{"paper_id":"07a1796a-8444-4e09-8894-9a772178bd14","body_text":"Resistance phenotypes and molecular characteristics of Staphylococcus aureus associated with pleuritis in patients at “Hôpital du Mali” teaching hospital | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Resistance phenotypes and molecular characteristics of Staphylococcus aureus associated with pleuritis in patients at “Hôpital du Mali” teaching hospital Aimé Césaire Kalambry, Tchamou Malraux Fleury Potindji, Ibrehima Guindo, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3579825/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Staphylococcus aureus (S. aureus) is one of the pathogens strongly implicated in hospital infections. Data on the resistance and molecular characteristics of this bacterium are rare in Mali. Objective This study aimed to evaluate the antibiotic resistance patterns, virulence factors of S. aureus isolates from pleural fluid infections in hospitalized patients. Methods Pleural effusion samples were obtained by thoracentesis for bacteriological examination from October 2021 to December 2022 at the “Hôpital du Mali” teaching hospital. Comorbidities such as HIV/AIDS and diabetes were assessed. Standard microbiological procedures were used for bacterial identification. The disk diffusion method was used to identify methicillin-resistant S. aureus . The PCR amplification method was used to detect the following genes: lukE/D , sek , bsa , sel , and sep. Results This study analyzed 6096 samples from inpatients and found a pooled frequency of bacterial pleuritis of 526 (8.6%) in thoracic surgery and pediatric wards. S. aureus was isolated in 52 (9.88%) cases, of which 39 (75%) isolates were MRSA. There was no significant difference between the sexes ( p = 1.00 ). The median age of the patients was 30 years. All S. aureus isolates showed resistance to penicillin-G. The leucocidin lukE/D toxin was detected in 7.7% of thoracic surgery patients, but sek , bsa , sel , and sep toxins were not found. Conclusion In this study, we found a high frequency of S. aureus (and MRSA) in pleurisy patients at the “Hôpital du Mali”. Only the leukocidin lukE/D was found. The empirical treatment protocol for pleurisy may need revision. Clindamycin, linezolid, teicoplanin, daptomycin, fosfomycin, vancomycin, moxifloxacin and fusidic acid were the most active antibiotics on our isolates in this study. Infection prevention measures, active surveillance, and effective therapeutic options are recommended. Bacterial pleuritis S. aureus multidrug resistance virulence Mali Figures Figure 1 Background Bacterial pleuritis is a common and widespread condition with significant mortality and morbidity [ 1 ]. Pleural infections can result from a variety of conditions and factors, such as location, demographics and comorbidities [ 2 ]. Although a positive pleural fluid culture defines infection, the microbiological profile can be highly diverse [ 3 ]. The viridans group and pneumococci are consistently among the most common isolates; anaerobic bacteria are also found. However, S. aureus is the most frequently isolated organism[ 4 , 5 ]. Sub-Saharan Africa remains a region with significant healthcare challenges, and the prevalence and morbidity of pleural fluid infection are of great concern. A study carried out in Chad revealed a prevalence of 13.6%. Only 4% of cases were of bacterial origin, excluding tuberculous pleuritis. With another study conducted in Niger in 2016, both authors reported that the etiology of pleuritis was dominated by tuberculosis [ 6 , 7 ]. Conversely, a South African study conducted over a 5-year period reported pleuritis of bacterial origin in more than half of cases. The main pathogens isolated were S. aureus , Streptococcus pneumoniae , tubercle bacillus and Klebsiella pneumoniae , in that order [ 8 ]. Research into pleural infection in sub-Saharan Africa has highlighted the predominance of S. aureus as the most common causative organism [ 8 ]. S. aureus can evade the defense barriers of the host immune system by producing various enzymes and toxins. In fact, a strong correlation between toxins and disease has been reported. The main S. aureus toxins have been divided into three groups: 1) pore-forming toxins (hemolysin-α, hemolysin-β, leukotoxin and γ-hemolysin), 2) exfoliative toxins (ET) and 3) super antigen toxins (toxic shock syndrome toxin and staphylococcal enterotoxins) [ 9 ]. When first introduced, penicillin had a considerable impact on S. aureus but was gradually replaced by other beta-lactam antibiotics due to the emergence of beta-lactamase-producing strains of S. aureus [ 10 ]. Methicillin was introduced to treat infections caused by penicillin-resistant isolates, but the emergence of methicillin resistance in S. aureus (MRSA) isolates has reduced the effectiveness of antibiotics. To reduce the spread of S. aureus infections, knowledge of virulence factors and genetic diversity can provide useful information for tailoring infection control programs. Identifying these factors could help to improve patient outcomes and reduce the burden of pleural infections in this region. Therefore, the aim of this study was to describe the clinical and molecular characteristics of S. aureus isolated from patients hospitalized for pleurisy in a teaching hospital in Mali. Methods Study design and population The present study was conducted as a cross-sectional investigation from October 2021 to December 2022 at the “Hôpital du Mali” teaching hospital in the thoracic surgery and pediatric departments among patients with pleural effusions. We obtained written consent from each participant. Review and approval of the study protocol was obtained from the ethics committee of the University of Sciences, Techniques and Technologies of Bamako, identifiable through the reference number 2021/228/USTTB from 06/09/2021. Sample collection Pleural effusion samples were obtained by puncture (thoracentesis) for bacteriological examination, and the samples were promptly transferred to the laboratory for analysis within an hour of collection. In addition, two comorbid conditions, namely, HIV and diabetes, were sought after. For this, blood samples were collected in dry tubes and sodium fluoride tubes. After centrifugation, serum and plasma obtained from each tube were used for the determination of HIV serology and blood sugar levels, respectively. Bacterial identification Pleural effusion samples obtained previously were systematically inoculated on brain-heart infusion (BHI) and an anaerobic blood culture flask and incubated at 35°C ± 2°C for 18–24 hours. Subsequently, fresh blood agar, enriched chocolate agar, and Sabouraud agar were inoculated using the aforementioned broths. The identification of S. aureus was performed according to standard microbiological procedures published previously [ 11 ]. The colonies were further subjected to agglutination using the Pastorex® Staph plus kit (BioMérieux, Marcy Etoile-Lyon). The identification of the isolates was later verified using the Phoenix M50 automaton (BD, Stockholm, Sweden) with the identification panel (PMIC/ID-600) specifically designed for gram-positive bacteria. Antimicrobial susceptibility testing The susceptibility of S. aureus to antibiotics was tested with a comprehensive panel of 19 antibiotics, including beta-lactams, macrolides, lincosamide, aminoglycosides, quinolones, glycopeptides, oxazolidinones, cyclins, and diaminopyrimidine + sulfonamides. Briefly, the method involved a suspension of pure bacterial colonies in sterile normal saline to a turbidity of McFarland standard 0.5 and then uniformly spreading them on Muller Hinton agar (MHA) plates with antibiotic discs. The plates were ultimately incubated at 37°C for 24 h. The zones of inhibition were measured in millimeters and classified as either susceptible (S) or resistant (R) and interpreted according to the EUCAST recommendations [ 12 ]. Quality control was ensured using the S. aureus ATCC 43300 strain. S. aureus exhibiting inhibition zone diameters of 19 mm or less on the 30 µg cefoxitin disk were classified as MRSA. Of note, multidrug resistance was defined by the lack of susceptibility to at least one agent in three or more antibiotic classes as described previously [ 13 ]. DNA extraction and molecular detection of toxin genes DNA was extracted according to the method described previously[ 14 ]. Briefly, pure colonies were suspended in 200 µl of Tris-EDTA solution, heated at 100°C for 10 minutes, and then immediately placed at -20°C for 5 to 10 minutes. After centrifugation at 12,000 rpm for 10 minutes, the obtained supernatant was used as a DNA template. Quality control of the extraction was carried out using the Thermo Scientific NanoDrop One/One C instrument. For the targeted genes: LukE-D, sek, sep, sel, and bsa , the primer sequences and their respective amplicon sizes are detailed in Table 1 . The amplification of the genes was achieved according to a previously described protocol using 35 thermal cycles of 95°C for denaturation, 56°C for hybridization, and 68°C for elongation [ 15 ]. The PCR products were electrophoresed on a 1.5% agarose gel with ethidium bromide at 80 milliamperes for 20 minutes and visualized using ultraviolet light using a transilluminator. A 50 bp DNA ladder was used as a size standard, which covers a size range from 50 bp to 500 bp and includes ten bands. Table 1 different sequences of primers of toxin genes and references Primer name Primer sequence (5' → 3') Size of products (pb) References bsa_Forward ACAGAAGCTGTTAAAACTACCC 100 [ 12 ] bsa_Reverse GATTAATATGACAATTGAAGTGGGTC 100 [ 12 ] lukE/D_Forward GC AACTTTTGTCAGTAGGACTG 200 [ 12 ] lukE/D_Reverse GTCTACTTCACTGACATAACTC 200 [ 12 ] sek_Forward GGTGTCTCTAATAGTGCCAG 200 [ 12 ] sek_Reverse TCGTTAGTAGCTGTGACTCC 200 [ 12 ] sel_ Forward ATCAATGGCAAGCATCAAACAG 200 [ 12 ] sel _Reverse TGGAAGACCGTATCCTGTG 200 [ 12 ] sep_Forward GACCTTGGTTCAAAAGACACC 200 [ 12 ] sep_Reverse TGTCTTGACTGAAGGTCTAGC 200 [ 12 ] Comorbidity identification The presence/absence of HIV and diabetes was assessed using the Wondfo Rapid One Step HIV 1/2 test and the ABX Pentra 400 chemistry analyzer, respectively. Data collection and analysis Data were collected through a questionnaire into the Excels sheet, and the analyses were performed using Epi info version 7.2.1.0 software. The comparison of our frequencies was conducted via Fisher's exact test. A significance level of 0.05 or less for the p value was deemed statistically significant. The determination of the proportion of multidrug-resistant isolates was made using the Antimicrobial Resistance Data Analysis package “AMR” [ 16 ] in RStudio (R-studio Team, 2020) according to the CMI 2012 guidelines [ 13 ]. Results Population features Of 6096 patients over the study period, the pooled prevalence of bacterial pleuritis in both thoracic surgery and pediatric departments was 526 (8.6%). Staphylococcus aureus was isolated in 52 (9.8%) of the cases. Of those 52 patients, 28 (53.8%) were male and 24 (46.2%) were female, resulting in a male/female ratio of 0.85. Statistical analysis revealed no significant difference as per a potential relationship between gender and occurrence of the condition ( p = 0.470 ). The median age (interquartile range) of the patients was 30 (30-43.8) years. Patients under the age of 4 and those between the ages of 50 and 90 accounted for 11 (21.2%) of cases. Comorbidities Over the data collection period, 3 (5.8%) of the