{"paper_id":"03ffca18-a710-461c-8044-42060a2d7168","body_text":"UNE Gene Family Analysis and Overexpression of UNE12 Enhances Salt Resistance in Brassica napus | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article UNE Gene Family Analysis and Overexpression of UNE12 Enhances Salt Resistance in Brassica napus Xiaolan Zhou, Fengwu Xie, Yilin Zhu, Shiwei Wang, Lili Liu, Rongkui Hui This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7238593/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Salt stress inhibits the growth, development, yield, and quality formation of the oilseed crop (rapeseed). This study identifies salt tolerance determinants within the UNE gene family of Brassica napus through integrated genomic and functional analyses. Genome-wide characterization revealed 21 BnUNE genes exhibiting structural diversification and parallel evolution with orthologs in Brassica rapa and Brassica oleracea, while core functional domains remained conserved. Phylogenetic analysis classified BnUNEs into 6 subclades with distinct motif architectures, intron/exon patterns, and predicted subcellular localization. Notably, subclade I members showed unique intron insertions and peroxisomal targeting, suggesting specialized roles in reactive oxygen species (ROS) metabolism and detoxification. Functional validation demonstrated that under 300 mM NaCl stress, transgenic lines BnUNE12-OE exhibited significantly enhanced salt tolerance compared to wild-type (WT) plants. The results that increased root length and fresh weight (37.2% and 29.8%), reduced the malondialdehyde (MDA) content (31.5%), elevated proline accumulation (2.3-fold), upregulated antioxidant genes (SOD1, CAT2). The study demonstrates that BnUNE12 significantly enhances salt stress tolerance in B. napus by synergistically regulating osmotic balance (promoting proline accumulation) and alleviating oxidative stress (enhancing ROS detoxification capacity). This work elucidated the adaptive evolution of the UNE gene family within the Brassica genus, and established BnUNE12 as a key molecular target for breeding salt tolerant rapeseed cultivars, providing a valuable genetic resource for molecular breeding of stress-resistant crops. Brassica napus UNE Bioinformatics analysis Gene overexpression Salt stress Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Key Message Genome-wide analysis identified 21 UNE members in Brassica napus . The overexpression of UNE12 alleviate membrane oxidative damage and regulate osmotic homeostasis, thereby enhancing the salt tolerance of plants. 1. Introduction Brassica napus (rapeseed), an allopolyploids species (2n=38, AACC) within the Brassicaceae family, serves as the second-largest source of edible oil globally, accounting for approximately 13-16% of the total production (Song et al. 2021). Its applications extend beyond edible oil production to include use as vegetables, animal feed, nectar sources, ornamental plants, and fertilizers (Raboanatahiry et al. 2021). Crucially, it contributes significantly to soil remediation, arable land expansion, and food security (Kniuipytė et al. 2023). B. napus originates from the interspecific hybridization between Brassica rapa (2n=20, AA) and Brassica oleracea (2n=18, CC), thereby emerging as a pivotal model organism for investigating interspecific evolutionary trajectories (Chalhoub et al. 2014). However, B. napus faces substantial yield and quality constraints due to its susceptibility to diverse abiotic and biotic stresses, including drought, salinity, insect pests, and heavy metal contamination (Neik et al. 2017; Hammac et al. 2017), which exert profound adverse effects on its growth, development, yield, and quality, thereby ultimately impeding the sustainable advancement of the B.napus industry. Accordingly, investigating the stress-specific gene expression profiles of B. napus under adverse conditions, enhancing its stress tolerance via biotechnological approaches, and further exploiting the utilization potential of B. napus are of crucial significance for meeting the global food production demands. Salinized land is expanding, posing a significant threat to agricultural productivity, with fragile and water-scarce ecosystems being disproportionately affected and a substantial portion of such salinized areas holding considerable potential for agricultural development(Wang et al. 2024). Salinity induces physiological drought, impairs soil structure (causing compaction and poor aeration), inhibits microbial activity, reduces fertility, and ultimately leads to significant crop yield losses, jeopardizing food security (Zhang, K et al.2019; Zhang, W et al. 2019). While tens of millions of hectares of saline-alkali land potentially suitable for B. napus cultivation, overwintering challenges persist in these cold, arid regions (Wu et al. 2019; Dai et al. 2024). Improving salt tolerance of B. napus for large-scale cultivation on such marginal land would not only utilize critical reserve arable resources but also significantly boost domestic rapeseed oil production, enhancing edible oil security and reducing import dependence. The basic helix-loop-helix (bHLH) transcription factor superfamily plays critical roles in plant biological processes. Characterized by a conserved DNA-binding basic region and a helix-loop-helix (HLH) dimerization domain, bHLH proteins regulate diverse processes including growth, development, stress responses, and metabolism (Zimmermann et al. 2004; Hao et al. 2021). Examples include Triticum aestivum bHLH39 ( TabHLH39 ), which significantly enhances the salt toleranceby modulating stress-responsive genes (Zhai et al. 2016), and Arabidopsis thaliana bHLH112 , which binds to E-box and GCG-box motifs to regulate the expression of genes associated with proline, peroxidase (POD), and superoxide dismutase (SOD), and consequently improving plant stress resistance (Sun et al. 2018). The haploid female gametophyte, alternatively termed the embryo sac, represents the fundamental reproductive unit in angiosperms, it differentiates within the ovule of the ovary and comprises an egg cell and a central cell(Skinner and Sundaresan 2018). As a pivotal tissue indispensable to plant reproduction, the embryo sac mediates the entire sexual reproduction whereby mature pollen grains discharged from the anther deposite on the pistil’s stigma, germinate, upon successful recognition, form a pollen tube that penetrates the ovule’s micropyle to reach the embryo sac, after whose rupture two male gametes are released, one fusing with the egg cell to generate a zygote that further develops into the embryo while the other unites with the two polar nuclei of the central cell to yield the primary endosperm nucleus that differentiates into endosperm, thus culminating in the completion of pollen fertilization (Johnson et al. 2019; Shivanna and Tandon 2020; Shin et al. 2021). Research on plant embryo sacs has predominantly focused on cell development, breeding, fertilization, and subsequent embryonic development processes. In contrast, studies integrating unfertilized embryo sacs ( UNEs ) with abiotic stresses remain exceedingly scarce. The A. thaliana UNE12 ( AtUNE12 ), a member of the bHLH superfamily, exhibits structural and functional features that not only adhere to familial commonalities but also display distinct regulatory modalities. It exerts an irreplaceable role in the growth regulation and environmental adaptation of A.thaliana . Related research facilitates the elucidation of intricate regulatory networks underlying plant life activities and offers a theoretical foundation for crop genetic improvement. While substantial advances have been achieved in research on AtUNE , investigations into the genetic evolution and functional characterization of B.napus UNE genes ( BnUNE ) in remain relatively limited. In the present study, bioinformatics approaches were utilized to identify members of the UNE gene family within the B. napus genome and its ancestral species ( B. rapa and B. oleracea ). The experiment of overexpressing UNE family member UNE12 under salt stress furnishes critical insights for further investigating the functions of UNE genes in B. napus growth and for the identification of salt-tolerant rapeseed germplasm. 2. Materials and Methods 2.1 Identification of members within the UNE gene family Protein sequence data and genome annotation files for B. napus (ZS11.v0) and B. rapa (ECD04.v0) were retrieved from the Brassica napus Information Resource (BnIR) website, whereas the corresponding files for B.oleracea and A.thaliana were acquired from the Ensembl database and TAIR, respectively (Yates et al. 2022; Yang et al. 2023; Reiser et al. 2024). Building on prior studies, the Hidden Markov Model (HMM) file (PF00010) corresponding to the conserved domain of UNE genes was downloaded from the InterPro database (Blum et al. 2025), and the HMM file (PTHR16223) specific to the UNE gene family was retrieved from the PANTHER database (Thomas et al. 2022). 2.2 Physicochemical properties analysis and phylogenetic tree construction The physicochemical properties of BnUNEs were predicted via ProtParam, an online tool within the Expasy suite(Wilkins et al. 1999). Sequence alignment of UNE gene family members was performed using the MUSCLE algorithm integrated in MEGA software. Subsequently, a phylogenetic tree was constructed based on the alignment results using the neighbor-joining (N-J) method, with bootstrap analysis configured for 1000 replications (Tamura et al. 2021). The generated phylogenetic tree was subjected to optimization and visualization using the online platform Chiplot (Xie et al. 2023). 2.3 Chromosome mapping and intragenomic collinearity analysis Chromosomal mapping and intragenomic collinearity analysis of B. napus were conducted using TBtools software, with gene distribution subjected to visualization (Chen et al. 2023). Furthermore, the Ka/Ks (nonsynonymous/synonymous substitution rate) ratios of BnUNE s were computed to assess the selection pressure exerted during the evolutionary process. 2.4 Analysis of conserved motifs, domains, and gene structures Protein sequences of UNE family members were submitted to the online MEME suite, with the number of motifs set to 20 for prediction (other parameters retained default values), yielding files in XML format (Bailey et al. 2015). Conserved domains of UNE family members were predicted via the CD-Search Tool within NCBI (Marchler-Bauer et al. 2011; Lu et al. 2022). Ultimately, an integrated visualization of motifs, domains, and gene structures was generated using TBtools. 2.5 Analysis of cis-acting regulatory elements in the promoter region In the present study, sequences 2000 bp upstream of BnUNE genes—corresponding to potential promoter regions—were retrieved from the B. napus genome using the Gff3 sequence extraction and Fasta extraction functions integrated in TBtools. Promoter sequences 2000 bp upstream of BnUNEs were extracted from genome annotation files. Subsequently, cis-acting element analysis of these sequences was performed using the online tool PlantCARE to predict cis-acting regulatory elements (CAREs) (Lescot et al. 2002). The results were visualized using TBtools. Identified CAREs were categorized based on their functional roles, with visualization of the outcomes conducted via the Advanced Gene Structure View function in TBtools. This comprehensive analysis advanced our understanding of the regulatory mechanisms governing BnUNE gene expression. 2.6 Interspecies collinearity analysis and subcellular localization prediction Prepared genome and genome annotation files were imported into TBtools, with analysis conducted using the One Step McScanX program. Following simplification processing, the results were visualized using the Multiple Synteny Plot program. Protein sequences of the UNE gene family were submitted to the WoLF PSORT server for prediction of subcellular localization (Horton et al. 2007). 2.7 Quantitative real-time PCR (qRT-PCR) analysis of BnUNE12 expression under salt stress conditions 。 B. napus cultivar J9707 (seeds provided by the Crop Research Institute, Hunan Academy of Agricultural Sciences) was used as the test material in this study. All hydroponic experiments were conducted in a greenhouse under the following growth conditions: temperature 23/25°C (day/night), photoperiod 16 h light/8 h dark, and relative humidity 50-60%. The housekeeping gene for qRT-PCR is BnaA01G0324400ZS. The 2 -ΔΔCt method was used to calculate the relative gene expression levels (Livak and Schmittgen 2001). 2.8 Investigation of Salt Tolerance through BnUNE12 Overexpression under Salt Stress To explore the association between the BnUNE12 gene (BnaA03G0270300ZS) and salt tolerance in B. napus , the pC2306 vector was linearized using KpnI and SalI as restriction sites, with the PCR product subjected to recovery (Fig. 8 A). The BnUNE12 gene was cloned using cDNA from J9707 as a template (Fig. 8 B), followed by ligation of the gene fragment into the linearized pC2306 vector. Subsequent PCR validation and sequencing confirmed the successful construction of the overexpression vector. Agrobacterium-mediated transformation of B. napus explants was performed to generate BnUNE12 overexpression plants. Total RNA was extracted from each BnUNE12 -OE line and reverse-transcribed into cDNA, and qRT-PCR was conducted to quantify the expression level of each line, thereby verifying the overexpression efficiency. 