{"paper_id":"059c34a6-ea50-4b6e-9b8b-10d8e4d240b0","body_text":"Quasi-monandry with a single-male predominating female sperm storage in pair-forming squid, Thysanoteuthis major | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Quasi-monandry with a single-male predominating female sperm storage in pair-forming squid, Thysanoteuthis major Ruku Rohana Akter, Azad Kamrun Naher, Yoshiki Kato, Noritaka Hirohashi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8815354/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract Monogamous animals often engage in long-term pair bonding. The oceanic diamond squid, Thysanoteuthis spp . are unique among cephalopods in that way they are often found in pairs consisting of one male and one female. In this study, we investigated the extent of mating fidelity in female Thysanoteuthis major in comparison to the highly polyandrous oceanic squid, Todarodes pacificus. Fragment length analysis was carried out using newly developed microsatellite markers. We found that in T. major , most females are polyandrous and each seminal receptacle (SR) contained a mixture of sperm genotypes with the mean of 6 different alleles. Additionally, all SRs within a female exhibited similar patterns of allele peaks with usually two major alleles, suggesting that there is a single male predominating sperm storage. In contrast, T. pacificus exhibited numerous alleles within SR and displayed different allele patterns between SRs. In T. major , rare alleles tended to appear in SRs locating at the most ventral side. These results suggest that T. major females are generally polyandrous and store sperm from males using two different strategies: one involving pair bonding, and the other through extra-pair copulation. We discuss a possible correlation between long-term pair bonding and a single-male predominance for sperm storage in this species. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Molecular studies in behavioral ecology over the recent decades have uncovered polyandry, a mating mode in which one female mates with more than two males during a single breeding/spawning cycle, as a prevalent pattern across animal taxa (Birkhead and Pizzari, 2002 ; Brockmann et al., 1994 ; Jones and Avise, 1997 ; Ohtani et al., 2022 ). Even in socially monogamous mammals and birds, females often mate outside their partner, known as extra pair copulation (EPC). Although EPC can bring some benefits to both sexes, it is especially advantageous for females because they can receive collective benefits from both modes. For example, monogamous or socially monogamous males often engage in pair bonding that is associated with mate guarding and paternal care for the young. Whereas, polyandrous females can receive direct and indirect benefits from multiple males such as nuptial gifts and different genetic elements, respectively. Pair bonding is more common in birds and mammals (Dolotovskaya et al., 2020 ; Hosken et al., 2009 ), and can reduce the cost of mate search, especially for species with widely scattered distributions (Loo et al., 2021 ; Schacht and Bell, 2016 ). In cephalopods, polyandry is prevailed but there are very few species reported to be monandrous, (for example 92–95% of females are genetic monogamy in Watasenia scintillans (Alam and Hirohashi, 2023 ; Sato et al., 2020 )). It is uncommon for cephalopods that males regularly engage long-term pair bonding before or after copulations. Exceptionally, the long-term pair bonding behavior has been proposed to occur in the diamond squids, Thysanoteuthis spp . Thysanoteuthis spp. are large (> 1m in adult body size), semelparous, oceanic squids distributed in tropical and subtropical oceans worldwide (Deville et al., 2024 ; Miyahara et al., 2005 ; Okutani, 1990 ) and release planktonic egg masses. T. major is most abundant among the three allopatric species of the family Thysanoteuthidae (Bower and Miyahara, 2005 ; Deville et al., 2024 ). Curiously, they are often observed in pairs of one male and one female with similar sizes. Anecdotal evidence suggests that the pairing begins in youth and continues into adulthood, indicating behavioral monogamy (Nigmatullin et al., 1995 ; Nishimura, 1966 ; Roper and Jereb, 2010 ). Currently, however, there is no genetic information available regarding the consequences of this rare phenomenon, which prompted us to investigate the molecular basis of their sexual partnership. In this study, we aimed to determine the extent of female fidelity/promiscuity in T. major by genotyping stored sperm from multiple storage organs, seminal receptacles (SRs) within the female buccal membrane using newly developed polymorphic microsatellite markers. Here, we present genetic evidence of female promiscuity. Interestingly, the paternal alleles commonly detected in all the SRs were skewed towards hypothetically a single male. We discuss possible benefits of pair bonding under the circumstance where partner scarcity is potentially problematic. Materials and methods Sample collection and species validation We obtained three pairs of T. major (Fig. 1 A) using parallel-rigged double lures, off Kami-cho, Hyogo, Japan. By using this type of lures, it is possible to fish paired squids at a time. We obtained 30 mature female specimens that were caught in waters off the Ryukyu archipelago as a part of commercial fishing (The Itoman Fishery, Okinawa). During commercial processing by the fishery, all parts except the mantle tissue were kept frozen on ship and transported to the laboratory. The specimens were first measured gonadal weights (testis, spermatophoric complex, ovary, oviduct, oviductal gland and nidamental gland) and dissected the buccal membranes and mantle tissues. Genomic DNAs were isolated from mantle tissues and sperm stored in the SRs using silica-base spin columns (TaKaRa). The species identification was carried out by sanger sequencing of mitochondrial cytochrome c oxidase I ( COI ) with BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) and Genetic Analyzer 3500 (Applied Biosystems) and by polymerase chain reaction (PCR)-based species validation using species-specific primers (Fig. S1 , Common forward primer: GTTACCGCTCATGGGTTTATTATA, Common reverse primer: TTCATCCGAGGGAAAGCTAT, T. major -specific reverse primer: CTATATCTGGTGCCCCTAGT, T. rhombus -specific primer: CTATATCAGGTGCTCCCAGC). Amplification of microsatellite loci was performed with polymerase chain reaction with 0.15 µM (either Hex, Fam, Cy3 or Ros)-tagged universal primer (Blacket et al., 2012 ) and 0.2 µM non-labeled forward and 0.5 µM reverse primers, and approximately 80 ng of genomic DNA in 10 µl of reaction mixture (KAPA2G Robust system) with heat denaturing (94 o C, 4 min) followed by 30 cycles of denaturing (94 o C 15 sec), annealing (60 o C, 15 sec) and extension (72 o C, 15 sec) and terminated by 15 min incubation at 72 o C. Fragment length analysis (ABI PRISM 3130xl Genetic Analyzer) was performed with GeneScan™ 600 LIZ dye Size Standard (Thermo Fisher Scientific). Subsequently, the four selected microsatellite loci were fully characterized by open-source tools, OSIRIS (National Institutes of Health) and GenAlEx v.6.5.1. Development of polymorphic microsatellite markers (SSRs) A series of procedures, including genomic DNA isolation, quantification and quality validation of genomic DNA, short read whole genome sequencing and bioinformatics were exactly followed as described in a previous report (Sato et al., 2020 ). Briefly, approximately 200 µg genomic DNA isolated from testis of a mature male were subjected to next generation sequencing (150 bp paired-end, Novaseq6000/PE150, Novogene), yielding 28,051,256 raw reads (BioSample: SAMD00874338; SRA: DRX611735). More than three million of paired-end reads were recovered after paired-end merger with PEAR. After filtering with a MISA + Primer 3 pipeline (Galaxy/NAAC, Japan), 46,934 SSR candidate sequences were obtained. Based on the PCR-PAGE-fragment analysis workflow with genomic DNAs isolated from 40 individual T. major as described in elsewhere (Sato et al., 2020 ), four highly polymorphic microsatellite markers (Tm45293, Tm11117, Tm40370, and Tm8400) were successfully developed (GenBank Acc. # LC916050-LC916053). Across the four SSR loci, 19 to 34 alleles were detected, while expected heterozygosity showed a higher value range of 0.925–0.962 (Table 1 , Supplementary Material Fig. S1 ). We used these microsatellite markers for genotyping sperm stored in the seminal receptacles of females. For statistical analysis, the generalized linear model (GLM) and principal component analysis (PCA) were carried out using R package version 4.4.1. Table 1 Information and characterization of newly developed polymorphic microsatellite markers for T. major genotyping Locus repeat forward sequence reverse sequence N Na Ho He Fis Pid Tm45293 (TAT)28 GTGTGTATTGGGCCGTTCTT GGATCCGAAATTTTCCTGGT 36 19 0.889 0.925 0.039 0.01 Tm11117 (AAG)26 CGATTTCGAAGGGAAAGAGA TACTCCCCACCCAGTCACTC 37 29 1.000 0.950 -0.053 0.0047 Tm40370 (GAA)21 CAACTGTCTGACCCGAAGGT TTCGCAGCCCTTTTCTTCTA 37 34 1.000 0.962 -0.040 0.0028 Tm08400 (ATA)31 CAGTGACCACCGTGCAACT TGTCAAAAACTCGATCCTCCT 37 22 0.811 0.936 0.134 0.0077 N, sample size; Na, number of alleles; Ho, observed heterozygosity; He, expected heterozygosity; Fis, fixation index; Pid, probability of identity Fragment size-based calibration to quantify each allele from mixed SSR amplicon profiles Due to features of PCR and a universal tail approach for indirect fluorescent labeling, the yield of PCR amplicon decreases as the fragment size increases. The peak height of alleles on electropherogram negatively correlated with base pair of SSR fragments. In order to estimate share rate of each allele in a mixed sperm population, we calibrate allele peaks using standard testis genomic DNAs that contain an equal amount of heterozygotic alleles. Therefore, the differences in peak height can solely be attributed to the size of amplicons. We used testis genomic DNAs isolated from 24 males, followed by singleplex PCR with 80 ng template per reaction and capillary electrophoresis as described above. We obtained the equation from a linear regression. Results Three pairs of males (average mantle length, 41.6 ± 0.36 cm; average body weight, 2.94 ± 0.38 kg, n = 3) and females (44.0 ± 0.36 cm; 3.05 ± 0.46 kg, n = 3) that were caught in the Sea of Japan, Hyogo on November, 2023 were all immature individuals (Fig. 1 A) with small testes (ranging 0.99–8.29 g) or ovaries (ranging 0-5.55 g). In these females, we were unable to find sperm in SRs (Fig. 1 B, middle ). Whereas, male (testis weight; 62.38 ± 7.89 g, n = 10) and female (ovary weight; 604.1 ± 172.8 g, n = 30) individuals that were caught in the Philippine Sea (off the Ryukyu Islands) during April to May, 2023 were all mature except one female. In this immature female, sperm were found in SRs. All specimens were confirmed to be T. major as validated by sanger sequencing and species-specific PCR approaches using mitochondrial COI sequences (Fig. S1 , (Deville et al., 2024 )). The SRs were located mostly at the ventral half of the buccal mass (Fig. 