patients in the thoracic surgery department were diagnosed with diabetes, while 2 (3.8%) were HIV positive. In the pediatrics department, no cases of diabetes or HIV seropositivity were identified. It must be noted that 46 (88.5%) of the patients had taken at least one antibiotic before undergoing sampling. Results of antibiotic susceptibility In both the Thoracic Surgery and Pediatrics departments, all S. aureus strains exhibited 100% resistance to penicillin-G. In terms of oxacillin resistance, we observed rates of 63.9% and 50% in the Thoracic Surgery and Pediatrics departments, respectively. Notably, none of the pediatric isolates showed resistance to vancomycin, daptomycin, moxifloxacin, or fosfomycin. The resistance patterns of S. aureus strains to various antibiotics are provided in Table 2 . In the Thoracic Surgery department, MRSA was represented for 26 (72.8%) cases, while in Pediatrics, it accounted for 13 (81.2%). The most effective antibiotics were fosfomycin 2 (3.8%), fusidic acid 3 (5.8%), daptomycin 3 (5.8%), vancomycin 5 (9.6%) and teicoplanin 6 (11.5%). The K and KT phenotypes of aminoglycosides were 17 (46.2%) in Thoracic Surgery and 7 (43.8%) in Pediatrics. Regarding the antibiotic resistance patterns in MRSA, a significant association was reported for the constitutive MLS b phenotype (n = 39; p ≤ 0.000 ). Of the 52 strains of S. aureus , 47 (90.4%) were multidrug resistant. Moreover, according to EUCAST Expert Rules version 3.3, we found 18 (34.6%) isolates exhibiting unusual resistance phenotypes [ 17 ]. MSSA had a higher and significant percentage of susceptibility to aminoglycosides 10 (76.9%) compared to MRSA 18 (46.2%) ( p = 0.05 ). Compared to macrolides, the constitutive MLSB phenotype was 1 (7.7%) in MSSA strains and 39 (100%) in MRSA. A significant relationship concerning MRSA was found (odds ratio: 0.0769; p = 0.000 ). Table 2 Antibiotic resistance of S. aureus isolates Thoracic surgery Pediatrics Total Antibiotics Resistant n(%) Resistant n(%) Resistant n(%) Penicillin-G 36(100) 16(100) 52(100) Oxacillin 29(80.6) 13(81.3) 42(80,8) Cefoxitin 26(72,8) 13(81,2) 39(75) Amikacin 17(47,2) 7(43,8) 24(46,2) Gentamicin 15(41,7) 5(31,2) 20(38,5) Tobramycin 19(52,8) 7(43,8) 24(46,2) Levofloxacin 12(33,3) 4(25,0) 16(30,8) Ciprofloxacin 12(33,3) 4(25,0) 16(30,8) Moxifloxacin 9(25,0) 0(0) 9(17,3) Tetracyclin 35(97,2) 15(93,8) 50(96,2) Erythromycin 28(77,8) 14(87,5) 42(80,8 Clindamycin 4(11,1) 1(6,2) 40(76,9) Linolezid 9(25,0) 4(25,0) 13(25,0) Teicoplanin 5(13,9) 1(6,2) 6(11,5) Daptomycin 3(8,3) 0(0) 3(5,8) Triméthoprim + sulfaméthoxazole 26(72,2) 11(68,8) 37(71,2) Fosfomycine 2(5.6) 0(0) 2(3.8) Vancomycin 5(13.9) 0(0) 5(9.6) Fusidic acid 1(2.8) 1(6.2) 3(5.8) Molecular detection of toxin genes In thoracic surgery, the toxin known as leucocidin lukE/D was detected in 7.7% of patients (n = 4), as shown in Fig. 1 . The toxins known as sek , bsa , sel , and sep were not detected in any of the patients. Discussion Patients referred to the Thoracic Surgery Department and the Pediatrics Department with pleurisy presented with S. aureus infections. The hospital frequency of pleurisy at Hôpital du Mali teaching hospital was 8.6%. Our results are lower than those reported by NGakoutou R et al, 2022, who cited in a 2006 study reporting a frequency of 15.9% in a pneumological setting. This could be explained by the evolution of practices in case management. This result is lower than those reported by some African authors (13.8% in Chad and 42.2% in South Africa) [ 18 , 19 ]. In developed countries, the hospital prevalence of pleurisy was 7.75 cases in 2017 in France and 9.9 cases per 100,000 inhabitants in Finland in 2017 [ 20 , 21 ]. An upward trend was found in the United States in Missouri. The weighted prevalence of empyema was 95.5 per 100,000 hospitalizations per year. It varied according to race and represented 68.10 per 100,000 inhabitants for white and black patients, respectively [ 22 ]. This increase would be linked to the emergence of bacterial strains with reduced sensitivity or expressing increased virulence. The male predominance in our study, although there was no significant difference, has been reported by other authors [ 23 ]. Most of the children in our study had their vaccination status up-to-date and had a protective effect against certain pathogens with respiratory tropism, such as Streptococcus pneumoniae and Haemophilus influenzae. These agents are indeed covered by the vaccination of the Expanded Programme on Immunization (EPI) carried out in Mali. The median age in our study was 30 years, which could be explained by the greater activity at this age of the life cycle in our country. The issue of antibiotic resistance has been consistently identified by the World Health Organization (WHO) as a top global health priority and a critical public health menace of the current century. In Africa, the mortality rate caused by antimicrobial resistance stands out as the highest in the world, with 24 deaths per 100,000 individuals [ 24 , 25 ]. In our facility, the most prescribed antibiotics to treat staphylococcal pleurisy are gentamicin (GEN) and ciprofloxacin (CIP). Our isolates showed a resistance of 38.5% to GEN and 30.8% to CIP. Our results are lower than those reported by some authors who found 72.6% resistance to GEN and 71.7% resistance to CIP [ 26 ]. For aminoglycosides, there was no significant difference between the presence of the sensitive phenotype in MRSA and MSSA ( p = 0.05 ). According to the guidelines of the American Association of Thoracic Surgery (AATS) and the British Thoracic Society (BTS), aminoglycosides should be avoided in the management of pleurisy, while other authors advise (13) molecules in the treatments for MRSA infections [ 27 , 28 ]. S. aureus penicillinase is species specific, plasmid-borne, and transmissible. It gives it resistance to penicillins G, V and A, carboxypenicillins and ureido-penicillins. More than 90% of S. aureus isolated from pathological products in the hospital environment are penicillinase producers [ 29 ]. In our study, penicillinase G was observed in 100% of our isolates. This observation confirms the strong trend of resistance of staphylococci to penicillin. In addition to their intrinsic resistance to beta-lactams, hospital-associated MRSA strains often show a variable but alarming level of multidrug resistance, which limits the possibilities of treatment to the few remaining effective drugs. MRSA poses a significant threat to public health, particularly in developing countries, due to its ability to cause life-threatening infections [ 11 ]. MRSA prevalence data in Africa are variable in terms of coverage and quality. They are available for South Africa, Nigeria and the countries of the Mediterranean basin but are fragmentary for the other countries [ 28 ]. Some come from single center studies, and others come from larger but few surveillance systems. Many studies have relied on phenotypic methods to identify MRSA. In our study, 75% of MRSA isolates were encountered. Some authors have reported an MRSA prevalence of 80.9% in Cyprus in 2022 [ 11 ]. In 2018, a study bringing together data from a large number of countries estimated the prevalence of MRSA to be between 25 and 50% for Algeria, Morocco and Cameroon compared to 10 to 25% for the Republic of Ivory Coast and Senegal; Mali had not provided data [ 28 ]. The variation between countries could be partly explained by differences in the availability and use of antimicrobials, the incidence of HIV infection (a risk factor for MRSA colonization) and differences in local infection control practices and specific pathogen characteristics of circulating clones. Due to differences in the extent of collection and testing methods, care should be taken when comparing data between countries. For macrolide resistance, the inducible MLS b phenotype was more frequent in MSSA than in MRSA (15.4%) (p = 0.04). On the other hand, the constitutive MLS b phenotype was more frequent in MRSA than in MSSA (100%) (p = 0.000). We noted a 56.2% predominance of the constitutive MLS b phenotype against 22.9% of the inducible MLS b phenotype in Iran [ 30 ]. Compared to vancomycin, the resistance is 9.6%. No resistance to vancomycin was detected in Zambia by the authors in hospital settings [ 31 ]. Vancomycin is the drug of choice used in the hospital setting to treat MRSA infections. Our results could perhaps be explained by the possible acquisition of resistance to vancomycin. The choice of this antibiotic to treat MRSA may also cause the emergence of vancomycin resistance. S. aureus is a pathogen whose strong adaptive power allows survival through the successive acquisition of antibiotic resistance genes, growth regulatory mechanisms in the presence of antibiotics and specific virulence factors. The vigilance of clinicians and microbiologists is needed to signal the emergence of new epidemiological phenomena, as well as to ensure compliance with prevention instructions and the judicious use of antibiotics, both in hospitals and in the community. S. aureus has a vast arsenal of virulence factors (including adhesive, immunomodulatory, and host cell-damaging molecules) whose presence or specificity varies from clone to clone, a variability that is reflected in the wide variety of infections this bacterium can cause [ 11 ]. Many virulence genes are found on mobile genetic elements; thus, their combination differs significantly between clones and even between closely related strains. The potential association of specific virulence factors with certain types of S. aureus infections or their severity remains difficult to establish, probably due to the number of these factors and their redundant functions. Certain staphylococcal toxins are responsible for specific clinical syndromes with sometimes very poor prognosis. This is Panton-Valentine Leucocidin (PVL). Leukocidin E ( LukE / D ) is a porogenic toxin produced by S. aureus that lyses host cells and promotes the virulence of the bacterium; it is hemolytic, unlike PVL [ 32 ]. We found 7.7% positivity for lukE/D. This rate is lower than those obtained by some authors, 44.3% in 2022 in China and 68.3% in 2017 in the Democratic Republic of Congo [ 33 ]. The absence of virulence factors sek, bsa, sep and sel during our study could indicate that the isolates obtained do not possess enterotoxin genes. Clindamycin, linezolid, teicoplanin, daptomycin, fosfomycin, vancomycin, moxifloxacin and fusidic acid were the most active antibiotics on our isolates during this study. On the other hand, at the Point G teaching hospital, Maiga A et al., 2017, found that the most active antibiotics were fusidic acid, the association amoxicillin + clavulanic acid and pristinamycin [ 34 ]. In this group of antibiotics, the resistance to fusidic acid was 5.8%, which implies that this antibiotic still remains active against S. aureus isolates. Limitations Our study was limited to a single hospital and is therefore not representative of the whole country; however, the profile of the affected population and their behavior are typical of the country. We did not perform molecular typing (clonal complex, sequence typing, SCCmec typing), molecular detection of the mecA gene coding for methicillin resistance, and even less molecular confirmation of the phenotypic identification of S. aureus by detection of the nuc gene coding for thermonuclease. Conclusion The results of our study indicate that S. aureus is