{"paper_id":"0630bd85-9861-4ee3-99f6-c7d086e2295b","body_text":"Multiplex Real-Time PCR Assessment of Semen Quality and Male Fertility Impacted by Sexually Transmitted Infections | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Multiplex Real-Time PCR Assessment of Semen Quality and Male Fertility Impacted by Sexually Transmitted Infections Anwer Jaber Faisal, Mokhtar Jawad Al-Imam, Alaa Saadi Abbood This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3993380/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 31 Mar, 2025 Read the published version in Acta Microbiologica Bulgarica → Version 1 posted You are reading this latest preprint version Abstract Introduction : Sexually transmitted diseases (STDs) are a severe problem because many infections are asymptomatic or have fewer symptoms and account for about 20% of male infertility. Objective: This study developed Real-time PCR kits to detect Treponema pallidum , Neisseria gonorrhoeae , Mycoplasma species, and Trichomonas vaginalis in infertile and fertile men's semen. Methods : Men aged 24–55 with no children and a conceiving issue were the patient group, while men aged 18–49 with at least one child and a standard seminal fluid check were the control group. The Amplisens® MULTIPRIME-FRT PCR kit was used to analyze the DNA for the human beta-globin HBB gene to determine if it came from the isolated pathogen. Results: The study revealed that out of the patient group, 22 out of 54 individuals tested positive (40.9%) for N. gonorrhoeae , 7 out of 54 (31.8%) for T. pallidum , 4 out of 54 (18.18%) for M. genitalium , and 2 out of 54 (9.09%) for T. vaginalis . In the control group, which consisted of 13 males, only one infection with N. gonorrhoeae was detected. Conclusion : The four urogenital infections evaluated were common in infertile people. However, they may not be the only cause of male infertility in this region. Infertility STD Neisseria gonorrhoeae Semen PCR Figures Figure 1 Figure 2 Figure 3 1. introduction Infections of the male genitourinary tract are a significant health concern, accounting for over 20% of all male infertility cases (1) . Male infertility can be idiopathic or result from various circumstances, such as immunogenic abnormalities, anatomical and genetic diseases, inflammation, and infection (2) . The primary cause of infertility in many males is pathological issues., but they are often misdiagnosed and treated, leaving the female partner to carry most of the burden of infertility. It is, therefore, critical to \"understand\" the causes of male infertility so that they can be appropriately diagnosed and treated (3) . Infections of the reproductive tract caused by bacteria, viruses, fungi, and parasitic microorganisms that are transmitted through sexual activity and cause sexually transmitted diseases (STDs) are a severe problem because many infections are asymptomatic or have fewer symptoms and account for about 20% of male infertility (4) . Treponema pallidum, Neisseria gonorrhoeae, Mycoplasma species, Ureaplasma species, Trichomonas vaginalis , and many viruses such as Herpes simplex type 1 and type 2, Human papillomavirus and Hepatitis B & C, which cause acute and chronic infections, have been found in the semen of asymptomatic guys and the resultant inflammations in the male reproductive system, cause spermatozoa to malfunction, resulting in lower sperm quality, sperm count, and sperm motility (5) . In the past three decades, the diagnosis of STDs, particularly in developing nations, has relied chiefly on conventional techniques like culture, enzyme immunoassay, and fluorescent antibody staining (6) . Screening semen samples requires quick, sensitive, adaptable, and affordable diagnostic methods. The main aim of this study was to determine the role of sexually transmitted diseases (STDs) on semen quality and male infertility, in addition to designing specific diagnostic kits for Real-time PCR for screening the presence of Treponema pallidum, Neisseria gonorrhoeae, Mycoplasma species , and Trichomonas vaginalis in the semen of infertile men.” We predict that multiplex real-time PCR may be more effective at detecting STDs in semen and contributing to a decline in male infertility. 2. Materials and Methods 2.1. Semen collection and study groups Two groups were chosen during this study; the patient groups' age varied from (24–55), which consisted of men with no children and a conceiving issue due to poor seminal fluid quality, sperm count, motility, and morphology values that were below the WHO (2010) lower reference criteria (7) . Males (18–49) with at least one child and a standard seminal fluid examination were considered the control group. The study's ethical approval was obtained from the ethical committee of the Central Health Laboratory in Baghdad, Iraq. 2.2. Seminal collection and preparation After 3–5 days of sexual abstinence, a sample of sperm was taken to the lab; the participants were told to follow a precise method, both orally and in writing, as follows: first, they had to urinate, then wash their hands with soap. Secondly, they must use antibacterial soap to wash their vaginal area before rinsing it with a physiological saline solution. Finally, the sperm acquired through masturbation was collected and preserved in a sterile, non-toxic container in the laboratory. The World Health Organization's standard manual assessed sperm count, motility, and morphology (7) . 2.3. DNA extraction and Human Beta-globin gene (HBB) detection by a Conventional Polymerase Chain Reaction (PCR). Presto™ Sperm DNA Extraction Kit (Taiwan) is used to extract whole genomic DNA from seminal samples; determination of DNA quantity and quality is done by using nanodrop at 260/280 nm and gel electrophoresis; the extracted DNA was tested for the human beta-globin HBB gene as a reference gene. The forward and reverse primers for the human HBB gene were 5′ AGTCAGGGCAGAGCCATCTA 3′ and 5′ CCTCACCACCAACTTCATCC 3′. 2.4. Selection of Sexual Transmitted Agents Treponema pallidum, Neisseria gonorrhoeae, Mycoplasma genitalium , and Trichomonas vaginalis were selected pathogens to be detected in this study since all the mentioned pathogens can cause sexually transmitted infections among couples and hurt semen parameters. 2.5. Multiplex real-time PCR for qualitatively detecting sexually transmitted Bacteria. Amplisens ® MULTIPRIME-FRT PCR kit is applied in vitro for nucleic acid amplification test to determine whether DNA is present which belongs to Treponema pallidum / Neisseria gonorrhoeae / Mycoplasma genitalium/ Trichomonas vaginalis , this is accomplished by detecting amplified products utilizing real-time hybridization fluorescence detection. All PCR reaction preparation stages were followed exactly as directed by the manufacturer, and the amplification scheme is described in Table (1). Table (1): Amplification program for detecting sexually transmitted agents. Step Temperature (°C) Time Cycles Hold 95 15 min. 1 Cycling 1 95 5 sec. 5 60 20 sec. 72 15 sec. Cycling 2 95 5 sec. 40 60 *20 sec. 72 15 sec. The MULTIPRIME-FRT PCR kit consists of an independent internal control that is used to verify the effectiveness of the DNA extraction and amplification processes. The presence of each bacterium is indicated by sending a signal to different channels that detect a fluorescent dye specific to each bacterium as shown in Table (2). Table (2): specific dyes for STD detection . Fluorophore Targets FAM Neisseria gonorrhoeae JOE Treponema pallidum ROX Mycoplasma genitalium Cy5.5 Trichomonas vaginalis Cy5 IC (Internal control) *Fluorescence detection occurs at this step. 2.5. Statistical Analysis The SAS (2012) program was used to investigate the impact of various factors on the research parameters. In this study, the least significant difference –the LSD test (ANOVA) was used to compare percentages, and the Chi-square test was used to compare means. 