1 B, right ). Although there were individual variations in the exact location and number of SRs, ranging from 7 to 22 (mean 17.0 ± 2.5, n = 20), the number of SR was positively correlated with gonad weight (Fig. 1 C, GLM, estimate ± s.e. = 0.0162 ± 0.002, n = 14, p < 0.001). Microsatellite-based fragment length analysis using a highly polymorphic SSR (Tm11117, Table I) revealed that 93.8% (15/16) of females were polyandrous, with each SR containing three or more paternal alleles (mean 5.96 ± 1.98, N SR = 346), suggesting a mixed sperm population from multiple males (Table S1 ). The minimum number of males involved in copulation per female was estimated to be 3.06 ± 1.12 (N female = 16), if there are neither hemi- nor homozygous paternal alleles (Table S1 ). Notably, the electropherograms revealed a close resemblance of peak patterns in microsatellite fragments between different SRs within the same female (Figs. 2 A-C). In contrast, in T. pacificus , the number of allele peaks from each SR was greater and showed different allele patterns between the SRs (Figs. 3 A-C). Visualization of the peak patten similarities using principal component analysis (PCA) showed the closer proximity of data points in PC1 (with 54.1 ~ 58.6% contribution rates) in T. major than in T. pacificus (Figs. 4 A-C). To quantify the relative amount of each allele peak, we analyzed the relationship between allele size and peak height (Fig. 5 A), resulting in a linear regression equation (Fig. 5 A inset, Linear regression, r = 0.669, P < 0.001). Using this formula, the relative amount of each peak was normalized. In T. major , when the share rate of each individual allele in the SR was displayed in descending order, we found that the sum of the two most abundant alleles reached 50% of the total alleles (Fig. 5 B). In contrast, in T. pacificus , six alleles were needed to reach a 50% share (Fig. 5 C). We next focused on rare alleles that appeared in small numbers of SRs to examine if there was any particular storage pattern on the female buccal membrane (Fig. 6 A-D). We were able to detect rare alleles in 44% of females (7/16) and among them, each female contained a few rare alleles (1.3 ± 0.5, n = 7, Fig. 6 E, Figs. S2-S7). Of note, these rare alleles were typically stored in SRs located near the apical end of the ventral buccal membrane (Fig. 6 E, red circles). Discussion Pair bonding is relatively common in birds and mammals, occasional in fish, and unusual in other taxa. In invertebrates, pair bonding is quite rare with only a few reported cases, such as eusocial termites (Hartke and Baer, 2011 ), the wood-feeding cockroach (Osaki and Kasuya, 2021 ), the deep-sea sponge-associated shrimp (Saito et al., 2001 ). To the best of our knowledge, the family Thysanoteuthidae is the only group of cephalopods that has been assumed to exhibit pair bonding (Nigmatullin et al., 1995 ; Nishimura, 1966 ; Roper and Jereb, 2010 ). This assumption is based on field observations by researchers, fishermen and citizens, who have witnessed that a pair of male and female often swims together. However, a more detailed analysis of pairing behavior in this species is necessary as the definition of pair bond varies among studies, researchers, and animal groups. In birds and mammals, pair bonding mostly refers to tight association between a mating pair. In accordance with this definition, and in order to distinguish it from simply nonsexual pair forming or same-sex pairing, we investigated the molecular validation of female fidelity in the mating behavior of T. major . Although we were able to obtain three pairs of T. major in the Sea of Japan using parallel-rigged double lures ((Arkhipkin and Rey-Méndez, 2015) see p175), they were all immature individuals consisting of one male and one female. Although squids caught with this fishing method are likely to be paired individuals (two lures are aligned in parallel at a short distance), there is no strong evidence that they were actually paired in deep water due to lack of direct observations. At the very least, we found no inconsistency between these results and the previous statement that pair formation occurs before puberty. We were unable to identify paired individuals caught by the Sode-Ika ( T. major ) fishery in the waters off Ryukyu archipelago due to their commercial fishing method (using tandem-rigged multiple lures). Nevertheless, we found genetic evidence of a mixed sperm population from multiple males within the female storage organs, suggesting that a polyandrous mating system is common in T. major . Curiously, however, a composition of the mixed microsatellite alleles of extracted sperm DNAs from each SR was remarkably similar among SRs within a female, and two dominant alleles were shared by almost half of the total alleles (Fig. 5 B). These results are in sharp contrast to those of T. pacificus where there is a large number of minor alleles that are almost evenly contributed in the SR and each SR displays a dissimilar allele composition (Fig. 3 ). These findings are consistent with a previous report on T. pacificus , suggesting that random patterns of sperm reservoir usage by multiple (9 to 23) males, result in the production of siblings with mixed paternity (Sato et al., 2023 ). Therefore, it is likely that in T. pacificus , there are neither paired males nor single consort males that can monopolize mating opportunities with single females. From these results, we speculated a possible scenario of mating episodes in T. major . 1) A paired-male transfers the spermatophores to his partner female multiple times (multiple copulations with a male). 2) Females occasionally engage in EPC with multiple males (a single copulation with multiple males). Due to the higher frequency of copulation by a paired-male compared to extra-pair males, the allele sharing rate by a paired-male in SRs is much larger. Additionally, a paired-male may have greater opportunities to remove the spermatangia transferred by extra-pair males from the female buccal membrane (Hall and Hanlon, 2002 ; Jean Geary, 1997 ; Wada et al., 2010 ). This can result in stored sperm becoming biased towards a paired-male. It is worth noting that we often find rare alleles in SRs located at the ventral end of the buccal membrane, which is a proximal site for egg laying (Fig. 6 ). Therefore, it is interesting to speculate that males pursuing extra-pair copulations may have fewer mating opportunities, resulting in choosing the most suitable insemination site for fertilization success. In order to determine the likelihood of these scenarios, the future research await to capture pair-bonded mated individuals in the wild. Although we are currently unable to test these hypotheses due to difficulty in obtaining them, it is worth speculating the reasons why T. major has adopted pair bonding despite no such behavior has been documented in other squids. First, the family Thysanoteuthidae occurs in a wide range of tropical and subtropical oceans worldwide (Deville et al., 2024 ). Such a horizontal dispersal with patchy distributions (ONITSUKA et al., 2010) of their habitats is considered as a typical characteristic of allopatric non-ecological speciation (Czekanski-Moir and Rundell, 2019 ). Next, they are also inactive swimmers with mean movement speeds of 0.9–1.3 km h − 1 (MIYAHARA et al., 2008) and recognized as one of fastest-growing squids with maximum of 4.6 mm d − 1 (Nigmatullin et al., 1995 ) or 7–10 cm mo − 1 (Bower and Miyahara, 2005 ) in mantle length and 177g d − 1 in body weight (Nigmatullin et al., 1995 ). Given these characteristics, T. major is unlikely to form large schools, as is often seen in epipelagic and mesopelagic squids. Instead, grouping in small numbers of individuals is more feasible to acquire prey resources. In line with this, it has been reported that Thysanoteuthis normally occurs in small groups with two or little more ( ≦ 5) individuals swimming in the surface waters (Bower and Miyahara, 2005 ). However, due to their scattered distribution and limited swimming capacity, squids, particularly male individuals, may suffer from a higher cost of mate search. Therefore, we hypothesize that pair-bonding in adults or pair-forming in young individuals may be associated with partner scarcity and the resulting high costs of female search in T. major . Theoretical (Loo et al., 2021 ) and empirical (Schacht and Bell, 2016 ) studies suggest that partner scarcity can lead to mate guarding by males and, therefore, monogamy. If two or more paired individuals happen to encounter each other, EPC would occur coincidentally. In T. rhombus (Thysanoteuthidae), the photophore is present only in immature stages and is lost by adulthood (Alejo-Plata‍ et al., 2023 ), suggesting a potential role in the pairing behavior between male and female at immature stages (Otjacques et al., 2023 ). Future research should focus on obtaining molecular evidence for the connection between pair bonding and partner's sperm predominance in SRs, as well as determining the paternity rate in egg masses to understand the behavioral ecology and mating system of this species. Furthermore, studies on invertebrate pair bonding may offer new insights into the evolution of protostome brains and endocrine systems that control socio-sexual cognitive abilities and performance. Declarations Conflict of interest The authors have no competing interests regarding this research. Ethics T. major individuals were obtained from fisheries as dead specimens, so it was not necessary to obtain approval for animal experiment. However, we conducted our experiments following the guidelines set by the animal care committees and Guidelines for the Care and Welfare of Cephalopods in Research (Fiorito et al., 2015 ), particularly regarding the minimum number of specimens required for our experiments. We also consulted with fisheries in Okinawa Prefecture, Japan beforehand regarding the handling and maintenance of fished specimens on the ship to consider ethical and welfare issues. The animals were quickly killed by disconnecting the nervous pathways to the lower parts of the nervous system followed by opening the mantle to remove the gut and head parts. Author contributions RRK: data curation, formal analysis, investigation, methodology and writing—original draft; AKN: data curation, formal analysis, investigation, methodology and writing—original draft; YK: resources, funding acquisition and writing—review and editing. NH: conceptualization, funding acquisition, data curation, formal analysis, methodology and writing—review and editing. All authors gave final approval for publication and agreed to be held accountable for the work performed herein. Acknowledgments and funding We are grateful to Mr. Yasuo Taniwaki, a fisherman, Hyogo and Mr. Yoshinao Higa at the Itomon Fishery Cooperative, Okinawa for transporting frozen squids, Dr. Makoto Nagata at Osaka Medical and Pharmaceutical University for mathematics. We acknowledge Interdisciplinary Center for Science Research at Shimane University for use of the facility, and the funding supports from the Faculty of Life and Environmental Science at Shimane University and Kakenhi (22H05681, 25K02088 to N.H. and 21K19158, 25K09247 to Y.K). This research was conducted in part as SDGs Research Project at Shimane University. Data availability The datasets generated during and/or analyzed during the current study are available in Supplementary Material. References Alam MNE, Hirohashi N (2023) Persistence of a highly monoandrous mating system despite an extremely male-biased operational sex ratio in the firefly squid Watasenia scintillans. Mar Biol 170:52. 