frequent among patients with pleurisy admitted to the Hospital of Mali Teaching Hospital, and the frequency of MRSA is alarming at 75%, particularly in the absence of a national prevalence assessment. This study can serve as a reference for monitoring the development of MRSA and setting up a surveillance system at the hospital. Our findings suggest that the current empirical treatment protocol for pleurisy, which consists of ciprofloxacin and gentamicin, may need to be revised. Despite the limited exploration of the frequency and severity of MRSA pleurisy in our country, our study highlights the importance of implementing infection prevention measures, such as the establishment of an infection control team and admission screening for MRSA. Furthermore, a better understanding of the epidemiology of these infections and the development of effective therapeutic strategies are essential for clinicians to prevent the spread of these infections. Abbreviations PCR Polymerase Chain Reaction S.aureus Staphylococcus aureus MRSA Methicillin-Resistant Staphylococcus aureus USTTB University of Sciences, Techniques and Technologies of Bamako EUCAST European Committee on Antimicrobial Susceptibility Testing MSSA Methicillin-Sensible Staphylococcus aureus MHA Muller Hinton Agar HIV/AIDS Human Immunodeficiency Virus/ Acquired Immune Deficiency Syndrome DNA Deoxyribonucleic Acid EPI Expanded Programme on Immunization Declarations Acknowledgments We thank the National Institutes of Health through the Fogarty international grant D43TW008652 for doctoral registration fees. The authors would like to thank the managers of the molecular biology laboratories of the National Public Health Institute and the University Center for Clinical Research in Mali. Authors’ contributions Study initiation and design: Sadio Yéna, funds collection: Séydou Doumbia, Data collection: Aimé Césaire Kalambry, Ambara Kassogué, Data interpretation, literature review, laboratory procedures, Statistical test, manuscript preparation: Aimé Césaire Kalamabry, Tchamou Malraux Fleury Potindji, Supervision of works: Ibrehima Guindo, Dinanibè Kambiré, Boubacar Sidiki Ibrahim Dramé, and Mahamadou Diakité. All the authors read and approved the final version of the manuscript. Funding As this work is part of a PhD thesis, we did not receive any funding for it. Data Availability All the information supporting our conclusions and appropriate references are included in the manuscript. The datasets used and analyzed in the current study are also available from the corresponding author. Ethics approval and consent to participate Review and approval of the study protocol was obtained from the ethics committee of the University of Sciences, Techniques and Technologies of Bamako, identifiable through the reference number 2021/228/USTTB from 06/09/2021. All participants provided written informed consent prior to their inclusion in the study. Consent for publication Not applicable. Competing interests The authors declare no competing interests. Author details 1 Laboratory Teaching Hospital “Hôpital du Mali” 2 Ecole Supérieure des Techniques Biologiques et Alimentaires, Université de Lomé, Lomé, Togo 3 Institut National de Santé Publique, Bamako, Mali 4 Service de Chirurgie Thoracique, CHU Hôpital du Mali, Bamako, Mali 5 University Clinical Research Center (UCRC) Bamako, Mali 6 Malaria Research and Training Center (MRTC), University of Bamako, Mali 7 Centre National de Recherche Scientifique et Technologique (CNRST), Institut de Recherche en Sciences de la Santé (IRSS), LR-Maladies Infectieuses et Parasitaires (LR-MIP), Ouagadougou, Burkina Faso. References Bedawi EO, Hassan M, McCracken D, Rahman NM. Pleural infection: a closer look at the etiopathogenesis, microbiology and role of antibiotics. Expert Rev Respir Med. 2019;13(4):337–47. Park J, Kim SJ, Kim H, Jung H, Shin HY. Ultrasound diagnosis and treatment of intractable anterior chest pain from golf - A case report –. Anesth Pain Med. 2023;18(1):65–9. Roy B, Shak HJ, Lee YCG. Pleural fluid investigations for pleural infections. J Lab Precis Med. 2021;6(April). 10.21037/jlpm-2021-01 . Hassan M, Cargill T, Harriss E, Asciak R, Mercer RM, Bedawi EO, et al. The microbiology of pleural infection in adults: a systematic review. Eur Respir J. 2019;54(3). 10.1183/13993003.00542-2019 . Avner BS, Ginosyan A, Le J, Mak J, Qiryaqoz Z, Huffman C. Analysis of antibiotic use and clinical outcomes in adults with known and suspected pleural empyema. BMC Infect Dis. 2022;22(1):783. Assao Neino MM, Gagara Im A, Ouédraogo AR, Maizoumbou D. Current state of pleurisy in Pulmophtisiology Department of Lamorde National Hospital in Niamey, Niger. J Funct Vent Pulmonol. 2016;7(21):15–9. NGakoutou R, Allawaye L, Ahamat A, Boltia MA, Mada J, Koboye A, Danda, Mihimit A. Profils épidémiologiques cliniques et étiologiques des pleurésies chez les patients hospitalisés dans le service de pneumo-phtisiologie de l’HGRN de N’Djamena au Tchad: à propos de 130 cas. Mali Med. 2022 37. Ghoor A, Mabaso T, Mopeli K, Izu A, Madhi SA, Lala SG, et al. Empyema in children hospitalized at Chris Hani Baragwanath Academic Hospital, Johannesburg, South Africa: A retrospective study. S Afr Med J. 2018;108(12):1055–8. Vaez H, Ghalehnoo ZR. Molecular characteristics of Staphylococcus aureus nasal carriage among health care workers at a Referral Hospital in Zabol, Iran. Pan Afr Med J. 2019;34. 10.11604/pamj.2019.34.196.16645 . Oliveira D, Borges A, Simões M. Staphylococcus aureus Toxins and Their Molecular Activity in Infectious Diseases. Toxins. 2018;10(6):252. Potindji TMF, Momani OAA, Omowumi BB, Baddal B. Screening of Toxin Genes in Methicillin-Resistant Staphylococcus aureus Clinical Isolates from a Hospital Setting in a Tertiary Hospital in Northern Cyprus. Pol J Microbiol. 2022;71(4):491–7. European Committe on Antimicrobial Susceptibility Testing. Antimicrobial susceptibility testing EUCAST disk diffusion method Version 8.0 January. Eur Soc Clin Microbiol Infect Deseases. 2020;0(January):1–21. Magiorakos A-P, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18(3):268–81. Vaez H, Tabaraei A, Moradi A, Ghaemi EA. Evaluation of methicillin resistance Staphylococcus aureus isolated from patients in Golestan province-north of Iran. Afr J Microbiol Res. Diep BA, Carleton HA, Chang RF, Sensabaugh GF, Perdreau-Remington F. Roles of 34 virulence genes in the evolution of hospital- and community-associated strains of methicillin-resistant Staphylococcus aureus . J Infect Dis. 2006;193(11):1495–503. Berends MS, Luz CF, Friedrich AW, Sinha BNM, Albers CJ, Glasner C. AMR: An R Package for Working with Antimicrobial Resistance Data. J Stat Softw. 2022;104(3). 10.18637/jss.v104.i03 . 2021 E. EUCAST Expert Rules ‘Intrinsic Resistance and Unusual Phenotypes’. 2021;(October). NGakoutou R. 2022. MALI MEDICAL Article Original Profils épidémiologiques, cliniques et étiologiques des pleurésies … MALI MEDICAL 2022 TOME XXXVII N°1 Profils épidémiologiques cliniques et étiologiques des pleurésies chez les patients hospitalisés dans le service de pneumo phtisiologie du point G. Ghoor A, Mabaso T, Mopeli K, Izu A, Madhi SA, Lala SG, et al. Empyema in children hospitalized at chris hani baragwanath academic hospital, Johannesburg, South Africa: A retrospective study. S Afr Med J. 2018;108(12):1055–8. Lehtomäki A, Nevalainen R, Ukkonen M, Nieminen J, Laurikka J, Khan J. Trends in the Incidence, Etiology, Treatment, and Outcomes of Pleural Infections in Adults Over a Decade in a Finnish University Hospital. Scand J Surg SJS Off Organ Finn Surg Soc Scand Surg Soc. 2020;109(2):127–32. Bobbio A, Bouam S, Frenkiel J, Zarca K, Fournel L, Canny E, et al. Epidemiology and prognostic factors of pleural empyema. Thorax. 2021;76(11):1117–23. Hassan S, Ahmed Z, Agha S, Dasari V, Stewart J, Smolderen K, et al. the Updated Estimate of Prevalence, Mortality and Hospital Length of Stay in Patients With Parapneumonic Empyema in the Us: Distribution of Health Outcomes Across Various Demographic Groups. Chest. 2019;156(4):A425–6. Najah L, Jabri H, El Khattabi W, Afif H. Profil bactériologique des pleurésies purulentes. Rev Mal Respir. 2019;36:A151. Aslam B, Wang W, Arshad MI, Khurshid M, Muzammil S, Rasool MH, et al. Antibiotic resistance: a rundown of a global crisis. Infect Drug Resist. 2018;11:1645–58. Murray CJ, Ikuta KS, Sharara F, Swetschinski L, Robles Aguilar G, Gray A, et al. Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. The Lancet. 2022;399(10325):629–55. Khan S, Yasin M, Muhammad M, Tareen S, Adeel M, Jan F. Culture and sensitivity patterns of the causative organisms isolated from the patient of Empyema Thoracis. Pak J Chest Med. 2021;27(2):80–7. Pandey RP, Mukherjee R, Chang CM. Antimicrobial resistance surveillance system mapping in different countries. Drug Target Insights. 2022;16(1):36–48. Lee AS, De Lencastre H, Garau J, Kluytmans J, Malhotra-Kumar S, Peschel A, et al. Methicillin-resistant Staphylococcus aureus . Nat Rev Dis Primer. 2018;4(1):18033. Guo Y, Song G, Sun M, Wang J, Wang Y. Prevalence and Therapies of Antibiotic-Resistance in Staphylococcus aureus . Front Cell Infect Microbiol. 2020;10(March):1–11. Khodabandeh M, Mohammadi M, Abdolsalehi MR, Alvandimanesh A, Gholami M, Bibalan MH, et al. Analysis of Resistance to Macrolide-Lincosamide-Streptogramin B Among mecA-Positive Staphylococcus Aureus Isolates. Osong Public Health Res Perspect. 2019;10(1):25–31. Mutalange M, Yamba K, Kapesa C, Mtonga F, Banda M, Muma JB, et al. Vancomycin Resistance in Staphylococcus aureus and Enterococcus Species isolated at the University Teaching Hospitals, Lusaka, Zambia: Should We Be Worried? Univ Zamb. J Agric Biomed Sci. 2021;5(1):18–28. Tam K, Torres VJ. Staphylococcus aureus Secreted Toxins and Extracellular Enzymes. Microbiol Spectr. 2019;7(2). 10.1128/microbiolspec.gpp3-0039-2018 . Lebughe M, Phaku P, Niemann S, Mumba D, Peters G, Muyembe-Tamfum JJ, et al. The impact of the Staphylococcus aureus virulome on infection in a developing country: A cohort study. Front Microbiol. 2017;8(AUG):1662. Maïga A, Dicko OA, Tchougoune LM, Fofana DB, Coulibaly DM, Maïga II. Haute prévalence des souches de staphylococcus aureus resistantes a la meticilline au centre hospitalier universitaire du Point G a Bamako (Mali) 2017. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3579825\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":303969882,\"identity\":\"15e572a6-f3d7-4d59-8f84-2d221385a504\",\"order_by\":0,\"name\":\"Aimé Césaire Kalambry\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA20lEQVRIiWNgGAWjYDACHgbGAwwMQMTewMAMEgDSBLUwQLTwHIBoAdLEapFIIFILf8/hBwd+5tzJN7j5xvBzQYUNA480AT0SZ9sMDvZue2a54XaOsfSMM2kMPHwJBKw5z2BwgHfbYQOD2zkG0rxthxnseQjokD/P/uHgX5CWm2eMf4O08BDSYnC2x+Aw2JYbPGbSRGkxPHOm4LDstmcGkmfSyqx5zqTxENQidyZ948O32+4Y8B0/vPk2T4WNHEEtcKBwgMMARBOtARgODewPiFc9CkbBKBgFIwoAAIELSOfFGnF2AAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Laboratory Teaching Hospital “Hôpital du Mali”\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Aimé\",\"middleName\":\"Césaire\",\"lastName\":\"Kalambry\",\"suffix\":\"\"},{\"id\":303969883,\"identity\":\"e7c57be6-21f1-4e64-8ef1-0742409f18a4\",\"order_by\":1,\"name\":\"Tchamou Malraux Fleury Potindji\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Ecole Supérieure des Techniques Biologiques et Alimentaires, Université de Lomé, Lomé, Togo\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tchamou\",\"middleName\":\"Malraux Fleury\",\"lastName\":\"Potindji\",\"suffix\":\"\"},{\"id\":303969884,\"identity\":\"57a57144-83d1-42d0-b35f-8eb70bcce6d4\",\"order_by\":2,\"name\":\"Ibrehima Guindo\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institut National de Santé Publique\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ibrehima\",\"middleName\":\"\",\"lastName\":\"Guindo\",\"suffix\":\"\"},{\"id\":303969885,\"identity\":\"5b1101eb-220d-4cd1-a2fd-7231715b98f0\",\"order_by\":3,\"name\":\"Ambara Kassogue\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Laboratory Teaching Hospital “Hôpital du Mali”\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ambara\",\"middleName\":\"\",\"lastName\":\"Kassogue\",\"suffix\":\"\"},{\"id\":303969886,\"identity\":\"137d282a-2857-4948-8d70-837f0b5e5e0b\",\"order_by\":4,\"name\":\"Dinanibè Kambire\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Centre National de Recherche Scientifique et Technologique (CNRST), Institut de Recherche en Sciences de la Santé (IRSS), LR-Maladies Infectieuses et Parasitaires (LR-MIP), Ouagadougou, Burkina Faso\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dinanibè\",\"middleName\":\"\",\"lastName\":\"Kambire\",\"suffix\":\"\"},{\"id\":303969887,\"identity\":\"e36ee978-bcbf-4bea-963c-2484738b91b2\",\"order_by\":5,\"name\":\"Boubacar Sidiki Ibrahim Dramé\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Laboratory Teaching Hospital “Hôpital du Mali”\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Boubacar\",\"middleName\":\"Sidiki Ibrahim\",\"lastName\":\"Dramé\",\"suffix\":\"\"},{\"id\":303969888,\"identity\":\"94581c16-e5d5-4d00-90bd-454574ec8112\",\"order_by\":6,\"name\":\"Sadio Yéna\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Service de Chirurgie Thoracique, CHU Hôpital du Mali, Bamako, Mali\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Sadio\",\"middleName\":\"\",\"lastName\":\"Yéna\",\"suffix\":\"\"},{\"id\":303969889,\"identity\":\"ae6c009c-4bad-4132-a5ec-8618a481fdd4\",\"order_by\":7,\"name\":\"Seydou Doumbia\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University Clinical Research Center (UCRC) Bamako, Mali\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Seydou\",\"middleName\":\"\",\"lastName\":\"Doumbia\",\"suffix\":\"\"},{\"id\":303969890,\"identity\":\"be6241b0-3b1a-432d-bbd8-043ca0f29ddc\",\"order_by\":8,\"name\":\"Mahamadou Diakité\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Malaria Research and Training Center (MRTC), University of Bamako, Mali\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mahamadou\",\"middleName\":\"\",\"lastName\":\"Diakité\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2023-11-08 15:00:04\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3579825/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3579825/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":56974008,\"identity\":\"41ad702e-5b15-42af-bfda-864b7e7f9d51\",\"added_by\":\"auto\",\"created_at\":\"2024-05-23 01:47:03\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":801506,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eResult of lukE/D PCR\\u003c/p\\u003e\\n\\u003cp\\u003eMT: DNA fragment size marker (100 bp); 1; 2; 3: \\u003cem\\u003eS. aureus \\u003c/em\\u003eamplicons\\u003c/p\\u003e\\n\\u003cp\\u003eCN: negative control; pb: base pair\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3579825/v1/6ea43a3978e594d7e6df0522.png\"},{\"id\":56974009,\"identity\":\"a935709f-855f-424e-b946-18c431679521\",\"added_by\":\"auto\",\"created_at\":\"2024-05-23 01:47:07\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1411568,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3579825/v1/59344124-3722-4ca6-b01d-f1d670067565.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Resistance phenotypes and molecular characteristics of Staphylococcus aureus associated with pleuritis in patients at “Hôpital du Mali” teaching hospital\",\"fulltext\":[{\"header\":\"Background\",\"content\":\"\\u003cp\\u003eBacterial pleuritis is a common and widespread condition with significant mortality and morbidity [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. Pleural infections can result from a variety of conditions and factors, such as location, demographics and comorbidities [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. Although a positive pleural fluid culture defines infection, the microbiological profile can be highly diverse [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. The viridans group and pneumococci are consistently among the most common isolates; anaerobic bacteria are also found. However, \\u003cem\\u003eS. aureus\\u003c/em\\u003e is the most frequently isolated organism[\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. Sub-Saharan Africa remains a region with significant healthcare challenges, and the prevalence and morbidity of pleural fluid infection are of great concern. A study carried out in Chad revealed a prevalence of 13.6%. Only 4% of cases were of bacterial origin, excluding tuberculous pleuritis. With another study conducted in Niger in 2016, both authors reported that the etiology of pleuritis was dominated by tuberculosis [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. Conversely, a South African study conducted over a 5-year period reported pleuritis of bacterial origin in more than half of cases. The main pathogens isolated were \\u003cem\\u003eS. aureus\\u003c/em\\u003e, \\u003cem\\u003eStreptococcus pneumoniae\\u003c/em\\u003e, tubercle bacillus and \\u003cem\\u003eKlebsiella pneumoniae\\u003c/em\\u003e, in that order [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. Research into pleural infection in sub-Saharan Africa has highlighted the predominance of \\u003cem\\u003eS. aureus\\u003c/em\\u003e as the most common causative organism [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. \\u003cem\\u003eS. aureus\\u003c/em\\u003e can evade the defense barriers of the host immune system by producing various enzymes and toxins. In fact, a strong correlation between toxins and disease has been reported. The main \\u003cem\\u003eS. aureus\\u003c/em\\u003e toxins have been divided into three groups: 1) pore-forming toxins (hemolysin-α, hemolysin-β, leukotoxin and γ-hemolysin), 2) exfoliative toxins (ET) and 3) super antigen toxins (toxic shock syndrome toxin and staphylococcal enterotoxins) [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. When first introduced, penicillin had a considerable impact on \\u003cem\\u003eS. aureus\\u003c/em\\u003e but was gradually replaced by other beta-lactam antibiotics due to the emergence of beta-lactamase-producing strains of \\u003cem\\u003eS. aureus\\u003c/em\\u003e[\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. Methicillin was introduced to treat infections caused by penicillin-resistant isolates, but the emergence of methicillin resistance in \\u003cem\\u003eS. aureus\\u003c/em\\u003e (MRSA) isolates has reduced the effectiveness of antibiotics. To reduce the spread of \\u003cem\\u003eS. aureus\\u003c/em\\u003e infections, knowledge of virulence factors and genetic diversity can provide useful information for tailoring infection control programs. Identifying these factors could help to improve patient outcomes and reduce the burden of pleural infections in this region. Therefore, the aim of this study was to describe the clinical and molecular characteristics of \\u003cem\\u003eS. aureus\\u003c/em\\u003e isolated from patients hospitalized for pleurisy in a teaching hospital in Mali.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStudy design and population\\u003c/h2\\u003e \\u003cp\\u003eThe present study was conducted as a cross-sectional investigation from October 2021 to December 2022 at the \\u0026ldquo;H\\u0026ocirc;pital du Mali\\u0026rdquo; teaching hospital in the thoracic surgery and pediatric departments among patients with pleural effusions. We obtained written consent from each participant. Review and approval of the study protocol was obtained from the ethics committee of the University of Sciences, Techniques and Technologies of Bamako, identifiable through the reference number 2021/228/USTTB from 06/09/2021.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003eSample collection\\u003c/h2\\u003e \\u003cp\\u003ePleural effusion samples were obtained by puncture (thoracentesis) for bacteriological examination, and the samples were promptly transferred to the laboratory for analysis within an hour of collection. In addition, two comorbid conditions, namely, HIV and diabetes, were sought after. For this, blood samples were collected in dry tubes and sodium fluoride tubes. After centrifugation, serum and plasma obtained from each tube were used for the determination of HIV serology and blood sugar levels, respectively.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eBacterial identification\\u003c/h2\\u003e \\u003cp\\u003ePleural effusion samples obtained previously were systematically inoculated on brain-heart infusion (BHI) and an anaerobic blood culture flask and incubated at 35\\u0026deg;C\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2\\u0026deg;C for 18\\u0026ndash;24 hours. Subsequently, fresh blood agar, enriched chocolate agar, and Sabouraud agar were inoculated using the aforementioned broths. The identification of \\u003cem\\u003eS. aureus\\u003c/em\\u003e was performed according to standard microbiological procedures published previously [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. The colonies were further subjected to agglutination using the Pastorex\\u0026reg; Staph plus kit (BioM\\u0026eacute;rieux, Marcy Etoile-Lyon). The identification of the isolates was later verified using the Phoenix M50 automaton (BD, Stockholm, Sweden) with the identification panel (PMIC/ID-600) specifically designed for gram-positive bacteria.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAntimicrobial susceptibility testing\\u003c/h2\\u003e \\u003cp\\u003eThe susceptibility of \\u003cem\\u003eS. aureus\\u003c/em\\u003e to antibiotics was tested with a comprehensive panel of 19 antibiotics, including beta-lactams, macrolides, lincosamide, aminoglycosides, quinolones, glycopeptides, oxazolidinones, cyclins, and diaminopyrimidine\\u0026thinsp;+\\u0026thinsp;sulfonamides. Briefly, the method involved a suspension of pure bacterial colonies in sterile normal saline to a turbidity of McFarland standard 0.5 and then uniformly spreading them on Muller Hinton agar (MHA) plates with antibiotic discs. The plates were ultimately incubated at 37\\u0026deg;C for 24 h. The zones of inhibition were measured in millimeters and classified as either susceptible (S) or resistant (R) and interpreted according to the EUCAST recommendations [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. Quality control was ensured using the \\u003cem\\u003eS. aureus\\u003c/em\\u003e ATCC 43300 strain.\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eS. aureus\\u003c/em\\u003e exhibiting inhibition zone diameters of 19 mm or less on the 30 \\u0026micro;g cefoxitin disk were classified as MRSA.\\u003c/p\\u003e \\u003cp\\u003eOf note, multidrug resistance was defined by the lack of susceptibility to at least one agent in three or more antibiotic classes as described previously [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e].