{"paper_id":"042ea2ea-11a6-484b-9383-9dfe0eb9a38e","body_text":"Shenling Baizhu San Ameliorates Metabolic-Associated Fatty Liver Disease Complicated with Sarcopenia via Regulating AMPKα Signaling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Shenling Baizhu San Ameliorates Metabolic-Associated Fatty Liver Disease Complicated with Sarcopenia via Regulating AMPKα Signaling Yan Yang, Yinan Song, Jianhui Li, Yuan Tian, Fengyuan Li, Xu Zhang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9439368/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 12 You are reading this latest preprint version Abstract Background and purpose: Metabolic-associated fatty liver disease (MAFLD) complicated with sarcopenia (SP) is associated with increased mortality and represents a significant threat to human health. Shenling Baizhu San (SLBZS) has demonstrated therapeutic efficacy in both MAFLD and SP. However, the mechanisms underlying the effects of SLBZS in MAFLD complicated with SP remain unclear. In this study, we investigated the potential mechanisms of SLBZS in a rat model of MAFLD complicated with SP induced by a HFHS diet. Methods: A HFHS diet was used to establish a rat model of MAFLD complicated with SP, and SLBZS was administered as an intervention. General indicators, histopathological examination, and serum biochemical parameters were assessed to evaluate therapeutic effects. Transcriptomic analysis was subsequently performed to identify potential targets associated with treatment efficacy. Finally, the mRNA and protein expression levels of AMPKα and related genes in liver and gastrocnemius tissues were measured using RT-PCR and Western blot, respectively, to verify the central role of the AMPKα signaling pathway in SLBZS-mediated treatment. Results: SLBZS significantly reduced hepatic ectopic lipid deposition, increased skeletal muscle mass and function, and decreased myosteatosis, thereby ameliorating MAFLD complicated with SP. The therapeutic effects of SLBZS were associated with activation of AMPKα in both liver and gastrocnemius muscle. In the liver, SLBZS regulated the expression of AMPKα and its downstream targets, including CPT-1, SREBP-1C, FAS and ACC, resulting in reduced lipogenesis and enhanced lipolysis. In the gastrocnemius muscle, SLBZS modulated the expression of AMPKα, CPT-1, SREBP-1C, FAS, ACC, FOXO1, and MAFbx, thereby reducing protein degradation and myosteatosis. Conclusion: These results demonstrate that SLBZS effectively ameliorates HFHS diet-induced MAFLD complicated with SP by improving hepatic and skeletal muscle metabolism. SLBZS activates the AMPKα signaling pathway and regulates CPT-1, SREBP-1C, FAS, and ACC to reduce hepatic lipid accumulation. In skeletal muscle, SLBZS modulates CPT-1, SREBP-1C, FAS, ACC, FOXO1, and MAFbx via AMPKα signaling, thereby reducing myosteatosis and muscle proteolysis. Biological sciences/Cell biology Health sciences/Diseases Health sciences/Medical research Biological sciences/Physiology metabolic-associated fatty liver disease sarcopenia traditional Chinese medicine Shenling Baizhu San AMPK Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Metabolic-associated fatty liver disease (MAFLD) is a chronic liver disorder characterized by systemic metabolic dysregulation and abnormal lipid deposition in the liver. Its disease spectrum includes hepatic steatosis, metabolic-associated steatohepatitis (MASH), hepatic fibrosis, cirrhosis, and hepatocellular carcinoma (HCC) 1 . A systematic review and meta-analysis estimated the global prevalence of MAFLD to be 32.4%, indicating a substantial burden on public health 2 . As a metabolic syndrome, MAFLD is commonly accompanied by multiple metabolic disorders, including type 2 diabetes mellitus, obesity, and dyslipidemia 3 . Recent studies have demonstrated that MAFLD is associated with the occurrence of sarcopenia (SP) 4 . SP is generally recognized as an aging-related disease 5 . It is primarily characterized by a progressive and generalized loss of skeletal muscle mass and function, accompanied by myosteatosis and abnormal accumulation of intermuscular adipose tissue (IMAT) 6,7 . It has been reported that approximately 25% to 70% of patients with MAFLD also present with SP 8 . SP may increase the risk of MAFLD progression and its adverse hepatic outcomes, including fibrosis, cirrhosis, and HCC 9 . Furthermore, MAFLD patients with SP exhibit a higher all-cause mortality rate 10 . Therefore, MAFLD complicated with SP has a high prevalence and poses a significant threat to human health. However, the shared mechanisms underlying MAFLD complicated with SP remain unclear. Metabolic dysregulation, insulin resistance (IR), and chronic inflammatory responses are considered major contributing factors 11 . Unhealthy eating habits induced-IR is a central pathogenic mechanism in both MAFLD and SP, and the liver and skeletal muscle are major target organs of insulin. The liver is the primary organ responsible for endogenous lipid synthesis. Under conditions of IR, the expression of genes involved in lipid metabolism is altered, leading to excessive synthesis and accumulation of triglycerides (TG) in hepatocytes, thereby promoting MAFLD 12 . During MAFLD progression, systemic IR activates the ubiquitin-proteasome pathway in skeletal muscle and promotes protein degradation 13 . IR also inhibits fatty acid β-oxidation, resulting in ectopic lipid deposition in myocytes 14 . By disrupting protein and lipid metabolism in skeletal muscle, IR leads to reduced muscle mass and increased myosteatosis. These findings indicate that IR contributes to the development of MAFLD complicated with SP by impairing metabolic homeostasis in both the liver and skeletal muscle. The 5′-adenosine monophosphate-activated protein kinase (AMPK) is an important signal molecule that delays or blocks the aging process 15 . It also plays a critical role in the progression of MAFLD complicated with SP. AMPK is a ubiquitously expressed serine or threonine protein kinase that regulates metabolism by phosphorylating downstream targets, including sterol regulatory element-binding protein 1 (SREBP1), fatty acid synthase (FAS), acetyl-CoA carboxylase (ACC), and carnitine palmitoyltransferase 1 (CPT-1). When AMPK is inhibited, SREBP-1C, a key transcription factor regulating enzymes involved in fatty acid synthesis such as FAS and ACC, is activated and translocates into the nucleus. Meanwhile, inhibition of AMPK suppresses CPT-1 expression, thereby reducing β-oxidation, the rate-limiting step in fatty acid catabolism 16 . Under conditions of IR, AMPK activity is reduced, leading to dysregulation of downstream signaling pathways, including the AMPK-SREBP1 and AMPK-CPT-1 axes. This disruption further impairs hepatic lipid metabolism and promotes MAFLD progression 17 . In addition, inhibition of AMPK adversely affects the AMPK-forkhead box O (FOXO) signaling axis 18 . FOXO transcription factors play a crucial role in protein metabolism. Reduced AMPK activity leads to dephosphorylation and activation of FOXO, which subsequently upregulates the expression of muscle atrophy F-box protein (MAFbx), a key mediator of ubiquitin-dependent protein degradation, thereby promoting skeletal muscle protein catabolism 19 . Currently, therapeutic strategies for MAFLD complicated with SP primarily include dietary intervention, physical activity, and vitamin D supplementation 20 . Recent studies have demonstrated that several traditional Chinese medicine (TCM) formulations are effective in the treatment of MAFLD and SP. For example, Lingguizhugan decoction, Xiaoyao San, and Xuefu Zhuyu Decoction can effectively attenuate ectopic lipid deposition in the liver and ameliorate MAFLD 21-23 . Buzhong Yiqi Decoction promotes the proliferation and differentiation of skeletal muscle satellite cells (MuSCs) and enhances mitochondrial function, thereby improving SP 24,25 . Shenling Baizhu San (SLBZS), a classical TCM formula, was first documented in the Taiping Huimin Heji Ju Fang during the Song Dynasty of China. Studies suggest that SLBZS ameliorates IR, reduces hepatic lipid deposition, and alleviates MAFLD by regulating mitochondrial energy metabolism, activating hepatocyte autophagy, and modulating the gut microbiota and associated metabolites 26,27 . It has also been applied in the treatment of SP 28 . However, the mechanisms underlying its regulatory effects on substance metabolism in skeletal muscle remain to be further elucidated. In this study, a rat model of MAFLD complicated with SP was established using a diet-induced approach, followed by intervention with SLBZS. First, the therapeutic effects of SLBZS on this model were evaluated. Subsequently, transcriptomic analysis was performed to identify potential targets associated with its therapeutic effects, and the underlying molecular mechanisms were further validated experimentally. This study aims to investigate the potential mechanisms by which SLBZS treats MAFLD complicated with SP through regulation of the AMPK signaling pathway in the liver and skeletal muscle, thereby modulating lipid and protein metabolism. Materials and Methods Diet and Drugs The high-fat, high-sugar (HFHS) diet consisted of 25% sucrose, 15% lard, 5% egg yolk powder, 1% cholesterol, 0.5% beef tallow flavor, 0.5% beef flavor, and 53% basal diet. SLBZS is composed of 10 Chinese herbal components, including Ren Shen, Fu Ling, Bai Zhu, Shan Yao, Bai Bian Dou, Lian Zi, Yi Yi Ren, Sha Ren, Jie Geng, and Gan Cao (Supplementary Table 1). It was produced by Beijing Tongrentang Pharmaceutical Factory (production batch number: 25101025). Compound identification of SLBZS was performed by Shanghai Biotree Biomedical Technology Co., Ltd. (Supplementary Figure 1). SLBZS was dissolved in normal saline and freshly prepared daily. Animals and Experimental Design Thirty male specific pathogen-free (SPF) Sprague-Dawley (SD) rats (6 weeks old, weighing 320±20 g) were purchased from SPF (Beijing) Biotechnology Co., Ltd. [Certificate No: SCXK (Jing) 2019-0010]. All rats were housed at a temperature of 25℃ ± 1℃ and a relative humidity of 55% ± 10%, under a 12-hour light-dark cycle. Food and water were provided ad libitum throughout the experimental period. After one week of acclimatization, the rats were randomly divided into three groups as follows: control group (C group, n=12), HFHS diet-fed group (HFHS group, n=12), and SLBZS-treated group (SLBZS group, n=6). Rats in the C group were fed a basal diet, whereas those in the other groups received the HFHS diet. Drug intervention was initiated at week 19 and continued for 8 consecutive weeks. The C group and HFHS group received 0.9% sodium chloride (NaCl) at 100 mL/kg by gavage. The SLBZS group received intragastric administration at a dose of 1.08 g/kg based on body weight, with an average volume of 2 mL per rat. General Indicator Observations and Body Composition Analysis Body weight and upper limb grip strength of rats in each group were measured weekly throughout the experimental period. Each measurement was performed twice per rat, and the average value was recorded. At the end of weeks 18 and 26, body composition analysis, including body weight, fat mass, fat percentage, lean mass, and lean percentage, was performed using the rat measurement function of the Minispec LF90 small animal body composition analyzer. Sample Preparation At the end of week 18, six rats were randomly selected from the control group and the HFHS group for tissue sample collection. At the end of week 26, all remaining rats were sacrificed, and liver and gastrocnemius tissues were collected. The procedures for tissue collection were as follows. Rats were fasted for 12 hours before the procedure, with free access to water. The anesthetic dose was calculated individually for each rat, and pentobarbital was administered intraperitoneally at 45–50 mg/kg. After adequate anesthesia was achieved, RNaseZap was applied to the abdominal area, and blood was collected from the abdominal aorta. Blood samples were allowed to clot and were then centrifuged to obtain serum, which was stored at −80℃ for biochemical analysis. Liver and gastrocnemius tissues were excised and weighed. Portions of the tissues were used for histopathological analysis, while the remaining samples were stored at −80℃ for transcriptomic and molecular analyses. Serum Biochemical Parameter Detection Serum biochemical parameters were measured using corresponding assay kits (Nanjing Jiancheng Bioengineering). The measured indices included TG, total cholesterol (TC), low-density lipoprotein (LDL), high-density lipoprotein (HDL), alanine aminotransferase (ALT), aspartate aminotransferase (AST), gamma-glutamyl transferase (GGT), and glucose (GLU). Serum levels of malondialdehyde (MDA) and insulin (INS) were determined using enzyme-linked immunosorbent assay (ELISA) kits (Nanjing Jiancheng Bioengineering). All procedures were conducted in strict accordance with the manufacturer’s instructions. Pathological Observations Liver and gastrocnemius tissues were fixed in 4% paraformaldehyde and embedded in paraffin. The fixed tissues were trimmed into cubes measuring 5×5×2 mm. Tissue sections were stained according to the protocols of hematoxylin and eosin (H&E) and Oil Red O (ORO) staining kits. Images were acquired using a slide scanning imaging system (Shenzhen Shengqiang Technology Co., Ltd.), and the diameter and cross-sectional area of gastrocnemius muscle fibers were quantified using ImageJ software. Transcriptome Analysis Total RNA was isolated from frozen liver and gastrocnemius tissues using a total RNA extraction kit (Invitrogen), and its purity was assessed using an ultra-micro spectrophotometer (Thermo Fisher Scientific, USA). High-quality RNA samples were submitted to LC-Bio Technologies (Hangzhou) Co., Ltd. for library construction and transcriptome sequencing. Differentially expressed genes (DEGs) between the SLBZS group and the HFHS group were identified using standard bioinformatics analyses. Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis (https://www.genome.jp/kegg/) was performed to identify signaling pathways associated with the DEGs. In addition, gene set enrichment analysis (GSEA) (https://www.gsea-msigdb.org/gsea/index.jsp) was conducted to evaluate the activation or inhibition status of the AMPK signaling pathway in both groups. Real-Time Reverse Transcription Polymerase Chain Reaction (RT-qPCR) Analysis The procedures for total RNA isolation and purity assessment were consistent with those described above. Complementary DNA (cDNA) was synthesized from 500 ng of total RNA using ReverTra Ace™ qPCR RT Master Mix with gDNA Remover (TOYOBO Co., Ltd., Japan), then diluted and stored at −20℃. Gene expression levels were quantified by real-time PCR using SYBR® Green Realtime PCR Master Mix (TOYOBO Co., Ltd., Japan). Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (China), and their sequences are listed in Table 1. The RT-qPCR protocol was as follows: initial denaturation at 95℃ for 30 s, followed by 40 cycles of 95℃ for 5 s, 52℃ for 10 s, and 72℃ for 15 s. After amplification, the relative expression levels of target genes were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the internal control using the 2 −ΔΔCT method. Western Blotting (WB) Analysis Liver and gastrocnemius tissues were used for protein extraction. The tissues were thawed on ice, rinsed with pre-cooled phosphate-buffered saline (PBS), and thoroughly homogenized. After centrifugation, the supernatant was discarded, and radioimmunoprecipitation assay (RIPA) lysis buffer was added. The samples were further homogenized using a tissue grinder, followed by centrifugation at low temperature, and the supernatant was collected. Protein concentration was determined using the bicinchoninic acid (BCA) assay according to the manufacturer’s instructions. Proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred onto polyvinylidene difluoride (PVDF) membranes. After blocking with 5% non-fat milk for 2 h at room temperature, membranes were incubated overnight at 4℃ with primary antibodies against target proteins. Primary antibodies included AMPKα, CPT-1, SREBP-1C, FAS, ACC, and β-actin for liver tissues, and AMPKα, CPT-1, SREBP-1C, FAS, ACC, FOXO1, MAFbx, and β-actin for gastrocnemius tissues (Jiangsu Qinke Biological Research Center Co., Ltd., China). After washing, membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Jiangsu Qinke Biological Research Center Co., Ltd., China) for 1 h at room temperature. Protein bands were visualized using a gel imaging system (Thermo Fisher Scientific, USA) and analyzed with ImageJ software. β-actin was used as the internal reference to normalize relative protein expression levels. Statistical Analysis GraphPad Prism 10.0 software was used for data analysis. All data are presented as the mean ± standard deviation (SD). Differences among groups were analyzed using one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparison test. A P value < 0.05 was considered statistically significant. Results 1. HFHS Diet Promotes MAFLD Complicated with SP in Rats Based on shared pathogenic mechanisms, an HFHS diet was used to establish a rat model of MAFLD complicated with SP. From the beginning of modeling to week 12, body weight in the HFHS group gradually increased compared with that in the C group. Notably, body weight in the HFHS group reached a peak at week 12. From week 13 onward, body weight in the HFHS group began to decline, whereas it continued to increase in the C group (Figure 1A). However, at week 18, body weight in the HFHS group remained higher than that in the C group (Figure 1B). Liver examination revealed that rats in the HFHS group exhibited higher liver wet weight and liver index compared with the C group (Figures 1C and 1D). The livers of HFHS-fed rats appeared paler than those of the C group. H&E and ORO staining demonstrated that hepatocytes in the HFHS group exhibited disrupted morphology, with marked hepatic steatosis and abundant lipid droplets (Figure 1E), indicating typical features of MAFLD. Serum biochemical analysis further supported these findings. The HFHS group showed significantly increased levels of TG, TC, LDL, and MDA, along with significantly decreased HDL levels (Figures 1F–J), indicating pronounced metabolic disturbances. In addition, serum ALT, AST, and GGT levels were elevated in the HFHS group (Figures 1K–M), suggesting hepatic injury. Levels of GLU, INS, and homeostasis model assessment of insulin resistance (HOMA-IR) were also significantly increased (Figures 1N–P), indicating the presence of IR. These results confirm that the HFHS diet induced MAFLD-related phenotypes in rats. During model establishment, forelimb grip strength was measured in all groups. From the start of modeling to week 14, grip strength increased in all groups, with the HFHS group reaching a higher peak value than the C group at week 14. From week 15 onward, grip strength in the HFHS group declined, whereas it continued to increase in the C group. By week 18, grip strength in the HFHS group was significantly lower than that in the C group (Figure 2A). Histopathological examination of the gastrocnemius muscle revealed that, compared with the C group, HFHS-fed rats exhibited disorganized muscle fiber arrangement, increased intermuscular space, pronounced muscle fiber necrosis and lysis, inflammatory infiltration, and myosteatosis (Figure 2B). Both muscle fiber diameter and cross-sectional area were reduced in the HFHS group (Figures 2C and 2D). The wet weight of the gastrocnemius muscle was also decreased in the HFHS group. According to the criteria defined by Richard N. Baumgartner et al. 29 , the difference in the skeletal muscle index (SI) ratio between the HFHS group and the C group (1.673) exceeded twice the standard deviation of the C group (0.774) (Table 2), indicating successful establishment of the SP model. Furthermore, body weight gain and body composition were evaluated at week 18. Body weight gain was higher in the HFHS group than in the C group (Figure 2E). Fat mass and fat percentage were significantly increased, whereas lean mass and lean percentage were decreased in the HFHS group (Figures 2F–I), indicating that the increased body weight gain was primarily attributable to fat accumulation rather than muscle mass. In summary, the HFHS diet effectively induced the development of MAFLD complicated with SP in rats. 2. SLBZS Effectively Alleviates Manifestations of MAFLD Complicated with SP in Rats Following administration of SLBZS, body weight in the SLBZS group began to increase from week 19, whereas body weight in the HFHS group continued to decrease. Body weight in the C group increased steadily throughout the experimental period (Figure 3A). At week 26, rats in the HFHS group exhibited the lowest body weight, whereas those in the SLBZS group showed the highest (Figure 3B). Liver examination revealed that rats in the SLBZS group had lower liver wet weight and liver index compared with those in the HFHS group (Figures 3C and 3D). The livers of rats in the SLBZS group appeared markedly darker than those in the HFHS group and were similar to those in the C group. H&E and ORO staining demonstrated that hepatocytes in the SLBZS group exhibited relatively normal morphology and arrangement, with intact nuclei, occasional ballooning vacuoles, and markedly reduced intracellular lipid droplets (Figure 3E), indicating that SLBZS effectively alleviated hepatic lipid deposition. Serum biochemical parameters were also assessed. Compared with the HFHS group, the SLBZS group exhibited significantly reduced levels of TG, TC, LDL, and MDA, along with significantly increased HDL levels (Figures 3F–J), suggesting that SLBZS effectively improved HFHS-induced metabolic disturbances. In addition, serum ALT, AST, and GGT levels were significantly decreased in the SLBZS group compared with the HFHS group (Figures 3K–M), indicating improved hepatic function. Levels of GLU, INS, and HOMA-IR were also reduced in the SLBZS group (Figures 3N–P), demonstrating attenuation of IR. These findings confirm that SLBZS effectively improves MAFLD-related manifestations in rats. During the treatment period, forelimb grip strength was measured in all groups. With increasing experimental duration, grip strength in the HFHS group progressively declined. In contrast, grip strength in the SLBZS group increased significantly by week 20 and exceeded that of the C group by week 26 (Figure 4A), indicating that SLBZS effectively improved muscle function. Histopathological examination of the gastrocnemius muscle revealed that, compared with the HFHS group, rats in the SLBZS group exhibited more orderly muscle fiber arrangement, reduced intermuscular space, absence of evident muscle fiber necrosis or lysis, minimal inflammatory infiltration, and decreased lipid droplet accumulation in myocytes (Figure 4B). Both muscle fiber diameter and cross-sectional area were significantly increased in the SLBZS group compared with the HFHS group (Figures 4C and 4D). The wet weight of the gastrocnemius muscle was also significantly increased in the SLBZS group and exceeded that of the C group, whereas the HFHS group showed the lowest values. The SI ratio was further evaluated. The SI ratio was higher in the SLBZS group than in the HFHS group and exceeded that of the C group. Meanwhile, the difference in SI ratio between the HFHS group and the C group (0.785) was greater than twice the SD of the C group, whereas the difference between the SLBZS group and the C group (−0.186) was less than twice the SD of the C group (Table 3), indicating that SLBZS effectively improved muscle mass. Furthermore, body weight gain and body composition were analyzed at week 26. Body weight gain was significantly higher in the SLBZS group than in the HFHS group (Figure 4E). Compared with the HFHS group, fat mass and fat percentage were significantly reduced, whereas lean mass and lean percentage were increased in the SLBZS group (Figures 4F–I), indicating that SLBZS effectively regulates body composition by reducing fat accumulation and increasing muscle mass. These findings demonstrate that SLBZS effectively ameliorates SP-related manifestations in rats. Collectively, SLBZS markedly ameliorates HFHS diet-induced MAFLD complicated with SP. 3. The AMPK Pathway as a Potential Target of SLBZS in the Treatment of MAFLD Complicated with SP To identify the signaling pathways mediating the therapeutic effects of SLBZS in MAFLD complicated with SP, transcriptomic analysis was performed. First, mRNA expression profiles were compared between the SLBZS and HFHS groups. A total of 895 DEGs were identified in the liver, including 506 upregulated and 389 downregulated genes. In skeletal muscle, 834 DEGs were identified, including 610 upregulated and 224 downregulated genes (Figures 5A and 5B). Subsequently, KEGG enrichment analysis was conducted to identify pathways associated with these DEGs. In addition to the insulin signaling pathway, the AMPK signaling pathway emerged as the most prominent pathway shared by both liver and muscle tissues (Figures 5C and 5D). Furthermore, GSEA indicated that the AMPK signaling pathway was suppressed in both liver and muscle tissues in the HFHS group but activated in the SLBZS group. These findings suggest that the AMPK signaling pathway represents a central mechanism underlying the therapeutic effects of SLBZS in MAFLD complicated with SP. 4. The AMPKα Signaling Pathway as a Core Mechanism of SLBZS in MAFLD Complicated with SP Following transcriptomic analysis, the expression of AMPKα and its downstream targets was further examined. In both liver and skeletal muscle tissues, the expression of AMPKα at both mRNA and protein levels was reduced in the HFHS group. After SLBZS treatment, AMPKα expression was significantly upregulated in both tissues (Figures 6A–C and 6H–J). Subsequently, downstream genes associated with AMPKα were analyzed. In the liver, the mRNA and protein levels of CPT-1, a gene associated with lipolysis, were decreased in the HFHS group, whereas the expression of SREBP-1C, FAS, and ACC, which are involved in lipogenesis, were increased. Following SLBZS treatment, CPT-1 expression was significantly increased, whereas SREBP-1C, FAS, and ACC expression levels were decreased (Figures 6A–B and 6D–G). These results indicate that the HFHS diet promotes hepatic lipid accumulation by inhibiting lipolysis and enhancing lipogenesis. SLBZS alleviates MAFLD by regulating AMPKα and its downstream targets, thereby improving hepatic lipid metabolism and reducing ectopic lipid deposition in the liver. In skeletal muscle tissues, similar trends were observed. In the HFHS group, the protein and mRNA levels of CPT-1 were decreased, whereas the expression levels of SREBP-1C, FAS, and ACC were increased. In addition, the levels of FOXO1 and MAFbx, which are associated with skeletal muscle protein degradation, were elevated. Following SLBZS treatment, the protein and mRNA levels of CPT-1 were significantly increased, whereas those of SREBP-1C, FAS, ACC, FOXO1, and MAFbx were decreased in the SLBZS group (Figures 6H–I and 6K–P). These results indicate that the HFHS diet induces SP by promoting skeletal muscle protein degradation and increasing intramyocellular lipid deposition. SLBZS attenuates SP-related manifestations by regulating AMPKα and its downstream factors, thereby reducing intramyocellular lipid accumulation and inhibiting protein degradation in skeletal muscle. Collectively, these findings suggest that SLBZS improves metabolic homeostasis in both liver and skeletal muscle tissues by regulating the AMPK signaling pathway, thereby ameliorating MAFLD complicated with SP. Discussion MAFLD is a highly prevalent disease associated with metabolic disorders, whereas sarcopenia (SP) is closely associated with aging. The mechanism underlying this comorbidity is closely related to metabolic disorders, IR, and low-grade chronic inflammation induced by unhealthy lifestyles 1 . Although MAFLD and SP are distinct conditions affecting different organs, substantial crosstalk and interaction occur during their progression 30 . Patients with MAFLD complicated with SP not only exhibit a higher risk of fibrosis but also show significantly increased mortality. Improvement of skeletal muscle mass and function may help mitigate disease progression 31 . At present, the primary interventions for MAFLD complicated with SP consist of dietary management and physical exercise, whereas pharmacological therapies remain limited 32 . Long-term clinical studies have demonstrated that SLBZS exerts therapeutic effects against MAFLD. Previous studies have also shown that SLBZS combined with exercise alleviates sarcopenic phenotypes, although the underlying mechanisms remain unclear. Earlier research has indicated that SLBZS reduces ectopic hepatic lipid deposition by regulating the gut microbiota and hepatic mitochondrial energy metabolism 33 . In the present study, we demonstrated that SLBZS exerts both anti-MAFLD and anti-SP effects. Considering that IR is a central pathogenic mechanism and that unhealthy dietary habits are key contributors to MAFLD complicated with SP, a rat model was established by feeding an HFHS diet for 18 weeks. As expected, the model rats exhibited characteristic features of MAFLD complicated with SP, including pronounced IR, altered serum biochemical and liver function parameters, increased hepatic lipid accumulation and liver index, reduced muscle mass and function, and evident myosteatosis. Body composition analysis using time-domain nuclear magnetic resonance (TD-NMR) further showed that, although the HFHS diet increased body weight, the proportion of muscle mass was markedly reduced and fat mass significantly increased in model rats compared with controls, indicating that weight gain was primarily attributable to fat accumulation. From week 19 onward, model rats received SLBZS treatment. After 8 weeks of intervention, body weight in the treated group was significantly reduced. In addition, HOMA-IR, serum biochemical parameters, liver function indices, hepatic lipid deposition, and liver index were all markedly improved, indicating effective amelioration of MAFLD. Meanwhile, forelimb grip strength increased significantly, fat proportion decreased, muscle proportion increased, muscle fiber diameter and cross-sectional area were enlarged, and intramyocellular lipid deposition was reduced, indicating that SP was effectively alleviated. These findings demonstrate that SLBZS exerts beneficial effects in rats with MAFLD complicated with SP. Because the mechanisms underlying MAFLD complicated with SP are complex, the pathophysiology of this comorbidity remains to be fully elucidated. In addition, TCM formulas are composed of multiple components and may act on diverse signaling pathways across different tissues and organs. To investigate both the disease mechanism and the molecular basis of SLBZS action, transcriptomic analyses were performed on liver and skeletal muscle tissues. KEGG and GSEA enrichment analyses indicated that the AMPK signaling pathway may play a central role in the therapeutic effects of SLBZS. Further analysis demonstrated that the AMPK signaling pathway was downregulated in both liver and skeletal muscle tissues in HFHS-fed rats. In the liver, decreased CPT-1 expression and increased expression of SREBP-1C, FAS, and ACC promoted de novo lipogenesis and lipid accumulation, leading to elevated circulating levels of TG, LDL, and other lipids. Excess lipid accumulation in hepatocytes enhanced oxidative stress and increased liver function indices such as ALT and AST, resulting in significant hepatic injury. Moreover, the HFHS diet induced pronounced IR in model rats. In skeletal muscle, downregulation of AMPK increased the expression of FOXO1 and MAFbx, thereby promoting protein degradation and reducing muscle mass. Concurrently, marked myosteatosis was observed during HFHS feeding, which may be associated with decreased CPT-1 expression and increased expression of SREBP-1C, FAS, and ACC in skeletal muscle cells. Notably, both myosteatosis and IMAT infiltration were observed during disease progression. IMAT is primarily derived from fibro-adipogenic progenitors (FAPs), a population