10.1007/s00227-023-04204-5 Alejo-Plata‍ MdC, Vallarta-Zárate JRF, Martínez-Magaña‍ VH, Rojas-González RI (2023) First record of juveniles of the oceanic squid Thysanoteuthis rhombus (Cephalopoda: Thysanoteuthidae) in the Gulf of Tehuantepec. Northeastern Trop Pac Graellsia 79:e199. 10.3989/graellsia.2023.v79.377 Arkhipkin AI, Rey-Méndez M et al (2015) World Squid Fisheries. Reviews Fisheries Sci Aquaculture 23:92–252. 10.1080/23308249.2015.1026226 Birkhead TR, Pizzari T (2002) Postcopulatory sexual selection. Nat Rev Genet 3:262–273. 10.1038/nrg774 Blacket MJ, Robin C, Good RT, Lee SF, Miller AD (2012) Universal primers for fluorescent labelling of PCR fragments–an efficient and cost-effective approach to genotyping by fluorescence. Mol Ecol Resour 12:456–463. 10.1111/j.1755-0998.2011.03104.x Bower JR, Miyahara K (2005) The diamond squid (Thysanoteuthis rhombus): A review of the fishery and recent research in Japan. Fish Res 73:1–11. https://doi.org/10.1016/j.fishres.2005.01.020 Brockmann HJ, Colson T, Potts W (1994) Sperm competition in horseshoe crabs (Limulus polyphemus). Behav Ecol Sociobiol 35:153–160. 10.1007/BF00167954 Czekanski-Moir JE, Rundell RJ (2019) The Ecology of Nonecological Speciation and Nonadaptive Radiations. Trends Ecol Evol 34:400–415. https://doi.org/10.1016/j.tree.2019.01.012 Deville D, Mori S, Kawai K, Escánez A, Macali A, Lishchenko F, Braid H, Githaiga-Mwicigi J, Mohamed KS, Bolstad KSR, Miyahara K, Sugimoto C, Fernández-Álvarez FÁ, Sanchez G (2024) Cryptic biodiversity in the commercial diamondback squid Thysanoteuthis rhombus Troschel 1857. Rev Fish Biol Fish 34:293–313. 10.1007/s11160-023-09813-3 Dolotovskaya S, Roos C, Heymann EW (2020) Genetic monogamy and mate choice in a pair-living primate. Sci Rep 10:20328. 10.1038/s41598-020-77132-9 Fiorito G, Affuso A, Basil J, Cole A, de Girolamo P, D’Angelo L, Dickel L, Gestal C, Grasso F, Kuba M, Mark F, Melillo D, Osorio D, Perkins K, Ponte G, Shashar N, Smith D, Smith J, Andrews PL (2015) Guidelines for the Care and Welfare of Cephalopods in Research –A consensus based on an initiative by CephRes, FELASA and the Boyd Group. Lab Anim 49:1–90. 10.1177/0023677215580006 Hall K, Hanlon R (2002) Principal features of the mating system of a large spawning aggregation of the giant Australian cuttlefish Sepia apama (Mollusca: Cephalopoda). Mar Biol 140:533–545. 10.1007/s00227-001-0718-0 Hartke TR, Baer B (2011) The mating biology of termites: a comparative review. Anim Behav 82:927–936. https://doi.org/10.1016/j.anbehav.2011.07.022 Hosken DJ, Stockley P, Tregenza T, Wedell N (2009) Monogamy and the Battle of the Sexes. Ann Rev Entomol 54:361–378. https://doi.org/10.1146/annurev.ento.54.110807.090608 Jean Geary B (1997) Female Choice of Males in Cuttlefish (Mollusca: Cephalopoda). Behaviour 134:975–988 Jones AG, Avise JC (1997) Microsatellite analysis of maternity and the mating system in the Gulf pipefish Syngnathus scovelli, a species with male pregnancy and sex-role reversal. Mol Ecol 6:203–213. https://doi.org/10.1046/j.1365-294X.1997.00173.x Loo SL, Rose D, Hawkes K, Kim PS (2021) Mate guarding in primates arises due to partner scarcity, even if the father provides no paternal care at all. Theor Popul Biol 142:100–113. https://doi.org/10.1016/j.tpb.2021.09.006 MIYAHARA K., OTA T., HATAYAMA J., MITSUNAGA Y., GOTO T., ONITSUKA G. (2008) Tagging studies on the diamond squid (Thysanoteuthis rhombus) in the western Sea of Japan. Bull Jpn Soc Fish Oceanogr 72:30–36 Miyahara K, Ota T, Kohno N, Ueta Y, Bower JR (2005) Catch fluctuations of the diamond squid Thysanoteuthis rhombus in the Sea of Japan and models to forecast CPUE based on analysis of environmental factors. Fish Res 72:71–79. https://doi.org/10.1016/j.fishres.2004.10.013 Nigmatullin CM, Arkhipkin AI, Sabirov RM (1995) Age, growth and reproductive biology of diamond-shaped squid Thysanoteuthis rhombus (Oegopsida: Thysanoteuthidae). Mar Ecol Prog Ser 124:73–87 Nishimura S (1966) Notes on the occurrence and biology of the oceanic squid, Thysanoteuthis rhombus Toschel, in Japan. Publication Seto Mar Biol Lab 14:327–349 Ohtani R, Yamamoto J, Yanagimoto T, Adachi K, Bower JR, Fujioka HA, Hirose M, Nakaya M, Suzuki S, Tokioka S (2022) Genetic evidence for multiple mating and mixing of sperm from multiple males in the seminal receptacles of female Japanese flying squid (Todarodes pacificus). J Molluscan Stud 88. 10.1093/mollus/eyac021 Okutani T (1990) Squids, cuttlefish and octopuses∗. Mar Behav Physiol 18:1–17. 10.1080/10236249009378778 ONITSUKA G., HIROSE N., MIYAHARA K., OTA T., HATAYAMA J., MITSUNAGA Y., GOTO T. (2010) Numerical simulation of the migration and distribution of diamond squid (Thysanoteuthis rhombus) in the southwest Sea of Japan. Fish Oceanogr 19:63–75. https://doi.org/10.1111/j.1365-2419.2009.00528.x Osaki H, Kasuya E (2021) Mutual wing-eating between female and male within mating pairs in wood-feeding cockroach. Ethology 127:433–437. https://doi.org/10.1111/eth.13133 Otjacques E, Pissarra V, Bolstad K, Xavier JC, McFall-Ngai M, Rosa R (2023) Bioluminescence in cephalopods: biodiversity, biogeography and research trends. Front Mar Sci 10–2023. 10.3389/fmars.2023.1161049 Roper CFE, Jereb P (2010) Cephalopods of the world - an annotated and illustrated catalogue of cephalopod species known to date. Myopsid and oegopsid squids, vol 2. FAO Species Catalogue for Fishery Purposes FAO, Rome Saito T, Uchida I, Takeda M (2001) Pair formation in Spongicola japonica (Crustacea: Stenopodidea: Spongicolidae), a shrimp associated with deep-sea hexactinellid sponges. J Mar Biol Association United Kingd 81:789–797. 10.1017/S002531540100460X Sato N, Ono H, Hirohashi N, Iwata Y (2023) Multiplicity of sperm receptacles for securing the offspring genetic variability in a pelagic squid. Mar Biol 170:51. 10.1007/s00227-023-04194-4 Sato N, Tsuda S-I, Nur E, Alam M, Sasanami T, Iwata Y, Kusama S, Inamura O, Yoshida M-a, Hirohashi N (2020) Rare polyandry and common monogamy in the firefly squid, Watasenia scintillans. Sci Rep 10:10962. 10.1038/s41598-020-68006-1 Schacht R, Bell AV (2016) The evolution of monogamy in response to partner scarcity. Sci Rep 6:32472. 10.1038/srep32472 Wada T, Takegaki T, Mori T, Natsukari Y (2010) Sperm removal, ejaculation and their behavioural interaction in male cuttlefish in response to female mating history. Anim Behav 79:613–619. https://doi.org/10.1016/j.anbehav.2009.12.004 Supplementary Files ManuscriptDiamondsquidfinalsuppl.docx RukufigS1.jpeg RukufigS2.jpeg RukufigS3.jpeg RukufigS4.jpeg RukufigS5.jpeg RukufigS6.jpeg RukufigS7.jpeg Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revise and Resubmit 19 Mar, 2026 Reviewers agreed at journal 13 Feb, 2026 Reviewers invited by journal 12 Feb, 2026 Editor assigned by journal 10 Feb, 2026 First submitted to journal 07 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-8815354\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":590286719,\"identity\":\"65465b5a-cfbd-4505-8db1-a48e7177a925\",\"order_by\":0,\"name\":\"Ruku Rohana Akter\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shimane Daigaku\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ruku\",\"middleName\":\"Rohana\",\"lastName\":\"Akter\",\"suffix\":\"\"},{\"id\":590286720,\"identity\":\"d0923284-03be-4018-9399-fc97551de19e\",\"order_by\":1,\"name\":\"Azad Kamrun Naher\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shimane Daigaku\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Azad\",\"middleName\":\"Kamrun\",\"lastName\":\"Naher\",\"suffix\":\"\"},{\"id\":590286721,\"identity\":\"07da2d7e-771e-45b6-bb0e-e8aa70506aaa\",\"order_by\":2,\"name\":\"Yoshiki Kato\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Japan Fisheries Research and Education Agency: Kokuritsu Kenkyu Kaihatsu Hojin Suisan Kenkyu Kyoiku Kiko\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yoshiki\",\"middleName\":\"\",\"lastName\":\"Kato\",\"suffix\":\"\"},{\"id\":590286722,\"identity\":\"86527080-ecf6-426a-9de1-896264c2580d\",\"order_by\":3,\"name\":\"Noritaka Hirohashi\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/klEQVRIiWNgGAWjYBACA2Yg8aFAgh9IsTEkIMkw49PCOMNAQrKBeC0gSR4DBogWooA5O+/DxzYGFkCXsT978DDHLo+fAWjCjxoGdnMcWiyb2Y2NcwwkgC7jMTdI3JZcDGQYMPYcY2C2bMDhsMNsbNJALXUGB3jYJBK3MSduuP/GgIG3gYHZ4AAeLRZAW+wPsD8DaqlP3H8AaMtfQloYgFqA4WAG1HI4cQPQL8wEbGE27AFqkTjMA9JyPHHGAbaCwzLHJHD75fwxxgc/Kuok+Nvbn0n+3Fad2N/AvPHhmxqbZFwhhgDIUQd0kkSyAUEt6MCOdC2jYBSMglEwTAEAb7VJI+55cVMAAAAASUVORK5CYII=\",\"orcid\":\"https://orcid.org/0000-0001-9264-9517\",\"institution\":\"Shimane University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Noritaka\",\"middleName\":\"\",\"lastName\":\"Hirohashi\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2026-02-07 12:17:24\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-8815354/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-8815354/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":103002116,\"identity\":\"428d0063-e5e1-41c3-94d1-d01bf6d94506\",\"added_by\":\"auto\",\"created_at\":\"2026-02-19 13:57:31\",\"extension\":\"jpeg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":248443,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eDevelopment of sperm storage organs in female buccal membrane\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA, \\u003c/strong\\u003ean immature pair of the diamond squid,\\u003cem\\u003e T. major\\u003c/em\\u003e caught by lure fishing using parallel-rigged double jigs. \\u003cstrong\\u003eB, \\u003c/strong\\u003ethe buccal masses isolated from immature pair (\\u003cem\\u003eleft\\u003c/em\\u003e and \\u003cem\\u003emiddle\\u003c/em\\u003e) and the mature female (\\u003cem\\u003eright\\u003c/em\\u003e). Arrowheads indicate seminal receptacles (SRs) which do not contain sperm. Whereas in a mature female, SRs develop a pinkish color and contain sperm. \\u003cstrong\\u003eC, \\u003c/strong\\u003ea positive correlation between the total number of SR and gonad weight.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Rukufig1.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8815354/v1/d38c02d09261e3673f06c088.jpeg\"},{\"id\":103050218,\"identity\":\"27e39a3f-302b-4b42-820d-d6a7e9098310\",\"added_by\":\"auto\",\"created_at\":\"2026-02-20 07:48:49\",\"extension\":\"jpeg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":214961,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe allele peak patterns in each SR in \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eT. major\\u003c/strong\\u003e\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA, \\u003c/strong\\u003ephotographs showing isolated buccal mass which contains a dozen of SR (\\u003cem\\u003earrowheads\\u003c/em\\u003e). \\u003cstrong\\u003eB, \\u003c/strong\\u003erepresentative electrograms of fragment analysis using sperm genomic DNAs isolated from each SR indicated in (A). \\u003cstrong\\u003eC, \\u003c/strong\\u003estacked columns show the frequency of allele composition for each SR (individual color) in individual SR.