\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDNA extraction and molecular detection of toxin genes\\u003c/h2\\u003e \\u003cp\\u003eDNA was extracted according to the method described previously[\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. Briefly, pure colonies were suspended in 200 \\u0026micro;l of Tris-EDTA solution, heated at 100\\u0026deg;C for 10 minutes, and then immediately placed at -20\\u0026deg;C for 5 to 10 minutes. After centrifugation at 12,000 rpm for 10 minutes, the obtained supernatant was used as a DNA template. Quality control of the extraction was carried out using the Thermo Scientific NanoDrop One/One\\u003csup\\u003eC\\u003c/sup\\u003e instrument. For the targeted genes:\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eLukE-D, sek, sep, sel, and bsa\\u003c/em\\u003e, the primer sequences and their respective amplicon sizes are detailed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. The amplification of the genes was achieved according to a previously described protocol using 35 thermal cycles of 95\\u0026deg;C for denaturation, 56\\u0026deg;C for hybridization, and 68\\u0026deg;C for elongation [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. The PCR products were electrophoresed on a 1.5% agarose gel with ethidium bromide at 80 milliamperes for 20 minutes and visualized using ultraviolet light using a transilluminator. A 50 bp DNA ladder was used as a size standard, which covers a size range from 50 bp to 500 bp and includes ten bands.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003edifferent sequences of primers of toxin genes and references\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer name\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ePrimer sequence (5' \\u0026rarr; 3')\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eSize of products (pb)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eReferences\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003ebsa_Forward\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eACAGAAGCTGTTAAAACTACCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003ebsa_Reverse\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGATTAATATGACAATTGAAGTGGGTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003elukE/D_Forward\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGC AACTTTTGTCAGTAGGACTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e200\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003elukE/D_Reverse\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGTCTACTTCACTGACATAACTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e200\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003esek_Forward\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGGTGTCTCTAATAGTGCCAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e200\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003esek_Reverse\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTCGTTAGTAGCTGTGACTCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e200\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003esel_ Forward\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eATCAATGGCAAGCATCAAACAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e200\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003esel _Reverse\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTGGAAGACCGTATCCTGTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e200\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003esep_Forward\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGACCTTGGTTCAAAAGACACC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e200\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003esep_Reverse\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTGTCTTGACTGAAGGTCTAGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e200\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eComorbidity identification\\u003c/h2\\u003e \\u003cp\\u003eThe presence/absence of HIV and diabetes was assessed using the Wondfo Rapid One Step HIV 1/2 test and the ABX Pentra 400 chemistry analyzer, respectively.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eData collection and analysis\\u003c/h2\\u003e \\u003cp\\u003eData were collected through a questionnaire into the Excels sheet, and the analyses were performed using Epi info version 7.2.1.0 software. The comparison of our frequencies was conducted via Fisher's exact test. A significance level of 0.05 or less for the p value was deemed statistically significant. The determination of the proportion of multidrug-resistant isolates was made using the Antimicrobial Resistance Data Analysis package \\u0026ldquo;AMR\\u0026rdquo; [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e] in RStudio (R-studio Team, 2020) according to the CMI 2012 guidelines [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e].\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePopulation features\\u003c/h2\\u003e \\u003cp\\u003eOf 6096 patients over the study period, the pooled prevalence of bacterial pleuritis in both thoracic surgery and pediatric departments was 526 (8.6%). \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e was isolated in 52 (9.8%) of the cases. Of those 52 patients, 28 (53.8%) were male and 24 (46.2%) were female, resulting in a male/female ratio of 0.85. Statistical analysis revealed no significant difference as per a potential relationship between gender and occurrence of the condition (\\u003cem\\u003ep\\u0026thinsp;=\\u0026thinsp;0.470\\u003c/em\\u003e). The median age (interquartile range) of the patients was 30 (30-43.8) years. Patients under the age of 4 and those between the ages of 50 and 90 accounted for 11 (21.2%) of cases.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eComorbidities\\u003c/h2\\u003e \\u003cp\\u003eOver the data collection period, 3 (5.8%) of the patients in the thoracic surgery department were diagnosed with diabetes, while 2 (3.8%) were HIV positive. In the pediatrics department, no cases of diabetes or HIV seropositivity were identified. It must be noted that 46 (88.5%) of the patients had taken at least one antibiotic before undergoing sampling.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eResults of antibiotic susceptibility\\u003c/h2\\u003e \\u003cp\\u003eIn both the Thoracic Surgery and Pediatrics departments, all \\u003cem\\u003eS. aureus\\u003c/em\\u003e strains exhibited 100% resistance to penicillin-G. In terms of oxacillin resistance, we observed rates of 63.9% and 50% in the Thoracic Surgery and Pediatrics departments, respectively. Notably, none of the pediatric isolates showed resistance to vancomycin, daptomycin, moxifloxacin, or fosfomycin. The resistance patterns of \\u003cem\\u003eS. aureus\\u003c/em\\u003e strains to various antibiotics are provided in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e. In the Thoracic Surgery department, MRSA was represented for 26 (72.8%) cases, while in Pediatrics, it accounted for 13 (81.2%). The most effective antibiotics were fosfomycin 2 (3.8%), fusidic acid 3 (5.8%), daptomycin 3 (5.8%), vancomycin 5 (9.6%) and teicoplanin 6 (11.5%). The K and KT phenotypes of aminoglycosides were 17 (46.2%) in Thoracic Surgery and 7 (43.8%) in Pediatrics. Regarding the antibiotic resistance patterns in MRSA, a significant association was reported for the constitutive MLS\\u003csub\\u003eb\\u003c/sub\\u003e phenotype (n\\u0026thinsp;=\\u0026thinsp;39; \\u003cem\\u003ep\\u0026thinsp;\\u0026le;\\u0026thinsp;0.000\\u003c/em\\u003e).\\u003c/p\\u003e \\u003cp\\u003eOf the 52 strains of \\u003cem\\u003eS. aureus\\u003c/em\\u003e, 47 (90.4%) were multidrug resistant. Moreover, according to EUCAST Expert Rules version 3.3, we found 18 (34.6%) isolates exhibiting unusual resistance phenotypes [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eMSSA had a higher and significant percentage of susceptibility to aminoglycosides 10 (76.9%) compared to MRSA 18 (46.2%) (\\u003cem\\u003ep\\u0026thinsp;=\\u0026thinsp;0.05\\u003c/em\\u003e). Compared to macrolides, the constitutive MLSB phenotype was 1 (7.7%) in MSSA strains and 39 (100%) in MRSA. A significant relationship concerning MRSA was found (odds ratio: 0.0769; \\u003cem\\u003ep\\u0026thinsp;=\\u0026thinsp;0.000\\u003c/em\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eAntibiotic resistance of S. aureus isolates\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eThoracic surgery\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003ePediatrics\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eTotal\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eAntibiotics\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eResistant n(%)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eResistant n(%)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eResistant n(%)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePenicillin-G\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e36(100)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e16(100)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e52(100)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eOxacillin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e29(80.6)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e13(81.3)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e42(80,8)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCefoxitin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e26(72,8)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e13(81,2)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e39(75)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eAmikacin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e17(47,2)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e7(43,8)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e24(46,2)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGentamicin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e15(41,7)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5(31,2)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e20(38,5)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTobramycin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e19(52,8)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e7(43,8)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e24(46,2)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLevofloxacin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e12(33,3)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e4(25,0)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e16(30,8)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCiprofloxacin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e12(33,3)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e4(25,0)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e16(30,8)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMoxifloxacin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e9(25,0)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0(0)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e9(17,3)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTetracyclin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e35(97,2)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e15(93,8)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e50(96,2)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eErythromycin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e28(77,8)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e14(87,5)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e42(80,8\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eClindamycin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e4(11,1)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1(6,2)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e40(76,9)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLinolezid\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e9(25,0)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e4(25,0)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e13(25,0)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTeicoplanin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5(13,9)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1(6,2)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e6(11,5)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eDaptomycin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e3(8,3)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0(0)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e3(5,8)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTrim\\u0026eacute;thoprim\\u0026thinsp;+\\u0026thinsp;sulfam\\u0026eacute;thoxazole\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e26(72,2)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e11(68,8)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e37(71,2)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eFosfomycine\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e2(5.6)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0(0)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e2(3.8)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eVancomycin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5(13.9)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0(0)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e5(9.6)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eFusidic