of mesenchymal stromal cells located within the basal lamina surrounding the sarcolemma, where MuSCs reside 34 . Disrupted lipid metabolism in skeletal muscle may provide substrates for both myosteatosis and IMAT accumulation. Further studies are required to determine how the HFHS diet regulates the differentiation of FAPs. In summary, inhibition of AMPK is closely associated with the progression of MAFLD complicated with SP and represents a potential therapeutic target for this comorbidity. Studies have suggested that TCM monomers or formulas can ameliorate MAFLD via the AMPK signaling pathway. For example, Si-Ni-San improves hepatic lipid accumulation in MAFLD mice by activating the AMPK/p300/SREBP-1C axis and inhibiting hepatic fatty acid synthase (FASN) expression 35 . Rhizoma Atractylodis and 6-gingerol alleviate high-fat diet (HFD)-induced MAFLD by activating AMPK, downregulating SREBP1 expression, and suppressing fatty acid synthesis 36,37 . In the present study, the expression of AMPKα at both transcriptional and translational levels was significantly upregulated in the liver. With increased AMPK activity, the expression of downstream genes, including SREBP-1C, FAS, and ACC, was reduced, thereby inhibiting hepatic de novo lipogenesis. Meanwhile, the expression of CPT-1 was increased, which enhanced fatty acid β-oxidation and accelerated lipolysis in the liver. These effects reduced hepatic lipid accumulation and lipid peroxidation-induced hepatocyte injury, thereby restoring liver function. As the liver is the primary organ responsible for lipid synthesis, SLBZS demonstrated the capacity to regulate hepatic lipid metabolism and further reduce circulating levels of TG and LDL through AMPK signaling. In addition, insulin sensitivity was improved in model rats following SLBZS treatment. In summary, SLBZS regulates the expression of CPT-1, SREBP-1C, FAS, and ACC via the AMPK signaling pathway, thereby improving hepatic manifestations in MAFLD complicated with SP. AMPK also represents an important target of TCM in the treatment of MAFLD complicated with SP. For example, Gui Qi Zhuang Jin Decoction improves mitochondrial function and promotes mitochondrial energy metabolism in the gastrocnemius muscle of SP mice by activating the AMPK/peroxisome proliferator-activated receptor gamma coactivator-1 alpha (PGC-1α)/nuclear factor erythroid 2-related factor 2 (Nrf2) axis, thereby alleviating SP 38 . Jianpi Qiangji Granule improves skeletal muscle function by activating AMPK and regulating downstream PGC-1α expression 39 . Umbelliferone inhibits the expression of muscle ring-finger protein-1 (MuRF-1), forkhead box O3a (FoxO3a), and Atrogin-1 via AMPK, thereby suppressing protein ubiquitination and degradation in skeletal muscle and attenuating diabetic sarcopenia 40 . In the present study, SLBZS significantly upregulated AMPKα expression in the gastrocnemius muscle. Activation of AMPKα reduced the expression of FOXO1 and MAFbx, thereby decreasing protein degradation and attenuating muscle loss in MAFLD complicated with SP rats. Furthermore, AMPK activation also regulated lipid metabolism in skeletal muscle cells. Although skeletal muscle is not the primary organ for lipid metabolism, it expresses enzymes involved in both lipogenesis and lipolysis, enabling lipid utilization. Following SLBZS treatment, CPT-1 expression in the gastrocnemius was increased, promoting fatty acid oxidation, whereas the expression of SREBP-1C, FAS, and ACC was decreased, reducing lipid synthesis. By modulating the expression of lipid metabolism-related enzymes in skeletal muscle, SLBZS effectively alleviated myosteatosis in model rats. In addition, reduced IMAT infiltration was observed following SLBZS treatment. However, the molecular mechanisms by which SLBZS regulates fibro-adipogenic progenitor (FAP) differentiation and IMAT infiltration require further investigation. In summary, SLBZS regulates the expression of CPT-1, SREBP-1C, FAS, ACC, FOXO1, and MAFbx in skeletal muscle via the AMPK signaling pathway, thereby improving muscle-related manifestations in MAFLD complicated with SP. Based on the TCM theory that the spleen governs transportation and transformation and is associated with muscle function, a rat model of MAFLD complicated with SP was established using an HFHS diet to simulate the pathogenic condition of excessive dietary intake impairing spleen function. Following treatment with the classical spleen-strengthening formula SLBZS and evaluation of multiple physiological and biochemical parameters, we confirmed that SLBZS alleviates MAFLD complicated with SP. Transcriptomic analysis further indicated that the AMPK signaling pathway is involved in both the pathogenesis of MAFLD complicated with SP and the therapeutic mechanism of SLBZS, which was subsequently validated experimentally. In TCM theory, spleen deficiency is closely associated with metabolic disorders, immune dysfunction, gut microbiota imbalance, and intestinal dysfunction. The present study focused on the relationship between spleen deficiency and AMPK-mediated metabolic dysregulation in the liver and skeletal muscle, without examining other associated alterations. This is because TCM formulas typically exert multi-target effects, including modulation of low-grade chronic inflammation, macrophage polarization, and activation of pro-inflammatory signaling pathways. It was not feasible to comprehensively evaluate all contributing factors in this study. Therefore, the present work primarily aimed to elucidate the molecular mechanisms by which SLBZS ameliorates MAFLD complicated with SP from the perspective of metabolic regulation. Accordingly, we systematically analyzed the regulation of lipid and protein metabolism by SLBZS via the AMPK signaling pathway in different tissues and preliminarily clarified its molecular mechanism in liver and skeletal muscle. In addition, IMAT infiltration was observed in the model rats and was reduced following SLBZS treatment. However, the underlying molecular mechanisms were not further investigated in this study. This limitation was due to the fact that all rats had been sacrificed and tissues had been exposed during pathological procedures, which precluded the isolation of primary cells. Moreover, adipogenic differentiation of FAPs is a dynamic process that requires evaluation at multiple time points. These mechanisms will be explored in future studies. Conclusion The present study demonstrates that the classical TCM spleen-strengthening formula SLBZS effectively treats HFHS diet-induced MAFLD complicated with SP by improving metabolic function in both the liver and skeletal muscle. In the liver, SLBZS regulates the expression of lipid metabolism-related genes, including CPT-1, SREBP-1C, FAS, and ACC, via the AMPK signaling pathway, thereby modulating hepatic lipid metabolism and reducing lipid deposition in hepatocytes. In skeletal muscle, SLBZS regulates the expression of CPT-1, SREBP-1C, FAS, ACC, FOXO1, and MAFbx through AMPK signaling, thereby modulating lipid metabolism and protein catabolism, reducing myosteatosis, and inhibiting skeletal muscle proteolysis. Declarations Ethics statement The animal studies were approved by Yunnan College of Traditional Chinese Medicine Animal Experiment Ethics Review Committee. Author contributions YY, WW and YL designed this study, wrote the manuscript and provided funding support. YS designed the experiments and wrote the manuscript. JL performed data analysis and participated in partial manuscript writing. YT, FL and XZ conducted the experiments and data analysis. LH and KZ participated in partial experiments and data analysis. All authors have contributed to this article and approved the submitted version. Funding This study was supported by grants from the National Natural Science Foundation of China (82360886, 82560881), the Yunnan Provincial Science and Technology Department-Applied Basic Research Joint Special Funds of Chinese Medicine (202101AZ070001-219, 202301AZ070001-035), the Special Fund for Educational Research of Provincial Directly Affiliated Institutions of Fujian Province in 2023 (X2023007, X2023008). Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Data availability All data generated or analysed during this study are included in this published article and its supplementary information files. Unprocessed raw data are available from the corresponding author upon reasonable request. References Liu, C. H. et al. Sarcopenia and MASLD: novel insights and the future. Nat Rev Endocrinol 22 , 139–152 (2026). https://doi.org/10.1038/s41574-025-01197-7 Riazi, K. et al. The prevalence and incidence of NAFLD worldwide: a systematic review and meta-analysis. Lancet Gastroenterol Hepatol 7 , 851–861 (2022). https://doi.org/10.1016/s2468-1253(22)00165-0 Park, Y., Ko, K. S. & Rhee, B. D. Non-Alcoholic Fatty Liver Disease (NAFLD) Management in the Community. Int J Mol Sci 26 (2025). https://doi.org/10.3390/ijms26062758 Kim, J. A. & Choi, K. M. Sarcopenia and fatty liver disease. Hepatol Int 13 , 674–687 (2019). https://doi.org/10.1007/s12072-019-09996-7 Sayer, A. A. et al. Sarcopenia. Nat Rev Dis Primers 10 , 68 (2024). https://doi.org/10.1038/s41572-024-00550-w Habboub, B., Speer, R., Gosch, M. & Singler, K. The Diagnosis and Treatment of Sarcopenia and Sarcopenic Obesity. Dtsch Arztebl Int 122 , 121–126 (2025). https://doi.org/10.3238/arztebl.m2025.0004 Zamboni, M., Gattazzo, S. & Rossi, A. P. Myosteatosis: a relevant, yet poorly explored element of sarcopenia. Eur Geriatr Med 10 , 5–6 (2019). https://doi.org/10.1007/s41999-018-0134-3 Isakov, V. Metabolic dysfunction-associated steatotic liver disease: A story of muscle and mass. World J Gastroenterol 31 , 105346 (2025). https://doi.org/10.3748/wjg.v31.i20.105346 Dajti, E. et al. Sarcopenia evaluated by EASL/AASLD computed tomography-based criteria predicts mortality in patients with cirrhosis: A systematic review and meta-analysis. JHEP Rep 6 , 101113 (2024). https://doi.org/10.1016/j.jhepr.2024.101113 Golabi, P. et al. Contribution of sarcopenia and physical inactivity to mortality in people with non-alcoholic fatty liver disease. JHEP Rep 2 , 100171 (2020). https://doi.org/10.1016/j.jhepr.2020.100171 Zhai, Y. & Xiao, Q. The Common Mechanisms of Sarcopenia and NAFLD. Biomed Res Int 2017 , 6297651 (2017). https://doi.org/10.1155/2017/6297651 Hu, Y. et al. The Mutual Inhibition of FoxO1 and SREBP-1c Regulated the Progression of Hepatoblastoma by Regulating Fatty Acid Metabolism. Mediators Inflamm 2021 , 5754592 (2021). https://doi.org/10.1155/2021/5754592 Liu, Y. et al. Aspartate inhibits LPS-induced MAFbx and MuRF1 expression in skeletal muscle in weaned pigs by regulating Akt, AMPKα and FOXO1. Innate Immun 23 , 34–43 (2017). https://doi.org/10.1177/1753425916673443 Wu, C. et al. Fucoxanthin Mitigates High-Fat-Induced Lipid Deposition and Insulin Resistance in Skeletal Muscle through Inhibiting PKM1 Activity. J Agric Food Chem 72 , 18013–18026 (2024). https://doi.org/10.1021/acs.jafc.4c03677 Ge, Y., Zhou, M., Chen, C., Wu, X. & Wang, X. Role of AMPK mediated pathways in autophagy and aging. Biochimie 195 , 100–113 (2022). https://doi.org/10.1016/j.biochi.2021.11.008 Liang, Q., Ai, L., He, L., Wang, L. C. & Wang, J. L. Targeting the AMP-activated protein kinase pathway: the active metabolites of botanical drugs represent potential strategies for treating metabolic-associated fatty liver disease. Front Pharmacol 16 , 1681880 (2025). https://doi.org/10.3389/fphar.2025.1681880 Wang, H. et al. Natural active botanical metabolites: targeting AMPK signaling pathway to treat metabolic dysfunction-associated fatty liver disease. Front Pharmacol 16 , 1611400 (2025). https://doi.org/10.3389/fphar.2025.1611400 Liu, D. et al. Frontiers in sarcopenia: Advancements in diagnostics, molecular mechanisms, and therapeutic strategies. Mol Aspects Med 97 , 101270 (2024). https://doi.org/10.1016/j.mam.2024.101270 Nakashima, K. & Yakabe, Y. AMPK activation stimulates myofibrillar protein degradation and expression of atrophy-related ubiquitin ligases by increasing FOXO transcription factors in C2C12 myotubes. Biosci Biotechnol Biochem 71 , 1650–1656 (2007). https://doi.org/10.1271/bbb.70057 Polyzos, S. A., Vachliotis, I. D. & Mantzoros, C. S. Sarcopenia, sarcopenic obesity and nonalcoholic fatty liver disease. Metabolism 147 , 155676 (2023). https://doi.org/10.1016/j.metabol.2023.155676 Ning, Y. et al. Lingguizhugan Decoction Targets Intestinal Microbiota and Metabolites to Reduce Insulin Resistance in High-Fat Diet Rats. Diabetes Metab Syndr Obes 15 , 2427–2442 (2022). https://doi.org/10.2147/dmso.S370492 Liu, Y. et al. Xiaoyao San's dual efficacy in NAFLD and depression: Unraveling the mechanisms via network pharmacology and multi-omics. Phytomedicine 147 , 157221 (2025). https://doi.org/10.1016/j.phymed.2025.157221 Tang, H. et al. Hepatic transcriptome discloses the potential targets of Xuefu Zhuyu Decoction ameliorating non-alcoholic fatty liver disease induced by high-fat diet. J Tradit Complement Med 14 , 135–147 (2024). https://doi.org/10.1016/j.jtcme.2023.07.008 Gao, T. et al. Buzhong Yiqi Decoction accelerates skeletal muscle regeneration. Acta Biochim Biophys Sin (Shanghai) 57 , 847–850 (2024). https://doi.org/10.3724/abbs.2024223 Zeng, Y., Zeng, H., Liu, X. & Fan, T. Buzhong Yiqi decoction attenuates acquired myasthenia by regulating the JAK2/STAT3/AKT signaling pathway, inhibiting inflammation, and improving mitochondrial function. Allergol Immunopathol (Madr) 52 , 59–64 (2024). https://doi.org/10.15586/aei.v52i5.1147 Pan, M. et al. Shenling Baizhu powder alleviates non-alcoholic fatty liver disease by modulating autophagy and energy metabolism in high-fat diet-induced rats. Phytomedicine 130 , 155712 (2024). https://doi.org/10.1016/j.phymed.2024.155712 Chen, D. et al. Shenling Baizhu San ameliorates non-alcoholic fatty liver disease in mice by modulating gut microbiota and metabolites. Front Pharmacol 15 , 1343755 (2024). https://doi.org/10.3389/fphar.2024.1343755 Yao, J. & Xia, S. Exploring the role of traditional Chinese medicine in sarcopenia: mechanisms and therapeutic advances. Front Pharmacol 16 , 1541373 (2025). https://doi.org/10.3389/fphar.2025.1541373 Baumgartner, R. N. et al. Epidemiology of sarcopenia among the elderly in New Mexico. Am J Epidemiol 147 , 755–763 (1998). https://doi.org/10.1093/oxfordjournals.aje.a009520 Losasso, M. R. et al. Unraveling the Metabolic Pathways Between Metabolic-Associated Fatty Liver Disease (MAFLD) and Sarcopenia. Int J Mol Sci 26 (2025). https://doi.org/10.3390/ijms26104673 Zhao, Q., Yin, Y. & Deng, Y. Metabolic associated fatty liver disease and sarcopenia additively increase mortality: a real-world study. Nutr Diabetes 13 , 21 (2023). https://doi.org/10.1038/s41387-023-00250-6 Bali, T., Chrysavgis, L. & Cholongitas, E. Metabolic-Associated Fatty Liver Disease and Sarcopenia. Endocrinol Metab Clin North Am 52 , 497–508 (2023). https://doi.org/10.1016/j.ecl.2023.02.004 Yao, Z. et al. Effects of Shenling Baizhu powder on intestinal microflora metabolites and liver mitochondrial energy metabolism in nonalcoholic fatty liver mice. Front Microbiol 14 , 1147067 (2023). https://doi.org/10.3389/fmicb.2023.1147067 Molina, T., Fabre, P. & Dumont, N. A. Fibro-adipogenic progenitors in skeletal muscle homeostasis, regeneration and diseases. Open Biol 11 , 210110 (2021). https://doi.org/10.1098/rsob.210110 Lan, T. et al. Si-Ni-San inhibits hepatic Fasn expression and lipid accumulation in MAFLD mice through AMPK/p300/SREBP-1c axis. Phytomedicine 123 , 155209 (2024). https://doi.org/10.1016/j.phymed.2023.155209 Zheng, K. et al. Rhizoma Atractylodis Macrocephalae reduces HFD-induced MAFLD in mice through activated AMPK-mediated inhibition of fatty acid synthesis. Liver Res 9 , 157–168 (2025). https://doi.org/10.1016/j.livres.2025.04.004 Xia, Q. et al. 6-Gingerol regulates triglyceride and cholesterol biosynthesis to improve hepatic steatosis in MAFLD by activating the AMPK-SREBPs signaling pathway. Biomed Pharmacother 170 , 116060 (2024). https://doi.org/10.1016/j.biopha.2023.116060 Wang, D. et al. Gui Qi Zhuang Jin Decoction