3. Results 3.1. Seminal fluid analysis Fifty-four semen samples (patient group) the age mean ± was (32.3 ± 6.9) showed abnormal semen quality, which included low sperm concentration (≤ 15 million/ml), sperm progressive motility (≤ 32%), and abnormal sperm morphology “(≤ 30%), while the Thirteen -semen sample (control group) the age mean ± was (34.0 ± 6.5) showed average sperm concentration, motility, and morphology, all the semen parameters are listed in Table (3) Table (3): Patients and controls in seminal parameter variables. Variable Age (years) Sperm count (million/ml) Total motility (%) PR motility (%) Morphology (%) Patients (n = 54) 32.32 ± 6.86 9.41 ± 8.60 22.72 ± 15.72 2.69 ± 5.35 27.03 ± 16.52 Control (n = 13) 34.09 ± 6.54 38.42 ± 9.44 72.82 ± 14.01 52.1 ± 13.72 56.4 ± 17.67 T-Test 4.124 NS 5.366 ** 9.285 ** 4.509 ** 10.135 ** ** (P < 0.01). 3.2. DNA extraction and identification of human Beta globin ( HBB ) gene by PCR Genomic DNA extraction was done successfully by using“Presto™ Sperm DNA Extraction Kit to all seminal fluid (control and patients’ samples),” Nanodrop was used to estimate DNA concentration and purity; all samples had a concentration range of (50–240) ng/l and a purity range of (1.6-2.00), and DNA integrity was confirmed using agarose gel electrophoresis after the Nanodrop as shows Fig. 1 The desired HBB gene region was amplified by utilizing the conventional PCR technique for each sample (control and patients) as an internal control for DNA extraction; as illustrated in figure (2), gel electrophoresis was employed to find the amplified region in a 158 bp band. 3.3. Qualitative real-real-time PCR for the detection of Sexually Transmitted Diseases (STDs) “Four types of microorganisms are selected in this study to be detected in semen samples using specific PCR diagnostic kits for sexually transmitted diseases, Real-time PCR instrument software was used to analyze the results, which measures the fluorescent signals accumulated in the channels. It revealed four Quantitation data for cycling channels as shown in figure (3); the amplification of each bacterial DNA was recorded as a Ct value. The findings of this study indicated that the number of positive and negative results of the patient group were (22/54) and (32/54) respectively; in general, the percentage of N. gonorrhoeae was 9 (40.9%), T.pallidum was 7 (31.8%), M. genitalium was 4 (18.18%) and T. vaginalis was 2 (9.09%). The control group included ( 13 ) male; their results showed only one infection with N. gonorrhoeae , as shown in Table (4) Table (4): Distribution of study sample according to STD detection results. STDs results Infected patient group N = 22/54 control group N = 1/13 N. gonorrhoeae 9 (40.9%) 1 T.pallidum 7 (31.8%) 0 M. genitalium 4 (18.18%) 0 T. vaginalis 2 (9.09%) 0 Total 22 (100%) 1(7.69%) The effect of the infection STD infection on seminal parameters was tested statically, and the results were shown in Tables (5,6,7,8) which can be found in additional Table file. 4. Discussion Each sample in this study was classified according to the results of seminal fluid analysis, depending on sperm concentration, sperm total motility, PR motility, and sperm morphology, the average values considered according to WHO 2010; there was no significant difference in the age among each group. Figure (1) shows the band of the human Beta globin gene, which is used as an internal control in this study for DNA extractioThethe β-globin locus control region (LCR) is a prototype of a powerful mammalian regulatory DNA element, amplification controls, The housekeeping genes, are employed in molecular diagnosis to confirm that the PCR conditions are optimal; examples include beta-globin and GAPDH (8) . In the present study, the (qRT-PCR) is employed with particular primers for the detection of STDs, and the cycle threshold (Ct) value for the triplicate reactions served as a marker for the gene product's amplification precision, as shown in figure (3), qRT-PCR joins fluorescent probes with PCR primers, enabling precise quantification of microorganisms present in a semen sample (9) . N. gonorrhea was the most prevalent bacteria among the study groups, infecting about 9 of 22 of the patient group and 1 of 13 of the control group. At the same time, T. vaginalis was found to be present only in 2 of 22 of the patient group, as shown in Table (4). The detection of N . gonorrhoeae showed variation in the results of PCR; there were significant differences for each sperm count, motility, PR motility, and morphology, as shown in Table (5), A study by Hook et al. (1997) (10) suggested that N. gonorrhoeae and C. trachomatis are the most frequent sex-transmitted bacteria in the world., Knapp et al . (1994) (11) defined N. gonorrhoeae as a bacteria that is transmitted sexually and is characterized by asymptomatic or symptomatic infections. A study done in Jordanian by Abusarah et al. (2013) (12) involved 93 infertile males and 70 fertile controls; DNA of N. gonorrhoeae was detected in the semen samples of (6.5%) of the sterile males, and none of the control samples was infected. An association between STDs and idiopathic male infertility can be noticed due to different mechanisms for different pathogens, and some STDs may affect male fertility negatively, whereas others may not (13) . The detection of T.pallidum showed variation in the PCR results; there were significant differences for each sperm count, motility, PR motility, and morphology, and there were no significant differences for age. The main reason qRT-PCR is used in this study is the difficulty growing T. pallidum on currently available artificial media. Although no direct effect of syphilis microorganisms on male fertility has been documented, syphilis sequelae are known to influence fertility in some situations; a study done in Iraq by Al-Jelehawy et al (2021) (14) from a total of 137 cases of infertile patients were gathered (83 points in males, 54 points in females), 20 cases of sterile males and 15 cases of sterile females were suspected to have T.pallidum infection, these data indicate that syphilis may play an important role in infertility. The M. genitalium detection showed variation in PCR results; there were significant differences for each sperm count, motility, PR motility, and morphology, and there were no significant differences for age. According to Ahmadi et al. (2018) (15) , the frequency of M. genitalium was significantly higher in the infertile men compared with the fertile ones (9.7% vs. 1.2%; p = 0.001), the mean of cycle threshold (Ct) value was less in infected infertile than infected fertile men (p < 0.001), except for volume, pH, and viscosity, all semen characteristics were enhanced (p < 0.05), seminal fluid's level of leukocytes dropped (p = 0.02). Infections with genital mycoplasmas ( M. hominis and M. genitalium ) have been recognized for about a decade as a common sexually transmitted disease (STD) in developed countries ( 16 ). The male urethra naturally harbors genital mycoplasmas, which contaminate the semen upon ejaculation. However, these microorganisms are potentially harmful species that contribute to genital infections and male infertility by acting as their etiologic agents ( 17 ). According to a study by Gdoura et al. (2007) (18) , there is a direct association between the quantity of sperm and M. genitalium in infertile men's semen samples. Finally, the detection T. vaginalis showed variation in the PCR results; there were significant differences for each sperm count, motility, PR motility, and morphology there were no significant differences for age. T. vaginalis infection is a sexually transmitted disease that affects men's fertility, in men, Trichomoniasis has been linked to infertility due to a physical damage-related impairment in sperm cell quality and function. ( 19 ). Another