acid\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1(2.8)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1(6.2)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e3(5.8)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eMolecular detection of toxin genes\\u003c/h2\\u003e \\u003cp\\u003eIn thoracic surgery, the toxin known as leucocidin \\u003cem\\u003elukE/D\\u003c/em\\u003e was detected in 7.7% of patients (n\\u0026thinsp;=\\u0026thinsp;4), as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. The toxins known as \\u003cem\\u003esek\\u003c/em\\u003e, \\u003cem\\u003ebsa\\u003c/em\\u003e, \\u003cem\\u003esel\\u003c/em\\u003e, and \\u003cem\\u003esep\\u003c/em\\u003e were not detected in any of the patients.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003ePatients referred to the Thoracic Surgery Department and the Pediatrics Department with pleurisy presented with \\u003cem\\u003eS. aureus\\u003c/em\\u003e infections. The hospital frequency of pleurisy at H\\u0026ocirc;pital du Mali teaching hospital was 8.6%. Our results are lower than those reported by NGakoutou R et al, 2022, who cited in a 2006 study reporting a frequency of 15.9% in a pneumological setting. This could be explained by the evolution of practices in case management. This result is lower than those reported by some African authors (13.8% in Chad and 42.2% in South Africa) [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. In developed countries, the hospital prevalence of pleurisy was 7.75 cases in 2017 in France and 9.9 cases per 100,000 inhabitants in Finland in 2017 [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. An upward trend was found in the United States in Missouri. The weighted prevalence of empyema was 95.5 per 100,000 hospitalizations per year. It varied according to race and represented 68.10 per 100,000 inhabitants for white and black patients, respectively [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. This increase would be linked to the emergence of bacterial strains with reduced sensitivity or expressing increased virulence. The male predominance in our study, although there was no significant difference, has been reported by other authors [\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. Most of the children in our study had their vaccination status up-to-date and had a protective effect against certain pathogens with respiratory tropism, such as \\u003cem\\u003eStreptococcus pneumoniae\\u003c/em\\u003e and \\u003cem\\u003eHaemophilus influenzae.\\u003c/em\\u003e These agents are indeed covered by the vaccination of the Expanded Programme on Immunization (EPI) carried out in Mali. The median age in our study was 30 years, which could be explained by the greater activity at this age of the life cycle in our country.\\u003c/p\\u003e \\u003cp\\u003eThe issue of antibiotic resistance has been consistently identified by the World Health Organization (WHO) as a top global health priority and a critical public health menace of the current century. In Africa, the mortality rate caused by antimicrobial resistance stands out as the highest in the world, with 24 deaths per 100,000 individuals [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eIn our facility, the most prescribed antibiotics to treat staphylococcal pleurisy are gentamicin (GEN) and ciprofloxacin (CIP). Our isolates showed a resistance of 38.5% to GEN and 30.8% to CIP. Our results are lower than those reported by some authors who found 72.6% resistance to GEN and 71.7% resistance to CIP [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. For aminoglycosides, there was no significant difference between the presence of the sensitive phenotype in MRSA and MSSA (\\u003cem\\u003ep\\u0026thinsp;=\\u0026thinsp;0.05\\u003c/em\\u003e). According to the guidelines of the American Association of Thoracic Surgery (AATS) and the British Thoracic Society (BTS), aminoglycosides should be avoided in the management of pleurisy, while other authors advise (13) molecules in the treatments for MRSA infections [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eS. aureus\\u003c/em\\u003e penicillinase is species specific, plasmid-borne, and transmissible. It gives it resistance to penicillins G, V and A, carboxypenicillins and ureido-penicillins. More than 90% of \\u003cem\\u003eS. aureus\\u003c/em\\u003e isolated from pathological products in the hospital environment are penicillinase producers [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. In our study, penicillinase G was observed in 100% of our isolates. This observation confirms the strong trend of resistance of staphylococci to penicillin. In addition to their intrinsic resistance to beta-lactams, hospital-associated MRSA strains often show a variable but alarming level of multidrug resistance, which limits the possibilities of treatment to the few remaining effective drugs.\\u003c/p\\u003e \\u003cp\\u003eMRSA poses a significant threat to public health, particularly in developing countries, due to its ability to cause life-threatening infections [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. MRSA prevalence data in Africa are variable in terms of coverage and quality. They are available for South Africa, Nigeria and the countries of the Mediterranean basin but are fragmentary for the other countries [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. Some come from single center studies, and others come from larger but few surveillance systems. Many studies have relied on phenotypic methods to identify MRSA.\\u003c/p\\u003e \\u003cp\\u003eIn our study, 75% of MRSA isolates were encountered. Some authors have reported an MRSA prevalence of 80.9% in Cyprus in 2022 [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. In 2018, a study bringing together data from a large number of countries estimated the prevalence of MRSA to be between 25 and 50% for Algeria, Morocco and Cameroon compared to 10 to 25% for the Republic of Ivory Coast and Senegal; Mali had not provided data [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. The variation between countries could be partly explained by differences in the availability and use of antimicrobials, the incidence of HIV infection (a risk factor for MRSA colonization) and differences in local infection control practices and specific pathogen characteristics of circulating clones. Due to differences in the extent of collection and testing methods, care should be taken when comparing data between countries.\\u003c/p\\u003e \\u003cp\\u003eFor macrolide resistance, the inducible MLS \\u003csub\\u003eb phenotype\\u003c/sub\\u003e was more frequent in MSSA than in MRSA (15.4%) (p\\u0026thinsp;=\\u0026thinsp;0.04). On the other hand, the constitutive MLS \\u003csub\\u003eb phenotype\\u003c/sub\\u003e was more frequent in MRSA than in MSSA (100%) (p\\u0026thinsp;=\\u0026thinsp;0.000). We noted a 56.2% predominance of the constitutive MLS \\u003csub\\u003eb phenotype\\u003c/sub\\u003e against 22.9% of the inducible MLS \\u003csub\\u003eb phenotype\\u003c/sub\\u003e in Iran [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. Compared to vancomycin, the resistance is 9.6%. No resistance to vancomycin was detected in Zambia by the authors in hospital settings [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. Vancomycin is the drug of choice used in the hospital setting to treat MRSA infections. Our results could perhaps be explained by the possible acquisition of resistance to vancomycin. The choice of this antibiotic to treat MRSA may also cause the emergence of vancomycin resistance.\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eS. aureus\\u003c/em\\u003e is a pathogen whose strong adaptive power allows survival through the successive acquisition of antibiotic resistance genes, growth regulatory mechanisms in the presence of antibiotics and specific virulence factors. The vigilance of clinicians and microbiologists is needed to signal the emergence of new epidemiological phenomena, as well as to ensure compliance with prevention instructions and the judicious use of antibiotics, both in hospitals and in the community.\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eS. aureus\\u003c/em\\u003e has a vast arsenal of virulence factors (including adhesive, immunomodulatory, and host cell-damaging molecules) whose presence or specificity varies from clone to clone, a variability that is reflected in the wide variety of infections this bacterium can cause [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. Many virulence genes are found on mobile genetic elements; thus, their combination differs significantly between clones and even between closely related strains. The potential association of specific virulence factors with certain types of \\u003cem\\u003eS. aureus infections\\u003c/em\\u003e or their severity remains difficult to establish, probably due to the number of these factors and their redundant functions.\\u003c/p\\u003e \\u003cp\\u003eCertain staphylococcal toxins are responsible for specific clinical syndromes with sometimes very poor prognosis. This is Panton-Valentine Leucocidin (PVL). Leukocidin E (\\u003cem\\u003eLukE\\u003c/em\\u003e/\\u003cem\\u003eD\\u003c/em\\u003e) is a porogenic toxin produced by \\u003cem\\u003eS. aureus\\u003c/em\\u003e that lyses host cells and promotes the virulence of the bacterium; it is hemolytic, unlike PVL [\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eWe found 7.7% positivity for \\u003cem\\u003elukE/D.\\u003c/em\\u003e This rate is lower than those obtained by some authors, 44.3% in 2022 in China and 68.3% in 2017 in the Democratic Republic of Congo [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]. The absence of virulence factors \\u003cem\\u003esek, bsa, sep and sel\\u003c/em\\u003e during our study could indicate that the isolates obtained do not possess enterotoxin genes.