3. Results 3.1 Delineation of the phylogenetic trajectory of BnUNE family The hmmsearch program was employed to query both HMM profiles concurrently for the identification of candidate UNE genes within the B. napus proteome. An E-value cutoff of <0.01 was applied to intersect the search results, yielding 410 candidate members. Subsequently, using previously identified UNE protein sequences from A. thaliana as query sequences, a local BLASTP analysis was performed against these candidate genes, confirming 21 high-confidence UNE genes in B. napus . Application of the same methodology, identified 5, 10, and 9 UNE genes in A. thaliana , B. rapa , and B. oleracea , respectively.To elucidate the evolutionary relationships within the UNE gene family between B. napus and its ancestral species, A. thaliana was used as an outgroup to systematically identify orthologous UNE family members across the four genomes. A phylogenetic tree was subsequently constructed using the Chiplot platform (Fig. 1). Among the analyzed species, At UNE homologs exhibited the earliest evolutionary divergence, consistent with established species phylogeny.According to the U's triangle theory, which posits that B. napus originated from the natural hybridization between B. oleracea and B. rapa with genomic inheritance from both progenitors, Bn UNE genes clustered phylogenetically with their counterparts in B.rapa and B.oleracea . Furthermore, these genes occupied identical phylogenetic positions with comparable branch lengths, indicating a pattern of parallel evolution. This observation suggests that UNE genes underwent species-specific diversification: following the divergence of ancestral species into distinct lineages, accumulation of structural variations lead to partial functional specialization. Consequently, while core functions remain conserved, lineage-specific functions have emerged. Collectively, these analyses provide tangible insights into the evolutionary trajectories of the UNE gene family across species and lay the foundation for further investigations into the relationship between gene function and species adaptability. 3.2 Interpretation of protein conserved domains and gene structure Using the A. thaliana -containing clade as a reference, the UNE family was categorized into six subclades through the integration of phylogenetic tree topology, gene motifs, conserved domains, and gene structures (Fig. 1, 2). Subclade I comprises the largest number of members (13), which lack lineage-specific motifs. However, Bna_UNE12.4 and Bra_UNE12.4 acquired 4 and 2 introns, respectively, during evolution, leading to their structural homology with TRAPPC5_Trs31. TRAPP (transport protein particle) is a large, highly conserved multisubunit complex, with four types (I, II, III, and IV) identified in Saccharomyces cerevisiae, and Trs31, a conserved subunit of TRAPP complexes, plays a pivotal role in vesicle trafficking and autophagy (Zou et al. 2015).All members except Bna_UNE12.6 and Bo_UNE12.1 harbor Motifs 1, 2, 3, 4, and 5, implying that the bHLH domain is composed of one or more of these motifs—an assertion that requires further validation via investigations into the three-dimensional structures of these proteins. Notably, At_UNE12 is clustered in subclade VI, which contains 9 members. Following divergence from Arabidopsis, genes from the three Brassica species evolved to possess Motifs 12 and 16, whereas Bo_UNE12.1 exclusively acquired Motif 16 while losing Motifs 1, 5, and 13. 3.3 Protein physicochemical properties and predicting subcellular localization Data derived from ProtParam and WoLFPSORT were subjected to comprehensive summary and analysis (Table 1). The molecular weights of members across the four species ranged from 19.056 to 47.851 kDa. Subclade I exhibited the most pronounced variation in molecular weight, with the smallest member weighing 24.107 kDa and the largest reaching 47.851 kDa. In contrast, subclade III showed the least variation, with a maximum difference of merely 2.651 kDa. The overall variation in subclade VI did not exceed 1 kDa; however, Bo_UNE12.1 underwent a significant reduction in molecular weight (to 23.014 kDa) due to the loss of motifs 5, 13, and 1 during evolution. Regarding pI, 10 UNE family members were basic, while the remainder were acidic. Within subclade VI, all members except Bo_UNE12.1 exhibited acidic properties. This suggests that the C-terminus of UNE 12 is enriched in acidic amino acids, whereas the N-terminus contains a higher proportion of basic amino acids—an observation that explains the elevation in isoelectric point following the loss of C-terminal motifs. The aliphatic index of UNE family consistently exceeded 60, with some members reaching 80, indicating a high proportion of aliphatic amino acids and suggesting robust thermal stability. The Grand Average of Hydropathy (GRAVY) values reflected strong hydrophilicity. Collectively, these properties are consistent with the presence of a hydrophobic core within UNE proteins. Additionally, the instability index indicates that all UNE family are unstable protein, potentially due to the presence of specific degradation mechanisms or chaperone proteins that modulate their functional activity. WoLF PSORT analysis predicted that the majority of UNE gene family in B. napus are localized to the nucleus, with a subset residing in peroxisomes. The UNE gene family exerts primary functions in the nucleus, while peroxisomal members may participate in processes such as reactive oxygen species (ROS) metabolism and detoxification, fatty acid β-oxidation, and stress responses. Notably, all peroxisome-localized members belong to subclade I, signifying functional divergence within this subclade, with specialized roles in peroxisomes. Bo_UNE12.4 was uniquely predicted to be predominantly localized to chloroplasts. The presence of a signal sequence upstream of its start codon supports this prediction, and implies potential core functions may be associated with chloroplast-related physiological processes. However, the specific functions of Bo_UNE12.4 require experimental validation, including confirmation of its chloroplast localization and characterization of interacting protein networks. Table 1 Physicochemical properties and subcellular localization across A. thaliana , B. napus , and their ancestral species Sequence ID Rename Subclade AA Number MW/kDa Theoretical pI Instability Index Aliphatic Index GRAVY PSLP Bo2g028920.1 Bo_UNE12.9 Ⅰ 229 24.107 9.39 46.57 75.9 -0.459 nucl BnaA02T0114000ZS Bna_UNE12.2 Ⅰ 280 29.723 6.98 51.44 70.79 -0.524 nucl Bo3g018990.1 Bo_UNE12.6 Ⅰ 286 30.196 8.76 51.6 72.03 -0.452 pero BnaA10T0136900ZS Bna_UNE12.10 Ⅰ 289 30.289 5.88 48.92 72.35 -0.436 pero BnaC03T0125500ZS Bna_UNE12.15 Ⅰ 286 30.367 8.76 51.2 72.03 -0.477 pero BraA02t029661E Bra_UNE12.2 Ⅰ 293 31.179 6.32 49.77 67.99 -0.561 nucl AT5G58010.1 AT_UNE12.1 Ⅰ 297 31.470 5.79 50.15 70.37 -0.423 pero BnaC02T0139100ZS Bna_UNE12.13 Ⅰ 296 31.758 6.16 53.52 68.61 -0.62 nucl BraA10t046360E Bra_UNE12.9 Ⅰ 302 31.795 5.73 47.43 70.53 -0.46 pero Bo9g133640.1 Bo_UNE12.7 Ⅰ 331 35.229 6.41 46.94 66.71 -0.598 pero BnaC09T0412800ZS Bna_UNE12.21 Ⅰ 355 38.177 6.2 48.12 75.92 -0.391 pero BnaA03T0108600ZS Bna_UNE12.4 Ⅰ 418 45.263 8.64 43.59 86.32 -0.258 pero BraA03t008376E Bra_UNE12.4 Ⅰ 441 47.851 8.19 42.93 87.78 -0.197 pero BnaC01T0077700ZS Bna_UNE12.12 Ⅱ 327 34.579 6.3 52.93 67.77 -0.432 nucl Bo1g011740.1 Bo_UNE12.2 Ⅱ 327 34.579 6.3 52.93 67.77 -0.43 nucl BnaA01T0064700ZS Bna_UNE12.1 Ⅱ 327 34.591 6.3 52.35 68.96 -0.418 nucl BraA01t024441E Bra_UNE12.1 Ⅱ 327 34.591 6.3 52.09 68.96 -0.418 nucl AT4G30980.2 AT_UNE12.3 Ⅱ 358 38.582 9.02 57.56 63.55 -0.59 nucl BnaA04T0160400ZS Bna_UNE12.6 Ⅲ 326 34.232 6.45 50.17 59.94 -0.555 nucl BraA09t006007E Bra_UNE12.8 Ⅲ 339 35.743 6.45 57.2 66.81 -0.428 nucl Bo8g099910.1 Bo_UNE12.3 Ⅲ 340 35.786 6.3 55.43 67.74 -0.424 nucl BnaC08T0433700ZS Bna_UNE12.19 Ⅲ 340 35.831 6.16 53.32 68 -0.415 nucl BnaA09T0581100ZS Bna_UNE12.8 Ⅲ 344 36.229 6.45 57.62 68.37 -0.403 nucl AT2G24260.1 AT_UNE12.4 Ⅲ 350 36.522 6.36 46.94 68.89 -0.356 pero BnaC04T0455600ZS Bna_UNE12.17 Ⅲ 348 36.745 6.67 51.09 63.42 -0.509 nucl BraA04t043266E Bra_UNE12.6 Ⅲ 348 36.812 6.3 49.43 63.71 -0.52 nucl Bo4g154370.1 Bo_UNE12.8 Ⅲ 348 36.883 6.9 49.59 62.59 -0.541 nucl BnaC01T0310400ZS Bna_UNE12.11 Ⅳ 170 19.056 7.8 57.63 83.76 -0.414 nucl BnaC05T0017800ZS Bna_UNE12.18 Ⅳ 307 32.873 6.07 54.46 71.14 -0.432 nucl BnaA10T0015800ZS Bna_UNE12.9 Ⅳ 311 33.238 6.07 53.01 71.48 -0.423 nucl AT1G03040.3 AT_UNE12.2 Ⅳ 333 36.364 6.32 50.84 72.91 -0.459 nucl Bo5g003580.1 Bo_UNE12.4 Ⅳ 355 38.322 6.91 56.32 77.72 -0.379 chlo BnaA02T0255600ZS Bna_UNE12.3 Ⅴ 254 27.486 7.92 54.97 71.42 -0.485 nucl BraA02t031288E Bra_UNE12.3 Ⅴ 254 27.495 9.47 56.76 70.28 -0.475 nucl Bo2g100750.1 Bo_UNE12.5 Ⅴ 298 31.725 5.91 60.06 70.74 -0.413 nucl BnaC02T0344300ZS Bna_UNE12.14 Ⅴ 299 31.824 5.91 59.89 71.47 -0.398 nucl Bo9g005930.1 Bo_UNE12.1 Ⅵ 215 23.014 8.18 50.84 69.91 -0.493 nucl BnaC09T0011500ZS Bna_UNE12.20 Ⅵ 301 32.163 5.83 56.04 68.74 -0.492 nucl BnaA09T0026700ZS Bna_UNE12.7 Ⅵ 304 32.391 5.83 54.99 69.01 -0.475 nucl BraA09t000195E Bra_UNE12.7 Ⅵ 304 32.407 5.83 54.32 68.68 -0.484 nucl BnaC03T0324600ZS Bna_UNE12.16 Ⅵ 304 32.446 6.25 57.76 69.97 -0.445 nucl Bo01031s030.1 Bo_UNE12.10 Ⅵ 307 32.747 6.31 58.55 69.28 -0.454 nucl BraA03t010069E Bra_UNE12.5 Ⅵ 308 32.747 6.07 57.69 71.27 -0.412 nucl BnaA03T0270300ZS Bna_UNE12.5 Ⅵ 310 32.861 6.07 59.02 69.55 -0.43 nucl AT4G02590.1 AT_UNE12 Ⅵ 310 33.105 5.92 49.09 68.29 -0.488 nucl Abbreviation AA:Animo Acid; MW:Molecular Weight; GRAVY: Grand Average of Hydropathy; PSLP: Protein Subcellular Localization Prediction 3.4 Analysis of the CAREs in the promoter regions of B. napus 16 major CAREs were identified in the UNE family of B. napus , encompassing a substantial number of light-responsive elements (247) and other cis-elements, including anaerobic induction (66), MeJA-responsiveness (60), Abscisic acid responsive element (ABRE, 44), Low-temperature responsiveness (LTR, 29), Gibberellin responsive element (GRE, 21), and Salicylic acid responsive element (SARE, 16) (Fig. 3). These elements suggest that UNE genes are pivotal in plant growth and development, stress responses, and hormone regulation. The abundance of light-responsive CAREs such as G-box, TCT-motif implies a potential role for the UNE gene family in regulating photosynthesis-related pathways in B. napus . The G-box element can interact with light-induced transcriptional activators to modulate genes involved in chloroplast development and light energy utilization. This functional association aligns with its requirement for photosynthate accumulation in B. napus as a key oilseed crop (Toledo-Ortiz et al. 2014). Stress-related CAREs indicate that the UNE gene family employs diverse regulatory mechanisms in response to complex environmental stresses. Specifically, 66 anaerobic induction elements suggest that activation of certain UNE genes under root hypoxia stress, potentially maintaining cellular viability through regulation of glucose metabolism or energy metabolism. Additionally, 29 LTR elements implicate potential involvement of UNE genes in regulating cold adaptation, possibly acting synergistically with genes responsible for the synthesis of antifreeze proteins or osmotic. Notably, 44 ABREs suggest that ABA—a central stress signaling molecule—may drive UNE gene expression through the activation of its regulatory pathway. This ABA-mediated response could enhance cellular osmotic adjustment capacity (e.g., proline accumulation) and antioxidant enzyme activities (e.g., SOD, POD). This mechanism appears evolutionarily conserved, mirroring observations in A. thaliana where At UNE 12 enhances salt tolerance via activation of the SOS pathway. The identification of 60 MeJA-responsive elements and 21 GRE elements indicates potential integration of jasmonic acid (JA) and auxin (IAA) signaling pathways by the UNE gene family, Such integration may contribute to the balancing defense responses with growth and development in B. napus . JA signaling is frequently associated with plant insect and disease resistance (Campos et al. 2014), while, auxin-responsive elements may implicate UNE genes in embryonic development or organ morphogenesis. Furthermore, 16 SARE elements expand the potential regulatory network of UNE genes. As Salicylic acid (SA) is a pivotal signaling molecule in systemic acquired resistance (SAR), these elements suggest involvement of UNE genes in B. napus immune defense. Specifically, they may modulate the expression of pathogenesis-related protein genes during pathogen infection, thereby enhancing resistance (Tripathi et al. 2019; Han et al. 2022). Collectively, the co-occurrence of these multi-hormone responsive elements indicates that the UNE gene family likely integrates multiple signaling pathways to form a sophisticated gene regulatory network. This integrated system likely enables B. napus to address diverse physiological demands across different growth stages and environmental conditions. 3.5 Explanation of the chromosomal mapping and collinearity of the BnUNE s Deciphering the B. napus genome annotation file revealed that UNE gene family members are distributed across merely 6 chromosomes in the A subgenome and 7 chromosomes in the C subgenome (Fig. 4). Intraspecific synteny analysis demonstrated that these genes undergo segmental duplications on chromosomes, with no tandem duplications observed. Brassicaceae plants have experienced multiple whole-genome duplication (WGD) events, including γ, α, and β triplications. The segmental duplications within the UNE gene family are highly likely to have originated from these ancient WGD events, thereby resulting in the formation of interchromosomal syntenic copies (Ferreira de Carvalho et al. 2019; Das Laha et al. 2020)(Fig. 5). Chromosomal segmental duplications may also contribute to the amplification of UNE genes, resulting in the formation of syntenic homologous genes between non-homologous chromosomes. Ka/Ks data reveal that the UNE gene family has undergone purifying selection during evolution (SI Table 1). Synteny analysis between B. napus and its ancestral species indicates that chromosomes of the three species contain numerous syntenic blocks of the UNE gene family. This suggests that the UNE gene family in B. napus and its homologous genes in B. rapa and B. oleracea had established stable genomic distributions in their ancestral species, which were not subjected to large-scale rearrangements during allopolyploidization (Fig. 6). 