ameliorates mitochondrial dysfunction in sarcopenia mice via AMPK/PGC-1α/Nrf2 axis revealed by a metabolomics approach. Phytomedicine 133 , 155908 (2024). https://doi.org/10.1016/j.phymed.2024.155908 Pan, Z. et al. Jianpi Qiangji Granule ameliorates aging-associated sarcopenia via AMPK/PGC-1α axis in SAMP8 mice. Phytomedicine 148 , 157473 (2025). https://doi.org/10.1016/j.phymed.2025.157473 Kim, D. Y., Kang, Y. H. & Kang, M. K. Umbelliferone attenuates diabetic sarcopenia by modulating mitochondrial quality and the ubiquitin-proteasome system. Phytomedicine 144 , 156930 (2025). https://doi.org/10.1016/j.phymed.2025.156930 Tables Table 1. Primer sequences in the present study. Gene Primer sequences (5’-3’) AMPKα Forward: CCTTCGGCAAAGTGAAGATTGG Reverse: TCTTCAACCCTCCCGTGTTT CPT-1 Forward: TCCGGTTCAAGAATGGCATCA Reverse: CATTCGGCCAGTGGTGTCTA SREBP-1C Forward: GAACCCTTCCTGGGAACACC Reverse: AGTGTGGCTGCAGTACAACG FAS Forward: TGTCAGCCTGGTGAACGAAA Reverse: CCACACGAGGTGCAGTGATA ACC Forward: ACATGAGGTCCAGCATGTCC Reverse: CCGCCATCTTAATGTATTCTGCAT FOXO1 Forward: GGCGGGCTGGAAGAATTCAA Reverse: CGTCCTCGGCTCTTAGCAAAT MAFbx Forward: GTGAGCGACCTCAGCAGTTA Reverse: CATGGCGCTCCTTAGTACTCC GAPDH Forward: ACCCATCACCATCTTCCAGG Reverse: GACTGTGGTCATGAGCCCTT Table 2. Comparison of body weight, gastrocnemius wet weight, and SI in rats at the 18 th weekend( ` x ± s , n =6 ） Groups Body weight (g) Gastrocnemius wet weight (mg) SI C 511.7 ± 15.3 3470.0 ± 285.4 6.649 ± 0.387 HFHS 616.3 ± 29.2 *** 3095.0 ± 312.3 5.012 ± 0.311 *** Table 3. Comparison of body weight, gastrocnemius wet weight, and SI in rats at the 26 th weekend ( ` x ± s , n =6 ） Groups Body weight (g) Gastrocnemius wet weight (mg) SI C 530.8 ± 11.1 3432.9 ± 132.6 6.467 ± 0.218 HFHS 505.8 ± 21.3 2872.9 ± 130.7 *** 5.682 ± 0.194 *** SLBZS 633.8 ± 27.9 ### 4218.7 ± 267.3 ### 6.653 ± 0.234 ### Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterial.docx Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 06 May, 2026 Reviews received at journal 03 May, 2026 Reviews received at journal 28 Apr, 2026 Reviewers agreed at journal 27 Apr, 2026 Reviews received at journal 27 Apr, 2026 Reviewers agreed at journal 27 Apr, 2026 Reviewers agreed at journal 27 Apr, 2026 Reviewers agreed at journal 27 Apr, 2026 Reviewers invited by journal 27 Apr, 2026 Editor assigned by journal 24 Apr, 2026 Submission checks completed at journal 20 Apr, 2026 First submitted to journal 16 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-9439368\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":633676189,\"identity\":\"16e9eba0-d7ff-45d1-a2aa-a24b32acbcef\",\"order_by\":0,\"name\":\"Yan Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yunnan University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yan\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":633676190,\"identity\":\"cfbe6980-64cd-4154-b956-f5baeb0d8b33\",\"order_by\":1,\"name\":\"Yinan Song\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yunnan University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yinan\",\"middleName\":\"\",\"lastName\":\"Song\",\"suffix\":\"\"},{\"id\":633676191,\"identity\":\"d3365da7-11e8-462e-b66e-3d8576c199d3\",\"order_by\":2,\"name\":\"Jianhui Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yunnan University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jianhui\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":633676192,\"identity\":\"ab98d80e-961b-4fd2-891c-079675f7b408\",\"order_by\":3,\"name\":\"Yuan Tian\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yunnan University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yuan\",\"middleName\":\"\",\"lastName\":\"Tian\",\"suffix\":\"\"},{\"id\":633676193,\"identity\":\"42717e99-7f7f-4410-8d56-c98eb74b912a\",\"order_by\":4,\"name\":\"Fengyuan Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yunnan University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Fengyuan\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":633676194,\"identity\":\"c79fbaa3-c115-4b3f-adc7-2f5c0480aa47\",\"order_by\":5,\"name\":\"Xu Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yunnan University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xu\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":633676195,\"identity\":\"1b18cf22-2f93-48e9-8b15-d91b430b563c\",\"order_by\":6,\"name\":\"Li Hong\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Wuhan Special Service Recuperation Center\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Li\",\"middleName\":\"\",\"lastName\":\"Hong\",\"suffix\":\"\"},{\"id\":633676196,\"identity\":\"98b3d9c3-0ff3-497b-b8dc-603f905d6daa\",\"order_by\":7,\"name\":\"Kun Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yunnan University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Kun\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":633676197,\"identity\":\"15c8c141-37cb-4863-b257-8a5e4d75eceb\",\"order_by\":8,\"name\":\"Ya Lin\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Fujian University of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ya\",\"middleName\":\"\",\"lastName\":\"Lin\",\"suffix\":\"\"},{\"id\":633676198,\"identity\":\"b0520bbe-3462-4c22-8adb-a97cb65c7bc3\",\"order_by\":9,\"name\":\"Wei Wang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAp0lEQVRIiWNgGAWjYBACNigtx8befoA0LcZ8PGcSSLMtcZ6EgwFxSvkkkp89YGw7nN4mwZDA8KNiGxEOk0gzNwBqyW2TbjzA2HPmNhFaeA6YSTBuu53bJnMggZmxjSgtx7+BtKSzSSQYEKmFvQdsSwJJWsokGP/9N2wDBvJBovwi38y+TYLhTJq8fHv7wQc/KojQAgLMf6CMA8SpHwWjYBSMglFAEAAAZOw1KJhvHKwAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Yunnan University of Chinese Medicine\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Wei\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2026-04-16 14:23:24\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-9439368/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-9439368/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":108805131,\"identity\":\"c8e85183-7b1a-434a-8eec-298d5d0ec248\",\"added_by\":\"auto\",\"created_at\":\"2026-05-08 15:24:55\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2066789,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eBody weight, liver pathology, and serum biochemical parameters in MAFLD complicated with SP rats. (A) Body weight changes (week 1-18). (B) Body weigh at the 18th week (n=6). (C) Wet liver weight. (D) Liver index. (E) Gross morphology of the liver. Liver tissues were stained with H\\u0026amp;E and ORO and observed by a light microscope (original magnification, ×200). (F) Serum TG. (G) Serum TC. (H) Serum LDL. (I) Serum HDL. (J) Serum MDA. (K) Serum ALT. (L) Serum AST. (M) Serum GGT. (N) Serum GLU. (O) Serum INS. (P) HOMA-IR. n=6; \\u003cem\\u003e*P\\u003c/em\\u003e＜0.05, \\u003cem\\u003e**P\\u003c/em\\u003e＜0.01, \\u003cem\\u003e***P\\u003c/em\\u003e＜0.001. \\u003cem\\u003eP\\u003c/em\\u003e values were analyzed by one-way ANOVA followed by Tukey’s multiple comparison test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9439368/v1/5e9845e75e40a625b64db3a8.png\"},{\"id\":108605746,\"identity\":\"77b0fe18-90dc-4228-9d4f-5b9fc943e65a\",\"added_by\":\"auto\",\"created_at\":\"2026-05-06 12:15:41\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1631074,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eGrip strength, gastrocnemius pathology, and body composition analysis in MAFLD complicated with SP rats. (A) Grips strength of upper limbs changes (week 1-18). (B) Gross morphology of the gastrocnemius. Gastrocnemius tissues were stained with H\\u0026amp;E and ORO and observed by a light microscope (original magnification, H\\u0026amp;E staining ×100, ORO staining ×200). (C) Diameter of gastrocnemius. (D) Cross sectional area of gastrocnemius. (E) Body weight gain at the 18th week . (F) Fat mass. (G) The ratio of fat mass / body weight. (F) Lean mass. (G) The ratio of lean mass / body weight. n=6; \\u003cem\\u003e*P\\u003c/em\\u003e＜0.05, \\u003cem\\u003e**P\\u003c/em\\u003e＜0.01, \\u003cem\\u003e***P\\u003c/em\\u003e＜0.001. \\u003cem\\u003eP\\u003c/em\\u003evalues were analyzed by one-way ANOVA followed by Tukey’s multiple comparison test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9439368/v1/b9c41d8d9c17549e38ae3150.png\"},{\"id\":108605747,\"identity\":\"3a24a3a4-90a3-4d53-ba8a-b839823e7a8b\",\"added_by\":\"auto\",\"created_at\":\"2026-05-06 12:15:41\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":3856557,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSLBZS alleviated MAFLD-related manifestations in MAFLD complicated with SP rats. (A) Body weight changes (week 1-26). (B) Body weigh at the 26th week. (C) Wet liver weight. (D) Liver index. (E) Gross morphology of the liver. Liver tissues were stained with H\\u0026amp;E and ORO and observed by a light microscope (original magnification, ×200). (F) Serum TG. (G) Serum TC. (H) Serum LDL. (I) Serum HDL. (J) Serum MDA. (K) Serum ALT. (L) Serum AST. (M) Serum GGT. (N) Serum GLU. (O) Serum INS. (P) HOMA-IR. n=6; \\u003cem\\u003e*P\\u003c/em\\u003e＜0.05, \\u003cem\\u003e**P\\u003c/em\\u003e＜0.01, \\u003cem\\u003e***P\\u003c/em\\u003e＜0.001. \\u003cem\\u003eP\\u003c/em\\u003e values were analyzed by one-way ANOVA followed by Tukey’s multiple comparison test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9439368/v1/778f3a5eaa22285e0630ec64.png\"},{\"id\":108605749,\"identity\":\"4bd65c6c-6e87-4d63-acac-5a384af910c9\",\"added_by\":\"auto\",\"created_at\":\"2026-05-06 12:15:41\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2893434,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSLBZS alleviated SP-related manifestations in MAFLD complicated with SP rats. (A) Grips strength of upper limbs changes (week 1-26). (B) Gross morphology of the gastrocnemius. Gastrocnemius tissues were stained with H\\u0026amp;E and ORO and observed by a light microscope (original magnification, H\\u0026amp;E staining ×100, ORO staining ×200). (C) Diameter of gastrocnemius. (D) Cross sectional area of gastrocnemius. (E) Body weight gain at the 26th week. (F) Fat mass. (G) The ratio of fat mass / body weight. (F) Lean mass. (G) The ratio of lean mass / body weight. n=6; \\u003cem\\u003e*P\\u003c/em\\u003e＜0.05, \\u003cem\\u003e**P\\u003c/em\\u003e＜0.01, \\u003cem\\u003e***P\\u003c/em\\u003e＜0.001. \\u003cem\\u003eP\\u003c/em\\u003e values were analyzed by one-way ANOVA followed by Tukey’s multiple comparison test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9439368/v1/590be9393f4431400c516905.png\"},{\"id\":108605750,\"identity\":\"6e31705a-8729-4ce4-b894-2deca3c426c6\",\"added_by\":\"auto\",\"created_at\":\"2026-05-06 12:15:41\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2024999,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eTranscriptomic analysis of liver and gastrocnemius. (A) Volcano plot of DEGs in the liver. (B) Volcano plot of DEGs in the gastrocnemius. (C) KEGG enrichment scatter plot in liver tissues. (D) KEGG enrichment scatter plot in gastrocnemius tissues. (E) GSEA enrichment plot of AMPK signaling pathway in the liver. (F) GSEA enrichment plot of AMPK signaling pathway in the gastrocnemius.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9439368/v1/c90587618095324bb76e9a14.png\"},{\"id\":108605752,\"identity\":\"b6cbd6e3-e91c-4f91-a1eb-05de49be6b03\",\"added_by\":\"auto\",\"created_at\":\"2026-05-06 12:15:41\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2638041,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffects of SLBZS on the AMPK signaling pathway in MAFLD complicated with SP rats. (A) WB analysis of AMPKα, CPT-1, SREBP-1C, FAS, and ACC protein levels in liver tissues. (B) Relative expression of protein levels in liver tissues. (C-G) Relative mRNA levels of AMPKα, CPT-1, SREBP-1C, FAS, and ACC in liver tissues. (H) WB analysis of AMPKα, CPT-1, SREBP-1C, FAS, ACC, FOXO1, and MAFbx protein levels in gastrocnemius tissues. (I) Relative expression of protein levels in gastrocnemius tissues. (J-P) Relative mRNA levels of AMPKα, CPT-1, SREBP-1C, FAS, ACC, FOXO1, and MAFbx in gastrocnemius tissues. \\u003cem\\u003e*P\\u003c/em\\u003e＜0.05, \\u003cem\\u003e**P\\u003c/em\\u003e＜0.01, \\u003cem\\u003e***P\\u003c/em\\u003e＜0.001. \\u003cem\\u003eP\\u003c/em\\u003e values were analyzed by one-way ANOVA followed by Tukey’s multiple comparison test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9439368/v1/347c751cee0cce347109c814.png\"},{\"id\":109067684,\"identity\":\"bd833771-6ddf-40b2-9406-05e4318b0cb1\",\"added_by\":\"auto\",\"created_at\":\"2026-05-12 09:59:46\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":15724861,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9439368/v1/661c1903-70bf-46a9-9dda-9a0dc6f78720.pdf\"},{\"id\":108605748,\"identity\":\"7e3719a4-0886-46c6-9821-39c93eab08a0\",\"added_by\":\"auto\",\"created_at\":\"2026-05-06 12:15:41\",\"extension\":\"docx\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":1377709,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryMaterial.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9439368/v1/203a77c95660496094540b69.docx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Shenling Baizhu San Ameliorates Metabolic-Associated Fatty Liver Disease Complicated with Sarcopenia via Regulating AMPKα Signaling\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eMetabolic-associated fatty liver disease (MAFLD) is a chronic liver disorder characterized by systemic metabolic dysregulation and abnormal lipid deposition in the liver. Its disease spectrum includes hepatic steatosis, metabolic-associated steatohepatitis (MASH), hepatic fibrosis, cirrhosis, and hepatocellular carcinoma (HCC)\\u003csup\\u003e1\\u003c/sup\\u003e. A systematic review and meta-analysis estimated the global prevalence of MAFLD to be 32.4%, indicating a substantial burden on public health\\u003csup\\u003e2\\u003c/sup\\u003e. As a metabolic syndrome, MAFLD is commonly accompanied by multiple metabolic disorders, including type 2 diabetes mellitus, obesity, and dyslipidemia\\u003csup\\u003e3\\u003c/sup\\u003e. Recent studies have demonstrated that MAFLD is associated with the occurrence of sarcopenia (SP)\\u003csup\\u003e4\\u003c/sup\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003eSP is generally recognized as an aging-related disease\\u003csup\\u003e5\\u003c/sup\\u003e. It is primarily characterized by a progressive and generalized loss of skeletal muscle mass and function, accompanied by myosteatosis and abnormal accumulation of intermuscular adipose tissue (IMAT)\\u003csup\\u003e6,7\\u003c/sup\\u003e. It has been reported that approximately 25% to 70% of patients with MAFLD also present with SP\\u003csup\\u003e8\\u003c/sup\\u003e. SP may increase the risk of MAFLD progression and its adverse hepatic outcomes, including fibrosis, cirrhosis, and HCC\\u003csup\\u003e9\\u003c/sup\\u003e. Furthermore, MAFLD patients with SP exhibit a higher all-cause mortality rate\\u003csup\\u003e10\\u003c/sup\\u003e. Therefore, MAFLD complicated with SP has a high prevalence and poses a significant threat to human health. However, the shared mechanisms underlying MAFLD complicated with SP remain unclear. Metabolic dysregulation, insulin resistance (IR), and chronic inflammatory responses are considered major contributing factors\\u003csup\\u003e11\\u003c/sup\\u003e. Unhealthy eating habits induced-IR is a central pathogenic mechanism in both MAFLD and SP, and the liver and skeletal muscle are major target organs of insulin. The liver is the primary organ responsible for endogenous lipid synthesis. Under conditions of IR, the expression of genes involved in lipid metabolism is altered, leading to excessive synthesis and accumulation of triglycerides (TG) in hepatocytes, thereby promoting MAFLD\\u003csup\\u003e12\\u003c/sup\\u003e. During MAFLD progression, systemic IR activates the ubiquitin-proteasome pathway in skeletal muscle and promotes protein degradation\\u003csup\\u003e13\\u003c/sup\\u003e. IR also inhibits fatty acid β-oxidation, resulting in ectopic lipid deposition in myocytes\\u003csup\\u003e14\\u003c/sup\\u003e. By disrupting protein and lipid metabolism in skeletal muscle, IR leads to reduced muscle mass and increased myosteatosis. These findings indicate that IR contributes to the development of MAFLD complicated with SP by impairing metabolic homeostasis in both the liver and skeletal muscle.