study found that 8.2% of men experiencing impotence and infertility and 28.8% with urethral discharge had T. vaginalis . Examination of urethral discharge, urine, semen, and prostatic fluid using wet mount, stained films, and culture inoculation served as the basis for the diagnosis ( 20 ). Male genital tract infections have been the main controversy in male infertility since about 15% of it is due to genital tract infections. C. trachomatis, N. gonorrhoeae, T. vaginalis, and M. genitalium are the most common genital tract pathogens and have been widely studied recently. Conclusion The four urogenital pathogens under current investigation were common among infertile people, although it seems unlikely that they are the sole cause of male infertility in this world region. There is an argument about the effect of STDs on male infertility, due to the limited information about it, and the diagnostic tests such as seminal fluid analysis and culture techniques are variable, there must be many steps to expand the impact of STDs in male infertility, including the upcoming investigations of infertile couples by utilizing the proper control groups, advanced semen collection and precise microbiologic techniques. Healthcare professionals must spread awareness of the dangerous effects of STDs and the importance of using contraceptive methods to prevent STDs from spreading ( 21 ). Declarations Funding “The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.” Competing Interests “The authors have no relevant financial or non-financial interests to disclose.” Ethics statement “This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by Scientific Committee of the Department of Experimental Therapy, Iraqi Center for Cancer and Medical Genetics reviewed and approved the current studies. Author contributions “All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by [Anwer Jaber Faisal], [Mokhtar Jawad Al-Imam] and [Alaa Saadi Abbood]. The first draft of the manuscript was written by [Anwer Jaber Faisal] and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.” Data Availability “The datasets generated during the current study are not publicly available due ethical considerations but are available from the corresponding author on reasonable request.” Consent to participate. Informed consent was obtained from all individual participants included in the study. References Mascarenhas MN, Flaxman SR, Boerma T, Vanderpoel S, Gretchen A, Stevens (2012) National, regional, and global trends in infertility prevalence since 1990: a systematic analysis of 277 health surveys. PLoS medicine 9, 12 : e1001356 Rybar R, Prinosilova P, Kopecka V, Hlavicova J, Veznik Z, Zajicova A, Rubes J (2012) The effect of bacterial contamination of semen on sperm chromatin integrity and standard semen parameters in men from infertile couples. Andrologia 44 : 410–418 Apari Péter (2014) João Dinis de Sousa, and Viktor Müller. Why sexually transmitted infections tend to cause infertility: an evolutionary hypothesis. PLoS Pathog 10:8 Al-Sweih NA, Amani H, Al‐Fadli, Alexander E, Omu, Vincent OR (2012) Prevalence of Chlamydia trachomatis , Mycoplasma hominis , Mycoplasma genitalium , and Ureaplasma urealyticum infections and seminal quality in infertile and fertile men in Kuwait. Journal of andrology 33, no. 6 : 1323–1329 Rana K, Vander H, Bhandari P, Thaper D, Prabha V (2016) Microorganisms and male infertility: possible pathophysiological mechanisms. Adv Clin Med Microbiol 1:002 Sankuntaw N, Sukprasert S, Engchanil C, Kaewkes W, Chantratita W (2011) Vantanit Pairoj, and Viraphong Lulitanond. Single tube multiplex real-time PCR for the rapid detection of herpesvirus infections of the central nervous system. Mol Cell Probes 25:2–3 World Health Organization (2010) Examination and Processing of Human Semen. World Health Ed, (10): 286 Epner E, Reik A, Cimbora D, Telling A, Bender MA, Fiering S, Enver T et al (1998) The β-globin LCR is not necessary for an open chromatin structure or developmentally regulated transcription of the native mouse β-globin locus. Mol Cell 2(4):447–455 Betsou F, Beaumont K, Sueur JM, Orfila J Construction and evaluation of internal control DNA for PCR amplification of Chlamydia trachomatis DNA from urine samples. Journal of clinical Hook EW 3rd, Ching SF, Stephens J, Kim F, Hardy KR, Smith (1997) Lee. Diagnosis of Neisseria gonorrhoeae infections in women by using the ligase chain reaction on patient-obtained vaginal swabs. J Clin Microbiol 35(8):2129–2132 Knapp JS, Ohye R, Neal SW, Parekh MC, Higa H, Roselyn J (1994) Rice. Emerging in vitro resistance to quinolones in penicillinase-producing Neisseria gonorrhoeae strains in Hawaii. Antimicrob Agents Chemother 38(9):2200–2203 Abusarah EA, Ziad M, Awwad E, Charvalos, Asem A, Shehabi (2013) Molecular detection of potential sexually transmitted pathogens in semen and urine specimens of infertile and fertile males. Diagnostic microbiology and infectious disease 77, 4 : 283–286 Fode M, Fusco F, Lipshultz L, Weidner W (2016) Sexually transmitted disease and male infertility: a systematic review. Eur Urol focus 2(4):383–393 Al-Jelehawy AH, Jaber (2021) Estimation Syphilis Serostatus Saf Infertile Patients Medico-legal Update 21(2):77Qassim Muhsin Hashim Al-Faham, Zainab Hassan Hadi Al-Saadi, Saif Jabbar Yasir, and Ammar Kareem Kadhim Al-Furaiji Ahmadi M, Hossein A, Mirsalehian MAS, Gilani A, Bahador, and Malihe Talebi (2018). Improvement of semen parameters after antibiotic therapy in asymptomatic infertile men infected with Mycoplasma genitalium . Infection 46 : 31–38 Yoshida T, Deguchi T, Ito M, Maeda S-I (2002) Masayoshi Tamaki, and Hiroaki Ishiko. Quantitative detection of Mycoplasma genitalium from first-pass urine of men with urethritis and asymptomatic men by real-time PCR. J Clin Microbiol 40(4):1451–1455 Wang Y, Liang C-L, Wu Jun‐Qing, Xu C (2006) Shi‐Xiao Qin, and Er‐Sheng Gao. Do Ureaplasma urealyticum infections in the genital tract affect semen quality? Asian J Androl 8(5):562–568 Gdoura R, Kchaou W, Chaari C, Znazen A, Keskes L (2007) Tarek Rebai, and Adnane Hammami. Ureaplasma urealyticum, Ureaplasma parvum, Mycoplasma hominis and Mycoplasma genitalium infections and semen quality of infertile men. BMC Infectious Diseases 7 : 1–9 Lucena E, Moreno-Ortiz H, Coral L, Lombana O, Moran A (2014) Esteban-Pérez. Unexplained infertility caused by a latent but serious intruder: Trichomonas vaginalis . JFIV Reprod Med Genet 3(1):2–4 El Seoud SF, Abbas MM, Habib FS (1998) Study of trichomoniasis among Egyptian male patients. J Egypt Soc Parasitol 28(1):263–270 Gimenes Fabrícia, Souza RP, Bento JC, Jorge JV, Teixeira SS, Maria-Engler MG, Bonini, Marcia EL (2014) Male infertility: a public health issue caused by sexually transmitted pathogens. Nat Reviews Urol 11(12):672–687 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 31 Mar, 2025 Read the published version in Acta Microbiologica Bulgarica → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3993380\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":275175315,\"identity\":\"4b48f8c3-6432-48d5-971f-c164a1cf1f01\",\"order_by\":0,\"name\":\"Anwer Jaber Faisal\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABWklEQVRIie2RMUvDQBTHXwhclmtdE9TGj/BCoR1E+lUShLq0KhRKQIdAoS5xFxTyFTK1dIsU0iW260FEK0KnDhVBIih4p8VaG8FRMD/ecLx7P/53PICMjL8LAQSQxosGAgVR/EbUT4qM8/OvFDEDRF0o71BIm187d417G/J6WTmdHFG7Y3lea3KXHN5s4OAqgFmzD3nF/Kqo11HRiIAYPXdQimkUW35IykWKDYrRvimdDftA6HgphtU7mgNE8lmVxLk2VwiU1gFNikEN5VybK+pSis7q3WeuVPzbCWkIxWsrT1oilNEU5ddVBXmKxBXLZ4TIQnFCWlKpUBhPkVYVgx08ag6S3Z5blbWLKC76Ya25LhSNTfHSHe7Rb38psKr14NjhTlcJpdnUjje91qCjJS9mJT+qGeOkuV3QT5ZS5s8LUza1FQAEH9tJUeA4pac7n8c0JSMjI+P/8AYF8nbXpVwTewAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Anwer\",\"middleName\":\"Jaber\",\"lastName\":\"Faisal\",\"suffix\":\"\"},{\"id\":275175316,\"identity\":\"9b0be972-20bd-4cf7-9984-178871bbb6c2\",\"order_by\":1,\"name\":\"Mokhtar