3.6 Interprete the expression of BnUNE12 under salt stress. Based on BLAST results, the gene with the highest hit scores ( Bna_UNE12.5 , hereafter renamed BnUNE12 ) was selected for interpreting expression under salt stress. To investigate whether BnUNE12 functions similarly, leaf samples were collected from B. napus plants treated with 300 mM NaCl at seven time points within a 24-hour period for RNA extraction and subsequent quantification of BnUNE12 expression levels.The expression level displayed minimal variation from 0h to 1 h of salt stress, began to increase at 3 h, peaked at 6 h, decreased at 12 h but remained higher than that at 3 h, and continued to decline at 24 h to a level comparable to that at 3 h. Consequently, BnUNE12 expression was time-dependent following NaCl treatment, with the maximal induction occurring at 6 h (Fig. 7).These results demonstrate that treatment with 300 mM NaCl induces BnUNE12 expression, characterized by dynamic changes in expression levels over time. The 6 h time point represents the critical for peak salt stress-induced expression of this gene. Although transcript levels subsequently declined, they remained relatively elevated. Collectively, these findings indicate that a potential role for BnUNE12 in the B. napus salt stress response pathway. 3.7 Preliminary functional validation of BnUNE12 in salt tolerance 3.7.1 Construct overexpression BnUNE12 lines To further validate the involvement of BnUNE12 in plant responses to salt stress, dual restriction enzyme sites (KpnI and SalI) were used to introduce the designed primers into the vector pC2306, thereby constructing BnUNE12 overexpression lines (Fig. 8A, B). The forward primer sequence is ATGGCTAGTAACAACAACCCGC, and the reverse primer sequence is CTGTGGAGGAGGATTAGTCTCTGG. Quantification of BnUNE12 expression levels in transgenic lines (Fig. 8C) revealed significantly elevated expression in three independent overexpression lines ( BnUNE12 -OE1, -OE2, and -OE3) compared to the wild-type (WT) J9707. The expression levels reached approximately 2.8–3.9 times that of WT. These results confirm successful generation of BnUNE12 overexpression lines, providing essential materials for subsequent functional characterization. 3.7.2 Regulatory effects of BnUNE12 on root length and fresh weight Salt stress primarily impacts plants at the root level, where morphological alterations reflect stress responses. Root length and root fresh weight were quantified in WT and BnUNE12 -OE lines pre- and post- salt treatment. Under normal conditions, BnUNE12 -OE lines exhibited significantly reduced root length and fresh weight compared to WT (Fig. 9A, D, E), indicating that BnUNE12 overexpression constrains root development in B. napus . Following 300 mM NaCl treatment, root length difference between WT and transgenic lines were eliminated. This convergence suggests severe salt-induced inhibition of root apical meristem activity and elongation zone expansion in WT plants, arresting primary root growth and suppressed lateral root development. BnUNE12 -OE overexpression substantially mitigated these pathological manifestations. Furthermore, the significant difference ( P <0.05) in the fresh weight of the underground part between WT and BnUNE12 -OE lines vanished after salt treatment. This indicated that BnUNE12 -OE lines exhibit a certain tolerance to NaCl, and overexpression of BnUNE12 enhances salt tolerance in B. napus roots. Shoot phenotypes provided complementary evidence that NaCl treatment induced leaf yellowing and wilting across all lines, with symptoms markedly more severe in WT (Fig. 9A). Transgenic lines BnUNE12 -OE1 and -OE3 maintained significantly higher ( P <0.05) shoot fresh weight than WT under stress, despite BnUNE12 -OE2 showing reduced biomass under normal conditions (Fig. 9C). Whole-plant fresh weight analysis confirmed enhanced salt tolerance in transgenics, with no genotype difference under control conditions but significantly greater ( P <0.05) biomass in BnUNE12 -OE lines following salt stress (Fig. 9B). These phenotypic analyses demonstrate that BnUNE12 overexpression confers NaCl tolerance in B. napus . Notably, the observed root growth reduction and biomass decrease under normal conditions reflect a trade-off between growth and stress resistance. Analysis of CAREs revealed that the promoter region of BnUNE12 harbors abundant growth- and development-related elements as well as stress-responsive elements, collectively underscoring its pivotal role in mediating plant growth, development, and stress responses. Overexpression of BnUNE12 —characterized by a significant reduction in root length and a concomitant decrease in plant biomass—reflects a prioritization of stress resistance over growth in balancing these two physiological processes.This phenotypic observation, integrated with functional insights derived from CAREs analysis, indicates that utilizing the UNE12 gene for crop stress resistance breeding requires careful consideration of its dual impacts on growth performance and stress tolerance. The ultimate objective is to achieve a dynamic equilibrium between these traits through optimization of gene expression regulatory strategies. 3.7.3 BnUNE12 -mediated protection of membrane integrity Unsaturated fatty acids within cellular membrane systems incur lipid peroxidation upon exposure to stimuli such as oxidative stress, whereas malondialdehyde (MDA)—a key end product of lipid peroxidation—displays a positive correlation between its production levels and the extent of lipid peroxidation (Tsikas 2017). Upon membrane system damage, lipid peroxidation is exacerbated, leading to the excessive production of MDA. Consequently, MDA content quantification can indirectly reflect the extent of lipid peroxidation-induced damage in membrane systems and further assess impairments to membrane structure and function.Under normal growth conditions, MDA levels in WT plants were ~56.7% higher than in BnUNE12 -OE1 and ~87.3% higher than in BnUNE12 -OE3, with no significant difference relative to BnUNE12 -OE2 (Fig. 10A). The highest MDA levels in WT indicated a relatively elevated lipid peroxidation status in J9707 cells under basal physiological conditions, likely due to inherent genetic traits. In contrast, MDA levels in BnUNE12 -OE1 and BnUNE12 -OE3 were significantly lower than in WT. Following exposure to 300 mM NaCl, MDA levels increased across all lines: WT exhibited a 249% increase, while BnUNE12 -OE1, BnUNE12 -OE2, and BnUNE12 -OE3 showed increases of ~145%, 77.5%, and ~148.7%, respectively (Fig. 10A). The drastic elevation of MDA in WT upon salt stress indicated that salt stress severely disrupted intracellular redox homeostasis, triggering extensive lipid peroxidation. Although NaCl stress induced membrane damage in BnUNE12 -overexpressing lines, the impairment was significantly attenuated ( P <0.001) relative to WT. These results demonstrate that BnUNE12 overexpression enhances cellular tolerance to salt stress by mitigating membrane lipid peroxidation in B. napus . This protective mechanism may be evolutionarily conserved with At UNE 12 in A. thaliana , which alleviates salt stress through regulating ROS-related gene expression. Further investigation is warranted to characterize the interaction between BnUNE12 and its target gene promoters. 3.7.4 Role of BnUNE12 in regulating proline accumulation Salt stress disrupt the osmotic homeostasis between the intracellular and extracellular compartments in plant cells, impairing physiological processes. As a key cellular osmolyte, proline mitigates salt-induced damage. When WT and BnUNE12 -OE plants were cultivated under control conditions, the proline content in WT was marginally higher than that in BnUNE12 -OE lines, though this difference did not reach statistical significance (Fig.10B). Following 300 mM NaCl treatment, both genotypes displayed characteristic accumulation in response to abiotic stress. However, significant variations emerged in both accumulation magnitude and final proline concentrations: salt-stressed WT accumulates approximately 1.69- to 1.87-fold more proline than BnUNE12 -OE lines (Fig. 10B). While proline accumulation facilitates the modulation of osmotic potential in plants, its magnitude depends on stress intensity and duration, with higher levels not necessarily indicating superior tolerance. The elevated proline in WT may reflect compensatory biosynthesis to counteract severe cellular damage, whereas the significantly reduced accumulation in BnUNE12 -OE lines suggests alternative protective mechanisms. This pattern indicates that BnUNE12 overexpression alleviate salt stress through regulatory pathway that reduce dependence on massive proline accumulation for osmotic homeostasis. 3.7.5 Expression Analysis of BnUNE12 -OE and ROS-related Genes To identify the potential targets of BnUNE12 regulation, two canonical ROS-associated genes, Superoxide Dismutase 1 ( SOD1 ) and Catalase 2 ( CAT2 ), were selected for expression analysis. Under control conditions, SOD1 expression remained low across all genotypes, with no significant differences observed despite marginally higher levels in BnUNE12 -OE1 (Fig. 11A). Following exposure to 300 mM NaCl, SOD1 expression was upregulated in all lines. Notably, the relative SOD1 expression in BnUNE12 -OE3 was significantly higher than that in the J9707 ( P <0.05), while BnUNE12 -OE1 showed elevated but non-significant induction. This salt-dependent modulation indicates BnUNE12 influences SOD1 expression, with particularly pronounced effect in BnUNE1 2-OE3. For CAT2 , basal expression was uniformly low across genotypes under normal conditions (Fig. 11B). Salt stress significantly induced CAT2 expression in both WT and BnUNE12 -OE lines. Although no statistically significant inter-genotypic differences were detected despite subtle variations among individual lines. These findings suggest that SOD1 and CAT2 are likely not primary transcriptional targets of BnUNE12 . Their regulation may involve cooperative interactions with other transcription factors (e.g., MYB family proteins). Future investigation of BnUNE12 ’s interplay with additional ROS-responsive genes is warranted to elucidate its precise mechanisms in mitigates membrane damage. 4. Discussion The bHLH transcription factor superfamily represents the most structurally diverse class of regulatory proteins, characterized by a conserved bHLH domain that enables homo/heterodimerization and sequence-specific binding to E-box motifs (CANNTG) and other CAREs, allowing spatiotemporal control of gene expression profiles critical for developmental patterning and stress adaptation (Michael et al. 2023; Schneider et al.2023; Ning et al. 2025). The extraordinary diversity within the bHLH family enables its members to orchestrate a vast array of biological processes. In plants, this structurally versatile family has expanded into hundreds of members, forming intricate transcriptional regulatory networks—such as the canonical MYB-bHLH complex—that coordinate cellular differentiation and environmental responses (Qian et al. 2021). Leveraging this regulatory complexity, bHLH has emerged as key targets for improving stress resilience and optimize agronomic traits through precision breeding. Soil salinization impairs soil aeration and elevates osmotic potential, which in turn inhibits root growth, reduces the capacity of plants to absorb water and nutrients, and may even lead to physiological drought and subsequent wilting or death due to excessive osmotic stress (Munns et al. 2020; Abdalla et al. 2022; Liu et al. 2023). Soil salinization-induced accumulation of high-concentration salt ions can be taken up by plants, perturbing cellular metabolic homeostasis, inhibiting growth, and reducing crop yield and quality (Singh et al. 2022; Zhou et al. 2024). These constraints significantly challenge breeding by increasing costs and hindering sustainable agriculture. The bHLH family is integral to the orchestration of salt-stress tolerance in plants. A bHLH, designated NtbHLH123 , occupies a critical cis-regulatory position immediately upstream of the respiratory burst oxidase homolog (Rboh) NtRbohE in Nicotiana tabacum , acting as a molecular rheostat to modulates the Rboh-dependent signaling circuitry that underpins systemic salinity responses, ultimately potentiating cellular resilience and organismal fitness under high-salt conditions (Liu et al. 2021), CabHLH035 integrates ionic homeostasis and proline metabolism in Capsicum annuum (Zhang et al. 2022), AhbHLH21 directly occupies canonical G/E-box motifs within the promoters of AhPOD , AhCAT , and AhSOD , transcriptionally amplifying the antioxidant enzymatic repertoire and potentiating cellular redox buffering in Arachis hypogaea under salt stress (Zhao et al. 2024). Despite these advances, most bHLH members remain functionally uncharacterized due to the superfamily's extraordinary and diversity. Within the bHLH superfamily, the UNE clade has emerged as a pivotal regulator of both developmental programming and environmental adaptation. Functional studies of AtUNE12 and Populus alba×Populus glandulosa PagUNE12 revealing distinct molecular paradigms, AtUNE12 undergoes stimulus-dependent phosphorylation, enabling its high-affinity binding to G-box (CACGTG) and LTR15 (CCGAC) cis-motifs, activating a suite of ion-transport genes that restrict Na⁺ influx while sustaining K⁺ homeostasis, concomitantly, AtUNE12 directly up-regulates AtMYB61 , a key determinant of stomatal aperture, thereby reducing transpirational water loss and consolidating salt tolerance (He et al. 2022), During secondary growth, PagUNE12 orchestrates lignin polymerization by trans-activating laccase genes LAC40 and LAC49 together with class III peroxidases PER3 and PER6 , promoting guaiacyl-type lignin