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Rukufig2.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8815354/v1/c79f7ea3d59ecac580672083.jpeg\"},{\"id\":103049890,\"identity\":\"c168f4dd-98e8-4392-b661-8a19dad97594\",\"added_by\":\"auto\",\"created_at\":\"2026-02-20 07:47:04\",\"extension\":\"jpeg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":253698,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe allele peak patterns in each SR in \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eT. pacificus\\u003c/strong\\u003e\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA, \\u003c/strong\\u003ephotographs showing the isolated buccal mass which contains a dozen of SR (\\u003cem\\u003earrowheads\\u003c/em\\u003e). \\u003cstrong\\u003eB, \\u003c/strong\\u003erepresentative electrograms of fragment analysis using sperm genomic DNAs isolated from each SR indicated in (A). \\u003cstrong\\u003eC, \\u003c/strong\\u003estacked columns show the frequency of allele composition for each SR (individual color) in individual SR.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Rukufig3.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8815354/v1/77cc19dbd0fdabd256bc7953.jpeg\"},{\"id\":103002120,\"identity\":\"aefd4672-0825-4f20-b6be-72972a0bb8dc\",\"added_by\":\"auto\",\"created_at\":\"2026-02-19 13:57:31\",\"extension\":\"jpeg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":172515,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe similarity of allele peak patterns among SRs within a female.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eShown are principal component analysis (PCA) of the allele peak patterns (rates of each allele share) obtained from each SR of the same female. For \\u003cem\\u003eT. pacificus\\u003c/em\\u003e, only one SSR (Tp14, GenBank acc.#: AB327172.1) was used.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Rukufig4.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8815354/v1/5ce745daf3b4f1c0823e2a2e.jpeg\"},{\"id\":103002118,\"identity\":\"ef4c89f9-a4ab-4fc8-800b-0bf383e2a1a5\",\"added_by\":\"auto\",\"created_at\":\"2026-02-19 13:57:31\",\"extension\":\"jpeg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":185489,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eEstimation of cumulative allele share rate of stored sperm in total SRs within a female.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA,\\u003c/strong\\u003eplots show pairwise correlations between allele size and peak height of heterozygotes on electropherograms obtained by fragment analysis.\\u003cstrong\\u003e B, C,\\u003c/strong\\u003e the cumulative share rates of the normalized amount of each allele in sperm population stored in SRs for \\u003cem\\u003eT. major\\u003c/em\\u003e (B) and \\u003cem\\u003eT. pacificus\\u003c/em\\u003e (C) are shown. Each line represents data from a female individual analyzed with SSR117, and their average is shown with a bold \\u003cem\\u003ered\\u003c/em\\u003eline.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Rukufig5.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8815354/v1/9cb6aea50bb352ae95258afc.jpeg\"},{\"id\":103002121,\"identity\":\"965d0edc-2c92-4dca-a873-6405e2fc4dfc\",\"added_by\":\"auto\",\"created_at\":\"2026-02-19 13:57:31\",\"extension\":\"jpeg\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":308318,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eDistribution of SRs on female buccal membrane and location of SRs that contain rare alleles.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA, \\u003c/strong\\u003emultiple-aligned electropherograms show maternal alleles (\\u003cem\\u003epink arrowheads\\u003c/em\\u003e), dominant (\\u003cem\\u003epurple arrowheads\\u003c/em\\u003e) and other (\\u003cem\\u003ecyan arrowheads\\u003c/em\\u003e) paternal alleles. The paternal alleles that only appeared in a few SRs are marked in \\u003cem\\u003ered circles\\u003c/em\\u003e. \\u003cstrong\\u003eB, C, \\u003c/strong\\u003edistribution of SRs (B) and their numbering (C) corresponding to (A). The SRs that contain rare alleles are marked in \\u003cem\\u003ered\\u003c/em\\u003e. \\u003cstrong\\u003eD,\\u003c/strong\\u003e similar to (C), the distribution of SRs (\\u003cem\\u003eblue\\u003c/em\\u003e) and localization of rare alleles (\\u003cem\\u003ered\\u003c/em\\u003e) in other 10 females are shown (details are shown in Figs. S2-S7). In diagrams, the dorsal side of a heptagonal buccal mass is aligned at the \\u003cem\\u003etop,\\u003c/em\\u003e with lines indicating the dorsoventral axis (\\u003cem\\u003eblue\\u003c/em\\u003e) and the left-right axis (\\u003cem\\u003eorange\\u003c/em\\u003e). Female ID numbers are shown in each diagram.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Rukufig6.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8815354/v1/325ff03ced27fcdba0e3523e.jpeg\"},{\"id\":103056973,\"identity\":\"a85424f8-b10f-466c-a030-8345e2048e4f\",\"added_by\":\"auto\",\"created_at\":\"2026-02-20 09:26:42\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2129300,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8815354/v1/91943f64-bc9c-4329-b947-8acdaf3df3a3.pdf\"},{\"id\":103002126,\"identity\":\"dbb28852-1aa0-4c0b-a9f1-aef0fe46dc13\",\"added_by\":\"auto\",\"created_at\":\"2026-02-19 13:57:31\",\"extension\":\"docx\",\"order_by\":10,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":36939,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"ManuscriptDiamondsquidfinalsuppl.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8815354/v1/329576b3abed4a0b73387cd0.docx\"},{\"id\":103050096,\"identity\":\"606720d6-bdeb-40ea-b878-5c79fbda6748\",\"added_by\":\"auto\",\"created_at\":\"2026-02-20 07:48:10\",\"extension\":\"jpeg\",\"order_by\":11,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":263967,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"RukufigS1.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8815354/v1/8aad349eeef4ee3dee0388f1.jpeg\"},{\"id\":103002127,\"identity\":\"029a999c-0467-4946-99ce-db910d7b007d\",\"added_by\":\"auto\",\"created_at\":\"2026-02-19 13:57:31\",\"extension\":\"jpeg\",\"order_by\":12,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":283562,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"RukufigS2.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8815354/v1/0475f7f430533624ef247837.jpeg\"},{\"id\":103056529,\"identity\":\"0b83b357-c830-4a9d-94f3-81cba7d2ad4d\",\"added_by\":\"auto\",\"created_at\":\"2026-02-20 09:13:38\",\"extension\":\"jpeg\",\"order_by\":13,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":288979,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"RukufigS3.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8815354/v1/7d361ae351eb626c0efd8688.jpeg\"},{\"id\":103049898,\"identity\":\"fe33bdae-7dcd-41ce-9773-21e44779d05a\",\"added_by\":\"auto\",\"created_at\":\"2026-02-20 07:47:06\",\"extension\":\"jpeg\",\"order_by\":14,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":262602,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"RukufigS4.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8815354/v1/4c63163de63485253c60c879.jpeg\"},{\"id\":103049960,\"identity\":\"6a5c69a2-65fb-4bfa-a75a-3bacd0140b7a\",\"added_by\":\"auto\",\"created_at\":\"2026-02-20 07:47:27\",\"extension\":\"jpeg\",\"order_by\":15,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":337729,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"RukufigS5.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8815354/v1/396718c9ca2407a38bf51c5c.jpeg\"},{\"id\":103002123,\"identity\":\"9051920c-0289-4593-acd3-45c49aa5230a\",\"added_by\":\"auto\",\"created_at\":\"2026-02-19 13:57:31\",\"extension\":\"jpeg\",\"order_by\":16,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":323253,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"RukufigS6.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8815354/v1/cc3aad48e5948850c96c388c.jpeg\"},{\"id\":103002125,\"identity\":\"82b005e8-381d-478f-860e-1cdd81dda4cb\",\"added_by\":\"auto\",\"created_at\":\"2026-02-19 13:57:31\",\"extension\":\"jpeg\",\"order_by\":17,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":303924,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"RukufigS7.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8815354/v1/eca97a08904cd742b46b7abc.jpeg\"}],\"financialInterests\":\"\",\"formattedTitle\":\"Quasi-monandry with a single-male predominating female sperm storage in pair-forming squid, Thysanoteuthis major\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eMolecular studies in behavioral ecology over the recent decades have uncovered polyandry, a mating mode in which one female mates with more than two males during a single breeding/spawning cycle, as a prevalent pattern across animal taxa (Birkhead and Pizzari, \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e2002\\u003c/span\\u003e; Brockmann et al., \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e1994\\u003c/span\\u003e; Jones and Avise, \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e1997\\u003c/span\\u003e; Ohtani et al., \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e). Even in socially monogamous mammals and birds, females often mate outside their partner, known as extra pair copulation (EPC). Although EPC can bring some benefits to both sexes, it is especially advantageous for females because they can receive collective benefits from both modes. For example, monogamous or socially monogamous males often engage in pair bonding that is associated with mate guarding and paternal care for the young. Whereas, polyandrous females can receive direct and indirect benefits from multiple males such as nuptial gifts and different genetic elements, respectively. Pair bonding is more common in birds and mammals (Dolotovskaya et al., \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e; Hosken et al., \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2009\\u003c/span\\u003e), and can reduce the cost of mate search, especially for species with widely scattered distributions (Loo et al., \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e; Schacht and Bell, \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eIn cephalopods, polyandry is prevailed but there are very few species reported to be monandrous, (for example 92\\u0026ndash;95% of females are genetic monogamy in \\u003cem\\u003eWatasenia scintillans\\u003c/em\\u003e (Alam and Hirohashi, \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e; Sato et al., \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e)). It is uncommon for cephalopods that males regularly engage long-term pair bonding before or after copulations. Exceptionally, the long-term pair bonding behavior has been proposed to occur in the diamond squids, \\u003cem\\u003eThysanoteuthis spp\\u003c/em\\u003e. \\u003cem\\u003eThysanoteuthis spp.