Jawad Al-Imam\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Mustansiriyah University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mokhtar\",\"middleName\":\"Jawad\",\"lastName\":\"Al-Imam\",\"suffix\":\"\"},{\"id\":275175317,\"identity\":\"a6438bd6-4511-4b41-bdf7-7d0880997019\",\"order_by\":2,\"name\":\"Alaa Saadi Abbood\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Mustansiriyah University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Alaa\",\"middleName\":\"Saadi\",\"lastName\":\"Abbood\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-02-27 08:50:09\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3993380/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3993380/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.59393/amb25410107\",\"type\":\"published\",\"date\":\"2025-04-01T00:00:00+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":51821286,\"identity\":\"05d95bbb-1324-4313-9348-a8f89d011187\",\"added_by\":\"auto\",\"created_at\":\"2024-02-29 16:09:31\",\"extension\":\"jpeg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":48782,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe isolated genomic DNA from seminal fluid samples was electrophoresed on 1% agarose for an hour at 90 volts, followed by ethidium bromide staining for 20 minutes and UV light visualization using a gel documentation system.\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3993380/v1/962a929e3ed3d5b6e854aab5.jpeg\"},{\"id\":51821288,\"identity\":\"5f728606-8eb6-4ff0-b999-770f2023cadc\",\"added_by\":\"auto\",\"created_at\":\"2024-02-29 16:09:31\",\"extension\":\"jpeg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":44399,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cem\\u003e\\u003cstrong\\u003eHBB\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e gene\\u003c/strong\\u003e \\u003cstrong\\u003ePCR product in different DNA semen samples.\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3993380/v1/76cb3bb5275ef434965f1a06.jpeg\"},{\"id\":51821287,\"identity\":\"805f4672-7c62-4538-b6cc-9fc58072f288\",\"added_by\":\"auto\",\"created_at\":\"2024-02-29 16:09:31\",\"extension\":\"jpeg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":770077,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eA linear representation of the amplification curves derived from the target DNA.\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3993380/v1/cb64b0c381d447f1b0470394.jpeg\"},{\"id\":80670546,\"identity\":\"3703ed4d-9823-4578-b1b9-73c862738878\",\"added_by\":\"auto\",\"created_at\":\"2025-04-15 19:32:39\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1968389,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3993380/v1/d9347c6b-28b8-4fbf-a6f2-2dd572d210f2.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Multiplex Real-Time PCR Assessment of Semen Quality and Male Fertility Impacted by Sexually Transmitted Infections\",\"fulltext\":[{\"header\":\"1. introduction\",\"content\":\"\\u003cp\\u003eInfections of the male genitourinary tract are a significant health concern, accounting for over 20% of all male infertility cases \\u003csup\\u003e(1)\\u003c/sup\\u003e. Male infertility can be idiopathic or result from various circumstances, such as immunogenic abnormalities, anatomical and genetic diseases, inflammation, and infection \\u003csup\\u003e(2)\\u003c/sup\\u003e. The primary cause of infertility in many males is pathological issues., but they are often misdiagnosed and treated, leaving the female partner to carry most of the burden of infertility. It is, therefore, critical to \\\"understand\\\" the causes of male infertility so that they can be appropriately diagnosed and treated \\u003csup\\u003e(3)\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eInfections of the reproductive tract caused by bacteria, viruses, fungi, and parasitic microorganisms that are transmitted through sexual activity and cause sexually transmitted diseases (STDs) are a severe problem because many infections are asymptomatic or have fewer symptoms and account for about 20% of male infertility \\u003csup\\u003e(4)\\u003c/sup\\u003e. \\u003cem\\u003eTreponema pallidum, Neisseria gonorrhoeae, Mycoplasma species, Ureaplasma species, Trichomonas vaginalis\\u003c/em\\u003e, and many viruses such as Herpes simplex type 1 and type 2, Human papillomavirus and Hepatitis B \\u0026amp; C, which cause acute and chronic infections, have been found in the semen of asymptomatic guys and the resultant inflammations in the male reproductive system, cause spermatozoa to malfunction, resulting in lower sperm quality, sperm count, and sperm motility \\u003csup\\u003e(5)\\u003c/sup\\u003e. In the past three decades, the diagnosis of STDs, particularly in developing nations, has relied chiefly on conventional techniques like culture, enzyme immunoassay, and fluorescent antibody staining \\u003csup\\u003e(6)\\u003c/sup\\u003e. Screening semen samples requires quick, sensitive, adaptable, and affordable diagnostic methods.\\u003c/p\\u003e \\u003cp\\u003eThe main aim of this study was to determine the role of sexually transmitted diseases (STDs) on semen quality and male infertility, in addition to designing specific diagnostic kits for Real-time PCR for screening the presence of \\u003cem\\u003eTreponema pallidum, Neisseria gonorrhoeae, Mycoplasma species\\u003c/em\\u003e, and \\u003cem\\u003eTrichomonas vaginalis\\u003c/em\\u003e in the semen of infertile men.\\u0026rdquo; We predict that multiplex real-time PCR may be more effective at detecting STDs in semen and contributing to a decline in male infertility.\\u003c/p\\u003e\"},{\"header\":\"2. Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1. Semen collection and study groups\\u003c/h2\\u003e \\u003cp\\u003eTwo groups were chosen during this study; the patient groups' age varied from (24\\u0026ndash;55), which consisted of men with no children and a conceiving issue due to poor seminal fluid quality, sperm count, motility, and morphology values that were below the WHO (2010) lower reference criteria \\u003csup\\u003e(7)\\u003c/sup\\u003e. Males (18\\u0026ndash;49) with at least one child and a standard seminal fluid examination were considered the control group. The study's ethical approval was obtained from the ethical committee of the Central Health Laboratory in Baghdad, Iraq.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2. Seminal collection and preparation\\u003c/h2\\u003e \\u003cp\\u003eAfter 3\\u0026ndash;5 days of sexual abstinence, a sample of sperm was taken to the lab; the participants were told to follow a precise method, both orally and in writing, as follows: first, they had to urinate, then wash their hands with soap. Secondly, they must use antibacterial soap to wash their vaginal area before rinsing it with a physiological saline solution. Finally, the sperm acquired through masturbation was collected and preserved in a sterile, non-toxic container in the laboratory. The World Health Organization's standard manual assessed sperm count, motility, and morphology \\u003csup\\u003e(7)\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3. DNA extraction and Human Beta-globin gene (HBB) detection by a Conventional Polymerase Chain Reaction (PCR).\\u003c/h2\\u003e \\u003cp\\u003ePresto\\u0026trade; Sperm DNA Extraction Kit (Taiwan) is used to extract whole genomic DNA from seminal samples; determination of DNA quantity and quality is done by using nanodrop at 260/280 nm and gel electrophoresis; the extracted DNA was tested for the human beta-globin \\u003cem\\u003eHBB\\u003c/em\\u003e gene as a reference gene. The forward and reverse primers for the human \\u003cem\\u003eHBB\\u003c/em\\u003e gene were 5\\u0026prime; AGTCAGGGCAGAGCCATCTA 3\\u0026prime; and 5\\u0026prime; CCTCACCACCAACTTCATCC 3\\u0026prime;.