deposition, thereby dictating the mechanical architecture and physicochemical properties of wood. (Zhao et al. 2013;Song et al. 2023). B. napus holds a pivotal position in global food security and agricultural development, but its growth and yield are increasingly constrained by abiotic stresses, particularly soil salinity. Phylogenomic analysis positioned BnUNE paralogues as sister lineages to orthologs in progenitor species B. rapa and B. oleracea , consistent with B. napus ' allopolyploid origin. Topological relationships indicate lineage-specific structural rearrangements and functional specialization following speciation, with retention of ancestral functions alongside species-specific innovations. These findings not only illuminate the evolutionary history of UNE genes during Brassica divergence but also underscore the imperative of functionally dissecting this family in B. napus . Integrative analyses of the UNE gene family reveal pronounced diversification and intricate regulatory circuitry. The family resolves into six well-supported subclades (I–VI) that differ markedly in motif assemblages and intronic landscapes. Subclade I members exhibit intron insertions that engender pronounced structural variants. PSLP indicate a peroxisomal bias for several subclade I proteins, implying that these splice variants may modulate ROS metabolism and detoxification (Corpas 2019). Promoter scanning further expands our understanding of the UNE transcriptional network. An abundance of light-responsive elements (e.g., G-box, I-box) suggests that UNE genes are deeply integrated into photosynthetic regulation, facilitating efficient solar-energy capture and its subsequent conversion into storage lipids in B. napus . Stress-responsive motifs, including (LTR) and ABRE elements, implicate UNE genes in the mitigation of salinity, cold and other abiotic constraints. The presence of ABRE motifs, hallmarks of ABA-dependent signaling, points to enhanced osmotic adjustment and antioxidant capacity (Fujita et al. 2005; Yu et al. 2020). Additionally, hormone-responsive elements such as MeJA-responsiveness and GRE motifs reveal that UNE genes are capable of integrating jasmonate, auxin and other phytohormonal pathways to balance defense responses with developmental programs. Collectively, the convergence of multiple signaling cascades within UNE promoters underscores a sophisticated regulatory architecture that enables B. napus to simultaneously optimize growth and withstand diverse environmental challenges. BnUNE12 exhibited the highest sequence similarity to AtUNE12 , therefore hypothesized to perform comparable salinity-tolerance. Time-course quantitative PCR revealed that BnUNE12 may trigger a resource reallocation in which growth is temporarily sacrificed to fortify protective mechanisms, thereby enhancing salinity tolerance. Salt stress perturbs cellular redox homeostasis, resulting in the excessive accumulation of ROS that subsequently compromise membrane integrity and cellular function (Hasanuzzaman et al. 2021; Wani et al. 2021). Moreover, salinity disrupts cellular osmotic equilibrium, thereby impairing metabolic fluxes and physiological processes, cells accumulate large amounts of the compatible solute proline to re-establish homeostasis, which enhances water uptake from the apoplast and sustains turgor pressure, preserving cellular integrity and normal function under hyperosmotic stress (de Freitas et al. 2019; Hosseinifard et al. 2022). Accordingly, the relationship between BnUNE12 and salinity tolerance can be interrogated through two complementary physiological lenses: membrane integrity and osmolyte accumulation. Under non-stress conditions, transgenic lines over-expressing BnUNE12 consistently exhibit lower MDA contents than WT plants, indicating that BnUNE12 attenuates basal lipid peroxidation and fortifies membrane stability even in the absence of external stress. Following exposure to salt stress, MDA levels rise in all genotypes. The WT registers the sharpest increase, whereas BnUNE12 -overexpressing lines show a significantly moderated increment ( P <0.001). This provide compelling evidence that BnUNE12 mitigates salt-induced membrane oxidative damage, thereby preserving cellular integrity under hyperosmotic challenge. Salt stress experiments demonstrated that BnUNE12-overexpressing lines significantly reduced ( P <0.001) proline accumulation, which indirectly reflects that salt stress was notably alleviated ( P <0.001). In the current study, no significant differences were observed in the expression levels of ROS-associated genes SOD1 and CAT2 between WT and BnUNE12 -OE lines following salt treatment, implying that the impact of BnUNE12 overexpression on SOD1 and CAT2 expression may involve intricate intrinsic mechanisms. A partial regulatory network involving UNE genes and the potential regulatory mechanism by which BnUNE12 alleviates salt stress, which vividly delineates the rationale underlying this study (Fig. 12). Numerous CAREs distributed in the upstream regions of promoters within the UNE gene family are subject to modulation by hormone and environment, while sub-calde Ⅰ members potentially mitigate ROS accumulation which can induce excessive peroxidation of membranes, impairing its barrier integrity, and in turn trigger the SOS signaling as well as elicit the de novo synthesis of large amounts of proline to maintain osmotic homeostasis, ultimately enhancing cellular tolerance to salt stress (Mahajan et al. 2008). Rboh, belonging to the NADPH oxidase family, function in concert with the ROS scavenging system to regulate ROS homeostasis and thus attenuate oxidative damage (Chapman et al. 2019). Among these, RbohE is predominantly expressed in plant roots, and AtUNE12 has been demonstrated to enhance plant salt tolerance through the RbohE-mediated signaling, a mechanism supported by phylogenetic analyses revealing a high degree of structural conservation between BnUNE12 and AtUNE12 and by overexpression assays further corroborating their functional orthology, collectively suggesting that the RbohE signaling represents one of the conserved mechanisms by which UNE12 confers salt stress alleviation.The ABA regulatory network, which is indispensable for plant adaptive responses to environmental stresses, not only activates the Rboh pathway and modulates stomatal dynamics to mitigate salt stress but also facilitates the transcription of target genes (e.g., UNE ) via CAREs, thereby orchestrating multiple regulatory cascades that collectively counteract salt stress. 5. Conclusion This study characterized the UNE gene family in B. napus . Through in-depth bioinformatic analyses, 21 BnUNE genes were identified from the B. napus genome, which exhibit a close evolutionary relationship with their orthologs in the ancestral species B. rapa and B. oleracea , displaying a pattern of parallel evolution. During speciation, these genes underwent structural variations and functional specialization, retaining core functionalities while acquiring species-specific adaptations. The UNE family was classified into 6 subclades, showing significant divergence in motif composition, intron distribution, and subcellular localization; notably, certain members of subclade I, due to unique intron insertion events, tend to localize in peroxisomes, implying their potential critical roles in ROS metabolism and detoxification. The BnUNE12 gene was found to be significantly upregulated under salt stress; overexpression lines of BnUNE12 , when subjected to 300 mM NaCl treatment, exhibited superior performance compared to controls in biomass traits (root length, fresh weight), membrane lipid peroxidation, proline accumulation, and expression of antioxidant-related genes. These findings demonstrate that BnUNE12 enhances salt tolerance in B. napus by precisely modulating osmotic adjustment and oxidative stress responses, providing valuable genetic resources and a robust theoretical foundation for improving salt tolerance in B. napus and advancing stress-resistant molecular breeding. Future investigations into other UNE genes and integrated multi-omics approaches will further elucidate the role of this gene family in B. napus growth, development, and stress responses, contributing to the sustainable development of the rapeseed industry. Declarations FUNDING A project supported by Hunan Provincial Natural Science Foundation of China (2023JJ30266), Research Project on teaching reform in Hunan province (HNJG-2022-0791), Rapeseed Industry Germplasm Innovation Project of Hunan Provincial Department of Agriculture (HARS-03). COMPLIANCE WITH ETHICAL STANDARDS This article does not contain any studies with human participants performed by any of the authors. CONFLICT OF INTEREST The authors declare that they have no conflicts of interest. AUTHOR CONTRIBUTIONS Conceptualization, X.Z. and L.L.; methodology, F.X. and L.L.; software, F.X. and X.Z.; validation, X.Z., F.X. and Y.Z; formal analysis, F.X. and Y.Z.; investigation, X.Z., F.X., Y.Z. and S.W. ; resources, L.L. and S.H.; data curation, Y.Z.; writing—original draft preparation, X.Z. and F.X.; writing—review and editing, L.L. and R.H.; visualization, X.Z. and S.H.; supervision, L.L.; project administration, X.Z. and S.H.; funding acquisition, X.Z. L.L. and S.H. All authors have read and agreed to the published version of the manuscript. DATA AVAILABILITY The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request. References Abdalla M, Ahmed MA, Cai G, Zarebanadkauki M, Carminati A. (2022). Coupled effects of soil drying and salinity on soil-plant hydraulics. Plant physiology , 190 (2), 1228–1241. https://doi.org/10.1093/plphys/kiac229 Bailey TL, Johnson J, Grant CE, Noble WS. (2015). The MEME Suite. Nucleic acids research, 43(W1),W39–W49. https://doi.org/10.1093/nar/gkv416 Blum M, Andreeva A, Florentino LC, Chuguransky SR, Grego T, Hobbs E, Pinto BL, Orr A, Paysan-Lafosse T, Ponamareva I, Salazar GA, Bordin N, Bork P, Bridge A, Colwell L, Gough J, Haft DH, Letunic I, Llinares-López F, Marchler-Bauer A, … Bateman A. (2025). InterPro: the protein sequence classification resource in 2025. Nucleic acids research , 53(D1), D444 D456. https://doi.org/10.1093/nar/gkae1082 Campos ML, Kang JH, Howe GA. Jasmonate-Triggered Plant Immunity. J Chem Ecol 40, 657–675 (2014). https://doi.org/10.1007/s10886-014-0468-3 Chalhoub B, Denoeud F, Liu S, Parkin IA, Tang H, Wang X, Chiquet J, Belcram H, Tong C, Samans B, Corréa M, Da Silva C, Just J, Falentin C, Koh CS, Le Clainche I, Bernard M, Bento P, Noel B, Labadie K, … Wincker P. (2014). Plant genetics. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome. Science (New York, N.Y.) , 345 (6199), 950–953. https://doi.org/10.1126/science.1253435 Chapman JM, Muhlemann JK, Gayomba SR, Muday GK. (2019). RBOH-Dependent ROS Synthesis and ROS Scavenging by Plant Specialized Metabolites To Modulate Plant Development and Stress Responses. Chemical research in toxicology, 32(3), 370–396. https://doi.org/10.1021/acs.chemrestox.9b00028 Chen C, Wu Y, Li J, Wang X, Zeng Z, Xu J, Liu Y, Feng J, Chen H, He Y, Xia R. (2023). TBtools-II: A \"one for all, all for one\" bioinformatics platform for biological big-data mining. Molecular plant , 16(11), 1733–1742. https://doi.org/10.1016/j.molp.2023.09.010 Corpas FJ. (2019). Peroxisomes in higher plants: an example of metabolic adaptability. Botany Letters , 166 (3), 298–308. https://doi.org/10.1080/23818107.2019.1619196 Dai R, Zhan N, Geng R, Xu K, Zhou X, Li L, Yan G, Zhou F, Cai G. (2024). Progress on Salt Tolerance in Brassica napus . Plants , 13 (14), 1990. https://doi.org/10.3390/plants13141990 Das Laha S, Dutta S, Schäffner AR, Das M. (2020). Gene duplication and stress genomics in Brassicas: Current understanding and future prospects. Journal of plant physiology , 255 , 153293. https://doi.org/10.1016/j.jplph.2020.153293 de Freitas PAF, de Carvalho HH, Costa JH, Miranda RS, Saraiva KDDC, de Oliveira FDB, Coelho DG, Prisco JT, Gomes-Filho E. (2019). Salt acclimation in sorghum plants by exogenous proline: physiological and biochemical changes and regulation of proline metabolism. Plant cell reports , 38 (3), 403–416. https://doi.org/10.1007/s00299-019-02382-5 Ferreira de Carvalho J, Lucas J, Deniot G, Falentin C, Filangi O, Gilet M, Legeai F, Lode M, Morice J, Trotoux G, Aury JM, Barbe V, Keller J, Snowdon R, He Z, Denoeud F, Wincker P, Bancroft I, Chèvre AM, Rousseau-Gueutin M. (2019). Cytonuclear interactions remain stable during allopolyploid evolution despite repeated whole-genome duplications in Brassica. The Plant journal : for cell and molecular biology , 98 (3), 434–447. https://doi.org/10.1111/tpj.14228 Fujita Y, Fujita M, Satoh R, Maruyama K, Parvez MM, Seki M, Hiratsu K, Ohme-Takagi M, Shinozaki K, Yamaguchi-Shinozaki K. (2005). AREB1 is a transcription activator of novel ABRE-dependent ABA signaling that enhances drought stress tolerance in Arabidopsis. The Plant cell , 17 (12), 3470–3488. https://doi.org/10.1105/tpc.105.035659 Han Q, Tan W, Zhao Y, Yang F, Yao X, Lin H, Zhang D. (2022). Salicylic acid-activated BIN2 phosphorylation of TGA3 promotes Arabidopsis PR gene expression and disease resistance. The EMBO journal , 41 (19), e110682. https://doi.org/10.15252/embj.2022110682 Hao Y, Zong X, Ren P, Qian Y, Fu A. (2021). Basic Helix-Loop-Helix (bHLH) Transcription Factors Regulate a Wide Range of Functions in Arabidopsis . International Journal of Molecular Sciences, 22 (13), 7152. https://doi.org/10.3390/ijms22137152 Hasanuzzaman M, Raihan MRH, Masud AAC, Rahman K, Nowroz F, Rahman M, Nahar K, Fujita M. (2021). Regulation of Reactive Oxygen Species and Antioxidant Defense in Plants under Salinity. International journal of molecular sciences , 22 (17), 9326. https://doi.org/10.3390/ijms22179326 Hammac WA, Maaz TM, Koenig RT, Burke IC, Pan WL. (2017). Water and Temperature Stresses Impact Canola (Brassica napus L.) Fatty Acid, Protein, and Yield over Nitrogen and Sulfur. Journal of