\\u003c/p\\u003e \\u003cp\\u003eClindamycin, linezolid, teicoplanin, daptomycin, fosfomycin, vancomycin, moxifloxacin and fusidic acid were the most active antibiotics on our isolates during this study. On the other hand, at the Point G teaching hospital, Maiga A et al., 2017, found that the most active antibiotics were fusidic acid, the association amoxicillin\\u0026thinsp;+\\u0026thinsp;clavulanic acid and pristinamycin [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. In this group of antibiotics, the resistance to fusidic acid was 5.8%, which implies that this antibiotic still remains active against \\u003cem\\u003eS. aureus\\u003c/em\\u003e isolates.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eLimitations\\u003c/h2\\u003e \\u003cp\\u003eOur study was limited to a single hospital and is therefore not representative of the whole country; however, the profile of the affected population and their behavior are typical of the country. We did not perform molecular typing (clonal complex, sequence typing, \\u003cem\\u003eSCCmec\\u003c/em\\u003e typing), molecular detection of the \\u003cem\\u003emecA gene\\u003c/em\\u003e coding for methicillin resistance, and even less molecular confirmation of the phenotypic identification of \\u003cem\\u003eS. aureus\\u003c/em\\u003e by detection of the \\u003cem\\u003enuc\\u003c/em\\u003e gene coding for thermonuclease.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eThe results of our study indicate that \\u003cem\\u003eS. aureus\\u003c/em\\u003e is frequent among patients with pleurisy admitted to the Hospital of Mali Teaching Hospital, and the frequency of MRSA is alarming at 75%, particularly in the absence of a national prevalence assessment. This study can serve as a reference for monitoring the development of MRSA and setting up a surveillance system at the hospital. Our findings suggest that the current empirical treatment protocol for pleurisy, which consists of ciprofloxacin and gentamicin, may need to be revised.\\u003c/p\\u003e \\u003cp\\u003eDespite the limited exploration of the frequency and severity of MRSA pleurisy in our country, our study highlights the importance of implementing infection prevention measures, such as the establishment of an infection control team and admission screening for MRSA. Furthermore, a better understanding of the epidemiology of these infections and the development of effective therapeutic strategies are essential for clinicians to prevent the spread of these infections.\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"434\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"19.54022988505747%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ePCR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"80.45977011494253%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003ePolymerase Chain Reaction\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"19.54022988505747%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eS.aureus\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"80.45977011494253%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eStaphylococcus aureus\\u0026nbsp;\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"19.54022988505747%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eMRSA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"80.45977011494253%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eMethicillin-Resistant \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"19.54022988505747%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eUSTTB\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"80.45977011494253%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eUniversity of Sciences, Techniques and Technologies of Bamako\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"19.54022988505747%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eEUCAST\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"80.45977011494253%\\\" valign=\\\"top\\\"\\u003eEuropean Committee on Antimicrobial Susceptibility Testing\\u003cbr\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"19.54022988505747%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eMSSA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"80.45977011494253%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eMethicillin-Sensible \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"19.54022988505747%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eMHA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"80.45977011494253%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eMuller Hinton Agar\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"19.54022988505747%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHIV/AIDS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"80.45977011494253%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHuman Immunodeficiency Virus/\\u0026nbsp;Acquired Immune Deficiency Syndrome\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"19.54022988505747%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eDNA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"80.45977011494253%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eDeoxyribonucleic Acid\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"19.54022988505747%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eEPI\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"80.45977011494253%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eExpanded Programme on Immunization\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp skip=\\\"true\\\"\\u003eWe thank the National Institutes of Health through the Fogarty international grant D43TW008652 for doctoral registration fees. The authors would like to thank the managers of the molecular biology laboratories of the National Public Health Institute and the University Center for Clinical Research in Mali.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors\\u0026rsquo; contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp skip=\\\"true\\\"\\u003eStudy initiation and design: Sadio Y\\u0026eacute;na, funds collection: S\\u0026eacute;ydou Doumbia, Data collection: Aim\\u0026eacute; C\\u0026eacute;saire Kalambry, Ambara Kassogu\\u0026eacute;, Data interpretation, literature review, laboratory procedures, Statistical test, manuscript preparation: Aim\\u0026eacute; C\\u0026eacute;saire Kalamabry, Tchamou Malraux Fleury Potindji, Supervision of works: Ibrehima Guindo, Dinanib\\u0026egrave; Kambir\\u0026eacute;, Boubacar Sidiki Ibrahim Dram\\u0026eacute;, and Mahamadou Diakit\\u0026eacute;. All the authors read and approved the final version of the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAs this work is part of a PhD thesis, we did not receive any funding for it.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData Availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll the information supporting our conclusions and appropriate references are included in the manuscript. The datasets used and analyzed in the current study are also available from the corresponding author.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eReview and approval of the study protocol was obtained from the ethics committee of the University of Sciences, Techniques and Technologies of Bamako, identifiable through the reference number 2021/228/USTTB from 06/09/2021. All participants provided written informed consent prior to their inclusion in the study.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare no competing interests.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor details\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003csup\\u003e1\\u003c/sup\\u003e Laboratory Teaching Hospital \\u0026ldquo;H\\u0026ocirc;pital du Mali\\u0026rdquo;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003csup\\u003e2\\u003c/sup\\u003e Ecole Sup\\u0026eacute;rieure des Techniques Biologiques et Alimentaires, Universit\\u0026eacute; de Lom\\u0026eacute;, Lom\\u0026eacute;, Togo\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003csup\\u003e3\\u003c/sup\\u003e Institut National de Sant\\u0026eacute; Publique, Bamako, Mali\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003csup\\u003e4\\u0026nbsp;\\u003c/sup\\u003eService de Chirurgie\\u0026nbsp;Thoracique, CHU H\\u0026ocirc;pital du Mali, Bamako, Mali\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003csup\\u003e5\\u003c/sup\\u003e University Clinical Research Center (UCRC) Bamako, Mali\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003csup\\u003e6\\u0026nbsp;\\u003c/sup\\u003eMalaria Research and Training Center (MRTC), University of Bamako, Mali\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003csup\\u003e7\\u003c/sup\\u003e Centre National de Recherche Scientifique et Technologique (CNRST), Institut de Recherche en Sciences de la Sant\\u0026eacute; (IRSS), LR-Maladies Infectieuses et Parasitaires (LR-MIP), Ouagadougou, Burkina Faso.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eBedawi EO, Hassan M, McCracken D, Rahman NM. Pleural infection: a closer look at the etiopathogenesis, microbiology and role of antibiotics. Expert Rev Respir Med. 2019;13(4):337\\u0026ndash;47.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePark J, Kim SJ, Kim H, Jung H, Shin HY. Ultrasound diagnosis and treatment of intractable anterior chest pain from golf - A case report \\u0026ndash;. Anesth Pain Med. 2023;18(1):65\\u0026ndash;9.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRoy B, Shak HJ, Lee YCG. Pleural fluid investigations for pleural infections. J Lab Precis Med. 2021;6(April). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.21037/jlpm-2021-01\\u003c/span\\u003e\\u003cspan address=\\\"10.21037/jlpm-2021-01\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHassan M, Cargill T, Harriss E, Asciak R, Mercer RM, Bedawi EO, et al. The microbiology of pleural infection in adults: a systematic review. Eur Respir J. 2019;54(3). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1183/13993003.00542-2019\\u003c/span\\u003e\\u003cspan address=\\\"10.1183/13993003.00542-2019\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAvner BS, Ginosyan A, Le J, Mak J, Qiryaqoz Z, Huffman C. Analysis of antibiotic use and clinical outcomes in adults with known and suspected pleural empyema. BMC Infect Dis. 2022;22(1):783.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAssao Neino MM, Gagara Im A, Ou\\u0026eacute;draogo AR, Maizoumbou D. Current state of pleurisy in Pulmophtisiology Department of Lamorde National Hospital in Niamey, Niger. J Funct Vent Pulmonol. 2016;7(21):15\\u0026ndash;9.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNGakoutou R, Allawaye L, Ahamat A, Boltia MA, Mada J, Koboye A, Danda, Mihimit A. Profils \\u0026eacute;pid\\u0026eacute;miologiques cliniques et \\u0026eacute;tiologiques des pleur\\u0026eacute;sies chez les patients hospitalis\\u0026eacute;s dans le service de pneumo-phtisiologie de l\\u0026rsquo;HGRN de N\\u0026rsquo;Djamena au Tchad: \\u0026agrave; propos de 130 cas. Mali Med. 2022 37.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGhoor A, Mabaso T, Mopeli K, Izu A, Madhi SA, Lala SG, et al. Empyema in children hospitalized at Chris Hani Baragwanath Academic Hospital, Johannesburg, South Africa: A retrospective study. S Afr Med J. 2018;108(12):1055\\u0026ndash;8.