR2 (Figure 2A).  We assessed GABBR2 expression by \n193 immunoblots of whole brain extracts.  As shown in Fig. 2B, no GABBR2 protein was \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n10\n194 detected in extracts of whole brains harvested from cKO  mice, although it was easily \n195 detected in brain extracts from control mice.  As with the mRNA levels, loss of GABBR2 \n196 protein did not affect GABBR1 or CASR protein levels (Fig. 2B).  These results demonstrate \n197 the effective elimination of GABBR2 expression when Gabbr2lox/lox mice are bred with Cre \n198 recombinase-expressing mice.\n199\n200 Histological changes in the brain due to the loss of GABBR2\n201 GABBR2 is expressed throughout the brain, including the cerebral cortex, \n202 cerebellum, Purkinje neurons, hippocampus, CA3 neurons, thalamic nuclei, medial \n203 habenula, and astrocytes (19-23).  S100 proteins are expressed diffusely in glial cells, \n204 astrocytes and neurons throughout the brain (24, 25).  In the GABBR2 cKO cortex, there \n205 was a generalized decrease in diffuse S100 staining and fewer distinct S100-positive cells \n206 when compared to control mice (Figure 3A versus 3B, red arrows).  In addition, there were \n207 fewer S100-positive dendritic extensions in the GABBR2 cKO cortex (Figure 3A versus 3B, \n208 yellow arrows).   There was also an increase in vacuolated neuronal bodies and cell debris \n209 evident in Luxol blue stained sections (Figure 3C versus 3D, green arrows), suggesting \n210 potential neuronal damage.\n211 Changes were also evident in the dentate gyrus and CA3 region of the hippocampus \n212 of GABBR2 cKO mice. There was a clear reduction in staining of the CA3 region (Figure 4A \n213 versus 4B, blue arrows).  We observed a clear reduction in the number and layers of dense \n214 immature granular cells (Figure 4A versus 4B, green arrows and dotted border) as well as \n215 an increase in vacuolated cytoplasm in granular cells (Figure 4A versus 4B, and Figure 4C \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n11\n216 versus 4D, red arrows).  There were many shrunken pyramidal cells in the polymorphic \n217 cell layer (Figure 4A and 4B, yellow arrows).  \n218 Finally, the cerebellum of GABBR2 cKO mice demonstrated alterations in the \n219 organization of the Purkinje cell layer, with fewer Purkinje neurons, and more swollen or \n220 vacuolated cells (Figure 5A versus 5B, yellow arrows). Additionally, there were fewer \n221 dendritic projections penetrating into the molecular layer and reduced complexity of the \n222 dendritic branching pattern. (Figure 5A versus Figure 5B, red arrows). \n223\n224 Loss of GABBR2 Alters Behavior and Motor Skills \n225 Previous reports on the global GABBR2 KO mice described hyperalgesia, \n226 hyperlocomotion, elevated anxiety-related behaviors, and spontaneous seizure activity (3, \n227 26).  Therefore, we examined these activities in GABBR2 cKO mice to determine whether \n228 they mimicked the phenotype of global GABBR2 KO Mice.   GABBR2 cKO mice \n229 demonstrated a greater than 3-fold increase in locomotor activity compared to control \n230 mice (Figure 6).  There was a significant reduction of unsupported rearing behavior in \n231 GABBR2 cKO mice as compared to controls (Figure 6).  This decrease in exploratory \n232 behavior is likely indicative of increased levels of stress but can also be seen in the setting \n233 of neurodegenerative disorders (27-29).\n234 Baclofen is an agonist for gamma-aminobutyric acid (GABA) B receptors, and acts as \n235 a muscle relaxant (30, 31).  Global GABBR2 knockout mice were previously shown to be \n236 refractory to baclofen as measured by changes in rotarod performance (3).  Therefore, we \n237 assessed rotarod performance and responses to baclofen in GABBR2 cKO and control mice.   \n238 During the rotarod training period preceding baclofen administration, it was clear that cKO \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n12\n239 mice of both sexes had a baseline decrease in their ability to remain on the rotarod (Figure \n240 7A).   Therefore, we expressed the response to baclofen as the change from baseline.  \n241 Control mice of both sexes had a clear decrease in rotarod performance after baclofen \n242 treatment.  However, despite the reduced performance at baseline, cKO mice showed no \n243 additional decline in performance after administration of baclofen (Figure 7B).  \n244\n245 Loss of GABBR2 results in seizures and premature death.\n246 We did not detect obvious spontaneous seizure activity while GABBR2 cKO mice \n247 were being monitored for locomotor activity.  However, these mice had frequent seizures \n248 when subjected to stressful stimuli, such as, being handled or placed on the rotarod \n249 (Supplemental Video).  In addition, we noted an increase in premature mortality in \n250 GABBR2 cKO mice.  As shown in Figure 8, 100% of GABBR2 cKO mice died by 115 days of \n251 age while no control mice died during the same period.  In addition to the pathological \n252 brain findings described above, necropsy of GABBR2 cKO mice showed little food in the \n253 stomach and small intestines, but no gross pathological changes. However, there was \n254 marked thymic necrosis. The spleen was enlarged and had areas of lymphocytic necrosis. \n255 The pancreas showed an absence of eosinophilic zymogen granules within the exocrine \n256 pancreatic acinar cells. Mice that had died some time before necropsy had brain findings \n257 similar to those described above. There was mild dilation of the lateral ventricles, multiple \n258 foci where there was decreased staining of the neuropil, especially in areas where cell \n259 nuclei were shrunken and there was cytoplasmic vacuolar degeneration. Diffuse \n260 demyelination was seen, blood vessels appeared congested, and some vessels contained \n261 mature fibrin. \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n13\n262\n263  Discussion:\n264 We generated a floxed GABBR2 mouse, that when crossed with Cre-expressing mice \n265 can be used to generate conditional KO mice targeting GABBR2 expression in different cell \n266 types.  In this report, we crossed floxed GABBR2 mice with Actin-Cre mice to produce a \n267 widespread knockout of the Gabbr2 gene.  Gabbr2 mRNA expression was reduced by over \n268 80% in the whole brain and GABBR2 protein was not detected by immunoblot, \n269 documenting efficient disruption of the Gabbr2 gene.  The phenotype of Actin-Cre GABBR2 \n270 cKO mice was similar to the global GABBR2 KO mouse (3).  These mice demonstrated \n271 increased locomotor activity but a decrease in unsupported rearing behavior. These mice \n272 also have impaired motor coordination and balance as measured by decreased ability to \n273 remain on a rotarod and seizures in response to being handled. These neuro-behavioral \n274 changes were accompanied by widespread changes in brain histology and also a reduced \n275 lifespan, both speaking to the importance of GABBR2 signaling for overall brain health and, \n276 perhaps, whole-body physiology as well.\n277 We found that the loss of GABBR2 led to histological changes in different areas of \n278 the brain.  In the cortex, GABBR2 is expressed in many different neurons including \n279 GABAergic cortical interneurons (32) and inhibitory interneurons (33). Loss of GABBR2 \n280 would be expected to impair slow inhibitory Gaba signaling to the interneurons connecting \n281 different regions of the cortex, perhaps resulting in a progressive decline in interneuron \n282 function.   