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4. Selection of Sexual Transmitted Agents\\u003c/h2\\u003e \\u003cp\\u003e \\u003cem\\u003eTreponema pallidum, Neisseria gonorrhoeae, Mycoplasma genitalium\\u003c/em\\u003e, and \\u003cem\\u003eTrichomonas vaginalis\\u003c/em\\u003e were selected pathogens to be detected in this study since all the mentioned pathogens can cause sexually transmitted infections among couples and hurt semen parameters.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5. Multiplex real-time PCR for qualitatively detecting sexually transmitted Bacteria.\\u003c/h2\\u003e \\u003cp\\u003eAmplisens\\u003cem\\u003e\\u0026reg;\\u003c/em\\u003e MULTIPRIME-FRT PCR kit is applied \\u003cem\\u003ein vitro\\u003c/em\\u003e for nucleic acid amplification test to determine whether DNA is present which belongs to \\u003cem\\u003eTreponema pallidum / Neisseria gonorrhoeae / Mycoplasma genitalium/ Trichomonas vaginalis\\u003c/em\\u003e, this is accomplished by detecting amplified products utilizing real-time hybridization fluorescence detection. All PCR reaction preparation stages were followed exactly as directed by the manufacturer, and the amplification scheme is described in Table\\u0026nbsp;(1).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eTable\\u0026nbsp;(1): Amplification program for detecting sexually transmitted agents.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Taba\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eStep\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTemperature (\\u0026deg;C)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTime\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eCycles\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHold\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e95\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e15 min.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"2\\\" rowspan=\\\"3\\\"\\u003e \\u003cp\\u003eCycling 1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e95\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5 sec.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\" morerows=\\\"2\\\" rowspan=\\\"3\\\"\\u003e \\u003cp\\u003e5\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e60\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e20 sec.\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e72\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e15 sec.\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"2\\\" rowspan=\\\"3\\\"\\u003e \\u003cp\\u003eCycling 2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e95\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5 sec.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\" morerows=\\\"2\\\" rowspan=\\\"3\\\"\\u003e \\u003cp\\u003e40\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e60\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e*20 sec.\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e72\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e15 sec.\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe MULTIPRIME-FRT PCR kit consists of an independent internal control that is used to verify the effectiveness of the DNA extraction and amplification processes. The presence of each bacterium is indicated by sending a signal to different channels that detect a fluorescent dye specific to each bacterium as shown in Table\\u0026nbsp;(2).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eTable\\u0026nbsp;(2): specific dyes for STD detection\\u003c/b\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Tabb\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eFluorophore\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTargets\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eFAM\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eNeisseria gonorrhoeae\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eJOE\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eTreponema pallidum\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eROX\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eMycoplasma genitalium\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCy5.5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eTrichomonas vaginalis\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCy5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eIC \\u003cb\\u003e(Internal control)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003e*Fluorescence detection occurs at this step.\\u003c/b\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5. Statistical Analysis\\u003c/h2\\u003e \\u003cp\\u003eThe SAS (2012) program was used to investigate the impact of various factors on the research parameters. In this study, the least significant difference \\u0026ndash;the LSD test (ANOVA) was used to compare percentages, and the Chi-square test was used to compare means.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e3.1. Seminal fluid analysis\\u003c/h2\\u003e\\n \\u003cp\\u003eFifty-four semen samples (patient group) the age mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;was (32.3\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;6.9) showed abnormal semen quality, which included low sperm concentration (\\u0026le;\\u0026thinsp;15 million/ml), sperm progressive motility (\\u0026le;\\u0026thinsp;32%), and abnormal sperm morphology \\u0026ldquo;(\\u0026le;\\u0026thinsp;30%), while the Thirteen -semen sample (control group) the age mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;was (34.0\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;6.5) showed average sperm concentration, motility, and morphology, all the semen parameters are listed in Table (3)\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eTable\\u0026nbsp;(3): Patients and controls in seminal parameter variables.\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cdiv class=\\\"gridtable\\\"\\u003e\\n \\u003cdiv class=\\\"colspec\\\" align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/div\\u003e\\n \\u003cdiv class=\\\"colspec\\\" align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/div\\u003e\\n \\u003ctable id=\\\"Tabc\\\" border=\\\"1\\\"\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eVariable\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAge (years)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eSperm count (million/ml)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eTotal motility (%)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003ePR motility (%)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eMorphology (%)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ePatients (n\\u0026thinsp;=\\u0026thinsp;54)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e32.32\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;6.86\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e9.41\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;8.60\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e22.72\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;15.72\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e2.69\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;5.35\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e27.03\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;16.52\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eControl (n\\u0026thinsp;=\\u0026thinsp;13)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e34.09\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;6.54\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e38.42\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;9.44\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e72.82\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;14.01\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e52.1\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;13.72\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e56.4\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;17.67\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eT-Test\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e4.124 NS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e5.366 **\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e9.285 **\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e4.509 **\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e10.135 **\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd colspan=\\\"5\\\" align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e** (P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01).