\\u003c/em\\u003e are large (\\u0026gt;\\u0026thinsp;1m in adult body size), semelparous, oceanic squids distributed in tropical and subtropical oceans worldwide (Deville et al., \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e; Miyahara et al., \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e; Okutani, \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e1990\\u003c/span\\u003e) and release planktonic egg masses. \\u003cem\\u003eT. major\\u003c/em\\u003e is most abundant among the three allopatric species of the family Thysanoteuthidae (Bower and Miyahara, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e; Deville et al., \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). Curiously, they are often observed in pairs of one male and one female with similar sizes. Anecdotal evidence suggests that the pairing begins in youth and continues into adulthood, indicating behavioral monogamy (Nigmatullin et al., \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e1995\\u003c/span\\u003e; Nishimura, \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e1966\\u003c/span\\u003e; Roper and Jereb, \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e). Currently, however, there is no genetic information available regarding the consequences of this rare phenomenon, which prompted us to investigate the molecular basis of their sexual partnership.\\u003c/p\\u003e \\u003cp\\u003eIn this study, we aimed to determine the extent of female fidelity/promiscuity in \\u003cem\\u003eT. major\\u003c/em\\u003e by genotyping stored sperm from multiple storage organs, seminal receptacles (SRs) within the female buccal membrane using newly developed polymorphic microsatellite markers. Here, we present genetic evidence of female promiscuity. Interestingly, the paternal alleles commonly detected in all the SRs were skewed towards hypothetically a single male. We discuss possible benefits of pair bonding under the circumstance where partner scarcity is potentially problematic.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSample collection and species validation\\u003c/h2\\u003e \\u003cp\\u003eWe obtained three pairs of \\u003cem\\u003eT. major\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA) using parallel-rigged double lures, off Kami-cho, Hyogo, Japan. By using this type of lures, it is possible to fish paired squids at a time. We obtained 30 mature female specimens that were caught in waters off the Ryukyu archipelago as a part of commercial fishing (The Itoman Fishery, Okinawa). During commercial processing by the fishery, all parts except the mantle tissue were kept frozen on ship and transported to the laboratory. The specimens were first measured gonadal weights (testis, spermatophoric complex, ovary, oviduct, oviductal gland and nidamental gland) and dissected the buccal membranes and mantle tissues. Genomic DNAs were isolated from mantle tissues and sperm stored in the SRs using silica-base spin columns (TaKaRa). The species identification was carried out by sanger sequencing of mitochondrial cytochrome c oxidase I (\\u003cem\\u003eCOI\\u003c/em\\u003e) with BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) and Genetic Analyzer 3500 (Applied Biosystems) and by polymerase chain reaction (PCR)-based species validation using species-specific primers (Fig. \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e, Common forward primer: GTTACCGCTCATGGGTTTATTATA, Common reverse primer: TTCATCCGAGGGAAAGCTAT, \\u003cem\\u003eT. major\\u003c/em\\u003e-specific reverse primer: CTATATCTGGTGCCCCTAGT, \\u003cem\\u003eT. rhombus\\u003c/em\\u003e-specific primer: CTATATCAGGTGCTCCCAGC). Amplification of microsatellite loci was performed with polymerase chain reaction with 0.15 \\u0026micro;M (either Hex, Fam, Cy3 or Ros)-tagged universal primer (Blacket et al., \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e2012\\u003c/span\\u003e) and 0.2 \\u0026micro;M non-labeled forward and 0.5 \\u0026micro;M reverse primers, and approximately 80 ng of genomic DNA in 10 \\u0026micro;l of reaction mixture (KAPA2G Robust system) with heat denaturing (94 \\u003csup\\u003eo\\u003c/sup\\u003eC, 4 min) followed by 30 cycles of denaturing (94 \\u003csup\\u003eo\\u003c/sup\\u003eC 15 sec), annealing (60 \\u003csup\\u003eo\\u003c/sup\\u003eC, 15 sec) and extension (72 \\u003csup\\u003eo\\u003c/sup\\u003eC, 15 sec) and terminated by 15 min incubation at 72 \\u003csup\\u003eo\\u003c/sup\\u003eC. Fragment length analysis (ABI PRISM 3130xl Genetic Analyzer) was performed with GeneScan\\u0026trade; 600 LIZ dye Size Standard (Thermo Fisher Scientific). Subsequently, the four selected microsatellite loci were fully characterized by open-source tools, OSIRIS (National Institutes of Health) and GenAlEx v.6.5.1.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eDevelopment of polymorphic microsatellite markers (SSRs)\\u003c/h3\\u003e\\n\\u003cp\\u003eA series of procedures, including genomic DNA isolation, quantification and quality validation of genomic DNA, short read whole genome sequencing and bioinformatics were exactly followed as described in a previous report (Sato et al., \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). Briefly, approximately 200 \\u0026micro;g genomic DNA isolated from testis of a mature male were subjected to next generation sequencing (150 bp paired-end, Novaseq6000/PE150, Novogene), yielding 28,051,256 raw reads (BioSample: SAMD00874338; SRA: DRX611735). More than three million of paired-end reads were recovered after paired-end merger with PEAR. After filtering with a MISA\\u0026thinsp;+\\u0026thinsp;Primer 3 pipeline (Galaxy/NAAC, Japan), 46,934 SSR candidate sequences were obtained. Based on the PCR-PAGE-fragment analysis workflow with genomic DNAs isolated from 40 individual \\u003cem\\u003eT. major\\u003c/em\\u003e as described in elsewhere (Sato et al., \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e), four highly polymorphic microsatellite markers (Tm45293, Tm11117, Tm40370, and Tm8400) were successfully developed (GenBank Acc. # LC916050-LC916053). Across the four SSR loci, 19 to 34 alleles were detected, while expected heterozygosity showed a higher value range of 0.925\\u0026ndash;0.962 (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e, Supplementary Material Fig. \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e). We used these microsatellite markers for genotyping sperm stored in the seminal receptacles of females. For statistical analysis, the generalized linear model (GLM) and principal component analysis (PCA) were carried out using R package version 4.4.1.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eInformation and characterization of newly developed polymorphic microsatellite markers for \\u003cem\\u003eT. major\\u003c/em\\u003e genotyping\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"10\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c8\\\" colnum=\\\"8\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c9\\\" colnum=\\\"9\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c10\\\" colnum=\\\"10\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLocus\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003erepeat\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eforward sequence\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003ereverse sequence\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eN\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eNa\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eHo\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003eHe\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003eFis\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c10\\\"\\u003e \\u003cp\\u003ePid\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTm45293\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e(TAT)28\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGTGTGTATTGGGCCGTTCTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eGGATCCGAAATTTTCCTGGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e36\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e19\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e0.889\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.925\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e0.039\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c10\\\"\\u003e \\u003cp\\u003e0.01\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTm11117\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e(AAG)26\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCGATTTCGAAGGGAAAGAGA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eTACTCCCCACCCAGTCACTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e37\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e29\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e1.000\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.950\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e-0.053\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c10\\\"\\u003e \\u003cp\\u003e0.0047\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTm40370\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e(GAA)21\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCAACTGTCTGACCCGAAGGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eTTCGCAGCCCTTTTCTTCTA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e37\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e34\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e1.000\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.962\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e-0.040\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c10\\\"\\u003e \\u003cp\\u003e0.0028\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTm08400\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e(ATA)31\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCAGTGACCACCGTGCAACT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eTGTCAAAAACTCGATCCTCCT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e37\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e22\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e0.811\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.936\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e0.134\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c10\\\"\\u003e \\u003cp\\u003e0.0077\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003ctfoot\\u003e \\u003ctr\\u003e\\u003ctd colspan=\\\"10\\\"\\u003eN, sample size; Na, number of alleles; Ho, observed heterozygosity; He, expected heterozygosity; Fis, fixation index; Pid, probability of identity\\u003c/td\\u003e\\u003c/tr\\u003e \\u003c/tfoot\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e\\u003cp\\u003e\\u003cstrong\\u003eFragment size-based calibration to quantify each allele from mixed SSR amplicon profiles\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eDue to features of PCR and a universal tail approach for indirect fluorescent labeling, the yield of PCR amplicon decreases as the fragment size increases. The