Loss of inhibitory interneuron signaling may also result in changes in cell \n283 viability as reflected here as a reduction of cortical thickness, a decrease in S100 staining, \n284 reductions in dendritic extensions and the presence of vacuolated neurons and cellular \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n14\n285 debris.  Functionally, such a decline in neuronal populations might contribute to the loss of \n286 motor skills and cognitive function in the mice which we saw during the psychological and \n287 rotarod experiments (Figure 6 and Figure 7).  \n288 The hippocampus functions in memory and learning and GABBR2 expression \n289 typically occurs in the area near mossy fiber synapses that form the major excitatory input \n290 into the auto-associative network of pyramidal cells in the CA3 region (34). The loss of \n291 inhibitory input by GABBR2 to CA3 neurons could produce excitotoxity resulting of loss of \n292 pyramidal neurons (Figure 4B). Loss of neurons that govern lateral inhibition in the \n293 dentate gyrus can result in delamination of the granule cell layer and multilamellar \n294 discharges in response to cortical stimuli resulting in increased excitotoxicity (35). In the \n295 GABBR2 cKO mouse, progressive damage over time to the excitable neurons lacking \n296 GABBR2 input in the dentate gyrus of the hippocampus likely results in susceptibility to \n297 seizures and hyperexcitability (Figure 6). The histological phenotype of the GABBR2 cKO \n298 hippocampus is reminiscent of patients with epilepsy with a loss of dentate hilar neurons \n299 that govern dentate granule cell excitability (36, 37).\n300 Cerebellar Purkinje neurons are known to express GABBR2 (38). Purkinje neurons \n301 project to the intermediate discharge layer and are the key efferent output of the \n302 cerebellum. The GABBR2 cKO mice have fewer Purkinje neurons (Figure 5, yellow arrows) \n303 and smaller dendritic arbors (Figure 5, red arrows) contributing to the abnormal rotarod \n304 performance. Purkinje dysfunction may also lead to fewer connections between the \n305 Purkinje neuron’s dendritic arbors and the interneurons in the molecular layer which may \n306 increase glutamatergic stimuli and neurotoxicity. Some seizure disorders cause increased \n307 Purkinje death by glutamate excitotoxicity (39). \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n15\n308 In conclusion, the phenotype of GABBR2 cKO mice was similar to the global GABBR2 \n309 KO mouse (3).  Our characterization of the Actin-Cre GABBR2 cKO mice has revealed \n310 histological changes in multiple areas of the brain in addition to changes in rearing \n311 behavior and premature death.  Our studies do not discriminate between whether these \n312 changes are the result of altered brain development or due to progressive excitotoxic \n313 neuronal damage, although the use of inducible Cre transgenes could address this question \n314 in the future.  Nevertheless, these studies demonstrate that the floxed mice reported here \n315 will provide a new tool to target tissue-specific GABBR2 signaling through Cre-mediated \n316 recombination.  This will now provide scientists the ability to study GABBR2 function in \n317 different cell types without the potentially confounding effects of the neurological \n318 dysfunction caused by global knockout of GABBR2.\n319\n320 Acknowledgments:\n321 We thank the Yale Genome Editing Center for their help in generating the GABBR2 cKO \n322 mouse.\n323\n324\n325\n326 Figure 1\n327 CRISPR design to add loxP sites to the Gabbr2 gene. A. Map of Gabbr2 gene showing the \n328 guide RNAs used to create LoxP sites. B. Primers used to identify loxP sites in Actin-CRE \n329 Gabbr2lox/lox mice. C. Table summarizing the different Gabbr2lox/lox   mouse lines generated. \n330\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n16\n331 Figure 2.  \n332 Expression of Gabbr2, Gabbr1, and Casr in the brains of control and cKO mice.  