\\u003c/p\\u003e\\n\\u003cp\\u003eThe 5′-adenosine monophosphate-activated protein kinase (AMPK) is an important signal molecule that delays or blocks the aging process\\u003csup\\u003e15\\u003c/sup\\u003e. It also plays a critical role in the progression of MAFLD complicated with SP. AMPK is a ubiquitously expressed serine or threonine protein kinase that regulates metabolism by phosphorylating downstream targets, including sterol regulatory element-binding protein 1 (SREBP1), fatty acid synthase (FAS), acetyl-CoA carboxylase (ACC), and carnitine palmitoyltransferase 1 (CPT-1). When AMPK is inhibited, SREBP-1C, a key transcription factor regulating enzymes involved in fatty acid synthesis such as FAS and ACC, is activated and translocates into the nucleus. Meanwhile, inhibition of AMPK suppresses CPT-1 expression, thereby reducing β-oxidation, the rate-limiting step in fatty acid catabolism\\u003csup\\u003e16\\u003c/sup\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003eUnder conditions of IR, AMPK activity is reduced, leading to dysregulation of downstream signaling pathways, including the AMPK-SREBP1 and AMPK-CPT-1 axes. This disruption further impairs hepatic lipid metabolism and promotes MAFLD progression\\u003csup\\u003e17\\u003c/sup\\u003e. In addition, inhibition of AMPK adversely affects the AMPK-forkhead box O (FOXO) signaling axis\\u003csup\\u003e18\\u003c/sup\\u003e. FOXO transcription factors play a crucial role in protein metabolism. Reduced AMPK activity leads to dephosphorylation and activation of FOXO, which subsequently upregulates the expression of muscle atrophy F-box protein (MAFbx), a key mediator of ubiquitin-dependent protein degradation, thereby promoting skeletal muscle protein catabolism\\u003csup\\u003e19\\u003c/sup\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003eCurrently, therapeutic strategies for MAFLD complicated with SP primarily include dietary intervention, physical activity, and vitamin D supplementation\\u003csup\\u003e20\\u003c/sup\\u003e. Recent studies have demonstrated that several traditional Chinese medicine (TCM) formulations are effective in the treatment of MAFLD and SP. For example, Lingguizhugan decoction, Xiaoyao San, and Xuefu Zhuyu Decoction can effectively attenuate ectopic lipid deposition in the liver and ameliorate MAFLD\\u003csup\\u003e21-23\\u003c/sup\\u003e. Buzhong Yiqi Decoction promotes the proliferation and differentiation of skeletal muscle satellite cells (MuSCs) and enhances mitochondrial function, thereby improving SP\\u003csup\\u003e24,25\\u003c/sup\\u003e. Shenling Baizhu San (SLBZS), a classical TCM formula, was first documented in the Taiping Huimin Heji Ju Fang during the Song Dynasty of China. Studies suggest that SLBZS ameliorates IR, reduces hepatic lipid deposition, and alleviates MAFLD by regulating mitochondrial energy metabolism, activating hepatocyte autophagy, and modulating the gut microbiota and associated metabolites\\u003csup\\u003e26,27\\u003c/sup\\u003e. It has also been applied in the treatment of SP\\u003csup\\u003e28\\u003c/sup\\u003e. However, the mechanisms underlying its regulatory effects on substance metabolism in skeletal muscle remain to be further elucidated.\\u003c/p\\u003e\\n\\u003cp\\u003eIn this study, a rat model of MAFLD complicated with SP was established using a diet-induced approach, followed by intervention with SLBZS. First, the therapeutic effects of SLBZS on this model were evaluated. Subsequently, transcriptomic analysis was performed to identify potential targets associated with its therapeutic effects, and the underlying molecular mechanisms were further validated experimentally. This study aims to investigate the potential mechanisms by which SLBZS treats MAFLD complicated with SP through regulation of the AMPK signaling pathway in the liver and skeletal muscle, thereby modulating lipid and protein metabolism.\\u003c/p\\u003e\"},{\"header\":\"Materials and Methods\",\"content\":\"\\u003cp\\u003e\\u003cem\\u003eDiet and Drugs\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe high-fat, high-sugar (HFHS) diet consisted of 25% sucrose, 15% lard, 5% egg yolk powder, 1% cholesterol, 0.5% beef tallow flavor, 0.5% beef flavor, and 53% basal diet.\\u003c/p\\u003e\\n\\u003cp\\u003eSLBZS is composed of 10 Chinese herbal components, including Ren Shen, Fu Ling, Bai Zhu, Shan Yao, Bai Bian Dou, Lian Zi, Yi Yi Ren, Sha Ren, Jie Geng, and Gan Cao (Supplementary Table 1). It was produced by Beijing Tongrentang Pharmaceutical Factory (production batch number: 25101025). Compound identification of SLBZS was performed by Shanghai Biotree Biomedical Technology Co., Ltd. (Supplementary Figure 1). SLBZS was dissolved in normal saline and freshly prepared daily.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eAnimals and Experimental Design\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThirty male specific pathogen-free (SPF) Sprague-Dawley (SD) rats (6 weeks old, weighing 320\\u0026plusmn;20 g) were purchased from SPF (Beijing) Biotechnology Co., Ltd. [Certificate No: SCXK (Jing) 2019-0010]. All rats were housed at a temperature of 25℃ \\u0026plusmn; 1℃ and a relative humidity of 55% \\u0026plusmn; 10%, under a 12-hour light-dark cycle. Food and water were provided ad libitum throughout the experimental period.\\u003c/p\\u003e\\n\\u003cp\\u003eAfter one week of acclimatization, the rats were randomly divided into three groups as follows: control group (C group, n=12), HFHS diet-fed group (HFHS group, n=12), and SLBZS-treated group (SLBZS group, n=6). Rats in the C group were fed a basal diet, whereas those in the other groups received the HFHS diet. Drug intervention was initiated at week 19 and continued for 8 consecutive weeks. The C group and HFHS group received 0.9% sodium chloride (NaCl) at 100 mL/kg by gavage. The SLBZS group received intragastric administration at a dose of 1.08 g/kg based on body weight, with an average volume of 2 mL per rat.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eGeneral Indicator Observations and Body Composition Analysis\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eBody weight and upper limb grip strength of rats in each group were measured weekly throughout the experimental period. Each measurement was performed twice per rat, and the average value was recorded. At the end of weeks 18 and 26, body composition analysis, including body weight, fat mass, fat percentage, lean mass, and lean percentage, was performed using the rat measurement function of the Minispec LF90 small animal body composition analyzer.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eSample Preparation\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAt the end of week 18, six rats were randomly selected from the control group and the HFHS group for tissue sample collection. At the end of week 26, all remaining rats were sacrificed, and liver and gastrocnemius tissues were collected.\\u003c/p\\u003e\\n\\u003cp\\u003eThe procedures for tissue collection were as follows. Rats were fasted for 12 hours before the procedure, with free access to water. The anesthetic dose was calculated individually for each rat, and pentobarbital was administered intraperitoneally at 45\\u0026ndash;50 mg/kg. After adequate anesthesia was achieved, RNaseZap was applied to the abdominal area, and blood was collected from the abdominal aorta. Blood samples were allowed to clot and were then centrifuged to obtain serum, which was stored at \\u0026minus;80℃ for biochemical analysis. Liver and gastrocnemius tissues were excised and weighed. Portions of the tissues were used for histopathological analysis, while the remaining samples were stored at \\u0026minus;80℃ for transcriptomic and molecular analyses.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eSerum Biochemical Parameter Detection\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eSerum biochemical parameters were measured using corresponding assay kits (Nanjing Jiancheng Bioengineering). The measured indices included TG, total cholesterol (TC), low-density lipoprotein (LDL), high-density lipoprotein (HDL), alanine aminotransferase (ALT), aspartate aminotransferase (AST), gamma-glutamyl transferase (GGT), and glucose (GLU).\\u003c/p\\u003e\\n\\u003cp\\u003eSerum levels of malondialdehyde (MDA) and insulin (INS) were determined using enzyme-linked immunosorbent assay (ELISA) kits (Nanjing Jiancheng Bioengineering). All procedures were conducted in strict accordance with the manufacturer\\u0026rsquo;s instructions.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003ePathological Observations\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eLiver and gastrocnemius tissues were fixed in 4% paraformaldehyde and embedded in paraffin. The fixed tissues were trimmed into cubes measuring 5\\u0026times;5\\u0026times;2 mm. Tissue sections were stained according to the protocols of hematoxylin and eosin (H\\u0026amp;E) and Oil Red O (ORO) staining kits. Images were acquired using a slide scanning imaging system (Shenzhen Shengqiang Technology Co., Ltd.), and the diameter and cross-sectional area of gastrocnemius muscle fibers were quantified using ImageJ software.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eTranscriptome Analysis\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTotal RNA was isolated from frozen liver and gastrocnemius tissues using a total RNA extraction kit (Invitrogen), and its purity was assessed using an ultra-micro spectrophotometer (Thermo Fisher Scientific, USA). High-quality RNA samples were submitted to LC-Bio Technologies (Hangzhou) Co., Ltd. for library construction and transcriptome sequencing. Differentially expressed genes (DEGs) between the SLBZS group and the HFHS group were identified using standard bioinformatics analyses. Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis (https://www.genome.jp/kegg/) was performed to identify signaling pathways associated with the DEGs. In addition, gene set enrichment analysis (GSEA) (https://www.gsea-msigdb.org/gsea/index.jsp) was conducted to evaluate the activation or inhibition status of the AMPK signaling pathway in both groups.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eReal-Time Reverse Transcription Polymerase Chain Reaction (RT-qPCR) Analysis\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe procedures for total RNA isolation and purity assessment were consistent with those described above. Complementary DNA (cDNA) was synthesized from 500 ng of total RNA using ReverTra Ace\\u0026trade; qPCR RT Master Mix with gDNA Remover (TOYOBO Co., Ltd., Japan), then diluted and stored at \\u0026minus;20℃. Gene expression levels were quantified by real-time PCR using SYBR\\u0026reg; Green Realtime PCR Master Mix (TOYOBO Co., Ltd., Japan). Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (China), and their sequences are listed in Table 1.\\u003c/p\\u003e\\n\\u003cp\\u003eThe RT-qPCR protocol was as follows: initial denaturation at 95℃ for 30 s, followed by 40 cycles of 95℃ for 5 s, 52℃ for 10 s, and 72℃ for 15 s. After amplification, the relative expression levels of target genes were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the internal control using the 2\\u003csup\\u003e\\u0026minus;\\u0026Delta;\\u0026Delta;CT\\u003c/sup\\u003e method.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eWestern Blotting (WB) Analysis\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eLiver and gastrocnemius tissues were used for protein extraction. The tissues were thawed on ice, rinsed with pre-cooled phosphate-buffered saline (PBS), and thoroughly homogenized. After centrifugation, the supernatant was discarded, and radioimmunoprecipitation assay (RIPA) lysis buffer was added. The samples were further homogenized using a tissue grinder, followed by centrifugation at low temperature, and the supernatant was collected.\\u003c/p\\u003e\\n\\u003cp\\u003eProtein concentration was determined using the bicinchoninic acid (BCA) assay according to the manufacturer\\u0026rsquo;s instructions. Proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred onto polyvinylidene difluoride (PVDF) membranes. After blocking with 5% non-fat milk for 2 h at room temperature, membranes were incubated overnight at 4℃ with primary antibodies against target proteins. Primary antibodies included AMPK\\u0026alpha;, CPT-1, SREBP-1C, FAS, ACC, and \\u0026beta;-actin for liver tissues, and AMPK\\u0026alpha;, CPT-1, SREBP-1C, FAS, ACC, FOXO1, MAFbx, and \\u0026beta;-actin for gastrocnemius tissues (Jiangsu Qinke Biological Research Center Co., Ltd., China).\\u003c/p\\u003e\\n\\u003cp\\u003eAfter washing, membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Jiangsu Qinke Biological Research Center Co., Ltd., China) for 1 h at room temperature. Protein bands were visualized using a gel imaging system (Thermo Fisher Scientific, USA) and analyzed with ImageJ software. \\u0026beta;-actin was used as the internal reference to normalize relative protein expression levels.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eStatistical Analysis\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eGraphPad Prism 10.0 software was used for data analysis. All data are presented as the mean \\u0026plusmn; standard deviation (SD). Differences among groups were analyzed using one-way analysis of variance (ANOVA), followed by Tukey\\u0026rsquo;s multiple comparison test. A \\u003cem\\u003eP\\u003c/em\\u003e value \\u0026lt; 0.05 was considered statistically significant.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003ch2\\u003e1. HFHS Diet Promotes MAFLD Complicated with SP in Rats\\u003c/h2\\u003e\\n\\u003cp\\u003eBased on shared pathogenic mechanisms, an HFHS diet was used to establish a rat model of MAFLD complicated with SP. From the beginning of modeling to week 12, body weight in the HFHS group gradually increased compared with that in the C group. Notably, body weight in the HFHS group reached a peak at week 12. From week 13 onward, body weight in the HFHS group began to decline, whereas it continued to increase in the C group (Figure 1A). However, at week 18, body weight in the HFHS group remained higher than that in the C group (Figure 1B).\\u003c/p\\u003e\\n\\u003cp\\u003eLiver examination revealed that rats in the HFHS group exhibited higher liver wet weight and liver index compared with the C group (Figures 1C and 1D). The livers of HFHS-fed rats appeared paler than those of the C group. H\\u0026amp;E and ORO staining demonstrated that hepatocytes in the HFHS group exhibited disrupted morphology, with marked hepatic steatosis and abundant lipid droplets (Figure 1E), indicating typical features of MAFLD.\\u003c/p\\u003e\\n\\u003cp\\u003eSerum biochemical analysis further supported these findings. The HFHS group showed significantly increased levels of TG, TC, LDL, and MDA, along with significantly decreased HDL levels (Figures 1F–J), indicating pronounced metabolic disturbances. In addition, serum ALT, AST, and GGT levels were elevated in the HFHS group (Figures 1K–M), suggesting hepatic injury. Levels of GLU, INS, and homeostasis model assessment of insulin resistance (HOMA-IR) were also significantly increased (Figures 1N–P), indicating the presence of IR. These results confirm that the HFHS diet induced MAFLD-related phenotypes in rats.\\u003c/p\\u003e\\n\\u003cp\\u003eDuring model establishment, forelimb grip strength was measured in all groups. From the start of modeling to week 14, grip strength increased in all groups, with the HFHS group reaching a higher peak value than the C group at week 14. From week 15 onward, grip strength in the HFHS group declined, whereas it continued to increase in the C group. By week 18, grip strength in the HFHS group was significantly lower than that in the C group (Figure 2A).