peak height of alleles on electropherogram negatively correlated with base pair of SSR fragments. In order to estimate share rate of each allele in a mixed sperm population, we calibrate allele peaks using standard testis genomic DNAs that contain an equal amount of heterozygotic alleles. Therefore, the differences in peak height can solely be attributed to the size of amplicons. We used testis genomic DNAs isolated from 24 males, followed by singleplex PCR with 80 ng template per reaction and capillary electrophoresis as described above. We obtained the equation from a linear regression. \\u0026nbsp; \\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003eThree pairs of males (average mantle length, 41.6\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.36 cm; average body weight, 2.94\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.38 kg, n\\u0026thinsp;=\\u0026thinsp;3) and females (44.0\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.36 cm; 3.05\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.46 kg, n\\u0026thinsp;=\\u0026thinsp;3) that were caught in the Sea of Japan, Hyogo on November, 2023 were all immature individuals (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA) with small testes (ranging 0.99\\u0026ndash;8.29 g) or ovaries (ranging 0-5.55 g). In these females, we were unable to find sperm in SRs (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB, \\u003cem\\u003emiddle\\u003c/em\\u003e). Whereas, male (testis weight; 62.38\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;7.89 g, n\\u0026thinsp;=\\u0026thinsp;10) and female (ovary weight; 604.1\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;172.8 g, n\\u0026thinsp;=\\u0026thinsp;30) individuals that were caught in the Philippine Sea (off the Ryukyu Islands) during April to May, 2023 were all mature except one female. In this immature female, sperm were found in SRs. All specimens were confirmed to be \\u003cem\\u003eT. major\\u003c/em\\u003e as validated by sanger sequencing and species-specific PCR approaches using mitochondrial COI sequences (Fig. \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e, (Deville et al., \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e)). The SRs were located mostly at the ventral half of the buccal mass (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB, \\u003cem\\u003eright\\u003c/em\\u003e). Although there were individual variations in the exact location and number of SRs, ranging from 7 to 22 (mean 17.0\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.5, n\\u0026thinsp;=\\u0026thinsp;20), the number of SR was positively correlated with gonad weight (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC, GLM, estimate\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;s.e. = 0.0162\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.002, n\\u0026thinsp;=\\u0026thinsp;14, p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001).\\u003c/p\\u003e \\u003cp\\u003eMicrosatellite-based fragment length analysis using a highly polymorphic SSR (Tm11117, Table I) revealed that 93.8% (15/16) of females were polyandrous, with each SR containing three or more paternal alleles (mean 5.96\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.98, N\\u003csub\\u003eSR\\u003c/sub\\u003e = 346), suggesting a mixed sperm population from multiple males (Table \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e). The minimum number of males involved in copulation per female was estimated to be 3.06\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.12 (N\\u003csub\\u003efemale\\u003c/sub\\u003e = 16), if there are neither hemi- nor homozygous paternal alleles (Table \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e). Notably, the electropherograms revealed a close resemblance of peak patterns in microsatellite fragments between different SRs within the same female (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA-C). In contrast, in \\u003cem\\u003eT. pacificus\\u003c/em\\u003e, the number of allele peaks from each SR was greater and showed different allele patterns between the SRs (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA-C). Visualization of the peak patten similarities using principal component analysis (PCA) showed the closer proximity of data points in PC1 (with 54.1\\u0026thinsp;~\\u0026thinsp;58.6% contribution rates) in \\u003cem\\u003eT. major\\u003c/em\\u003e than in \\u003cem\\u003eT. pacificus\\u003c/em\\u003e (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA-C). To quantify the relative amount of each allele peak, we analyzed the relationship between allele size and peak height (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA), resulting in a linear regression equation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA inset, Linear regression, r\\u0026thinsp;=\\u0026thinsp;0.669, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001). Using this formula, the relative amount of each peak was normalized. In \\u003cem\\u003eT. major\\u003c/em\\u003e, when the share rate of each individual allele in the SR was displayed in descending order, we found that the sum of the two most abundant alleles reached 50% of the total alleles (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB). In contrast, in \\u003cem\\u003eT. pacificus\\u003c/em\\u003e, six alleles were needed to reach a 50% share (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eWe next focused on rare alleles that appeared in small numbers of SRs to examine if there was any particular storage pattern on the female buccal membrane (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA-D). We were able to detect rare alleles in 44% of females (7/16) and among them, each female contained a few rare alleles (1.3\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.5, n\\u0026thinsp;=\\u0026thinsp;7, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eE, Figs. S2-S7). Of note, these rare alleles were typically stored in SRs located near the apical end of the ventral buccal membrane (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eE, \\u003cem\\u003ered\\u003c/em\\u003e circles).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003ePair bonding is relatively common in birds and mammals, occasional in fish, and unusual in other taxa. In invertebrates, pair bonding is quite rare with only a few reported cases, such as eusocial termites (Hartke and Baer, \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e), the wood-feeding cockroach (Osaki and Kasuya, \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e), the deep-sea sponge-associated shrimp (Saito et al., \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e2001\\u003c/span\\u003e). To the best of our knowledge, the family Thysanoteuthidae is the only group of cephalopods that has been assumed to exhibit pair bonding (Nigmatullin et al., \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e1995\\u003c/span\\u003e; Nishimura, \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e1966\\u003c/span\\u003e; Roper and Jereb, \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e). This assumption is based on field observations by researchers, fishermen and citizens, who have witnessed that a pair of male and female often swims together. However, a more detailed analysis of pairing behavior in this species is necessary as the definition of pair bond varies among studies, researchers, and animal groups. In birds and mammals, pair bonding mostly refers to tight association between a mating pair. In accordance with this definition, and in order to distinguish it from simply nonsexual pair forming or same-sex pairing, we investigated the molecular validation of female fidelity in the mating behavior of \\u003cem\\u003eT. major\\u003c/em\\u003e. Although we were able to obtain three pairs of \\u003cem\\u003eT. major\\u003c/em\\u003e in the Sea of Japan using parallel-rigged double lures ((Arkhipkin and Rey-M\\u0026eacute;ndez, 2015) see p175), they were all immature individuals consisting of one male and one female. Although squids caught with this fishing method are likely to be paired individuals (two lures are aligned in parallel at a short distance), there is no strong evidence that they were actually paired in deep water due to lack of direct observations. At the very least, we found no inconsistency between these results and the previous statement that pair formation occurs before puberty.\\u003c/p\\u003e \\u003cp\\u003eWe were unable to identify paired individuals caught by the \\u003cem\\u003eSode-Ika\\u003c/em\\u003e (\\u003cem\\u003eT. major\\u003c/em\\u003e) fishery in the waters off Ryukyu archipelago due to their commercial fishing method (using tandem-rigged multiple lures). Nevertheless, we found genetic evidence of a mixed sperm population from multiple males within the female storage organs, suggesting that a polyandrous mating system is common in \\u003cem\\u003eT. major\\u003c/em\\u003e. Curiously, however, a composition of the mixed microsatellite alleles of extracted sperm DNAs from each SR was remarkably similar among SRs within a female, and two dominant alleles were shared by almost half of the total alleles (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB). These results are in sharp contrast to those of \\u003cem\\u003eT. pacificus\\u003c/em\\u003e where there is a large number of minor alleles that are almost evenly contributed in the SR and each SR displays a dissimilar allele composition (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). These findings are consistent with a previous report on \\u003cem\\u003eT. pacificus\\u003c/em\\u003e, suggesting that random patterns of sperm reservoir usage by multiple (9 to 23) males, result in the production of siblings with mixed paternity (Sato et al., \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). Therefore, it is likely that in \\u003cem\\u003eT. pacificus\\u003c/em\\u003e, there are neither paired males nor single consort males that can monopolize mating opportunities with single females.\\u003c/p\\u003e \\u003cp\\u003eFrom these results, we speculated a possible scenario of mating episodes in \\u003cem\\u003eT. major\\u003c/em\\u003e. 1) A paired-male transfers the spermatophores to his partner female multiple times (multiple copulations with a male). 2) Females occasionally engage in EPC with multiple males (a single copulation with multiple males). Due to the higher frequency of copulation by a paired-male compared to extra-pair males, the allele sharing rate by a paired-male in SRs is much larger. Additionally, a paired-male may have greater opportunities to remove the spermatangia transferred by extra-pair males from the female buccal membrane (Hall and Hanlon, \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e2002\\u003c/span\\u003e; Jean Geary, \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e1997\\u003c/span\\u003e; Wada et al., \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e). This can result in stored sperm becoming biased towards a paired-male. It is worth noting that we often find rare alleles in SRs located at the ventral end of the buccal membrane, which is a proximal site for egg laying (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e). Therefore, it is interesting to speculate that males pursuing extra-pair copulations may have fewer mating opportunities, resulting in choosing the most suitable insemination site for fertilization success.