A. QPCR to \n333 assess mRNA levels in whole-brain RNA. The specific transcript is shown on the top of each \n334 graph.  Bars represent the mean ± SEM.  *** p<.001.  B. Protein expression levels of \n335 GABBR2, GABBR1, and CASR in whole-brain extracts.  n= 6 control and n=12 cKO.\n336\n337 Figure 3. \n338 Brain sections of cerebral cortex from cKO and control brains stained for S100 and Luxol \n339 blue.  There was a reduction of S100 staining overall and fewer S100-labeled neurons in \n340 the cKO cortex (A) versus control cortex (B).  Yellow arrows point to neuronal dendrites.  \n341 Red arrows point to S100-labeled neuronal bodies.  There are more vacuolated neurons \n342 and cell debris in the cortex of cKO mice revealed by Luxol blue staining (C versus D). \n343 Green arrows point examples of vacuolated neurons. Scale bar = 200 microns\n344\n345 Figure 4.\n346 Hippocampus of the cKO mice have increased vacuolation of pyramidal neurons and a \n347 reduction of CA3 neurons and granular cells when compared to control mice.  The \n348 polymorphic layer of dentate gyrus (A and B) with CA3 neurons are identified with blue \n349 arrows, the dense immature granules with green arrows. The white dotted line showing \n350 border of the dense immature granular layer, and yellow arrows identify pyramidal \n351 neurons of polymorphic layer, and red arrows identify granular cells.  A congested capillary \n352 is present in the cKO hippocampus (black arrow). Hematoxylin and eosin staining of the \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n17\n353 hippocampus in A-B, and E -F is Luxol Blue staining.  A and C are control mice, B and D are \n354 cKO mice.  Scale bar = 1000 microns in A and B, 200 microns in the insets, and 100 microns \n355 in C and D. \n356\n357  Figure 5. \n358 Cerebellum of cKO and control mice stained with Luxol blue.  A is a control brain and B is a \n359 representative cKO brain.  The cerebellum has reduced Luxol blue staining in the cKO \n360 compared to the control brain. There are fewer Purkinje neurons (yellow arrows) and \n361 shorter, fewer and less complex dendritic extensions (red arrows) in the cKO cerebellum \n362 (A versus B).  A and B Scale bar is 1000 microns. Inserts of A and B scale bar is 200 microns.\n363\n364 Figure 6.\n365  Measurements of locomotor activity and unsupported rearing in cKO versus control mice. \n366 Increased locomotor activity and decreased unsupported rearing is seen in cKO mice.  Bars \n367 represent the mean ± SEM.  ***p<0.001, **p<0.01. n= 14 for control mice, n=11 for cKO \n368 mice.\n369\n370 Figure 7.\n371 Rotarod experiments in female and male control and cKO mice.  A). Training periods over 2 \n372 separate days showing times on rotarod for control (blue) and cKO mice (red).  Points \n373 represent the mean ± SEM dwelling times over 5 trials on each of 2 days.  Note that cKO \n374 mice stay on the rod for shorter periods at baseline, although they do improve with \n375 training.  B). Rotarod experiments in female and male control and cKO mice before and \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n18\n376 after administration of baclofen, a GABBR2 agonist.  Bar graphs on the left demonstrate the \n377 absolute dwell times on the rotarod.  Bar graphs on the right represent the change in dwell \n378 time in response to baclofen administration.  Bars represent mean ± SEM. *P<0.05, \n379 **p<0.01, ***p<0.001.  n=4/group\n380\n381 Figure 8.\n382 Kaplan-Myer plot showing survival curves of control and cKO mice.  No control mice died \n383 over 150 days of observation.  100% of cKO mice died by 115 days.  n= 11 in each group.  \n384 Gehan-Breslow-Wilcoxon test (p<0.0001).\n385\n386\n387\n388\n389 References:\n390 1. Misgeld U, Bijak M, Jarolimek W. A physiological role for GABAB receptors and the effects of \n391 baclofen in the mammalian central nervous system. Prog Neurobiol. 