\\u003c/p\\u003e\\n\\u003cp\\u003eHistopathological examination of the gastrocnemius muscle revealed that, compared with the C group, HFHS-fed rats exhibited disorganized muscle fiber arrangement, increased intermuscular space, pronounced muscle fiber necrosis and lysis, inflammatory infiltration, and myosteatosis (Figure 2B). Both muscle fiber diameter and cross-sectional area were reduced in the HFHS group (Figures 2C and 2D). The wet weight of the gastrocnemius muscle was also decreased in the HFHS group. According to the criteria defined by Richard N. Baumgartner et al.\\u003csup\\u003e29\\u003c/sup\\u003e, the difference in the skeletal muscle index (SI) ratio between the HFHS group and the C group (1.673) exceeded twice the standard deviation of the C group (0.774) (Table 2), indicating successful establishment of the SP model.\\u003c/p\\u003e\\n\\u003cp\\u003eFurthermore, body weight gain and body composition were evaluated at week 18. Body weight gain was higher in the HFHS group than in the C group (Figure 2E). Fat mass and fat percentage were significantly increased, whereas lean mass and lean percentage were decreased in the HFHS group (Figures 2F–I), indicating that the increased body weight gain was primarily attributable to fat accumulation rather than muscle mass.\\u003c/p\\u003e\\n\\u003cp\\u003eIn summary, the HFHS diet effectively induced the development of MAFLD complicated with SP in rats.\\u003c/p\\u003e\\n\\u003ch2\\u003e2. SLBZS Effectively Alleviates Manifestations of MAFLD Complicated with SP in Rats\\u003c/h2\\u003e\\n\\u003cp\\u003eFollowing administration of SLBZS, body weight in the SLBZS group began to increase from week 19, whereas body weight in the HFHS group continued to decrease. Body weight in the C group increased steadily throughout the experimental period (Figure 3A). At week 26, rats in the HFHS group exhibited the lowest body weight, whereas those in the SLBZS group showed the highest (Figure 3B).\\u003c/p\\u003e\\n\\u003cp\\u003eLiver examination revealed that rats in the SLBZS group had lower liver wet weight and liver index compared with those in the HFHS group (Figures 3C and 3D). The livers of rats in the SLBZS group appeared markedly darker than those in the HFHS group and were similar to those in the C group. H\\u0026amp;E and ORO staining demonstrated that hepatocytes in the SLBZS group exhibited relatively normal morphology and arrangement, with intact nuclei, occasional ballooning vacuoles, and markedly reduced intracellular lipid droplets (Figure 3E), indicating that SLBZS effectively alleviated hepatic lipid deposition.\\u003c/p\\u003e\\n\\u003cp\\u003eSerum biochemical parameters were also assessed. Compared with the HFHS group, the SLBZS group exhibited significantly reduced levels of TG, TC, LDL, and MDA, along with significantly increased HDL levels (Figures 3F–J), suggesting that SLBZS effectively improved HFHS-induced metabolic disturbances. In addition, serum ALT, AST, and GGT levels were significantly decreased in the SLBZS group compared with the HFHS group (Figures 3K–M), indicating improved hepatic function. Levels of GLU, INS, and HOMA-IR were also reduced in the SLBZS group (Figures 3N–P), demonstrating attenuation of IR. These findings confirm that SLBZS effectively improves MAFLD-related manifestations in rats.\\u003c/p\\u003e\\n\\u003cp\\u003eDuring the treatment period, forelimb grip strength was measured in all groups. With increasing experimental duration, grip strength in the HFHS group progressively declined. In contrast, grip strength in the SLBZS group increased significantly by week 20 and exceeded that of the C group by week 26 (Figure 4A), indicating that SLBZS effectively improved muscle function.\\u003c/p\\u003e\\n\\u003cp\\u003eHistopathological examination of the gastrocnemius muscle revealed that, compared with the HFHS group, rats in the SLBZS group exhibited more orderly muscle fiber arrangement, reduced intermuscular space, absence of evident muscle fiber necrosis or lysis, minimal inflammatory infiltration, and decreased lipid droplet accumulation in myocytes (Figure 4B). Both muscle fiber diameter and cross-sectional area were significantly increased in the SLBZS group compared with the HFHS group (Figures 4C and 4D). The wet weight of the gastrocnemius muscle was also significantly increased in the SLBZS group and exceeded that of the C group, whereas the HFHS group showed the lowest values.\\u003c/p\\u003e\\n\\u003cp\\u003eThe SI ratio was further evaluated. The SI ratio was higher in the SLBZS group than in the HFHS group and exceeded that of the C group. Meanwhile, the difference in SI ratio between the HFHS group and the C group (0.785) was greater than twice the SD of the C group, whereas the difference between the SLBZS group and the C group (−0.186) was less than twice the SD of the C group (Table 3), indicating that SLBZS effectively improved muscle mass.\\u003c/p\\u003e\\n\\u003cp\\u003eFurthermore, body weight gain and body composition were analyzed at week 26. Body weight gain was significantly higher in the SLBZS group than in the HFHS group (Figure 4E). Compared with the HFHS group, fat mass and fat percentage were significantly reduced, whereas lean mass and lean percentage were increased in the SLBZS group (Figures 4F–I), indicating that SLBZS effectively regulates body composition by reducing fat accumulation and increasing muscle mass. These findings demonstrate that SLBZS effectively ameliorates SP-related manifestations in rats.\\u003c/p\\u003e\\n\\u003cp\\u003eCollectively, SLBZS markedly ameliorates HFHS diet-induced MAFLD complicated with SP.\\u003c/p\\u003e\\n\\u003ch2\\u003e3. The AMPK Pathway as a Potential Target of SLBZS in the Treatment of MAFLD Complicated with SP\\u003c/h2\\u003e\\n\\u003cp\\u003eTo identify the signaling pathways mediating the therapeutic effects of SLBZS in MAFLD complicated with SP, transcriptomic analysis was performed. First, mRNA expression profiles were compared between the SLBZS and HFHS groups. A total of 895 DEGs were identified in the liver, including 506 upregulated and 389 downregulated genes. In skeletal muscle, 834 DEGs were identified, including 610 upregulated and 224 downregulated genes (Figures 5A and 5B).\\u003c/p\\u003e\\n\\u003cp\\u003eSubsequently, KEGG enrichment analysis was conducted to identify pathways associated with these DEGs. In addition to the insulin signaling pathway, the AMPK signaling pathway emerged as the most prominent pathway shared by both liver and muscle tissues (Figures 5C and 5D). Furthermore, GSEA indicated that the AMPK signaling pathway was suppressed in both liver and muscle tissues in the HFHS group but activated in the SLBZS group. These findings suggest that the AMPK signaling pathway represents a central mechanism underlying the therapeutic effects of SLBZS in MAFLD complicated with SP.\\u003c/p\\u003e\\n\\u003ch2\\u003e4. The AMPKα Signaling Pathway as a Core Mechanism of SLBZS in MAFLD Complicated with SP\\u003c/h2\\u003e\\n\\u003cp\\u003eFollowing transcriptomic analysis, the expression of AMPKα and its downstream targets was further examined. In both liver and skeletal muscle tissues, the expression of AMPKα at both mRNA and protein levels was reduced in the HFHS group. After SLBZS treatment, AMPKα expression was significantly upregulated in both tissues (Figures 6A–C and 6H–J).\\u003c/p\\u003e\\n\\u003cp\\u003eSubsequently, downstream genes associated with AMPKα were analyzed. In the liver, the mRNA and protein levels of CPT-1, a gene associated with lipolysis, were decreased in the HFHS group, whereas the expression of SREBP-1C, FAS, and ACC, which are involved in lipogenesis, were increased. Following SLBZS treatment, CPT-1 expression was significantly increased, whereas SREBP-1C, FAS, and ACC expression levels were decreased (Figures 6A–B and 6D–G).\\u003c/p\\u003e\\n\\u003cp\\u003eThese results indicate that the HFHS diet promotes hepatic lipid accumulation by inhibiting lipolysis and enhancing lipogenesis. SLBZS alleviates MAFLD by regulating AMPKα and its downstream targets, thereby improving hepatic lipid metabolism and reducing ectopic lipid deposition in the liver.\\u003c/p\\u003e\\n\\u003cp\\u003eIn skeletal muscle tissues, similar trends were observed. In the HFHS group, the protein and mRNA levels of CPT-1 were decreased, whereas the expression levels of SREBP-1C, FAS, and ACC were increased. In addition, the levels of FOXO1 and MAFbx, which are associated with skeletal muscle protein degradation, were elevated. Following SLBZS treatment, the protein and mRNA levels of CPT-1 were significantly increased, whereas those of SREBP-1C, FAS, ACC, FOXO1, and MAFbx were decreased in the SLBZS group (Figures 6H–I and 6K–P). These results indicate that the HFHS diet induces SP by promoting skeletal muscle protein degradation and increasing intramyocellular lipid deposition. SLBZS attenuates SP-related manifestations by regulating AMPKα and its downstream factors, thereby reducing intramyocellular lipid accumulation and inhibiting protein degradation in skeletal muscle.\\u003c/p\\u003e\\n\\u003cp\\u003eCollectively, these findings suggest that SLBZS improves metabolic homeostasis in both liver and skeletal muscle tissues by regulating the AMPK signaling pathway, thereby ameliorating MAFLD complicated with SP.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eMAFLD is a highly prevalent disease associated with metabolic disorders, whereas sarcopenia (SP) is closely associated with aging. The mechanism underlying this comorbidity is closely related to metabolic disorders, IR, and low-grade chronic inflammation induced by unhealthy lifestyles\\u003csup\\u003e1\\u003c/sup\\u003e. Although MAFLD and SP are distinct conditions affecting different organs, substantial crosstalk and interaction occur during their progression\\u003csup\\u003e30\\u003c/sup\\u003e. Patients with MAFLD complicated with SP not only exhibit a higher risk of fibrosis but also show significantly increased mortality. Improvement of skeletal muscle mass and function may help mitigate disease progression\\u003csup\\u003e31\\u003c/sup\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003eAt present, the primary interventions for MAFLD complicated with SP consist of dietary management and physical exercise, whereas pharmacological therapies remain limited\\u003csup\\u003e32\\u003c/sup\\u003e. Long-term clinical studies have demonstrated that SLBZS exerts therapeutic effects against MAFLD. Previous studies have also shown that SLBZS combined with exercise alleviates sarcopenic phenotypes, although the underlying mechanisms remain unclear. Earlier research has indicated that SLBZS reduces ectopic hepatic lipid deposition by regulating the gut microbiota and hepatic mitochondrial energy metabolism\\u003csup\\u003e33\\u003c/sup\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003eIn the present study, we demonstrated that SLBZS exerts both anti-MAFLD and anti-SP effects. Considering that IR is a central pathogenic mechanism and that unhealthy dietary habits are key contributors to MAFLD complicated with SP, a rat model was established by feeding an HFHS diet for 18 weeks. As expected, the model rats exhibited characteristic features of MAFLD complicated with SP, including pronounced IR, altered serum biochemical and liver function parameters, increased hepatic lipid accumulation and liver index, reduced muscle mass and function, and evident myosteatosis. Body composition analysis using time-domain nuclear magnetic resonance (TD-NMR) further showed that, although the HFHS diet increased body weight, the proportion of muscle mass was markedly reduced and fat mass significantly increased in model rats compared with controls, indicating that weight gain was primarily attributable to fat accumulation.\\u003c/p\\u003e\\n\\u003cp\\u003eFrom week 19 onward, model rats received SLBZS treatment. After 8 weeks of intervention, body weight in the treated group was significantly reduced. In addition, HOMA-IR, serum biochemical parameters, liver function indices, hepatic lipid deposition, and liver index were all markedly improved, indicating effective amelioration of MAFLD. Meanwhile, forelimb grip strength increased significantly, fat proportion decreased, muscle proportion increased, muscle fiber diameter and cross-sectional area were enlarged, and intramyocellular lipid deposition was reduced, indicating that SP was effectively alleviated. These findings demonstrate that SLBZS exerts beneficial effects in rats with MAFLD complicated with SP.\\u003c/p\\u003e\\n\\u003cp\\u003eBecause the mechanisms underlying MAFLD complicated with SP are complex, the pathophysiology of this comorbidity remains to be fully elucidated. In addition, TCM formulas are composed of multiple components and may act on diverse signaling pathways across different tissues and organs. To investigate both the disease mechanism and the molecular basis of SLBZS action, transcriptomic analyses were performed on liver and skeletal muscle tissues. KEGG and GSEA enrichment analyses indicated that the AMPK signaling pathway may play a central role in the therapeutic effects of SLBZS.\\u003c/p\\u003e\\n\\u003cp\\u003eFurther analysis demonstrated that the AMPK signaling pathway was downregulated in both liver and skeletal muscle tissues in HFHS-fed rats. In the liver, decreased CPT-1 expression and increased expression of SREBP-1C, FAS, and ACC promoted de novo lipogenesis and lipid accumulation, leading to elevated circulating levels of TG, LDL, and other lipids. Excess lipid accumulation in hepatocytes enhanced oxidative stress and increased liver function indices such as ALT and AST, resulting in significant hepatic injury. Moreover, the HFHS diet induced pronounced IR in model rats.\\u003c/p\\u003e\\n\\u003cp\\u003eIn skeletal muscle, downregulation of AMPK increased the expression of FOXO1 and MAFbx, thereby promoting protein degradation and reducing muscle mass. Concurrently, marked myosteatosis was observed during HFHS feeding, which may be associated with decreased CPT-1 expression and increased expression of SREBP-1C, FAS, and ACC in skeletal muscle cells. Notably, both myosteatosis and IMAT infiltration were observed during disease progression. IMAT is primarily derived from fibro-adipogenic progenitors (FAPs), a population of mesenchymal stromal cells located within the basal lamina surrounding the sarcolemma, where MuSCs reside\\u003csup\\u003e34\\u003c/sup\\u003e. Disrupted lipid metabolism in skeletal muscle may provide substrates for both myosteatosis and IMAT accumulation. Further studies are required to determine how the HFHS diet regulates the differentiation of FAPs.\\u003c/p\\u003e\\n\\u003cp\\u003eIn summary, inhibition of AMPK is closely associated with the progression of MAFLD complicated with SP and represents a potential therapeutic target for this comorbidity.\\u003c/p\\u003e\\n\\u003cp\\u003eStudies have suggested that TCM monomers or formulas can ameliorate MAFLD via the AMPK signaling pathway. For example, Si-Ni-San improves hepatic lipid accumulation in MAFLD mice by activating the AMPK/p300/SREBP-1C axis and inhibiting hepatic fatty acid synthase (FASN) expression\\u003csup\\u003e35\\u003c/sup\\u003e. Rhizoma Atractylodis and 6-gingerol alleviate high-fat diet (HFD)-induced MAFLD by activating AMPK, downregulating SREBP1 expression, and suppressing fatty acid synthesis\\u003csup\\u003e36,37\\u003c/sup\\u003e. In the present study, the expression of AMPKα at both transcriptional and translational levels was significantly upregulated in the liver. With increased AMPK activity, the expression of downstream genes, including SREBP-1C, FAS, and ACC, was reduced, thereby inhibiting hepatic de novo lipogenesis. Meanwhile, the expression of CPT-1 was increased, which enhanced fatty acid β-oxidation and accelerated lipolysis in the liver. These effects reduced hepatic lipid accumulation and lipid peroxidation-induced hepatocyte injury, thereby restoring liver function. As the liver is the primary organ responsible for lipid synthesis, SLBZS demonstrated the capacity to regulate hepatic lipid metabolism and further reduce circulating levels of TG and LDL through AMPK signaling. In addition, insulin sensitivity was improved in model rats following SLBZS treatment. In summary, SLBZS regulates the expression of CPT-1, SREBP-1C, FAS, and ACC via the AMPK signaling pathway, thereby improving hepatic manifestations in MAFLD complicated with SP.