\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n \\u003c/table\\u003e\\n \\u003c/div\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e3.2. DNA extraction and identification of human Beta globin (\\u003cem\\u003eHBB\\u003c/em\\u003e) gene by PCR\\u003c/h2\\u003e\\n \\u003cp\\u003eGenomic DNA extraction was done successfully by using\\u0026ldquo;Presto\\u0026trade; Sperm DNA Extraction Kit to all seminal fluid (control and patients\\u0026rsquo; samples),\\u0026rdquo; Nanodrop was used to estimate DNA concentration and purity; all samples had a concentration range of (50\\u0026ndash;240) ng/l and a purity range of (1.6-2.00), and DNA integrity was confirmed using agarose gel electrophoresis after the Nanodrop as shows Fig.\\u0026nbsp;1\\u003c/p\\u003e\\n \\u003cp\\u003eThe desired \\u003cem\\u003eHBB\\u003c/em\\u003e gene region was amplified by utilizing the conventional PCR technique for each sample (control and patients) as an internal control for DNA extraction; as illustrated in figure (2), gel electrophoresis was employed to find the amplified region in a 158 bp band.\\u003c/p\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e3.3. Qualitative real-real-time PCR for the detection of Sexually Transmitted Diseases (STDs)\\u003c/h2\\u003e\\n \\u003cp\\u003e\\u0026ldquo;Four types of microorganisms are selected in this study to be detected in semen samples using specific PCR diagnostic kits for sexually transmitted diseases, Real-time PCR instrument software was used to analyze the results, which measures the fluorescent signals accumulated in the channels. It revealed four Quantitation data for cycling channels as shown in figure (3); the amplification of each bacterial DNA was recorded as a Ct value.\\u003c/p\\u003e\\n \\u003cp\\u003eThe findings of this study indicated that the number of positive and negative results of the patient group were (22/54) and (32/54) respectively; in general, the percentage of \\u003cem\\u003eN. gonorrhoeae\\u003c/em\\u003e was 9 (40.9%), \\u003cem\\u003eT.pallidum\\u003c/em\\u003e was 7 (31.8%), \\u003cem\\u003eM. genitalium\\u003c/em\\u003e was 4 (18.18%) and \\u003cem\\u003eT. vaginalis\\u003c/em\\u003e was 2 (9.09%). The control group included (\\u003cspan class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e) male; their results showed only one infection with \\u003cem\\u003eN. gonorrhoeae\\u003c/em\\u003e, as shown in Table\\u0026nbsp;(4)\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eTable\\u0026nbsp;(4): Distribution of study sample according to STD detection results.\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cdiv class=\\\"gridtable\\\"\\u003e\\n \\u003ctable id=\\\"Tabd\\\" border=\\\"1\\\"\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eSTDs results\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eInfected patient group\\u003c/p\\u003e\\n \\u003cp\\u003eN\\u0026thinsp;=\\u0026thinsp;22/54\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003econtrol group\\u003c/p\\u003e\\n \\u003cp\\u003eN\\u0026thinsp;=\\u0026thinsp;1/13\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eN. gonorrhoeae\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e9 (40.9%)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eT.pallidum\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e7 (31.8%)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eM. genitalium\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e4 (18.18%)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eT. vaginalis\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e2 (9.09%)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eTotal\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e22 (100%)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e1(7.69%)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n \\u003c/table\\u003e\\n \\u003c/div\\u003e\\n \\u003cp\\u003eThe effect of the infection STD infection on seminal parameters was tested statically, and the results were shown in Tables\\u0026nbsp;(5,6,7,8) which can be found in additional Table file.\\u003c/p\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"4. Discussion\",\"content\":\"\\u003cp\\u003eEach sample in this study was classified according to the results of seminal fluid analysis, depending on sperm concentration, sperm total motility, PR motility, and sperm morphology, the average values considered according to WHO 2010; there was no significant difference in the age among each group.\\u003c/p\\u003e \\u003cp\\u003eFigure (1) shows the band of the human Beta globin gene, which is used as an internal control in this study for DNA extractioThethe β-globin locus control region (LCR) is a prototype of a powerful mammalian regulatory DNA element, amplification controls, The housekeeping genes, are employed in molecular diagnosis to confirm that the PCR conditions are optimal; examples include beta-globin and GAPDH \\u003csup\\u003e(8)\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eIn the present study, the (qRT-PCR) is employed with particular primers for the detection of STDs, and the cycle threshold (Ct) value for the triplicate reactions served as a marker for the gene product's amplification precision, as shown in figure (3), qRT-PCR joins fluorescent probes with PCR primers, enabling precise quantification of microorganisms present in a semen sample \\u003csup\\u003e(9)\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eN. gonorrhea\\u003c/em\\u003e was the most prevalent bacteria among the study groups, infecting about 9 of 22 of the patient group and 1 of 13 of the control group. At the same time, \\u003cem\\u003eT. vaginalis\\u003c/em\\u003e was found to be present only in 2 of 22 of the patient group, as shown in Table\\u0026nbsp;(4). The detection of \\u003cem\\u003eN\\u003c/em\\u003e. \\u003cem\\u003egonorrhoeae\\u003c/em\\u003e showed variation in the results of PCR; there were significant differences for each sperm count, motility, PR motility, and morphology, as shown in Table\\u0026nbsp;(5), A study by Hook \\u003cem\\u003eet al.\\u003c/em\\u003e (1997) \\u003csup\\u003e(10)\\u003c/sup\\u003e suggested that \\u003cem\\u003eN. gonorrhoeae\\u003c/em\\u003e and \\u003cem\\u003eC. trachomatis\\u003c/em\\u003e are the most frequent sex-transmitted bacteria in the world., Knapp \\u003cem\\u003eet al\\u003c/em\\u003e. (1994) \\u003csup\\u003e(11)\\u003c/sup\\u003e defined \\u003cem\\u003eN. gonorrhoeae\\u003c/em\\u003e as a bacteria that is transmitted sexually and is characterized by asymptomatic or symptomatic infections. A study done in Jordanian by Abusarah \\u003cem\\u003eet al.