agricultural and food chemistry , 65 (48), 10429–10438. https://doi.org/10.1021/acs.jafc.7b02778 He Z, Wang Z, Nie X, Qu M, Zhao H, Ji X, Wang Y. (2022). UNFERTILIZED EMBRYO SAC 12 phosphorylation plays a crucial role in conferring salt tolerance. Plant physiology , 188 (2), 1385–1401. https://doi.org/10.1093/plphys/kiab549 Horton P, Park KJ, Obayashi T, Fujita N, Harada H, Adams-Collier CJ, Nakai K. (2007). WoLF PSORT: protein localization predictor. Nucleic acids research , 35 (Web Server issue), W585–W587. https://doi.org/10.1093/nar/gkm259 Hosseinifard M, Stefaniak S, Ghorbani Javid M, Soltani E, Wojtyla L, Garnczarska M. (2022). Contribution of Exogenous Proline to Abiotic Stresses Tolerance in Plants: A Review. International journal of molecular sciences , 23 (9), 5186. https://doi.org/10.3390/ijms23095186 Johnson M. A, Harper JF, Palanivelu R. (2019). A Fruitful Journey: Pollen Tube Navigation from Germination to Fertilization. Annual review of plant biology , 70 , 809–837. https://doi.org/10.1146/annurev-arplant-050718-100133 Kniuipyte I, Dikšaityte A, Praspaliauskas M, Pedišius N, Žaltauskaite J. (2023). Oilseed rape (Brassica napus L.) potential to remediate Cd contaminated soil under different soil water content. Journal of environmental management , 325(Pt A), 116627. https://doi.org/10.1016/j.jenvman.2022.116627 Lescot M, Déhais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rouzé P, Rombauts S. (2002). PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic acids research , 30(1),325–327. https://doi.org/10.1093/nar/30.1.325 Li, D, Li YY, Zhou ZC, Xiang X, Liu X, Wang J, Hu ZR, Xiang SP, Li W, Xiao QZ, Wang Y, Hu RS, Zhao Q. (2021). Tobacco transcription factor bHLH123 improves salt tolerance by activating NADPH oxidase NtRbohE expression. Plant physiology , 186 (3), 1706–1720. https://doi.org/10.1093/plphys/kiab176 Liu Y, Wang F, Zhang,A, Chen Z, Luo X, Kong D, Zhang F, Yu X, Liu G, Luo L. (2023). Improvement of Salinity Tolerance in Water-Saving and Drought-Resistance Rice (WDR). International journal of molecular sciences , 24 (6), 5444. https://doi.org/10.3390/ijms24065444 Livak KJ, Schmittgen TD. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif.) , 25 (4), 402–408. https://doi.org/10.1006/meth.2001.1262 Lu S, Wang J, Chitsaz F, Derbyshire MK, Geer RC, Gonzales NR, Gwadz M, Hurwitz DI, Marchler GH, Song JS, Thanki N, Yamashita RA, Yang M, Zhang D, Zheng C, Lanczycki CJ, Marchler-Bauer A. (2020). CDD/SPARCLE: the conserved domain database in 2020. Nucleic acids research , 48 (D1), D265–D268. https://doi.org/10.1093/nar/gkz991 Mahajan S, Pandey GK, Tuteja N. (2008). Calcium- and salt-stress signaling in plants: shedding light on SOS pathway. Archives of biochemistry and biophysics , 471 (2), 146–158. https://doi.org/10.1016/j.abb.2008.01.010 Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, Fong JH, Geer LY, Geer RC, Gonzales NR, Gwadz M, Hurwitz DI, Jackson JD, Ke Z, Lanczycki CJ, Lu F, Marchler GH, Mullokandov M, Omelchenko MV, Robertson CL, … Bryant SH. (2011). CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic acids research , 39 (Database issue), D225–D229. https://doi.org/10.1093/nar/gkq1189 Michael AK, Stoos L, Crosby P, Eggers N, Nie XY, Makasheva K, Minnich M, Healy KL, Weiss J, Kempf G, Cavadini S, Kater L, Seebacher J, Vecchia L, Chakraborty D, Isbel L, Grand RS, Andersch F, Fribourgh JL, Schübeler D, … Thomä NH. (2023). Cooperation between bHLH transcription factors and histones for DNA access. Nature , 619 (7969), 385–393. https://doi.org/10.1038/s41586-023-06282-3 Munns R, Passioura JB, Colmer TD, Byrt CS. (2020). Osmotic adjustment and energy limitations to plant growth in saline soil. The New phytologist , 225 (3), 1091–1096. https://doi.org/10.1111/nph.15862 Neik TX, Barbetti MJ, Batley J. (2017). Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus . Frontiers in plant science , 8 , 1788. https://doi.org/10.3389/fpls.2017.01788 Ning M, Li Q, Wang Y, Li Q, Tao Y, Zhang F, Hu F, Huang L. (2025). Alternative splicing drives the functional diversification of a bHLH transcription factor in the control of growth and drought tolerance in rice. Science bulletin , 70 (2), 153–156. https://doi.org/10.1016/j.scib.2024.06.001 Postiglione AE, Muday GK. (2020). The Role of ROS Homeostasis in ABA-Induced Guard Cell Signaling. Frontiers in plant science , 11 , 968. https://doi.org/10.3389/fpls.2020.00968 Qian Y, Zhang T, Yu Y, Gou L, Yang J, Xu J, Pi E. (2021). Regulatory Mechanisms of bHLH Transcription Factors in Plant Adaptive Responses to Various Abiotic Stresses. Frontiers in plant science , 12 , 677611. https://doi.org/10.3389/fpls.2021.677611 Raboanatahiry N, Li H, Yu L, Li M. (2021). B.napus ( Brassica napus ): Processing, Utilization, and Genetic Improvement. Agronomy , 11 (9), 1776. https://doi.org/10.3390/agronomy11091776 Reiser L, Bakker E, Subramaniam S, Chen X, Sawant S, Khosa K, Prithvi T, Berardini TZ. (2024). The Arabidopsis Information Resource in 2024. Genetics , 227 (1), iyae027. https://doi.org/10.1093/genetics/iyae027 Schneider HM, Lor VS, Zhang X, Saengwilai P, Hanlon MT, Klein S. P, Davis JL, Borkar AN, Depew CL, Bennett MJ, Kaeppler SM, Brown KM, Bhosale R, Lynch JP. (2023). Transcription factor bHLH121 regulates root cortical aerenchyma formation in maize. Proceedings of the National Academy of Sciences of the United States of America , 120 (12), e2219668120. https://doi.org/10.1073/pnas.2219668120 Sharipova G, Ivanov R, Veselov D, Akhiyarova G, Seldimirova O, Galin I, Fricke W, Vysotskaya L, Kudoyarova G. (2022). Effect of Salinity on Stomatal Conductance, Leaf Hydraulic Conductance, HvPIP2 Aquaporin, and Abscisic Acid Abundance in Barley Leaf Cells. International journal of molecular sciences , 23 (22), 14282. https://doi.org/10.3390/ijms232214282 Shin JM, Yuan L, Ohme-Takagi M, Kawashima T. (2021). Cellular dynamics of double fertilization and early embryogenesis in flowering plants. Journal of experimental zoology. Part B, Molecular and developmental evolution , 336 (8), 642–651. https://doi.org/10.1002/jez.b.22981 Shivanna KR, Tandon R. (2020). Developmental biology of dispersed pollen grains. The International journal of developmental biology , 64 (1-2-3), 7–19. https://doi.org/10.1387/ijdb.190166ks Singh, A.K, Singh, R.P, Singh, S, Rathore, S.S. (2022). Crop Adaptability to Excess Salt. In: Ansari SA, Ansari MI, Husen A. (eds) Augmenting Crop Productivity in Stress Environment . Springer, Singapore. https://doi.org/10.1007/978-981-16-6361-1_11 Skinner DJ, Sundaresan V. (2018). Recent advances in understanding female gametophyte development. F1000Research , 7 , F1000 Faculty Rev-804. https://doi.org/10.12688/f1000research.14508.1 Song C, Guo Y, Shen W, Yao X, Xu H, Zhao Y, Li R, Lin J. (2023). Pag UNE 12 encodes a basic helix-loop-helix transcription factor that regulates the development of secondary vascular tissue in poplar. Plant physiology , 192(2), 1046–1062. https://doi.org/10.1093/plphys/kiad152 Song JM, Liu DX, Xie WZ, Yang Z, Guo L, Liu K, Yang QY, Chen LL. (2021). BnPIR: Brassica napus pan-genome information resource for 1689 accessions. Plant biotechnology journal , 19 (3), 412–414. https://doi.org/10.1111/pbi.13491 Sun X, Wang Y, Sui N. (2018). Transcriptional regulation of bHLH during plant response to stress. Biochemical and biophysical research communications , 503 (2), 397–401. https://doi.org/10.1016/j.bbrc.2018.07.123 Tamura K, Stecher G, Kumar S. (2021). MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Molecular biology and evolution , 38(7), 3022 3027. https://doi.org/10.1093/molbev/msab120 Thomas PD, Ebert D, Muruganujan A, Mushayahama T, Albou LP, Mi H. (2022). PANTHER: Making genome-scale phylogenetics accessible to all. Protein science : a publication of the Protein Society , 31 (1), 8–22. https://doi.org/10.1002/pro.4218 Toledo-Ortiz G, Johansson H, Lee KP, Bou-Torrent J, Stewart K, Steel G, Rodríguez-Concepción M, Halliday KJ. (2014). The HY5-PIF regulatory module coordinates light and temperature control of photosynthetic gene transcription. PLoS genetics , 10 (6), e1004416. https://doi.org/10.1371/journal.pgen.1004416 Tripathi D, Raikhy G, Kumar D. (2019). Chemical elicitors of systemic acquired resistance—Salicylic acid and its functional analogs. Current Plant Biology, 17 , 48-59. https://doi.org/10.1016/j.cpb.2019.03.002 Tsikas D. (2017). Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: Analytical and biological challenges. Analytical biochemistry , 524 , 13–30. https://doi.org/10.1016/j.ab.2016.10.021 Wang GZ, Ni G, Feng G, Burrill HM, Li J, Zhang J, Zhang F. (2024). Saline-alkali soil reclamation and utilization in China: progress and prospects. Frontiers of Agricultural Science and Engineering, 11 (2), 216-228. https://doi.org/10.15302/J-FASE-2024551 Wani KI, Naeem M, Castroverde CDM, Kalaji HM, Albaqami M, Aftab T. (2021). Molecular Mechanisms of Nitric Oxide (NO) Signaling and Reactive Oxygen Species (ROS) Homeostasis during Abiotic Stresses in Plants. International journal of molecular sciences , 22 (17), 9656. https://doi.org/10.3390/ijms22179656 Wilkins MR, Gasteiger E, Bairoch A, Sanchez JC, Williams KL, Appel RD, Hochstrasser DF. (1999). Protein identification and analysis tools in the ExPASy server. Methods in molecular biology (Clifton, N.J.) , 112 , 531–552. https://doi.org/10.1385/1-59259-584-7:531 Wu H, Guo J, Wang C, Li K, Zhang X, Yang Z, Li M, Wang B. (2019). An Effective Screening Method and a Reliable Screening Trait for Salt Tolerance of Brassica napus at the Germination Stage. Frontiers in plant science , 10 , 530. https://doi.org/10.3389/fpls.2019.00530 Xie J, Chen Y, Cai G, Cai R, Hu Z, Wang H. (2023). Tree Visualization By One Table (tvBOT): a web application for visualizing, modifying and annotating phylogenetic trees. Nucleic acids research , 51(W1), W587–W592. https://doi.org/10.1093/nar/gkad359 Yang Z, Wang S, Wei L, Huang Y, Liu D, Jia Y, Luo C, Lin Y, Liang C, Hu Y, Dai C, Guo L, Zhou Y, Yang QY. (2023). BnIR: A multi-om ics database with various tools for Brassica napus research and breeding. Molecular plant , 16(4), 775 789. https://doi.org/10.1016/j.molp.2023.03.007 Yates, A. D., Allen, J., Amode, R. M., Azov, A. G., Barba, M., Becerra, A., Bhai, J., Campbell, L. I., Carbajo Martinez, M., Chakiachvili, M., Chougule, K., Christensen, M., Contreras-Moreira, B., Cuzick, A., Da Rin Fioretto, L., Davis, P., De Silva, N. H., Diamantakis, S., Dyer, S., Elser, J., … Flicek, P. (2022). Ensembl Genomes 2022: an expanding genome resource for non-vertebrates. Nucleic acids research , 50 (D1), D996–D1003. https://doi.org/10.1093/nar/gkab1007 Yu J, Cang J, Lu Q, Fan B, Xu Q, Li W, Wang X. (2020). ABA enhanced cold tolerance of wheat 'dn1' via increasing ROS scavenging system. Plant signaling & behavior , 15 (8), 1780403. https://doi.org/10.1080/15592324.2020.1780403 Zhai Y, Zhang L, Xia C, Fu S, Zhao G, Jia J, Kong X. (2016). The wheat transcription factor, TabHLH39, improves tolerance to multiple abiotic stressors in transgenic plants. Biochemical and biophysical research communications , 473 (4), 1321–1327. https://doi.org/10.1016/j.bbrc.2016.04.071 Zhang H, Guo J, Chen X, Zhou Y, Pei Y, Chen L, Ul Haq S, Lu M, Gong H, Chen R. (2022). Pepper bHLH transcription factor CabHLH035 contributes to salt tolerance by modulating ion homeostasis and proline biosynthesis. Horticulture research , 9 , uhac203. https://doi.org/10.1093/hr/uhac203 Zhang K, Shi Y, Cui X, Yue P, Li K, Liu X, Tripathi BM, Chu H. (2019). Salinity Is a Key Determinant for Soil Microbial Communities in a Desert Ecosystem. mSystems , 4 (1), e00225-18. https://doi.org/10.1128/mSystems.00225-18 Zhang WW, Wang C, Xue R, Wang LJ. (2019). Effects of salinity on the soil microbial community and soil fertility. Journal of Integrative Agriculture , 18(6), 1360–1368. https://doi.org/10.1016/S2095-3119(18)62077-5 Zhao Q, Nakashima J, Chen F, Yin Y, Fu C, Yun J, Shao H, Wang X, Wang ZY, Dixon RA. (2013). Laccase is necessary and nonredundant with peroxidase for lignin polymerization during vascular development in Arabidopsis. The Plant cell , 25 (10), 3976–3987. https://doi.org/10.1105/tpc.113.117770 Zhao X, Wang Q, Yan C, Sun Q, Wang J, Li C, Yuan C, Mou,Y, Shan S. (2024). The bHLH transcription factor AhbHLH121 improves salt tolerance in peanut. International journal of biological macromolecules , 256 (Pt 2), 128492. https://doi.org/10.1016/j.ijbiomac.2023.128492 Zhou H, Shi H, Yang Y, Feng X, Chen X, Xiao F, Lin H, Guo Y. (2024). Insights into plant salt stress signaling and tolerance. Journal of genetics and genomics = Yi chuan xue bao , 51 (1), 16–34. https://doi.org/10.1016/j.jgg.2023.08.007 Zimmermann I. M Heim MA, Weisshaar B, Uhrig JF. (2004). Comprehensive identification of Arabidopsis thaliana MYB transcription factors interacting with R/B-like BHLH proteins. The Plant Journal, 40 (2), 22–34. https://doi.org/10.1111/j.1365-313X.2004.02183.x Zou S, Liu Y, Zhang C, Yu S, Liang Y. (2015). Bet3 participates in autophagy through GTPase Ypt1 in Saccharomyces cerevisiae. Cell biology international , 39 (4), 466–474. https://doi.org/10.1002/cbin.10416 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-7238593\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":503690268,\"identity\":\"fe7fe75c-a573-4c06-9304-0f3ed741f424\",\"order_by\":0,\"name\":\"Xiaolan Zhou\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hunan University of Science and Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaolan\",\"middleName\":\"\",\"lastName\":\"Zhou\",\"suffix\":\"\"},{\"id\":503690269,\"identity\":\"d0b15967-5cb9-4a8c-a087-cf26fab44894\",\"order_by\":1,\"name\":\"Fengwu Xie\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hunan University of Science and Technology School of Life Science\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Fengwu\",\"middleName\":\"\",\"lastName\":\"Xie\",\"suffix\":\"\"},{\"id\":503690270,\"identity\":\"4aa0205a-4da2-429c-b595-edeffacb894f\",\"order_by\":2,\"name\":\"Yilin