1995;46(4):423-62.\n392 2. Couve A, Moss SJ, Pangalos MN. GABAB receptors: a new paradigm in G protein signaling. Mol \n393 Cell Neurosci. 2000;16(4):296-312.\n394 3. Gassmann M, Shaban H, Vigot R, Sansig G, Haller C, Barbieri S, et al. Redistribution of GABAB(1) \n395 protein and atypical GABAB responses in GABAB(2)-deficient mice. J Neurosci. 2004;24(27):6086-97.\n396 4. Cheng Z, Tu C, Rodriguez L, Chen TH, Dvorak MM, Margeta M, et al. Type B gamma-\n397 aminobutyric acid receptors modulate the function of the extracellular Ca2+-sensing receptor and cell \n398 differentiation in murine growth plate chondrocytes. Endocrinology. 2007;148(10):4984-92.\n399 5. Zhang D, Li X, Yao Z, Wei C, Ning N, Li J. GABAergic signaling facilitates breast cancer metastasis \n400 by promoting ERK1/2-dependent phosphorylation. Cancer Lett. 2014;348(1-2):100-8.\n401 6. Wu JX, Shan FX, Zheng JN, Pei DS. beta-arrestin promotes c-Jun N-terminal kinase mediated \n402 apoptosis via a GABA(B)R.beta-arrestin.JNK signaling module. Asian Pac J Cancer Prev. 2014;15(2):1041-\n403 6.\n404 7. Marshall FH, White J, Main M, Green A, Wise A. GABA(B) receptors function as heterodimers. \n405 Biochem Soc Trans. 1999;27(4):530-5.\n406 8. Mohler H, Benke D, Fritschy JM. GABA(B)-receptor isoforms molecular architecture and \n407 distribution. Life Sci. 2001;68(19-20):2297-300.\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n19\n408 9. Chang W, Tu C, Cheng Z, Rodriguez L, Chen TH, Gassmann M, et al. Complex formation with the \n409 Type B gamma-aminobutyric acid receptor affects the expression and signal transduction of the \n410 extracellular calcium-sensing receptor. Studies with HEK-293 cells and neurons. J Biol Chem. \n411 2007;282(34):25030-40.\n412 10. Chang W, Tu CL, Jean-Alphonse FG, Herberger A, Cheng Z, Hwong J, et al. PTH hypersecretion \n413 triggered by a GABA(B1) and Ca(2+)-sensing receptor heterocomplex in hyperparathyroidism. Nat \n414 Metab. 2020;2(3):243-55.\n415 11. Yang H, Wang H, Jaenisch R. Generating genetically modified mice using CRISPR/Cas-mediated \n416 genome engineering. Nat Protoc. 2014;9(8):1956-68.\n417 12. Price NL, Rotllan N, Zhang X, Canfran-Duque A, Nottoli T, Suarez Y, et al. Specific Disruption of \n418 Abca1 Targeting Largely Mimics the Effects of miR-33 Knockout on Macrophage Cholesterol Efflux and \n419 Atherosclerotic Plaque Development. Circ Res. 2019;124(6):874-80.\n420 13. Quadros RM, Miura H, Harms DW, Akatsuka H, Sato T, Aida T, et al. Easi-CRISPR: a robust \n421 method for one-step generation of mice carrying conditional and insertion alleles using long ssDNA \n422 donors and CRISPR ribonucleoproteins. Genome Biol. 2017;18(1):92.\n423 14. Concordet JP, Haeussler M. CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing \n424 experiments and screens. Nucleic Acids Res. 2018;46(W1):W242-W5.\n425 15. Nagy A. Manipulating the mouse embryo : a laboratory manual. 3rd ed. Cold Spring Harbor, N.Y.: \n426 Cold Spring Harbor Laboratory Press Cold Spring Harbor, N.Y.; 2003.\n427 16. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative \n428 PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-8.\n429 17. Carson FL, Cappellano CH. Histotechnology. A self-instructional text. 3rd ed. [Chicago]: ASCP \n430 Press [Chicago]; 2009.\n431 18. Schuler V, Luscher C, Blanchet C, Klix N, Sansig G, Klebs K, et al. Epilepsy, hyperalgesia, impaired \n432 memory, and loss of pre- and postsynaptic GABA(B) responses in mice lacking GABA(B(1)). Neuron. \n433 2001;31(1):47-58.\n434 19. During MJ, Ryder KM, Spencer DD. Hippocampal GABA transporter function in temporal-lobe \n435 epilepsy. Nature. 1995;376(6536):174-7.\n436 20. Mederos S, Sanchez-Puelles C, Esparza J, Valero M, Ponomarenko A, Perea G. GABAergic \n437 signaling to astrocytes in the prefrontal cortex sustains goal-directed behaviors. Nat Neurosci. \n438 2021;24(1):82-92.