\\u003c/p\\u003e\\n\\u003cp\\u003eAMPK also represents an important target of TCM in the treatment of MAFLD complicated with SP. For example, Gui Qi Zhuang Jin Decoction improves mitochondrial function and promotes mitochondrial energy metabolism in the gastrocnemius muscle of SP mice by activating the AMPK/peroxisome proliferator-activated receptor gamma coactivator-1 alpha (PGC-1α)/nuclear factor erythroid 2-related factor 2 (Nrf2) axis, thereby alleviating SP\\u003csup\\u003e38\\u003c/sup\\u003e. Jianpi Qiangji Granule improves skeletal muscle function by activating AMPK and regulating downstream PGC-1α expression\\u003csup\\u003e39\\u003c/sup\\u003e. Umbelliferone inhibits the expression of muscle ring-finger protein-1 (MuRF-1), forkhead box O3a (FoxO3a), and Atrogin-1 via AMPK, thereby suppressing protein ubiquitination and degradation in skeletal muscle and attenuating diabetic sarcopenia\\u003csup\\u003e40\\u003c/sup\\u003e. In the present study, SLBZS significantly upregulated AMPKα expression in the gastrocnemius muscle. Activation of AMPKα reduced the expression of FOXO1 and MAFbx, thereby decreasing protein degradation and attenuating muscle loss in MAFLD complicated with SP rats. Furthermore, AMPK activation also regulated lipid metabolism in skeletal muscle cells. Although skeletal muscle is not the primary organ for lipid metabolism, it expresses enzymes involved in both lipogenesis and lipolysis, enabling lipid utilization. Following SLBZS treatment, CPT-1 expression in the gastrocnemius was increased, promoting fatty acid oxidation, whereas the expression of SREBP-1C, FAS, and ACC was decreased, reducing lipid synthesis. By modulating the expression of lipid metabolism-related enzymes in skeletal muscle, SLBZS effectively alleviated myosteatosis in model rats. In addition, reduced IMAT infiltration was observed following SLBZS treatment. However, the molecular mechanisms by which SLBZS regulates fibro-adipogenic progenitor (FAP) differentiation and IMAT infiltration require further investigation. In summary, SLBZS regulates the expression of CPT-1, SREBP-1C, FAS, ACC, FOXO1, and MAFbx in skeletal muscle via the AMPK signaling pathway, thereby improving muscle-related manifestations in MAFLD complicated with SP.\\u003c/p\\u003e\\n\\u003cp\\u003eBased on the TCM theory that the spleen governs transportation and transformation and is associated with muscle function, a rat model of MAFLD complicated with SP was established using an HFHS diet to simulate the pathogenic condition of excessive dietary intake impairing spleen function. Following treatment with the classical spleen-strengthening formula SLBZS and evaluation of multiple physiological and biochemical parameters, we confirmed that SLBZS alleviates MAFLD complicated with SP. Transcriptomic analysis further indicated that the AMPK signaling pathway is involved in both the pathogenesis of MAFLD complicated with SP and the therapeutic mechanism of SLBZS, which was subsequently validated experimentally.\\u003c/p\\u003e\\n\\u003cp\\u003eIn TCM theory, spleen deficiency is closely associated with metabolic disorders, immune dysfunction, gut microbiota imbalance, and intestinal dysfunction. The present study focused on the relationship between spleen deficiency and AMPK-mediated metabolic dysregulation in the liver and skeletal muscle, without examining other associated alterations. This is because TCM formulas typically exert multi-target effects, including modulation of low-grade chronic inflammation, macrophage polarization, and activation of pro-inflammatory signaling pathways. It was not feasible to comprehensively evaluate all contributing factors in this study. Therefore, the present work primarily aimed to elucidate the molecular mechanisms by which SLBZS ameliorates MAFLD complicated with SP from the perspective of metabolic regulation. Accordingly, we systematically analyzed the regulation of lipid and protein metabolism by SLBZS via the AMPK signaling pathway in different tissues and preliminarily clarified its molecular mechanism in liver and skeletal muscle.\\u003c/p\\u003e\\n\\u003cp\\u003eIn addition, IMAT infiltration was observed in the model rats and was reduced following SLBZS treatment. However, the underlying molecular mechanisms were not further investigated in this study. This limitation was due to the fact that all rats had been sacrificed and tissues had been exposed during pathological procedures, which precluded the isolation of primary cells. Moreover, adipogenic differentiation of FAPs is a dynamic process that requires evaluation at multiple time points. These mechanisms will be explored in future studies.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eThe present study demonstrates that the classical TCM spleen-strengthening formula SLBZS effectively treats HFHS diet-induced MAFLD complicated with SP by improving metabolic function in both the liver and skeletal muscle. In the liver, SLBZS regulates the expression of lipid metabolism-related genes, including CPT-1, SREBP-1C, FAS, and ACC, via the AMPK signaling pathway, thereby modulating hepatic lipid metabolism and reducing lipid deposition in hepatocytes. In skeletal muscle, SLBZS regulates the expression of CPT-1, SREBP-1C, FAS, ACC, FOXO1, and MAFbx through AMPK signaling, thereby modulating lipid metabolism and protein catabolism, reducing myosteatosis, and inhibiting skeletal muscle proteolysis.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003eEthics statement\\u003c/p\\u003e\\n\\u003cp\\u003eThe animal studies were approved by Yunnan College of Traditional Chinese Medicine Animal Experiment Ethics Review Committee.\\u003c/p\\u003e\\n\\u003cp\\u003eAuthor contributions\\u003c/p\\u003e\\n\\u003cp\\u003eYY, WW and YL designed this study, wrote the manuscript and provided funding support. YS designed the experiments and wrote the manuscript. JL performed data analysis and participated in partial manuscript writing. YT, FL and XZ conducted the experiments and data analysis. LH and KZ participated in partial experiments and data analysis. All authors have contributed to this article and approved the submitted version.\\u003c/p\\u003e\\n\\u003cp\\u003eFunding\\u003c/p\\u003e\\n\\u003cp\\u003eThis study was supported by grants from the National Natural Science Foundation of China (82360886, 82560881), the Yunnan Provincial Science and Technology Department-Applied Basic Research Joint Special Funds of Chinese Medicine (202101AZ070001-219, 202301AZ070001-035), the Special Fund for Educational Research of Provincial Directly Affiliated Institutions of Fujian Province in 2023 (X2023007, X2023008).\\u003c/p\\u003e\\n\\u003cp\\u003eConflict of interest\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\\u003c/p\\u003e\\n\\u003cp\\u003eData availability\\u003c/p\\u003e\\n\\u003cp\\u003eAll data generated or analysed during this study are included in this published article and its supplementary information files. Unprocessed raw data are available from the corresponding author upon reasonable request.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eLiu, C. H.\\u003cem\\u003e et al.\\u003c/em\\u003e Sarcopenia and MASLD: novel insights and the future. \\u003cem\\u003eNat Rev Endocrinol\\u003c/em\\u003e \\u003cstrong\\u003e22\\u003c/strong\\u003e, 139\\u0026ndash;152 (2026). https://doi.org/10.1038/s41574-025-01197-7\\u003c/li\\u003e\\n\\u003cli\\u003eRiazi, K.\\u003cem\\u003e et al.\\u003c/em\\u003e The prevalence and incidence of NAFLD worldwide: a systematic review and meta-analysis. \\u003cem\\u003eLancet Gastroenterol Hepatol\\u003c/em\\u003e \\u003cstrong\\u003e7\\u003c/strong\\u003e, 851\\u0026ndash;861 (2022). https://doi.org/10.1016/s2468-1253(22)00165-0\\u003c/li\\u003e\\n\\u003cli\\u003ePark, Y., Ko, K. S. \\u0026amp; Rhee, B. D. Non-Alcoholic Fatty Liver Disease (NAFLD) Management in the Community. \\u003cem\\u003eInt J Mol Sci\\u003c/em\\u003e \\u003cstrong\\u003e26\\u003c/strong\\u003e (2025). https://doi.org/10.3390/ijms26062758\\u003c/li\\u003e\\n\\u003cli\\u003eKim, J. A. \\u0026amp; Choi, K. M. Sarcopenia and fatty liver disease. \\u003cem\\u003eHepatol Int\\u003c/em\\u003e \\u003cstrong\\u003e13\\u003c/strong\\u003e, 674\\u0026ndash;687 (2019). https://doi.org/10.1007/s12072-019-09996-7\\u003c/li\\u003e\\n\\u003cli\\u003eSayer, A. A.\\u003cem\\u003e et al.\\u003c/em\\u003e Sarcopenia. \\u003cem\\u003eNat Rev Dis Primers\\u003c/em\\u003e \\u003cstrong\\u003e10\\u003c/strong\\u003e, 68 (2024). https://doi.org/10.1038/s41572-024-00550-w\\u003c/li\\u003e\\n\\u003cli\\u003eHabboub, B., Speer, R., Gosch, M. \\u0026amp; Singler, K. The Diagnosis and Treatment of Sarcopenia and Sarcopenic Obesity. \\u003cem\\u003eDtsch Arztebl Int\\u003c/em\\u003e \\u003cstrong\\u003e122\\u003c/strong\\u003e, 121\\u0026ndash;126 (2025). https://doi.org/10.3238/arztebl.m2025.0004\\u003c/li\\u003e\\n\\u003cli\\u003eZamboni, M., Gattazzo, S. \\u0026amp; Rossi, A. P. Myosteatosis: a relevant, yet poorly explored element of sarcopenia. \\u003cem\\u003eEur Geriatr Med\\u003c/em\\u003e \\u003cstrong\\u003e10\\u003c/strong\\u003e, 5\\u0026ndash;6 (2019). https://doi.org/10.1007/s41999-018-0134-3\\u003c/li\\u003e\\n\\u003cli\\u003eIsakov, V. Metabolic dysfunction-associated steatotic liver disease: A story of muscle and mass. \\u003cem\\u003eWorld J Gastroenterol\\u003c/em\\u003e \\u003cstrong\\u003e31\\u003c/strong\\u003e, 105346 (2025). https://doi.org/10.3748/wjg.v31.i20.105346\\u003c/li\\u003e\\n\\u003cli\\u003eDajti, E.\\u003cem\\u003e et al.\\u003c/em\\u003e Sarcopenia evaluated by EASL/AASLD computed tomography-based criteria predicts mortality in patients with cirrhosis: A systematic review and meta-analysis. \\u003cem\\u003eJHEP Rep\\u003c/em\\u003e \\u003cstrong\\u003e6\\u003c/strong\\u003e, 101113 (2024). https://doi.org/10.1016/j.jhepr.2024.101113\\u003c/li\\u003e\\n\\u003cli\\u003eGolabi, P.\\u003cem\\u003e et al.\\u003c/em\\u003e Contribution of sarcopenia and physical inactivity to mortality in people with non-alcoholic fatty liver disease. \\u003cem\\u003eJHEP Rep\\u003c/em\\u003e \\u003cstrong\\u003e2\\u003c/strong\\u003e, 100171 (2020). https://doi.org/10.1016/j.jhepr.2020.100171\\u003c/li\\u003e\\n\\u003cli\\u003eZhai, Y. \\u0026amp; Xiao, Q. The Common Mechanisms of Sarcopenia and NAFLD. \\u003cem\\u003eBiomed Res Int\\u003c/em\\u003e \\u003cstrong\\u003e2017\\u003c/strong\\u003e, 6297651 (2017). https://doi.org/10.1155/2017/6297651\\u003c/li\\u003e\\n\\u003cli\\u003eHu, Y.\\u003cem\\u003e et al.\\u003c/em\\u003e The Mutual Inhibition of FoxO1 and SREBP-1c Regulated the Progression of Hepatoblastoma by Regulating Fatty Acid Metabolism. \\u003cem\\u003eMediators Inflamm\\u003c/em\\u003e \\u003cstrong\\u003e2021\\u003c/strong\\u003e, 5754592 (2021). https://doi.org/10.1155/2021/5754592\\u003c/li\\u003e\\n\\u003cli\\u003eLiu, Y.\\u003cem\\u003e et al.\\u003c/em\\u003e Aspartate inhibits LPS-induced MAFbx and MuRF1 expression in skeletal muscle in weaned pigs by regulating Akt, AMPK\\u0026alpha; and FOXO1. \\u003cem\\u003eInnate Immun\\u003c/em\\u003e \\u003cstrong\\u003e23\\u003c/strong\\u003e, 34\\u0026ndash;43 (2017). https://doi.org/10.1177/1753425916673443\\u003c/li\\u003e\\n\\u003cli\\u003eWu, C.\\u003cem\\u003e et al.\\u003c/em\\u003e Fucoxanthin Mitigates High-Fat-Induced Lipid Deposition and Insulin Resistance in Skeletal Muscle through Inhibiting PKM1 Activity. \\u003cem\\u003eJ Agric Food Chem\\u003c/em\\u003e \\u003cstrong\\u003e72\\u003c/strong\\u003e, 18013\\u0026ndash;18026 (2024). https://doi.org/10.1021/acs.jafc.4c03677\\u003c/li\\u003e\\n\\u003cli\\u003eGe, Y., Zhou, M., Chen, C., Wu, X. \\u0026amp; Wang, X. Role of AMPK mediated pathways in autophagy and aging. \\u003cem\\u003eBiochimie\\u003c/em\\u003e \\u003cstrong\\u003e195\\u003c/strong\\u003e, 100\\u0026ndash;113 (2022). https://doi.org/10.1016/j.biochi.2021.11.008\\u003c/li\\u003e\\n\\u003cli\\u003eLiang, Q., Ai, L., He, L., Wang, L. C. \\u0026amp; Wang, J. L. Targeting the AMP-activated protein kinase pathway: the active metabolites of botanical drugs represent potential strategies for treating metabolic-associated fatty liver disease. \\u003cem\\u003eFront Pharmacol\\u003c/em\\u003e \\u003cstrong\\u003e16\\u003c/strong\\u003e, 1681880 (2025). https://doi.org/10.3389/fphar.2025.1681880\\u003c/li\\u003e\\n\\u003cli\\u003eWang, H.\\u003cem\\u003e et al.\\u003c/em\\u003e Natural active botanical metabolites: targeting AMPK signaling pathway to treat metabolic dysfunction-associated fatty liver disease. \\u003cem\\u003eFront Pharmacol\\u003c/em\\u003e \\u003cstrong\\u003e16\\u003c/strong\\u003e, 1611400 (2025). https://doi.org/10.3389/fphar.2025.1611400\\u003c/li\\u003e\\n\\u003cli\\u003eLiu, D.\\u003cem\\u003e et al.\\u003c/em\\u003e Frontiers in sarcopenia: Advancements in diagnostics, molecular mechanisms, and therapeutic strategies. \\u003cem\\u003eMol Aspects Med\\u003c/em\\u003e \\u003cstrong\\u003e97\\u003c/strong\\u003e, 101270 (2024). https://doi.org/10.1016/j.mam.2024.101270\\u003c/li\\u003e\\n\\u003cli\\u003eNakashima, K. \\u0026amp; Yakabe, Y. AMPK activation stimulates myofibrillar protein degradation and expression of atrophy-related ubiquitin ligases by increasing FOXO transcription factors in C2C12 myotubes. \\u003cem\\u003eBiosci Biotechnol Biochem\\u003c/em\\u003e \\u003cstrong\\u003e71\\u003c/strong\\u003e, 1650\\u0026ndash;1656 (2007). https://doi.org/10.1271/bbb.70057\\u003c/li\\u003e\\n\\u003cli\\u003ePolyzos, S. A., Vachliotis, I. D. \\u0026amp; Mantzoros, C. S. Sarcopenia, sarcopenic obesity and nonalcoholic fatty liver disease. \\u003cem\\u003eMetabolism\\u003c/em\\u003e \\u003cstrong\\u003e147\\u003c/strong\\u003e, 155676 (2023). https://doi.org/10.1016/j.metabol.2023.155676\\u003c/li\\u003e\\n\\u003cli\\u003eNing, Y.\\u003cem\\u003e et al.\\u003c/em\\u003e Lingguizhugan Decoction Targets Intestinal Microbiota and Metabolites to Reduce Insulin Resistance in High-Fat Diet Rats. \\u003cem\\u003eDiabetes Metab Syndr Obes\\u003c/em\\u003e \\u003cstrong\\u003e15\\u003c/strong\\u003e, 2427\\u0026ndash;2442 (2022). https://doi.org/10.2147/dmso.S370492\\u003c/li\\u003e\\n\\u003cli\\u003eLiu, Y.\\u003cem\\u003e et al.\\u003c/em\\u003e Xiaoyao San\\u0026apos;s dual efficacy in NAFLD and depression: Unraveling the mechanisms via network pharmacology and multi-omics. \\u003cem\\u003ePhytomedicine\\u003c/em\\u003e \\u003cstrong\\u003e147\\u003c/strong\\u003e, 157221 (2025). https://doi.org/10.1016/j.phymed.2025.157221\\u003c/li\\u003e\\n\\u003cli\\u003eTang, H.\\u003cem\\u003e et al.\\u003c/em\\u003e Hepatic transcriptome discloses the potential targets of Xuefu Zhuyu Decoction ameliorating non-alcoholic fatty liver disease induced by high-fat diet. \\u003cem\\u003eJ Tradit Complement Med\\u003c/em\\u003e \\u003cstrong\\u003e14\\u003c/strong\\u003e, 135\\u0026ndash;147 (2024). https://doi.org/10.1016/j.jtcme.2023.07.008\\u003c/li\\u003e\\n\\u003cli\\u003eGao, T.\\u003cem\\u003e et al.\\u003c/em\\u003e Buzhong Yiqi Decoction accelerates skeletal muscle regeneration. \\u003cem\\u003eActa Biochim Biophys Sin (Shanghai)\\u003c/em\\u003e \\u003cstrong\\u003e57\\u003c/strong\\u003e, 847\\u0026ndash;850 (2024). https://doi.org/10.3724/abbs.2024223\\u003c/li\\u003e\\n\\u003cli\\u003eZeng, Y., Zeng, H., Liu, X. \\u0026amp; Fan, T. Buzhong Yiqi decoction attenuates acquired myasthenia by regulating the JAK2/STAT3/AKT signaling pathway, inhibiting inflammation, and improving mitochondrial function. \\u003cem\\u003eAllergol Immunopathol (Madr)\\u003c/em\\u003e \\u003cstrong\\u003e52\\u003c/strong\\u003e, 59\\u0026ndash;64 (2024). https://doi.org/10.15586/aei.v52i5.1147\\u003c/li\\u003e\\n\\u003cli\\u003ePan, M.\\u003cem\\u003e et al.\\u003c/em\\u003e Shenling Baizhu powder alleviates non-alcoholic fatty liver disease by modulating autophagy and energy metabolism in high-fat diet-induced rats. \\u003cem\\u003ePhytomedicine\\u003c/em\\u003e \\u003cstrong\\u003e130\\u003c/strong\\u003e, 155712 (2024). https://doi.org/10.1016/j.phymed.2024.155712\\u003c/li\\u003e\\n\\u003cli\\u003eChen, D.