\\u003c/p\\u003e \\u003cp\\u003eIn order to determine the likelihood of these scenarios, the future research await to capture pair-bonded mated individuals in the wild. Although we are currently unable to test these hypotheses due to difficulty in obtaining them, it is worth speculating the reasons why \\u003cem\\u003eT. major\\u003c/em\\u003e has adopted pair bonding despite no such behavior has been documented in other squids. First, the family Thysanoteuthidae occurs in a wide range of tropical and subtropical oceans worldwide (Deville et al., \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). Such a horizontal dispersal with patchy distributions (ONITSUKA et al., 2010) of their habitats is considered as a typical characteristic of allopatric non-ecological speciation (Czekanski-Moir and Rundell, \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). Next, they are also inactive swimmers with mean movement speeds of 0.9\\u0026ndash;1.3 km h\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e (MIYAHARA et al., 2008) and recognized as one of fastest-growing squids with maximum of 4.6 mm d\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e (Nigmatullin et al., \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e1995\\u003c/span\\u003e) or 7\\u0026ndash;10 cm mo\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e (Bower and Miyahara, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e) in mantle length and 177g d\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e in body weight (Nigmatullin et al., \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e1995\\u003c/span\\u003e). Given these characteristics, \\u003cem\\u003eT. major\\u003c/em\\u003e is unlikely to form large schools, as is often seen in epipelagic and mesopelagic squids. Instead, grouping in small numbers of individuals is more feasible to acquire prey resources. In line with this, it has been reported that Thysanoteuthis normally occurs in small groups with two or little more (\\u0026thinsp;≦\\u0026thinsp;5) individuals swimming in the surface waters (Bower and Miyahara, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e). However, due to their scattered distribution and limited swimming capacity, squids, particularly male individuals, may suffer from a higher cost of mate search. Therefore, we hypothesize that pair-bonding in adults or pair-forming in young individuals may be associated with partner scarcity and the resulting high costs of female search in \\u003cem\\u003eT. major\\u003c/em\\u003e. Theoretical (Loo et al., \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e) and empirical (Schacht and Bell, \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e) studies suggest that partner scarcity can lead to mate guarding by males and, therefore, monogamy. If two or more paired individuals happen to encounter each other, EPC would occur coincidentally. In \\u003cem\\u003eT. rhombus\\u003c/em\\u003e (Thysanoteuthidae), the photophore is present only in immature stages and is lost by adulthood (Alejo-Plata\\u0026zwj; et al., \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e), suggesting a potential role in the pairing behavior between male and female at immature stages (Otjacques et al., \\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). Future research should focus on obtaining molecular evidence for the connection between pair bonding and partner's sperm predominance in SRs, as well as determining the paternity rate in egg masses to understand the behavioral ecology and mating system of this species. Furthermore, studies on invertebrate pair bonding may offer new insights into the evolution of protostome brains and endocrine systems that control socio-sexual cognitive abilities and performance.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\" \\u003cp\\u003e \\u003cstrong\\u003eConflict of interest\\u003c/strong\\u003e \\u003cp\\u003eThe authors have no competing interests regarding this research.\\u003c/p\\u003e \\u003c/p\\u003e\\u003cp\\u003e \\u003ch2\\u003eEthics\\u003c/h2\\u003e \\u003cp\\u003e\\u003cem\\u003eT. major\\u003c/em\\u003e individuals were obtained from fisheries as dead specimens, so it was not necessary to obtain approval for animal experiment. However, we conducted our experiments following the guidelines set by the animal care committees and Guidelines for the Care and Welfare of Cephalopods in Research (Fiorito et al., \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e), particularly regarding the minimum number of specimens required for our experiments. We also consulted with fisheries in Okinawa Prefecture, Japan beforehand regarding the handling and maintenance of fished specimens on the ship to consider ethical and welfare issues. The animals were quickly killed by disconnecting the nervous pathways to the lower parts of the nervous system followed by opening the mantle to remove the gut and head parts.\\u003c/p\\u003e \\u003c/p\\u003e\\u003ch2\\u003eAuthor contributions\\u003c/h2\\u003e \\u003cp\\u003eRRK: data curation, formal analysis, investigation, methodology and writing\\u0026mdash;original draft; AKN: data curation, formal analysis, investigation, methodology and writing\\u0026mdash;original draft; YK: resources, funding acquisition and writing\\u0026mdash;review and editing. NH: conceptualization, funding acquisition, data curation, formal analysis, methodology and writing\\u0026mdash;review and editing. All authors gave final approval for publication and agreed to be held accountable for the work performed herein.\\u003c/p\\u003e\\u003ch2\\u003eAcknowledgments and funding\\u003c/h2\\u003e \\u003cp\\u003eWe are grateful to Mr. Yasuo Taniwaki, a fisherman, Hyogo and Mr. Yoshinao Higa at the Itomon Fishery Cooperative, Okinawa for transporting frozen squids, Dr. Makoto Nagata at Osaka Medical and Pharmaceutical University for mathematics. We acknowledge Interdisciplinary Center for Science Research at Shimane University for use of the facility, and the funding supports from the Faculty of Life and Environmental Science at Shimane University and Kakenhi (22H05681, 25K02088 to N.H. and 21K19158, 25K09247 to Y.K). This research was conducted in part as SDGs Research Project at Shimane University.\\u003c/p\\u003e\\u003ch2\\u003eData availability\\u003c/h2\\u003e \\u003cp\\u003eThe datasets generated during and/or analyzed during the current study are available in Supplementary Material.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eAlam MNE, Hirohashi N (2023) Persistence of a highly monoandrous mating system despite an extremely male-biased operational sex ratio in the firefly squid Watasenia scintillans. Mar Biol 170:52. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s00227-023-04204-5\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00227-023-04204-5\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAlejo-Plata\\u0026zwj; MdC, Vallarta-Z\\u0026aacute;rate JRF, Mart\\u0026iacute;nez-Maga\\u0026ntilde;a\\u0026zwj; VH, Rojas-Gonz\\u0026aacute;lez RI (2023) First record of juveniles of the oceanic squid Thysanoteuthis rhombus (Cephalopoda: Thysanoteuthidae) in the Gulf of Tehuantepec. Northeastern Trop Pac Graellsia 79:e199. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3989/graellsia.2023.v79.377\\u003c/span\\u003e\\u003cspan address=\\\"10.3989/graellsia.2023.v79.377\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eArkhipkin AI, Rey-M\\u0026eacute;ndez M et al (2015) World Squid Fisheries. Reviews Fisheries Sci Aquaculture 23:92\\u0026ndash;252. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1080/23308249.2015.1026226\\u003c/span\\u003e\\u003cspan address=\\\"10.1080/23308249.2015.1026226\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBirkhead TR, Pizzari T (2002) Postcopulatory sexual selection. Nat Rev Genet 3:262\\u0026ndash;273. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/nrg774\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/nrg774\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBlacket MJ, Robin C, Good RT, Lee SF, Miller AD (2012) Universal primers for fluorescent labelling of PCR fragments\\u0026ndash;an efficient and cost-effective approach to genotyping by fluorescence. Mol Ecol Resour 12:456\\u0026ndash;463. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/j.1755-0998.2011.03104.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1755-0998.2011.03104.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBower JR, Miyahara K (2005) The diamond squid (Thysanoteuthis rhombus): A review of the fishery and recent research in Japan. Fish Res 73:1\\u0026ndash;11. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.fishres.2005.01.020\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.fishres.2005.01.020\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBrockmann HJ, Colson T, Potts W (1994) Sperm competition in horseshoe crabs (Limulus polyphemus). Behav Ecol Sociobiol 35:153\\u0026ndash;160. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/BF00167954\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/BF00167954\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCzekanski-Moir JE, Rundell RJ (2019) The Ecology of Nonecological Speciation and Nonadaptive Radiations. Trends Ecol Evol 34:400\\u0026ndash;415. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.tree.2019.01.012\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.tree.2019.01.012\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDeville D, Mori S, Kawai K, Esc\\u0026aacute;nez A, Macali A, Lishchenko F, Braid H, Githaiga-Mwicigi J, Mohamed KS, Bolstad KSR, Miyahara K, Sugimoto C, Fern\\u0026aacute;ndez-\\u0026Aacute;lvarez F\\u0026Aacute;, Sanchez G (2024) Cryptic biodiversity in the commercial diamondback squid Thysanoteuthis rhombus Troschel 1857. Rev Fish Biol Fish 34:293\\u0026ndash;313. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s11160-023-09813-3\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s11160-023-09813-3\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDolotovskaya S, Roos C, Heymann EW (2020) Genetic monogamy and mate choice in a pair-living primate. Sci Rep 10:20328. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41598-020-77132-9\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41598-020-77132-9\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFiorito G, Affuso A, Basil J, Cole A, de Girolamo P, D\\u0026rsquo;Angelo L, Dickel L, Gestal C, Grasso F, Kuba M, Mark F, Melillo D, Osorio D, Perkins K, Ponte G, Shashar N, Smith D, Smith J, Andrews PL (2015) Guidelines for the Care and Welfare of Cephalopods in Research \\u0026ndash;A consensus based on an initiative by CephRes, FELASA and the Boyd Group. Lab Anim 49:1\\u0026ndash;90. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1177/0023677215580006\\u003c/span\\u003e\\u003cspan address=\\\"10.1177/0023677215580006\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHall K, Hanlon R (2002) Principal features of the mating system of a large spawning aggregation of the giant Australian cuttlefish Sepia apama (Mollusca: Cephalopoda). Mar Biol 140:533\\u0026ndash;545. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s00227-001-0718-0\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00227-001-0718-0\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHartke TR, Baer B (2011) The mating biology of termites: a comparative review. Anim Behav 82:927\\u0026ndash;936. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.anbehav.2011.07.022\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.anbehav.2011.07.022\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHosken DJ, Stockley P, Tregenza T, Wedell N (2009) Monogamy and the Battle of the Sexes. Ann Rev Entomol 54:361\\u0026ndash;378. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1146/annurev.ento.54.110807.090608\\u003c/span\\u003e\\u003cspan address=\\\"10.1146/annurev.ento.54.110807.090608\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJean Geary B (1997) Female Choice of Males in Cuttlefish (Mollusca: Cephalopoda). Behaviour 134:975\\u0026ndash;988\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJones AG, Avise JC (1997) Microsatellite analysis of maternity and the mating system in the Gulf pipefish Syngnathus scovelli, a species with male pregnancy and sex-role reversal. Mol Ecol 6:203\\u0026ndash;213. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1046/j.1365-294X.1997.00173.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1046/j.1365-294X.1997.00173.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLoo SL, Rose D, Hawkes K, Kim PS (2021) Mate guarding in primates arises due to partner scarcity, even if the father provides no paternal care at all. Theor Popul Biol 142:100\\u0026ndash;113. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.tpb.2021.09.006\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.tpb.2021.09.006\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMIYAHARA K., OTA T., HATAYAMA J., MITSUNAGA Y., GOTO T., ONITSUKA G. (2008) Tagging studies on the diamond squid (Thysanoteuthis rhombus) in the western Sea of Japan. Bull Jpn Soc Fish Oceanogr 72:30\\u0026ndash;36\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMiyahara K, Ota T, Kohno N, Ueta Y, Bower JR (2005) Catch fluctuations of the diamond squid Thysanoteuthis rhombus in the Sea of Japan and models to forecast CPUE based on analysis of environmental factors. Fish Res 72:71\\u0026ndash;79. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.fishres.2004.10.013\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.fishres.2004.10.013\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNigmatullin CM, Arkhipkin AI, Sabirov RM (1995) Age, growth and reproductive biology of diamond-shaped squid Thysanoteuthis rhombus (Oegopsida: Thysanoteuthidae). Mar Ecol Prog Ser 124:73\\u0026ndash;87\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNishimura S (1966) Notes on the occurrence and biology of the oceanic squid, Thysanoteuthis rhombus Toschel, in Japan. Publication Seto Mar Biol Lab 14:327\\u0026ndash;349\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOhtani R, Yamamoto J, Yanagimoto T, Adachi K, Bower JR, Fujioka HA, Hirose M, Nakaya M, Suzuki S, Tokioka S (2022) Genetic evidence for multiple mating and mixing of sperm from multiple males in the seminal receptacles of female Japanese flying squid (Todarodes pacificus). J Molluscan Stud 88. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/mollus/eyac021\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/mollus/eyac021\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOkutani T (1990) Squids, cuttlefish and octopuses\\u0026lowast;. Mar Behav Physiol 18:1\\u0026ndash;17. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1080/10236249009378778\\u003c/span\\u003e\\u003cspan address=\\\"10.1080/10236249009378778\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eONITSUKA G., HIROSE N., MIYAHARA K., OTA T., HATAYAMA J., MITSUNAGA Y., GOTO T. (2010) Numerical simulation of the migration and distribution of diamond squid (Thysanoteuthis rhombus) in the southwest Sea of Japan. Fish Oceanogr 19:63\\u0026ndash;75. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/j.1365-2419.2009.00528.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1365-2419.2009.00528.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOsaki H, Kasuya E (2021) Mutual wing-eating between female and male within mating pairs in wood-feeding cockroach. Ethology 127:433\\u0026ndash;437. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/eth.13133\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/eth.13133\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOtjacques E, Pissarra V, Bolstad K, Xavier JC, McFall-Ngai M, Rosa R (2023) Bioluminescence in cephalopods: biodiversity, biogeography and research trends. Front Mar Sci 10\\u0026ndash;2023. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3389/fmars.2023.1161049\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fmars.2023.1161049\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRoper CFE, Jereb P (2010) Cephalopods of the world - an annotated and illustrated catalogue of cephalopod species known to date. Myopsid and oegopsid squids, vol 2. FAO Species Catalogue for Fishery Purposes FAO, Rome\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSaito T, Uchida I, Takeda M (2001) Pair formation in Spongicola japonica (Crustacea: Stenopodidea: Spongicolidae), a shrimp associated with deep-sea hexactinellid sponges. J Mar Biol Association United Kingd 81:789\\u0026ndash;797. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1017/S002531540100460X\\u003c/span\\u003e\\u003cspan address=\\\"10.1017/S002531540100460X\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSato N, Ono H, Hirohashi N, Iwata Y (2023) Multiplicity of sperm receptacles for securing the offspring genetic variability in a pelagic squid. Mar Biol 170:51. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s00227-023-04194-4\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00227-023-04194-4\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSato N, Tsuda S-I, Nur E, Alam M, Sasanami T, Iwata Y, Kusama S, Inamura O, Yoshida M-a, Hirohashi N (2020) Rare polyandry and common monogamy in the firefly squid, Watasenia scintillans. Sci Rep 10:10962. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41598-020-68006-1\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41598-020-68006-1\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSchacht R, Bell AV (2016) The evolution of monogamy in response to partner scarcity. Sci Rep 6:32472. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/srep32472\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/srep32472\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWada T, Takegaki T, Mori T, Natsukari Y (2010) Sperm removal, ejaculation and their behavioural interaction in male cuttlefish in response to female mating history. Anim Behav 79:613\\u0026ndash;619. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.anbehav.2009.12.004\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.anbehav.2009.12.004\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":true,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"marine-biology\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"mabi\",\"sideBox\":\"Learn more about [Marine Biology](https://www.springer.com/journal/227)\",\"snPcode\":\"227\",\"submissionUrl\":\"https://submission.nature.com/new-submission/227/3\",\"title\":\"Marine Biology\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-8815354/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-8815354/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eMonogamous animals often engage in long-term pair bonding. The oceanic diamond squid, \\u003cem\\u003eThysanoteuthis spp\\u003c/em\\u003e. are unique among cephalopods in that way they are often found in pairs consisting of one male and one female. In this study, we investigated the extent of mating fidelity in female \\u003cem\\u003eThysanoteuthis major\\u003c/em\\u003e in comparison to the highly polyandrous oceanic squid, \\u003cem\\u003eTodarodes pacificus.\\u003c/em\\u003e Fragment length analysis was carried out using newly developed microsatellite markers. We found that in \\u003cem\\u003eT. major\\u003c/em\\u003e, most females are polyandrous and each seminal receptacle (SR) contained a mixture of sperm genotypes with the mean of 6 different alleles. Additionally, all SRs within a female exhibited similar patterns of allele peaks with usually two major alleles, suggesting that there is a single male predominating sperm storage. In contrast, \\u003cem\\u003eT. pacificus\\u003c/em\\u003e exhibited numerous alleles within SR and displayed different allele patterns between SRs. In \\u003cem\\u003eT. major\\u003c/em\\u003e, rare alleles tended to appear in SRs locating at the most ventral side. These results suggest that \\u003cem\\u003eT. major\\u003c/em\\u003e females are generally polyandrous and store sperm from males using two different strategies: one involving pair bonding, and the other through extra-pair copulation. We discuss a possible correlation between long-term pair bonding and a single-male predominance for sperm storage in this species.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Quasi-monandry with a single-male predominating female sperm storage in pair-forming squid, Thysanoteuthis major\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-02-19 13:57:25\",\"doi\":\"10.21203/rs.3.rs-8815354/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revise and Resubmit\",\"date\":\"2026-03-19T16:12:01+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"\",\"date\":\"2026-02-14T01:11:33+00:00\",\"index\":0,\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2026-02-12T13:07:10+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2026-02-10T05:28:45+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Marine Biology\",\"date\":\"2026-02-07T19:25:36+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"marine-biology\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"mabi\",\"sideBox\":\"Learn more about [Marine Biology](https://www.springer.com/journal/227)\",\"snPcode\":\"227\",\"submissionUrl\":\"https://submission.nature.com/new-submission/227/3\",\"title\":\"Marine Biology\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"ea550796-f848-405a-9236-2420b3e1fd40\",\"owner\":[],\"postedDate\":\"February 19th, 2026\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"under-review\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2026-05-11T19:15:37+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-02-19 13:57:25\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-8815354\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-8815354\",\"identity\":\"rs-8815354\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}