Zhu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hunan University of Science and Technology School of Life Science\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yilin\",\"middleName\":\"\",\"lastName\":\"Zhu\",\"suffix\":\"\"},{\"id\":503690271,\"identity\":\"e3b0b8f5-0170-41f4-a1cb-8662c9a104d3\",\"order_by\":3,\"name\":\"Shiwei Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Central South University of Forestry and Technology School of Life Science and Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shiwei\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":503690272,\"identity\":\"fc359bc5-5b21-4b5b-b935-f9ba39e4e011\",\"order_by\":4,\"name\":\"Lili Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hunan University of Science and Technology School of Life Science\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Lili\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":503690273,\"identity\":\"9e162929-c554-400d-ae1b-0223feba47fc\",\"order_by\":5,\"name\":\"Rongkui Hui\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4UlEQVRIiWNgGAWjYBACAwbGBgjNzJD8IKFCQk6eFC3PDB6csTA2bCCoBU4zPpB82FaRyHCAgBZzieS2Dx931BobHGdOMEicJ5HA2MD88NENPFosZyQ2z5x55riZwWG2hAeJ2yTy2BnYjI1z8DnsRmIzM2/bMRuDwzxAW7ZJFDM28LBJE6mF/4NE4hyJxIYDxGmpATqMIQGonhgtZx42M85sO2AseZghzSDhmISxYTMhvxxPf8zwsa3OsO/8geSHP2rq5OTZmx8+xqcFCg4jsZkJKweBOuKUjYJRMApGwcgEAPHgT8w93L4GAAAAAElFTkSuQmCC\",\"orcid\":\"https://orcid.org/0009-0003-2458-635X\",\"institution\":\"Hunan Academy of Agricultural Sciences\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Rongkui\",\"middleName\":\"\",\"lastName\":\"Hui\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-07-29 03:41:56\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-7238593/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-7238593/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":90161255,\"identity\":\"e978af0e-b84d-4199-b3ad-63e036529b28\",\"added_by\":\"auto\",\"created_at\":\"2025-08-29 09:12:34\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":774828,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePhylogenetic tree of \\u003cem\\u003eA. thaliana\\u003c/em\\u003e, \\u003cem\\u003eB. napus\\u003c/em\\u003e, and its ancestral species. The four species were clustered into 6 subclades, each of which was assigned a distinct color for differentiation: subclade Ⅰ (blue), subclade Ⅱ (yellow), subclade Ⅲ (green), subclade Ⅳ (red), subclade Ⅴ (cyan), and subclade Ⅵ (purple).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7238593/v1/06f7ba1f997822da1feec1fc.png\"},{\"id\":90160378,\"identity\":\"945ee46b-550b-4bd6-9598-e8290d5898a3\",\"added_by\":\"auto\",\"created_at\":\"2025-08-29 09:04:35\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":370763,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eIntegrated visualization of the phylogenetic tree, conserved motifs, protein domains, and gene structures of \\u003cem\\u003eA. thaliana\\u003c/em\\u003e, \\u003cem\\u003eB. napus\\u003c/em\\u003e, and its ancestral species. The right-hand legend is partitioned into three sections: the uppermost section differentiates conserved motifs of the \\u003cem\\u003eUNE\\u003c/em\\u003e family; the middle section denotes distinct domains of the family's proteins; the lowermost section represents discrete components of the family's gene structures\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7238593/v1/7c56a0425a5833455078dbd8.png\"},{\"id\":90160355,\"identity\":\"aa303b71-2bab-4af4-9c0b-d32785a8e67a\",\"added_by\":\"auto\",\"created_at\":\"2025-08-29 09:04:35\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":258976,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCAREs of the \\u003cem\\u003eUNE\\u003c/em\\u003e family in \\u003cem\\u003eB. napus\\u003c/em\\u003e. Each tile denotes the 20 bp region at the C-terminus of the CARE, serving to indicate the termination position of the element; Tile colors are used to differentiate between distinct CAREs; Definitions of elements are as follows: ARE: Auxin responsive element; LTR: Low-temperature responsiveness; SARE: Salicylic acid responsive element; ABRE: Abscisic acid responsive element; GRE: Gibberellin responsive element; MRE: MYB binding site involved in light responsiveness; MBS: MYB binding site associated with drought inducibility. MBSI: MYB binding site involved in flavonoid biosynthetic genes regulation\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7238593/v1/8ba22600d5c7f17b295de305.png\"},{\"id\":90160341,\"identity\":\"f4657dbf-6c5d-4b87-8dcc-7dcf9072f4cb\",\"added_by\":\"auto\",\"created_at\":\"2025-08-29 09:04:34\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":207088,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eChromosomal localization and syntenic genes of \\u003cem\\u003eBnUNE\\u003c/em\\u003e family. \\u003cem\\u003eUNE\\u003c/em\\u003egenes are not present in all chromosomes of \\u003cem\\u003eB. napus\\u003c/em\\u003e; furthermore, these genes exclusively exhibit segmental duplications, with no tandem duplications observed\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7238593/v1/f8a37c9a66e92d2c5a8f5068.png\"},{\"id\":90161258,\"identity\":\"5439efe7-f9c7-4885-a241-a986cd544ae3\",\"added_by\":\"auto\",\"created_at\":\"2025-08-29 09:12:35\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":488794,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eIntraspecific synteny analysis of \\u003cem\\u003eB. napus\\u003c/em\\u003e. A01–A10 denote chromosome designations of the A subgenome, and C01–C09 denote those of the C subgenome. Red wavy lines represent gene density of the corresponding chromosomes, with lower gene density observed closer to the inner circle. Colors of gene IDs correspond to those of chromosomal blocks: purple represents the A subgenome, and blue indicates the C subgenome\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7238593/v1/2eb7af06b9a7da8f73d5003d.png\"},{\"id\":90161268,\"identity\":\"f1bc7fd6-fba4-4c0b-9475-89eab906e6f1\",\"added_by\":\"auto\",\"created_at\":\"2025-08-29 09:12:36\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":325895,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eChromosomal synteny analysis between \\u003cem\\u003eB. napus\\u003c/em\\u003e and its ancestral species. Red lines represent syntenic gene pairs; \\u003cem\\u003eB. rapa\\u003c/em\\u003e chromosomes are depicted in blue,\\u003cem\\u003eB. napus\\u003c/em\\u003e chromosomes in green, and \\u003cem\\u003eB. oleracea\\u003c/em\\u003e chromosomes in black\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7238593/v1/46bd95a13363d5145c2d03c4.png\"},{\"id\":90160350,\"identity\":\"b555d467-c8ef-4f0d-8403-e39faee2827a\",\"added_by\":\"auto\",\"created_at\":\"2025-08-29 09:04:35\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":60006,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eTime-course \\u003cem\\u003eBnUNE12\\u003c/em\\u003e expression level in \\u003cem\\u003eB. napus\\u003c/em\\u003e under salt stress\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7238593/v1/19fad097a8f5537718845319.png\"},{\"id\":90160386,\"identity\":\"2f2eaa75-e83c-4407-b12d-18a1cbf7a9e6\",\"added_by\":\"auto\",\"created_at\":\"2025-08-29 09:04:36\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":186471,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eConstruction of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e overexpression vector. A: pCAMBIA2306 vector map and electrophoretic map of restriction site; B: \\u003cem\\u003eBnUNE12\\u003c/em\\u003e gene clone; C: The overexpression effect of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE. *: \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05; **: \\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.01; ***: \\u003cem\\u003eP \\u003c/em\\u003e\\u0026lt; 0.001; unlabeled * indicates no significant difference,\\u003cem\\u003e P\\u003c/em\\u003e \\u0026gt; 0.05\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7238593/v1/a006f7273d3b0a741879e130.png\"},{\"id\":90161260,\"identity\":\"4b98af04-6511-4f0a-9c79-94d3cc4c4a87\",\"added_by\":\"auto\",\"created_at\":\"2025-08-29 09:12:35\",\"extension\":\"png\",\"order_by\":9,\"title\":\"Figure 9\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":750165,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eOverexpression of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e enhanced salt tolerance in \\u003cem\\u003eB. napus\\u003c/em\\u003e. A: Phenotypic comparison between WT and \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-overexpressing lines under salt stress conditions; B: Total fresh weight of WT and \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE lines; C: Shoot fresh weight of WT and \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE lines; D: Root fresh weight of WT and \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE lines; E: Root length of WT and \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE lines. *: \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05; **: \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01; ***: \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.001; unlabeled * indicates no significant difference, \\u003cem\\u003eP\\u003c/em\\u003e \\u0026gt; 0.05\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image9.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7238593/v1/14ee2703213e57ad85c20f12.png\"},{\"id\":90161257,\"identity\":\"219dbedf-73f6-48bc-a779-a7fc9115bc6b\",\"added_by\":\"auto\",\"created_at\":\"2025-08-29 09:12:35\",\"extension\":\"png\",\"order_by\":10,\"title\":\"Figure 10\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":792848,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eOrganic osmotic regulation of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE lines under salt stress. A: The effect of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e on MDA content under salt stress; B: The effect of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e on proline content under salt stress. *: \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05; **:\\u003cem\\u003e P\\u003c/em\\u003e \\u0026lt; 0.01; ***: \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.001; unlabeled * indicates no significant difference, \\u003cem\\u003eP \\u003c/em\\u003e\\u0026gt; 0.05\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image10.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7238593/v1/9e836c9945450e644cb17d30.png\"},{\"id\":90160358,\"identity\":\"b9c164d4-614e-474b-a04e-0cfddfc00b8b\",\"added_by\":\"auto\",\"created_at\":\"2025-08-29 09:04:35\",\"extension\":\"png\",\"order_by\":11,\"title\":\"Figure 11\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":658113,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eROS-related genes expression level in \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE line. A: Relative expression level of \\u003cem\\u003eSOD1\\u003c/em\\u003e in WT and \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE; B: Relative expression level of \\u003cem\\u003eCAT2\\u003c/em\\u003e in WT and \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE. *: \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05; **: \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01; ***: \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.001; unlabeled * indicates no significant difference,\\u003cem\\u003eP\\u003c/em\\u003e \\u0026gt; 0.05\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image11.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7238593/v1/58b30df79deb49eeea5d719e.png\"},{\"id\":90161275,\"identity\":\"fb636e21-1ccb-465f-af51-129650b760c5\",\"added_by\":\"auto\",\"created_at\":\"2025-08-29 09:12:36\",\"extension\":\"png\",\"order_by\":12,\"title\":\"Figure 12\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":106157,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSchematic illustration of factors regulating the \\u003cem\\u003eUNE\\u003c/em\\u003e family and potential mechanisms by which this family participates in salt stress responses. Dark green blocks indicate the \\u003cem\\u003eUNE\\u003c/em\\u003efamily; green arrows denote promotion or progression to the next step; red lines signify inhibition of the subsequent process; purple boxes refer to specific intracellular substances; black boxes correspond to exogenous signals perceived by cells; blue boxes represent intracellular physiological processes; the letter \\\"P\\\" in the orange ellipse stands for phosphorylation; and peroxisomes are indicated by yellow boxes (Mahajan et al. 2008; Tsikas 2017; Chapman et al. 2019; Postiglione and Muday 2020; Liu et al. 2021; He et al. 2022; Sharipova et al. 2022; Zhang et al. 2022; Zhao et al.2024)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image12.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7238593/v1/6e9f5f42539cc5878d1702e7.png\"},{\"id\":97135658,\"identity\":\"25fbcfa2-ba3c-4815-afcb-754e7513a992\",\"added_by\":\"auto\",\"created_at\":\"2025-12-01 09:52:28\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":6097052,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7238593/v1/7a3dc4aa-7b4d-4435-8b7b-85409c9c5fa9.pdf\"}],\"financialInterests\":\"\",\"formattedTitle\":\"UNE Gene Family Analysis and Overexpression of UNE12 Enhances Salt Resistance in Brassica napus\",\"fulltext\":[{\"header\":\"Key Message\",\"content\":\"\\u003cp\\u003eGenome-wide analysis identified 21 \\u003cem\\u003eUNE\\u003c/em\\u003e members in \\u003cem\\u003eBrassica napus\\u003c/em\\u003e. The overexpression of \\u003cem\\u003eUNE12\\u003c/em\\u003e alleviate membrane oxidative damage and regulate osmotic homeostasis, thereby enhancing the salt tolerance of plants.