\n439 21. Scanziani M. GABA spillover activates postsynaptic GABA(B) receptors to control rhythmic \n440 hippocampal activity. Neuron. 2000;25(3):673-81.\n441 22. Wang L, Bruce G, Spary E, Deuchars J, Deuchars SA. GABA(B) Mediated Regulation of \n442 Sympathetic Preganglionic Neurons: Pre- and Postsynaptic Sites of Action. Front Neurol. 2010;1:142.\n443 23. Kuner R, Kohr G, Grunewald S, Eisenhardt G, Bach A, Kornau HC. Role of heteromer formation in \n444 GABAB receptor function. Science. 1999;283(5398):74-7.\n445 24. Chong ZZ, Changyaleket B, Xu H, Dull RO, Schwartz DE. Identifying S100B as a Biomarker and a \n446 Therapeutic Target For Brain Injury and Multiple Diseases. Curr Med Chem. 2016;23(15):1571-96.\n447 25. Hernandez-Ortega K, Canul-Euan AA, Solis-Paredes JM, Borboa-Olivares H, Reyes-Munoz E, \n448 Estrada-Gutierrez G, et al. S100B actions on glial and neuronal cells in the developing brain: an overview. \n449 Front Neurosci. 2024;18:1425525.\n450 26. Mombereau C, Kaupmann K, Froestl W, Sansig G, van der Putten H, Cryan JF. Genetic and \n451 pharmacological evidence of a role for GABA(B) receptors in the modulation of anxiety- and \n452 antidepressant-like behavior. Neuropsychopharmacology. 2004;29(6):1050-62.\n453 27. Lever C, Burton S, O'Keefe J. Rearing on hind legs, environmental novelty, and the hippocampal \n454 formation. Rev Neurosci. 2006;17(1-2):111-33.\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n20\n455 28. Torres-Lista V, Parrado-Fernandez C, Alvarez-Monton I, Frontinan-Rubio J, Duran-Prado M, \n456 Peinado JR, et al. Neophobia, NQO1 and SIRT1 as premorbid and prodromal indicators of AD in 3xTg-AD \n457 mice. Behav Brain Res. 2014;271:140-6.\n458 29. Sturman O, Germain PL, Bohacek J. Exploratory rearing: a context- and stress-sensitive behavior \n459 recorded in the open-field test. Stress. 2018;21(5):443-52.\n460 30. Davidoff RA. Antispasticity drugs: mechanisms of action. Ann Neurol. 1985;17(2):107-16.\n461 31. Allerton CA, Boden PR, Hill RG. Actions of the GABAB agonist, (-)-baclofen, on neurones in deep \n462 dorsal horn of the rat spinal cord in vitro. Br J Pharmacol. 1989;96(1):29-38.\n463 32. Kelsom C, Lu W. Development and specification of GABAergic cortical interneurons. Cell Biosci. \n464 2013;3(1):19.\n465 33. Zeng X, Niu Y, Qin G, Zhang D, Zhou J, Chen L. Deficiency in the function of inhibitory \n466 interneurons contributes to glutamate-associated central sensitization through GABABR2-SynCAM1 \n467 signaling in chronic migraine rats. FASEB J. 2020;34(11):14780-98.\n468 34. Vogt KE, Nicoll RA. Glutamate and gamma-aminobutyric acid mediate a heterosynaptic \n469 depression at mossy fiber synapses in the hippocampus. Proc Natl Acad Sci U S A. 1999;96(3):1118-22.\n470 35. Sloviter RS. The functional organization of the hippocampal dentate gyrus and its relevance to \n471 the pathogenesis of temporal lobe epilepsy. Ann Neurol. 1994;35(6):640-54.\n472 36. Cendes F. Febrile seizures and mesial temporal sclerosis. Curr Opin Neurol. 2004;17(2):161-4.\n473 37. Yang F, Liu ZR, Chen J, Zhang SJ, Quan QY, Huang YG, et al. Roles of astrocytes and microglia in \n474 seizure-induced aberrant neurogenesis in the hippocampus of adult rats. J Neurosci Res. \n475 2010;88(3):519-29.\n476 38. Jamal L, Khan AN, Butt S, Patel CR, Zhang H. The level and distribution of the GABA(B)R1 and \n477 GABA(B)R2 receptor subunits in the rat's inferior colliculus. Front Neural Circuits. 2012;6:92.\n478 39. Paul MS, Limaiem F. Histology, Purkinje Cells.  StatPearls. Treasure Island (FL)2024.\n479\n480\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint \n\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 23, 2025. ; https://doi.org/10.1101/2025.01.23.634473doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}