\\u003cem\\u003e et al.\\u003c/em\\u003e Shenling Baizhu San ameliorates non-alcoholic fatty liver disease in mice by modulating gut microbiota and metabolites. \\u003cem\\u003eFront Pharmacol\\u003c/em\\u003e \\u003cstrong\\u003e15\\u003c/strong\\u003e, 1343755 (2024). https://doi.org/10.3389/fphar.2024.1343755\\u003c/li\\u003e\\n\\u003cli\\u003eYao, J. \\u0026amp; Xia, S. Exploring the role of traditional Chinese medicine in sarcopenia: mechanisms and therapeutic advances. \\u003cem\\u003eFront Pharmacol\\u003c/em\\u003e \\u003cstrong\\u003e16\\u003c/strong\\u003e, 1541373 (2025). https://doi.org/10.3389/fphar.2025.1541373\\u003c/li\\u003e\\n\\u003cli\\u003eBaumgartner, R. N.\\u003cem\\u003e et al.\\u003c/em\\u003e Epidemiology of sarcopenia among the elderly in New Mexico. \\u003cem\\u003eAm J Epidemiol\\u003c/em\\u003e \\u003cstrong\\u003e147\\u003c/strong\\u003e, 755\\u0026ndash;763 (1998). https://doi.org/10.1093/oxfordjournals.aje.a009520\\u003c/li\\u003e\\n\\u003cli\\u003eLosasso, M. R.\\u003cem\\u003e et al.\\u003c/em\\u003e Unraveling the Metabolic Pathways Between Metabolic-Associated Fatty Liver Disease (MAFLD) and Sarcopenia. \\u003cem\\u003eInt J Mol Sci\\u003c/em\\u003e \\u003cstrong\\u003e26\\u003c/strong\\u003e (2025). https://doi.org/10.3390/ijms26104673\\u003c/li\\u003e\\n\\u003cli\\u003eZhao, Q., Yin, Y. \\u0026amp; Deng, Y. Metabolic associated fatty liver disease and sarcopenia additively increase mortality: a real-world study. \\u003cem\\u003eNutr Diabetes\\u003c/em\\u003e \\u003cstrong\\u003e13\\u003c/strong\\u003e, 21 (2023). https://doi.org/10.1038/s41387-023-00250-6\\u003c/li\\u003e\\n\\u003cli\\u003eBali, T., Chrysavgis, L. \\u0026amp; Cholongitas, E. Metabolic-Associated Fatty Liver Disease and Sarcopenia. \\u003cem\\u003eEndocrinol Metab Clin North Am\\u003c/em\\u003e \\u003cstrong\\u003e52\\u003c/strong\\u003e, 497\\u0026ndash;508 (2023). https://doi.org/10.1016/j.ecl.2023.02.004\\u003c/li\\u003e\\n\\u003cli\\u003eYao, Z.\\u003cem\\u003e et al.\\u003c/em\\u003e Effects of Shenling Baizhu powder on intestinal microflora metabolites and liver mitochondrial energy metabolism in nonalcoholic fatty liver mice. \\u003cem\\u003eFront Microbiol\\u003c/em\\u003e \\u003cstrong\\u003e14\\u003c/strong\\u003e, 1147067 (2023). https://doi.org/10.3389/fmicb.2023.1147067\\u003c/li\\u003e\\n\\u003cli\\u003eMolina, T., Fabre, P. \\u0026amp; Dumont, N. A. Fibro-adipogenic progenitors in skeletal muscle homeostasis, regeneration and diseases. \\u003cem\\u003eOpen Biol\\u003c/em\\u003e \\u003cstrong\\u003e11\\u003c/strong\\u003e, 210110 (2021). https://doi.org/10.1098/rsob.210110\\u003c/li\\u003e\\n\\u003cli\\u003eLan, T.\\u003cem\\u003e et al.\\u003c/em\\u003e Si-Ni-San inhibits hepatic Fasn expression and lipid accumulation in MAFLD mice through AMPK/p300/SREBP-1c axis. \\u003cem\\u003ePhytomedicine\\u003c/em\\u003e \\u003cstrong\\u003e123\\u003c/strong\\u003e, 155209 (2024). https://doi.org/10.1016/j.phymed.2023.155209\\u003c/li\\u003e\\n\\u003cli\\u003eZheng, K.\\u003cem\\u003e et al.\\u003c/em\\u003e Rhizoma Atractylodis Macrocephalae reduces HFD-induced MAFLD in mice through activated AMPK-mediated inhibition of fatty acid synthesis. \\u003cem\\u003eLiver Res\\u003c/em\\u003e \\u003cstrong\\u003e9\\u003c/strong\\u003e, 157\\u0026ndash;168 (2025). https://doi.org/10.1016/j.livres.2025.04.004\\u003c/li\\u003e\\n\\u003cli\\u003eXia, Q.\\u003cem\\u003e et al.\\u003c/em\\u003e 6-Gingerol regulates triglyceride and cholesterol biosynthesis to improve hepatic steatosis in MAFLD by activating the AMPK-SREBPs signaling pathway. \\u003cem\\u003eBiomed Pharmacother\\u003c/em\\u003e \\u003cstrong\\u003e170\\u003c/strong\\u003e, 116060 (2024). https://doi.org/10.1016/j.biopha.2023.116060\\u003c/li\\u003e\\n\\u003cli\\u003eWang, D.\\u003cem\\u003e et al.\\u003c/em\\u003e Gui Qi Zhuang Jin Decoction ameliorates mitochondrial dysfunction in sarcopenia mice via AMPK/PGC-1\\u0026alpha;/Nrf2 axis revealed by a metabolomics approach. \\u003cem\\u003ePhytomedicine\\u003c/em\\u003e \\u003cstrong\\u003e133\\u003c/strong\\u003e, 155908 (2024). https://doi.org/10.1016/j.phymed.2024.155908\\u003c/li\\u003e\\n\\u003cli\\u003ePan, Z.\\u003cem\\u003e et al.\\u003c/em\\u003e Jianpi Qiangji Granule ameliorates aging-associated sarcopenia via AMPK/PGC-1\\u0026alpha; axis in SAMP8 mice. \\u003cem\\u003ePhytomedicine\\u003c/em\\u003e \\u003cstrong\\u003e148\\u003c/strong\\u003e, 157473 (2025). https://doi.org/10.1016/j.phymed.2025.157473\\u003c/li\\u003e\\n\\u003cli\\u003eKim, D. Y., Kang, Y. H. \\u0026amp; Kang, M. K. Umbelliferone attenuates diabetic sarcopenia by modulating mitochondrial quality and the ubiquitin-proteasome system. \\u003cem\\u003ePhytomedicine\\u003c/em\\u003e \\u003cstrong\\u003e144\\u003c/strong\\u003e, 156930 (2025). https://doi.org/10.1016/j.phymed.2025.156930\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"},{\"header\":\"Tables\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eTable 1. Primer sequences in the present study.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"568\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eGene\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ePrimer sequences (5’-3’)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eAMPKα\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eForward:\\u003c/strong\\u003e CCTTCGGCAAAGTGAAGATTGG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eReverse:\\u003c/strong\\u003e TCTTCAACCCTCCCGTGTTT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eCPT-1\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eForward:\\u003c/strong\\u003e TCCGGTTCAAGAATGGCATCA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eReverse:\\u003c/strong\\u003e CATTCGGCCAGTGGTGTCTA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eSREBP-1C\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eForward:\\u003c/strong\\u003e GAACCCTTCCTGGGAACACC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eReverse:\\u003c/strong\\u003e AGTGTGGCTGCAGTACAACG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eFAS\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eForward:\\u003c/strong\\u003e TGTCAGCCTGGTGAACGAAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eReverse:\\u003c/strong\\u003e CCACACGAGGTGCAGTGATA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eACC\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eForward:\\u003c/strong\\u003e ACATGAGGTCCAGCATGTCC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eReverse:\\u003c/strong\\u003e CCGCCATCTTAATGTATTCTGCAT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eFOXO1\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eForward:\\u003c/strong\\u003e GGCGGGCTGGAAGAATTCAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eReverse:\\u003c/strong\\u003e CGTCCTCGGCTCTTAGCAAAT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eMAFbx\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eForward:\\u003c/strong\\u003e GTGAGCGACCTCAGCAGTTA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eReverse:\\u003c/strong\\u003e CATGGCGCTCCTTAGTACTCC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eGAPDH\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eForward:\\u003c/strong\\u003e ACCCATCACCATCTTCCAGG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eReverse:\\u0026nbsp;\\u003c/strong\\u003eGACTGTGGTCATGAGCCCTT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 2. Comparison of body weight, gastrocnemius wet weight, and SI in rats at the 18\\u003csup\\u003eth\\u003c/sup\\u003e weekend(\\u003c/strong\\u003e\\u003cstrong\\u003e`\\u003c/strong\\u003e\\u003cstrong\\u003e\\u003cem\\u003ex\\u003c/em\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e±\\u003cem\\u003es\\u003c/em\\u003e, \\u003cem\\u003en\\u003c/em\\u003e=6\\u003c/strong\\u003e\\u003cstrong\\u003e）\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eGroups\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eBody weight (g)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eGastrocnemius wet weight (mg)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eSI\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e511.7 ± 15.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e3470.0 ± 285.4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e6.649 ± 0.387\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHFHS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e616.3 ± 29.2\\u003csup\\u003e***\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e3095.0 ± 312.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e5.012 ± 0.311\\u003csup\\u003e***\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 3. Comparison of body weight, gastrocnemius wet weight, and SI in rats at the 26\\u003csup\\u003eth\\u003c/sup\\u003e weekend (\\u003c/strong\\u003e\\u003cstrong\\u003e`\\u003c/strong\\u003e\\u003cstrong\\u003e\\u003cem\\u003ex\\u003c/em\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e±\\u003cem\\u003es\\u003c/em\\u003e, \\u003cem\\u003en\\u003c/em\\u003e=6\\u003c/strong\\u003e\\u003cstrong\\u003e）\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eGroups\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eBody weight (g)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eGastrocnemius wet weight (mg)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eSI\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e530.8 ± 11.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e3432.9 ± 132.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e6.467 ± 0.218\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHFHS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e505.8 ± 21.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e2872.9 ± 130.7\\u003csup\\u003e***\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e5.682 ± 0.194\\u003csup\\u003e***\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eSLBZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e633.8 ± 27.9\\u003csup\\u003e###\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e4218.7 ± 267.3\\u003csup\\u003e###\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e6.653 ± 0.234\\u003csup\\u003e###\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"npj-aging\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"\",\"sideBox\":\"Learn more about [npj Aging](https://www.nature.com/npjamd/)\",\"snPcode\":\"41514\",\"submissionUrl\":\"https://submission.springernature.com/new-submission/41514/3\",\"title\":\"npj Aging\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"NPJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"metabolic-associated fatty liver disease, sarcopenia, traditional Chinese medicine, Shenling Baizhu San, AMPK \",\"lastPublishedDoi\":\"10.21203/rs.3.rs-9439368/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-9439368/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cstrong\\u003eBackground and purpose:\\u003c/strong\\u003eMetabolic-associated fatty liver disease (MAFLD) complicated with sarcopenia (SP) is associated with increased mortality and represents a significant threat to human health. Shenling Baizhu San (SLBZS) has demonstrated therapeutic efficacy in both MAFLD and SP. However, the mechanisms underlying the effects of SLBZS in MAFLD complicated with SP remain unclear. In this study, we investigated the potential mechanisms of SLBZS in a rat model of MAFLD complicated with SP induced by a HFHS diet.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMethods: \\u003c/strong\\u003eA HFHS diet was used to establish a rat model of MAFLD complicated with SP, and SLBZS was administered as an intervention. General indicators, histopathological examination, and serum biochemical parameters were assessed to evaluate therapeutic effects. Transcriptomic analysis was subsequently performed to identify potential targets associated with treatment efficacy. Finally, the mRNA and protein expression levels of AMPKα and related genes in liver and gastrocnemius tissues were measured using RT-PCR and Western blot, respectively, to verify the central role of the AMPKα signaling pathway in SLBZS-mediated treatment.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eResults: \\u003c/strong\\u003eSLBZS significantly reduced hepatic ectopic lipid deposition, increased skeletal muscle mass and function, and decreased myosteatosis, thereby ameliorating MAFLD complicated with SP. The therapeutic effects of SLBZS were associated with activation of AMPKα in both liver and gastrocnemius muscle. In the liver, SLBZS regulated the expression of AMPKα and its downstream targets, including CPT-1, SREBP-1C, FAS and ACC, resulting in reduced lipogenesis and enhanced lipolysis. In the gastrocnemius muscle, SLBZS modulated the expression of AMPKα, CPT-1, SREBP-1C, FAS, ACC, FOXO1, and MAFbx, thereby reducing protein degradation and myosteatosis.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConclusion:\\u003c/strong\\u003e These results demonstrate that SLBZS effectively ameliorates HFHS diet-induced MAFLD complicated with SP by improving hepatic and skeletal muscle metabolism. SLBZS activates the AMPKα signaling pathway and regulates CPT-1, SREBP-1C, FAS, and ACC to reduce hepatic lipid accumulation. In skeletal muscle, SLBZS modulates CPT-1, SREBP-1C, FAS, ACC, FOXO1, and MAFbx via AMPKα signaling, thereby reducing myosteatosis and muscle proteolysis.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Shenling Baizhu San Ameliorates Metabolic-Associated Fatty Liver Disease Complicated with Sarcopenia via Regulating AMPKα Signaling\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-05-06 12:15:36\",\"doi\":\"10.21203/rs.3.rs-9439368/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2026-05-06T12:58:27+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-05-03T16:46:44+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-04-29T02:45:13+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"90394756502762379211089540219497414053\",\"date\":\"2026-04-28T01:52:06+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-04-28T01:48:12+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"285096422430705469849427310761462801936\",\"date\":\"2026-04-27T23:42:23+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"170929576267852951026706496293928601754\",\"date\":\"2026-04-27T23:07:20+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"327498180704794964927192208690981116361\",\"date\":\"2026-04-27T10:56:44+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2026-04-27T10:15:44+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2026-04-24T13:47:05+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2026-04-20T04:38:28+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"npj Aging\",\"date\":\"2026-04-16T14:11:18+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"npj-aging\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"\",\"sideBox\":\"Learn more about [npj Aging](https://www.nature.com/npjamd/)\",\"snPcode\":\"41514\",\"submissionUrl\":\"https://submission.springernature.com/new-submission/41514/3\",\"title\":\"npj Aging\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"NPJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"9513ecb8-d0d8-46b6-b2ba-4ab3c02ed392\",\"owner\":[],\"postedDate\":\"May 6th, 2026\",\"published\":true,\"recentEditorialEvents\":[{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2026-05-06T12:58:27+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-05-03T16:46:44+00:00\",\"index\":17,\"fulltext\":\"\"}],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"in-revision\",\"subjectAreas\":[{\"id\":67442280,\"name\":\"Biological sciences/Cell biology\"},{\"id\":67442281,\"name\":\"Health sciences/Diseases\"},{\"id\":67442282,\"name\":\"Health sciences/Medical research\"},{\"id\":67442283,\"name\":\"Biological sciences/Physiology\"}],\"tags\":[],\"updatedAt\":\"2026-05-06T13:10:57+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-05-06 12:15:36\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-9439368\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-9439368\",\"identity\":\"rs-9439368\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}