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVaez H, Ghalehnoo ZR. Molecular characteristics of \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e nasal carriage among health care workers at a Referral Hospital in Zabol, Iran. Pan Afr Med J. 2019;34. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.11604/pamj.2019.34.196.16645\\u003c/span\\u003e\\u003cspan address=\\\"10.11604/pamj.2019.34.196.16645\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOliveira D, Borges A, Sim\\u0026otilde;es M. \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e Toxins and Their Molecular Activity in Infectious Diseases. Toxins. 2018;10(6):252.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePotindji TMF, Momani OAA, Omowumi BB, Baddal B. Screening of Toxin Genes in Methicillin-Resistant \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e Clinical Isolates from a Hospital Setting in a Tertiary Hospital in Northern Cyprus. Pol J Microbiol. 2022;71(4):491\\u0026ndash;7.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEuropean Committe on Antimicrobial Susceptibility Testing. Antimicrobial susceptibility testing EUCAST disk diffusion method Version 8.0 January. Eur Soc Clin Microbiol Infect Deseases. 2020;0(January):1\\u0026ndash;21.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMagiorakos A-P, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18(3):268\\u0026ndash;81.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVaez H, Tabaraei A, Moradi A, Ghaemi EA. Evaluation of methicillin resistance \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e isolated from patients in Golestan province-north of Iran. Afr J Microbiol Res.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDiep BA, Carleton HA, Chang RF, Sensabaugh GF, Perdreau-Remington F. Roles of 34 virulence genes in the evolution of hospital- and community-associated strains of methicillin-resistant \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e. J Infect Dis. 2006;193(11):1495\\u0026ndash;503.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBerends MS, Luz CF, Friedrich AW, Sinha BNM, Albers CJ, Glasner C. AMR: An R Package for Working with Antimicrobial Resistance Data. J Stat Softw. 2022;104(3). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.18637/jss.v104.i03\\u003c/span\\u003e\\u003cspan address=\\\"10.18637/jss.v104.i03\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e2021 E. EUCAST Expert Rules \\u0026lsquo;Intrinsic Resistance and Unusual Phenotypes\\u0026rsquo;. 2021;(October).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNGakoutou R. 2022. MALI MEDICAL Article Original Profils \\u0026eacute;pid\\u0026eacute;miologiques, cliniques et \\u0026eacute;tiologiques des pleur\\u0026eacute;sies \\u0026hellip; MALI MEDICAL 2022 TOME XXXVII N\\u0026deg;1 Profils \\u0026eacute;pid\\u0026eacute;miologiques cliniques et \\u0026eacute;tiologiques des pleur\\u0026eacute;sies chez les patients hospitalis\\u0026eacute;s dans le service de pneumo phtisiologie du point G.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGhoor A, Mabaso T, Mopeli K, Izu A, Madhi SA, Lala SG, et al. Empyema in children hospitalized at chris hani baragwanath academic hospital, Johannesburg, South Africa: A retrospective study. S Afr Med J. 2018;108(12):1055\\u0026ndash;8.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLehtom\\u0026auml;ki A, Nevalainen R, Ukkonen M, Nieminen J, Laurikka J, Khan J. Trends in the Incidence, Etiology, Treatment, and Outcomes of Pleural Infections in Adults Over a Decade in a Finnish University Hospital. Scand J Surg SJS Off Organ Finn Surg Soc Scand Surg Soc. 2020;109(2):127\\u0026ndash;32.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBobbio A, Bouam S, Frenkiel J, Zarca K, Fournel L, Canny E, et al. Epidemiology and prognostic factors of pleural empyema. Thorax. 2021;76(11):1117\\u0026ndash;23.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHassan S, Ahmed Z, Agha S, Dasari V, Stewart J, Smolderen K, et al. the Updated Estimate of Prevalence, Mortality and Hospital Length of Stay in Patients With Parapneumonic Empyema in the Us: Distribution of Health Outcomes Across Various Demographic Groups. Chest. 2019;156(4):A425\\u0026ndash;6.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNajah L, Jabri H, El Khattabi W, Afif H. Profil bact\\u0026eacute;riologique des pleur\\u0026eacute;sies purulentes. Rev Mal Respir. 2019;36:A151.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAslam B, Wang W, Arshad MI, Khurshid M, Muzammil S, Rasool MH, et al. Antibiotic resistance: a rundown of a global crisis. Infect Drug Resist. 2018;11:1645\\u0026ndash;58.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMurray CJ, Ikuta KS, Sharara F, Swetschinski L, Robles Aguilar G, Gray A, et al. Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. The Lancet. 2022;399(10325):629\\u0026ndash;55.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKhan S, Yasin M, Muhammad M, Tareen S, Adeel M, Jan F. Culture and sensitivity patterns of the causative organisms isolated from the patient of Empyema Thoracis. Pak J Chest Med. 2021;27(2):80\\u0026ndash;7.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePandey RP, Mukherjee R, Chang CM. Antimicrobial resistance surveillance system mapping in different countries. Drug Target Insights. 2022;16(1):36\\u0026ndash;48.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLee AS, De Lencastre H, Garau J, Kluytmans J, Malhotra-Kumar S, Peschel A, et al. Methicillin-resistant \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e. Nat Rev Dis Primer. 2018;4(1):18033.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGuo Y, Song G, Sun M, Wang J, Wang Y. Prevalence and Therapies of Antibiotic-Resistance in \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e. Front Cell Infect Microbiol. 2020;10(March):1\\u0026ndash;11.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKhodabandeh M, Mohammadi M, Abdolsalehi MR, Alvandimanesh A, Gholami M, Bibalan MH, et al. Analysis of Resistance to Macrolide-Lincosamide-Streptogramin B Among mecA-Positive Staphylococcus Aureus Isolates. Osong Public Health Res Perspect. 2019;10(1):25\\u0026ndash;31.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMutalange M, Yamba K, Kapesa C, Mtonga F, Banda M, Muma JB, et al. Vancomycin Resistance in \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e and Enterococcus Species isolated at the University Teaching Hospitals, Lusaka, Zambia: Should We Be Worried? Univ Zamb. J Agric Biomed Sci. 2021;5(1):18\\u0026ndash;28.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTam K, Torres VJ. \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e Secreted Toxins and Extracellular Enzymes. Microbiol Spectr. 2019;7(2). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1128/microbiolspec.gpp3-0039-2018\\u003c/span\\u003e\\u003cspan address=\\\"10.1128/microbiolspec.gpp3-0039-2018\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLebughe M, Phaku P, Niemann S, Mumba D, Peters G, Muyembe-Tamfum JJ, et al. The impact of the \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e virulome on infection in a developing country: A cohort study. Front Microbiol. 2017;8(AUG):1662.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMa\\u0026iuml;ga A, Dicko OA, Tchougoune LM, Fofana DB, Coulibaly DM, Ma\\u0026iuml;ga II. Haute pr\\u0026eacute;valence des souches de staphylococcus aureus resistantes a la meticilline au centre hospitalier universitaire du Point G a Bamako (Mali) 2017.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Bacterial pleuritis, S. aureus, multidrug resistance, virulence, Mali\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3579825/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3579825/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e \\u003cp\\u003e \\u003cem\\u003eStaphylococcus aureus (S. aureus) is\\u003c/em\\u003e one of the pathogens strongly implicated in hospital infections. Data on the resistance and molecular characteristics of this bacterium are rare in Mali.\\u003c/p\\u003e\\u003ch2\\u003eObjective\\u003c/h2\\u003e \\u003cp\\u003eThis study aimed to evaluate the antibiotic resistance patterns, virulence factors of \\u003cem\\u003eS. aureus\\u003c/em\\u003e isolates from pleural fluid infections in hospitalized patients.\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e \\u003cp\\u003ePleural effusion samples were obtained by thoracentesis for bacteriological examination from October 2021 to December 2022 at the \\u0026ldquo;H\\u0026ocirc;pital du Mali\\u0026rdquo; teaching hospital. Comorbidities such as HIV/AIDS and diabetes were assessed. Standard microbiological procedures were used for bacterial identification. The disk diffusion method was used to identify methicillin-resistant \\u003cem\\u003eS. aureus\\u003c/em\\u003e. The PCR amplification method was used to detect the following genes: \\u003cem\\u003elukE/D\\u003c/em\\u003e, \\u003cem\\u003esek\\u003c/em\\u003e, \\u003cem\\u003ebsa\\u003c/em\\u003e, \\u003cem\\u003esel\\u003c/em\\u003e, and \\u003cem\\u003esep.\\u003c/em\\u003e\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e \\u003cp\\u003eThis study analyzed 6096 samples from inpatients and found a pooled frequency of bacterial pleuritis of 526 (8.6%) in thoracic surgery and pediatric wards. \\u003cem\\u003eS. aureus\\u003c/em\\u003e was isolated in 52 (9.88%) cases, of which 39 (75%) isolates were MRSA. There was no significant difference between the sexes (\\u003cem\\u003ep\\u0026thinsp;=\\u0026thinsp;1.00\\u003c/em\\u003e). The median age of the patients was 30 years. All \\u003cem\\u003eS. aureus\\u003c/em\\u003e isolates showed resistance to penicillin-G. The leucocidin \\u003cem\\u003elukE/D\\u003c/em\\u003e toxin was detected in 7.7% of thoracic surgery patients, but \\u003cem\\u003esek\\u003c/em\\u003e, \\u003cem\\u003ebsa\\u003c/em\\u003e, \\u003cem\\u003esel\\u003c/em\\u003e, and \\u003cem\\u003esep\\u003c/em\\u003e toxins were not found.\\u003c/p\\u003e\\u003ch2\\u003eConclusion\\u003c/h2\\u003e \\u003cp\\u003eIn this study, we found a high frequency of \\u003cem\\u003eS. aureus\\u003c/em\\u003e (and MRSA) in pleurisy patients at the \\u0026ldquo;H\\u0026ocirc;pital du Mali\\u0026rdquo;. Only the leukocidin \\u003cem\\u003elukE/D\\u003c/em\\u003e was found. The empirical treatment protocol for pleurisy may need revision. Clindamycin, linezolid, teicoplanin, daptomycin, fosfomycin, vancomycin, moxifloxacin and fusidic acid were the most active antibiotics on our isolates in this study. Infection prevention measures, active surveillance, and effective therapeutic options are recommended.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Resistance phenotypes and molecular characteristics of Staphylococcus aureus associated with pleuritis in patients at “Hôpital du Mali” teaching hospital\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-05-23 01:46:58\",\"doi\":\"10.21203/rs.3.rs-3579825/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"0f8d2f79-c8fb-40b6-89ad-0acb8ca6dc70\",\"owner\":[],\"postedDate\":\"May 23rd, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-05-23T01:46:58+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-05-23 01:46:58\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3579825\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3579825\",\"identity\":\"rs-3579825\",\"version\":[\"v1\"]},\"buildId\":\"7rjqhiLT3MXkJMwkYKINL\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}