\\u003c/em\\u003e (2013) \\u003csup\\u003e(12)\\u003c/sup\\u003e involved 93 infertile males and 70 fertile controls; DNA of \\u003cem\\u003eN. gonorrhoeae\\u003c/em\\u003e was detected in the semen samples of (6.5%) of the sterile males, and none of the control samples was infected. An association between STDs and idiopathic male infertility can be noticed due to different mechanisms for different pathogens, and some STDs may affect male fertility negatively, whereas others may not \\u003csup\\u003e(13)\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eThe detection of \\u003cem\\u003eT.pallidum\\u003c/em\\u003e showed variation in the PCR results; there were significant differences for each sperm count, motility, PR motility, and morphology, and there were no significant differences for age. The main reason qRT-PCR is used in this study is the difficulty growing \\u003cem\\u003eT. pallidum\\u003c/em\\u003e on currently available artificial media. Although no direct effect of syphilis microorganisms on male fertility has been documented, syphilis sequelae are known to influence fertility in some situations; a study done in Iraq by Al-Jelehawy et al (2021) \\u003csup\\u003e(14)\\u003c/sup\\u003e from a total of 137 cases of infertile patients were gathered (83 points in males, 54 points in females), 20 cases of sterile males and 15 cases of sterile females were suspected to have \\u003cem\\u003eT.pallidum\\u003c/em\\u003e infection, these data indicate that syphilis may play an important role in infertility.\\u003c/p\\u003e \\u003cp\\u003eThe \\u003cem\\u003eM. genitalium\\u003c/em\\u003e detection showed variation in PCR results; there were significant differences for each sperm count, motility, PR motility, and morphology, and there were no significant differences for age. According to Ahmadi \\u003cem\\u003eet al.\\u003c/em\\u003e (2018) \\u003csup\\u003e(15)\\u003c/sup\\u003e, the frequency of \\u003cem\\u003eM. genitalium\\u003c/em\\u003e was significantly higher in the infertile men compared with the fertile ones (9.7% vs. 1.2%; p = 0.001), the mean of cycle threshold (Ct) value was less in infected infertile than infected fertile men (p \\u0026lt; 0.001), except for volume, pH, and viscosity, all semen characteristics were enhanced (p \\u0026lt; 0.05), seminal fluid's level of leukocytes dropped (p = 0.02). Infections with genital mycoplasmas (\\u003cem\\u003eM. hominis\\u003c/em\\u003e and \\u003cem\\u003eM. genitalium\\u003c/em\\u003e) have been recognized for about a decade as a common sexually transmitted disease (STD) in developed countries (\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e). The male urethra naturally harbors genital mycoplasmas, which contaminate the semen upon ejaculation. However, these microorganisms are potentially harmful species that contribute to genital infections and male infertility by acting as their etiologic agents (\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e). According to a study by Gdoura et al. (2007) \\u003csup\\u003e(18)\\u003c/sup\\u003e, there is a direct association between the quantity of sperm and \\u003cem\\u003eM. genitalium\\u003c/em\\u003e in infertile men's semen samples.\\u003c/p\\u003e \\u003cp\\u003eFinally, the detection \\u003cem\\u003eT. vaginalis\\u003c/em\\u003e showed variation in the PCR results; there were significant differences for each sperm count, motility, PR motility, and morphology there were no significant differences for age. \\u003cem\\u003eT. vaginalis\\u003c/em\\u003e infection is a sexually transmitted disease that affects men's fertility, in men, Trichomoniasis has been linked to infertility due to a physical damage-related impairment in sperm cell quality and function. (\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e). Another study found that 8.2% of men experiencing impotence and infertility and 28.8% with urethral discharge had \\u003cem\\u003eT. vaginalis\\u003c/em\\u003e. Examination of urethral discharge, urine, semen, and prostatic fluid using wet mount, stained films, and culture inoculation served as the basis for the diagnosis (\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e). Male genital tract infections have been the main controversy in male infertility since about 15% of it is due to genital tract infections. \\u003cem\\u003eC. trachomatis, N. gonorrhoeae, T. vaginalis, and M. genitalium\\u003c/em\\u003e are the most common genital tract pathogens and have been widely studied recently.\\u003c/p\\u003e \"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eThe four urogenital pathogens under current investigation were common among infertile people, although it seems unlikely that they are the sole cause of male infertility in this world region. There is an argument about the effect of STDs on male infertility, due to the limited information about it, and the diagnostic tests such as seminal fluid analysis and culture techniques are variable, there must be many steps to expand the impact of STDs in male infertility, including the upcoming investigations of infertile couples by utilizing the proper control groups, advanced semen collection and precise microbiologic techniques. Healthcare professionals must spread awareness of the dangerous effects of STDs and the importance of using contraceptive methods to prevent STDs from spreading (\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e).\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026ldquo;The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.\\u0026rdquo;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting Interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026ldquo;The authors have no relevant financial or non-financial interests to disclose.\\u0026rdquo;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics statement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026ldquo;This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by Scientific Committee of the Department of Experimental Therapy, Iraqi Center for Cancer and Medical Genetics reviewed and approved the current studies.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor contributions\\u003c/strong\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u0026ldquo;All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by [Anwer Jaber Faisal], [Mokhtar Jawad Al-Imam] and [Alaa Saadi Abbood]. The first draft of the manuscript was written by [Anwer Jaber Faisal] and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\\u0026rdquo;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData Availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026ldquo;The datasets generated during the current study are not publicly available due ethical considerations but are available from the corresponding author on reasonable request.\\u0026rdquo;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent to participate.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eInformed consent was obtained from all individual participants included in the study.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eMascarenhas MN, Flaxman SR, Boerma T, Vanderpoel S, Gretchen A, Stevens (2012) National, regional, and global trends in infertility prevalence since 1990: a systematic analysis of 277 health surveys. PLoS medicine 9, 12 : e1001356\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRybar R, Prinosilova P, Kopecka V, Hlavicova J, Veznik Z, Zajicova A, Rubes J (2012) The effect of bacterial contamination of semen on sperm chromatin integrity and standard semen parameters in men from infertile couples. Andrologia 44 : 410\\u0026ndash;418\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eApari P\\u0026eacute;ter (2014) Jo\\u0026atilde;o Dinis de Sousa, and Viktor M\\u0026uuml;ller. Why sexually transmitted infections tend to cause infertility: an evolutionary hypothesis. PLoS Pathog 10:8\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAl-Sweih NA, Amani H, Al‐Fadli, Alexander E, Omu, Vincent OR (2012) Prevalence of \\u003cem\\u003eChlamydia trachomatis\\u003c/em\\u003e, \\u003cem\\u003eMycoplasma hominis\\u003c/em\\u003e, \\u003cem\\u003eMycoplasma genitalium\\u003c/em\\u003e, and \\u003cem\\u003eUreaplasma urealyticum\\u003c/em\\u003e infections and seminal quality in infertile and fertile men in Kuwait. Journal of andrology 33, no. 6 : 1323\\u0026ndash;1329\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRana K, Vander H, Bhandari P, Thaper D, Prabha V (2016) Microorganisms and male infertility: possible pathophysiological mechanisms. Adv Clin Med Microbiol 