\\u003c/p\\u003e\"},{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003e\\u003cem\\u003eBrassica napus\\u0026nbsp;\\u003c/em\\u003e(rapeseed), an allopolyploids species (2n=38, AACC) within the \\u003cem\\u003eBrassicaceae\\u003c/em\\u003e family, serves as the second-largest source of edible oil globally, accounting for approximately 13-16% of the total production (Song et al. 2021). Its applications extend beyond edible oil production to include use as vegetables, animal feed, nectar sources, ornamental plants, and fertilizers (Raboanatahiry et al. 2021). Crucially, it contributes significantly to soil remediation, arable land expansion, and food security (Kniuipytė et al. 2023). \\u003cem\\u003eB. napus\\u003c/em\\u003e originates from the interspecific hybridization between \\u003cem\\u003eBrassica rapa\\u003c/em\\u003e (2n=20, AA) and \\u003cem\\u003eBrassica oleracea\\u003c/em\\u003e (2n=18, CC), thereby emerging as a pivotal model organism for investigating interspecific evolutionary trajectories (Chalhoub et al. 2014).\\u0026nbsp;However, \\u003cem\\u003eB. napus\\u003c/em\\u003e faces substantial yield and quality constraints due to its susceptibility to diverse abiotic and biotic stresses, including drought, salinity, insect pests, and heavy metal contamination (Neik et al. 2017; Hammac et al. 2017), which exert profound adverse effects on its growth, development, yield, and quality, thereby ultimately impeding the sustainable advancement of the \\u003cem\\u003eB.napus\\u003c/em\\u003e industry. Accordingly, investigating the stress-specific gene expression profiles of \\u003cem\\u003eB. napus\\u003c/em\\u003e under adverse conditions, enhancing its stress tolerance via biotechnological approaches, and further exploiting the utilization potential of \\u003cem\\u003eB. napus\\u003c/em\\u003e are of crucial significance for meeting the global food production demands.\\u003c/p\\u003e\\n\\u003cp\\u003eSalinized land is expanding, posing a significant threat to agricultural productivity, with fragile and water-scarce ecosystems being disproportionately affected and a substantial portion of such salinized areas holding considerable potential for agricultural development(Wang et al. 2024).\\u0026nbsp;Salinity induces physiological drought, impairs soil structure (causing compaction and poor aeration), inhibits microbial activity, reduces fertility, and ultimately leads to significant crop yield losses, jeopardizing food security (Zhang, K et al.2019; Zhang, W et al. 2019).\\u0026nbsp;While tens of millions of hectares of saline-alkali land potentially suitable for \\u003cem\\u003eB. napus\\u003c/em\\u003e cultivation, overwintering challenges persist in these cold, arid regions (Wu et al. 2019; Dai et al. 2024). Improving salt tolerance of \\u003cem\\u003eB. napus\\u003c/em\\u003e for large-scale cultivation on such marginal land would not only utilize critical reserve arable resources but also significantly boost domestic rapeseed oil production, enhancing edible oil security and reducing import dependence.\\u003c/p\\u003e\\n\\u003cp\\u003eThe basic helix-loop-helix (bHLH) transcription factor superfamily plays critical roles in plant biological processes. Characterized by a conserved DNA-binding basic region and a helix-loop-helix (HLH) dimerization domain, bHLH proteins regulate diverse processes including growth, development, stress responses, and metabolism (Zimmermann et al. 2004; Hao et al. 2021).\\u0026nbsp;Examples include \\u003cem\\u003eTriticum aestivum\\u003c/em\\u003e \\u003cem\\u003ebHLH39\\u003c/em\\u003e(\\u003cem\\u003eTabHLH39\\u003c/em\\u003e), which significantly enhances the salt toleranceby modulating stress-responsive genes (Zhai et al. 2016), and\\u003cem\\u003e\\u0026nbsp;Arabidopsis thaliana bHLH112\\u003c/em\\u003e, which binds to E-box and GCG-box motifs to regulate the expression of genes associated with proline, peroxidase (POD), and superoxide dismutase (SOD), and consequently improving plant stress resistance (Sun et al. 2018). The haploid female gametophyte, alternatively termed the embryo sac, represents the fundamental reproductive unit in angiosperms, it differentiates within the ovule of the ovary and comprises an egg cell and a central cell(Skinner and Sundaresan 2018).\\u0026nbsp;As a pivotal tissue indispensable to plant reproduction, the embryo sac mediates the entire sexual reproduction whereby mature pollen grains discharged from the anther deposite on the pistil\\u0026rsquo;s stigma, germinate, upon successful recognition, form a pollen tube that penetrates the ovule\\u0026rsquo;s micropyle to reach the embryo sac, after whose rupture two male gametes are released, one fusing with the egg cell to generate a zygote that further develops into the embryo while the other unites with the two polar nuclei of the central cell to yield the primary endosperm nucleus that differentiates into endosperm, thus culminating in the completion of pollen fertilization\\u0026nbsp;(Johnson et al. 2019; Shivanna and Tandon 2020; Shin et al. 2021).\\u0026nbsp;Research on plant embryo sacs has predominantly focused on cell development, breeding, fertilization, and subsequent embryonic development processes. In contrast, studies integrating unfertilized embryo sacs (\\u003cem\\u003eUNEs\\u003c/em\\u003e) with abiotic stresses remain exceedingly scarce. The \\u003cem\\u003eA. thaliana UNE12\\u0026nbsp;\\u003c/em\\u003e(\\u003cem\\u003eAtUNE12\\u003c/em\\u003e), a member of the bHLH superfamily, exhibits structural and functional features that not only adhere to familial commonalities but also display distinct regulatory modalities. It exerts an irreplaceable role in the growth regulation and environmental adaptation of \\u003cem\\u003eA.thaliana\\u003c/em\\u003e. Related research facilitates the elucidation of intricate regulatory networks underlying plant life activities and offers a theoretical foundation for crop genetic improvement. While substantial advances have been achieved in research on \\u003cem\\u003eAtUNE\\u003c/em\\u003e, investigations into the genetic evolution and functional characterization of \\u003cem\\u003eB.napus UNE\\u003c/em\\u003e genes (\\u003cem\\u003eBnUNE\\u003c/em\\u003e) in remain relatively limited. In the present study, bioinformatics approaches were utilized to identify members of the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family within the \\u003cem\\u003eB. napus\\u003c/em\\u003e genome and its ancestral species (\\u003cem\\u003eB. rapa\\u003c/em\\u003e and \\u003cem\\u003eB. oleracea\\u003c/em\\u003e). The experiment of overexpressing \\u003cem\\u003eUNE\\u003c/em\\u003e family member \\u003cem\\u003eUNE12\\u003c/em\\u003e under salt stress furnishes critical insights for further investigating the functions of \\u003cem\\u003eUNE\\u003c/em\\u003e genes in \\u003cem\\u003eB. napus\\u003c/em\\u003e growth and for the identification of salt-tolerant rapeseed germplasm.\\u003c/p\\u003e\"},{\"header\":\"2. Materials and Methods\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003e2.1 Identification of members within the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eProtein sequence data and genome annotation files for \\u003cem\\u003eB. napus\\u003c/em\\u003e (ZS11.v0) and \\u003cem\\u003eB. rapa\\u003c/em\\u003e (ECD04.v0) were retrieved from the \\u003cem\\u003eBrassica napus\\u003c/em\\u003e Information Resource (BnIR) website, whereas the corresponding files for \\u003cem\\u003eB.oleracea\\u003c/em\\u003e and \\u003cem\\u003eA.thaliana\\u003c/em\\u003e were acquired from the Ensembl database and TAIR, respectively (Yates et al. 2022; Yang et al. 2023; Reiser et al. 2024).\\u0026nbsp;Building on prior studies, the Hidden Markov Model (HMM) file (PF00010) corresponding to the conserved domain of UNE genes was downloaded from the InterPro database (Blum et al. 2025), and the HMM file (PTHR16223) specific to the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family was retrieved from the PANTHER database (Thomas et al. 2022).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e2.2 Physicochemical properties analysis and phylogenetic tree construction\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe physicochemical properties of \\u003cem\\u003eBnUNEs\\u003c/em\\u003e were predicted via ProtParam, an online tool within the Expasy suite(Wilkins et al. 1999).\\u0026nbsp;Sequence alignment of UNE gene family members was performed using the MUSCLE algorithm integrated in MEGA software. Subsequently, a phylogenetic tree was constructed based on the alignment results using the neighbor-joining (N-J) method, with bootstrap analysis configured for 1000 replications (Tamura et al. 2021).\\u0026nbsp;The generated phylogenetic tree was subjected to optimization and visualization using the online platform Chiplot (Xie et al. 2023).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e2.3 Chromosome mapping and intragenomic collinearity analysis\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eChromosomal mapping and intragenomic collinearity analysis of \\u003cem\\u003eB. napus\\u003c/em\\u003e were conducted using TBtools software, with gene distribution subjected to visualization (Chen et al. 2023). Furthermore, the Ka/Ks (nonsynonymous/synonymous substitution rate) ratios of \\u003cem\\u003eBnUNE\\u003c/em\\u003es were computed to assess the selection pressure exerted during the evolutionary process.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e2.4 Analysis of conserved motifs, domains, and gene structures\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eProtein sequences of \\u003cem\\u003eUNE\\u003c/em\\u003e family members were submitted to the online MEME suite, with the number of motifs set to 20 for prediction (other parameters retained default values), yielding files in XML format (Bailey et al. 2015). Conserved domains of \\u003cem\\u003eUNE\\u003c/em\\u003e family members were predicted via the CD-Search Tool within NCBI (Marchler-Bauer et al. 2011;\\u0026nbsp;Lu et al. 2022). Ultimately, an integrated visualization of motifs, domains, and gene structures was generated using TBtools.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e2.5 Analysis of cis-acting regulatory elements in the promoter region\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eIn the present study, sequences 2000 bp upstream of \\u003cem\\u003eBnUNE\\u003c/em\\u003e genes\\u0026mdash;corresponding to potential promoter regions\\u0026mdash;were retrieved from the \\u003cem\\u003eB. napus\\u003c/em\\u003e genome using the Gff3 sequence extraction and Fasta extraction functions integrated in TBtools. Promoter sequences 2000 bp upstream of \\u003cem\\u003eBnUNEs\\u003c/em\\u003e were extracted from genome annotation files. Subsequently, cis-acting element analysis of these sequences was performed using the online tool PlantCARE to predict cis-acting regulatory elements (CAREs) (Lescot et al. 2002). The results were visualized using TBtools. Identified CAREs were categorized based on their functional roles, with visualization of the outcomes conducted via the Advanced Gene Structure View function in TBtools. This comprehensive analysis advanced our understanding of the regulatory mechanisms governing \\u003cem\\u003eBnUNE\\u003c/em\\u003e gene expression.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e2.6 Interspecies collinearity analysis and subcellular localization prediction\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003ePrepared genome and genome annotation files were imported into TBtools, with analysis conducted using the One Step McScanX program. Following simplification processing, the results were visualized using the Multiple Synteny Plot program. Protein sequences of the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family were submitted to the WoLF PSORT server for prediction of subcellular localization (Horton et al. 2007).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e2.7 Quantitative real-time PCR (qRT-PCR) analysis of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e expression under salt stress conditions\\u003c/strong\\u003e\\u003cstrong\\u003e。\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eB. napus\\u003c/em\\u003e cultivar J9707 (seeds provided by the Crop Research Institute, Hunan Academy of Agricultural Sciences) was used as the test material in this study. All hydroponic experiments were conducted in a greenhouse under the following growth conditions: temperature 23/25\\u0026deg;C (day/night), photoperiod 16 h light/8 h dark, and relative humidity 50-60%. The housekeeping gene for qRT-PCR is BnaA01G0324400ZS. The 2\\u003csup\\u003e-\\u0026Delta;\\u0026Delta;Ct\\u003c/sup\\u003e method was used to calculate the relative gene expression levels (Livak and Schmittgen 2001).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e2.8 Investigation of Salt Tolerance through \\u003cem\\u003eBnUNE12\\u003c/em\\u003e Overexpression under Salt Stress\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo explore the association between the \\u003cem\\u003eBnUNE12\\u003c/em\\u003e gene (BnaA03G0270300ZS) and salt tolerance in \\u003cem\\u003eB. napus\\u003c/em\\u003e, the pC2306 vector was linearized using KpnI and SalI as restriction sites, with the PCR product subjected to recovery (Fig. 8 A). The \\u003cem\\u003eBnUNE12\\u003c/em\\u003e gene was cloned using cDNA from J9707 as a template (Fig. 8 B), followed by ligation of the gene fragment into the linearized pC2306 vector. Subsequent PCR validation and sequencing confirmed the successful construction of the overexpression vector. Agrobacterium-mediated transformation of \\u003cem\\u003eB. napus\\u003c/em\\u003e explants was performed to generate \\u003cem\\u003eBnUNE12\\u003c/em\\u003e overexpression plants. Total RNA was extracted from each \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE line and reverse-transcribed into cDNA, and qRT-PCR was conducted to quantify the expression level of each line, thereby verifying the overexpression efficiency.