1:002\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSankuntaw N, Sukprasert S, Engchanil C, Kaewkes W, Chantratita W (2011) Vantanit Pairoj, and Viraphong Lulitanond. Single tube multiplex real-time PCR for the rapid detection of herpesvirus infections of the central nervous system. Mol Cell Probes 25:2\\u0026ndash;3\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWorld Health Organization (2010) Examination and Processing of Human Semen. World Health Ed, (10): 286\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEpner E, Reik A, Cimbora D, Telling A, Bender MA, Fiering S, Enver T et al (1998) The β-globin LCR is not necessary for an open chromatin structure or developmentally regulated transcription of the native mouse β-globin locus. Mol Cell 2(4):447\\u0026ndash;455\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBetsou F, Beaumont K, Sueur JM, Orfila J Construction and evaluation of internal control DNA for PCR amplification of \\u003cem\\u003eChlamydia trachomatis\\u003c/em\\u003e DNA from urine samples. Journal of clinical\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHook EW 3rd, Ching SF, Stephens J, Kim F, Hardy KR, Smith (1997) Lee. Diagnosis of \\u003cem\\u003eNeisseria gonorrhoeae\\u003c/em\\u003e infections in women by using the ligase chain reaction on patient-obtained vaginal swabs. J Clin Microbiol 35(8):2129\\u0026ndash;2132\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKnapp JS, Ohye R, Neal SW, Parekh MC, Higa H, Roselyn J (1994) Rice. Emerging in vitro resistance to quinolones in penicillinase-producing \\u003cem\\u003eNeisseria gonorrhoeae\\u003c/em\\u003e strains in Hawaii. Antimicrob Agents Chemother 38(9):2200\\u0026ndash;2203\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAbusarah EA, Ziad M, Awwad E, Charvalos, Asem A, Shehabi (2013) Molecular detection of potential sexually transmitted pathogens in semen and urine specimens of infertile and fertile males. Diagnostic microbiology and infectious disease 77, 4 : 283\\u0026ndash;286\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFode M, Fusco F, Lipshultz L, Weidner W (2016) Sexually transmitted disease and male infertility: a systematic review. Eur Urol focus 2(4):383\\u0026ndash;393\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAl-Jelehawy AH, Jaber (2021) Estimation Syphilis Serostatus Saf Infertile Patients Medico-legal Update 21(2):77Qassim Muhsin Hashim Al-Faham, Zainab Hassan Hadi Al-Saadi, Saif Jabbar Yasir, and Ammar Kareem Kadhim Al-Furaiji\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAhmadi M, Hossein A, Mirsalehian MAS, Gilani A, Bahador, and Malihe Talebi (2018). Improvement of semen parameters after antibiotic therapy in asymptomatic infertile men infected with \\u003cem\\u003eMycoplasma genitalium\\u003c/em\\u003e. Infection 46 : 31\\u0026ndash;38\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYoshida T, Deguchi T, Ito M, Maeda S-I (2002) Masayoshi Tamaki, and Hiroaki Ishiko. Quantitative detection of \\u003cem\\u003eMycoplasma genitalium\\u003c/em\\u003e from first-pass urine of men with urethritis and asymptomatic men by real-time PCR. J Clin Microbiol 40(4):1451\\u0026ndash;1455\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang Y, Liang C-L, Wu Jun‐Qing, Xu C (2006) Shi‐Xiao Qin, and Er‐Sheng Gao. Do Ureaplasma urealyticum infections in the genital tract affect semen quality? Asian J Androl 8(5):562\\u0026ndash;568\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGdoura R, Kchaou W, Chaari C, Znazen A, Keskes L (2007) Tarek Rebai, and Adnane Hammami. Ureaplasma \\u003cem\\u003eurealyticum, Ureaplasma\\u003c/em\\u003e parvum, \\u003cem\\u003eMycoplasma hominis\\u003c/em\\u003e and \\u003cem\\u003eMycoplasma genitalium\\u003c/em\\u003e infections and semen quality of infertile men. BMC Infectious Diseases 7 : 1\\u0026ndash;9\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLucena E, Moreno-Ortiz H, Coral L, Lombana O, Moran A (2014) Esteban-P\\u0026eacute;rez. Unexplained infertility caused by a latent but serious intruder: \\u003cem\\u003eTrichomonas vaginalis\\u003c/em\\u003e. JFIV Reprod Med Genet 3(1):2\\u0026ndash;4\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEl Seoud SF, Abbas MM, Habib FS (1998) Study of trichomoniasis among Egyptian male patients. J Egypt Soc Parasitol 28(1):263\\u0026ndash;270\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGimenes Fabr\\u0026iacute;cia, Souza RP, Bento JC, Jorge JV, Teixeira SS, Maria-Engler MG, Bonini, Marcia EL (2014) Male infertility: a public health issue caused by sexually transmitted pathogens. Nat Reviews Urol 11(12):672\\u0026ndash;687\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Infertility, STD, Neisseria gonorrhoeae, Semen, PCR\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3993380/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3993380/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cstrong\\u003eIntroduction\\u003c/strong\\u003e: Sexually transmitted diseases (STDs) are a severe problem because many infections are asymptomatic or have fewer symptoms and account for about 20% of male infertility.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eObjective:\\u003c/strong\\u003e This study developed Real-time PCR kits to detect \\u003cem\\u003eTreponema pallidum\\u003c/em\\u003e, \\u003cem\\u003eNeisseria gonorrhoeae\\u003c/em\\u003e, Mycoplasma species, and \\u003cem\\u003eTrichomonas vaginalis\\u003c/em\\u003e in infertile and fertile men's semen.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMethods\\u003c/strong\\u003e: Men aged 24–55 with no children and a conceiving issue were the patient group, while men aged 18–49 with at least one child and a standard seminal fluid check were the control group. The Amplisens® MULTIPRIME-FRT PCR kit was used to analyze the DNA for the human beta-globin HBB gene to determine if it came from the isolated pathogen.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eResults:\\u003c/strong\\u003e The study revealed that out of the patient group, 22 out of 54 individuals tested positive (40.9%) for \\u003cem\\u003eN. gonorrhoeae\\u003c/em\\u003e, 7 out of 54 (31.8%) for \\u003cem\\u003eT. pallidum\\u003c/em\\u003e, 4 out of 54 (18.18%) for \\u003cem\\u003eM. genitalium\\u003c/em\\u003e, and 2 out of 54 (9.09%) for \\u003cem\\u003eT. vaginalis\\u003c/em\\u003e. In the control group, which consisted of 13 males, only one infection with \\u003cem\\u003eN. gonorrhoeae\\u003c/em\\u003e was detected.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConclusion\\u003c/strong\\u003e: The four urogenital infections evaluated were common in infertile people. However, they may not be the only cause of male infertility in this region.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Multiplex Real-Time PCR Assessment of Semen Quality and Male Fertility Impacted by Sexually Transmitted Infections\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-02-29 16:09:22\",\"doi\":\"10.21203/rs.3.rs-3993380/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"d246cb55-14fd-44e8-914f-bab51ab36137\",\"owner\":[],\"postedDate\":\"February 29th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-04-15T19:32:34+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-3993380\",\"link\":\"https://doi.org/10.59393/amb25410107\",\"journal\":{\"identity\":\"acta-microbiologica-bulgarica\",\"isVorOnly\":true,\"title\":\"Acta Microbiologica Bulgarica\"},\"publishedOn\":\"2025-04-01 00:00:00\",\"publishedOnDateReadable\":\"April 1st, 2025\"},\"versionCreatedAt\":\"2024-02-29 16:09:22\",\"video\":\"\",\"vorDoi\":\"10.59393/amb25410107\",\"vorDoiUrl\":\"https://doi.org/10.59393/amb25410107\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3993380\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3993380\",\"identity\":\"rs-3993380\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}