\\u003c/p\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003e3.1 Delineation of the phylogenetic trajectory of\\u003cem\\u003e\\u0026nbsp;BnUNE\\u0026nbsp;\\u003c/em\\u003efamily\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe hmmsearch program was employed to query both HMM profiles concurrently for the identification of candidate \\u003cem\\u003eUNE\\u003c/em\\u003e genes within the \\u003cem\\u003eB. napus\\u003c/em\\u003e proteome. An E-value cutoff of \\u0026lt;0.01 was applied to intersect the search results, yielding 410 candidate members. Subsequently, using previously identified \\u003cem\\u003eUNE\\u003c/em\\u003e protein sequences from \\u003cem\\u003eA. thaliana\\u003c/em\\u003e as query sequences, a local BLASTP analysis was performed against these candidate genes, confirming 21 high-confidence \\u003cem\\u003eUNE\\u003c/em\\u003e genes in \\u003cem\\u003eB. napus\\u003c/em\\u003e. Application of the same methodology, identified 5, 10, and 9 \\u003cem\\u003eUNE\\u003c/em\\u003e genes in \\u003cem\\u003eA. thaliana\\u003c/em\\u003e, \\u003cem\\u003eB. rapa\\u003c/em\\u003e, and \\u003cem\\u003eB. oleracea\\u003c/em\\u003e, respectively.To elucidate the evolutionary relationships within the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family between \\u003cem\\u003eB. napus\\u003c/em\\u003e and its ancestral species, \\u003cem\\u003eA. thaliana\\u003c/em\\u003e was used as an outgroup to systematically identify orthologous \\u003cem\\u003eUNE\\u003c/em\\u003e family members across the four genomes. A phylogenetic tree was subsequently constructed using the Chiplot platform (Fig. 1). Among the analyzed species, \\u003cem\\u003eAt\\u003c/em\\u003e\\u003cem\\u003eUNE\\u003c/em\\u003e homologs exhibited the earliest evolutionary divergence, consistent with established species phylogeny.According to the U\\u0026apos;s triangle theory, which posits that \\u003cem\\u003eB. napus\\u003c/em\\u003e originated from the natural hybridization between \\u003cem\\u003eB. oleracea\\u003c/em\\u003e and \\u003cem\\u003eB. rapa\\u003c/em\\u003e with genomic inheritance from both progenitors, \\u003cem\\u003eBn\\u003c/em\\u003e\\u003cem\\u003eUNE\\u003c/em\\u003e genes clustered \\u0026nbsp;phylogenetically with their counterparts in \\u003cem\\u003eB.rapa\\u003c/em\\u003e and \\u003cem\\u003eB.oleracea\\u003c/em\\u003e. Furthermore, these genes occupied identical phylogenetic positions with comparable branch lengths, indicating a pattern of parallel evolution. This observation suggests that \\u003cem\\u003eUNE\\u003c/em\\u003e genes underwent species-specific diversification: following the divergence of ancestral species into distinct lineages, accumulation of\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003estructural variations lead to partial functional specialization. Consequently, while core functions remain conserved, lineage-specific functions have emerged. Collectively, these analyses provide tangible insights into the evolutionary trajectories of the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family across species and lay the foundation for further investigations into the relationship between gene function and species adaptability.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e3.2\\u003c/strong\\u003e \\u003cstrong\\u003eInterpretation of\\u003c/strong\\u003e \\u003cstrong\\u003eprotein conserved domains and gene structure\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eUsing the \\u003cem\\u003eA. thaliana\\u003c/em\\u003e-containing clade as a reference, the \\u003cem\\u003eUNE\\u003c/em\\u003e family was categorized into six subclades through the integration of phylogenetic tree topology, gene motifs, conserved domains, and gene structures (Fig. 1, 2). Subclade I comprises the largest number of members (13), which lack lineage-specific motifs. However, \\u003cem\\u003eBna_UNE12.4\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eBra_UNE12.4\\u003c/em\\u003e acquired 4 and 2 introns, respectively, during evolution, leading to their structural homology with TRAPPC5_Trs31. TRAPP (transport protein particle) is a large, highly conserved multisubunit complex, with four types (I, II, III, and IV) identified in Saccharomyces cerevisiae, and Trs31, a conserved subunit of TRAPP complexes, plays a pivotal role in vesicle trafficking and autophagy (Zou et al. 2015).All members except \\u003cem\\u003eBna_UNE12.6\\u003c/em\\u003e and \\u003cem\\u003eBo_UNE12.1\\u003c/em\\u003e harbor Motifs 1, 2, 3, 4, and 5, implying that the bHLH domain is composed of one or more of these motifs\\u0026mdash;an assertion that requires further validation via investigations into the three-dimensional structures of these proteins. Notably, \\u003cem\\u003eAt_UNE12\\u003c/em\\u003e is clustered in subclade VI, which contains 9 members. Following divergence from Arabidopsis, genes from the three \\u003cem\\u003eBrassica\\u003c/em\\u003e species evolved to possess Motifs 12 and 16, whereas \\u003cem\\u003eBo_UNE12.1\\u003c/em\\u003e exclusively acquired Motif 16 while losing Motifs 1, 5, and 13.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e3.3\\u003c/strong\\u003e \\u003cstrong\\u003eProtein physicochemical properties and predicting subcellular localization\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eData derived from ProtParam and WoLFPSORT were subjected to comprehensive summary and analysis (Table 1). The molecular weights of members across the four species ranged from 19.056 to 47.851 kDa. Subclade I exhibited the most pronounced variation in molecular weight, with the smallest member weighing 24.107 kDa and the largest reaching 47.851 kDa. In contrast, subclade III showed the least variation, with a maximum difference of merely 2.651 kDa. The overall variation in subclade VI did not exceed 1 kDa; however, Bo_UNE12.1 underwent a significant reduction in molecular weight (to 23.014 kDa) due to the loss of motifs 5, 13, and 1 during evolution. Regarding pI, 10 \\u003cem\\u003eUNE\\u003c/em\\u003e family members were basic, while the remainder were acidic. Within subclade VI, all members except\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eBo_UNE12.1 exhibited acidic properties. This suggests that the C-terminus of \\u003cem\\u003eUNE\\u003c/em\\u003e12 is enriched in acidic amino acids, whereas the N-terminus contains a higher proportion of basic amino acids\\u0026mdash;an observation that explains the elevation in isoelectric point following the loss of C-terminal motifs. The aliphatic index of \\u003cem\\u003eUNE\\u003c/em\\u003e family consistently exceeded 60, with some members reaching 80, indicating a high proportion of aliphatic amino acids and suggesting robust thermal stability. The Grand Average of Hydropathy (GRAVY) values reflected strong hydrophilicity. Collectively, these properties are consistent with the presence of a hydrophobic core within \\u003cem\\u003eUNE\\u003c/em\\u003e proteins. Additionally, the instability index indicates that all \\u003cem\\u003eUNE\\u003c/em\\u003e family are unstable protein, potentially due to the presence of specific degradation mechanisms or chaperone proteins that modulate their functional activity. WoLF PSORT analysis predicted that the majority of \\u003cem\\u003eUNE\\u003c/em\\u003e gene family in \\u003cem\\u003eB. napus\\u003c/em\\u003e are localized to the nucleus, with a subset residing in peroxisomes. The \\u003cem\\u003eUNE\\u003c/em\\u003e gene family exerts primary functions in the nucleus, while peroxisomal members may participate in processes such as reactive oxygen species (ROS) metabolism and detoxification, fatty acid \\u0026beta;-oxidation, and stress responses. Notably, all peroxisome-localized members belong to subclade I, signifying functional divergence within this subclade, with specialized roles in peroxisomes. \\u003cem\\u003eBo_UNE12.4\\u003c/em\\u003e was uniquely predicted to be predominantly localized to chloroplasts. The presence of a signal sequence upstream of its start codon supports this prediction, and implies potential core functions may be associated with chloroplast-related physiological processes. However, the specific functions of \\u003cem\\u003eBo_UNE12.4\\u003c/em\\u003e require experimental validation, including confirmation of its chloroplast localization and characterization of interacting protein networks.\\u003c/p\\u003e\\n\\u003ctable border=\\\"0\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"100%\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd colspan=\\\"10\\\" style=\\\"width: 100px;\\\"\\u003e\\n \\u003cp\\u003eTable 1 Physicochemical properties and subcellular localization across \\u003cem\\u003eA. thaliana\\u003c/em\\u003e, \\u003cem\\u003eB. napus\\u003c/em\\u003e, and their ancestral species\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eSequence ID\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eRename\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eSubclade\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003eAA Number\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003eMW/kDa\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003eTheoretical pI\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eInstability Index\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003eAliphatic Index\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003eGRAVY\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003ePSLP\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBo2g028920.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBo_UNE12.9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅠ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e229\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e24.107\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e9.39\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e46.57\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e75.9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.459\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaA02T0114000ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅠ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e280\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e29.723\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.98\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e51.44\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e70.79\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.524\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBo3g018990.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBo_UNE12.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅠ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e286\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e30.196\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e8.76\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e51.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e72.03\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.452\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003epero\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaA10T0136900ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.10\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅠ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e289\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e30.289\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e5.88\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e48.92\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e72.35\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.436\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003epero\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaC03T0125500ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.15\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅠ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e286\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e30.367\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e8.76\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e51.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e72.03\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.477\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003epero\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBraA02t029661E\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBra_UNE12.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅠ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e293\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e31.179\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.32\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e49.77\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e67.99\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.561\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eAT5G58010.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eAT_UNE12.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅠ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e297\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e31.470\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e5.79\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e50.15\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e70.37\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.423\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003epero\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaC02T0139100ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.13\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅠ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e296\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e31.758\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.16\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e53.52\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e68.61\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.62\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBraA10t046360E\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBra_UNE12.9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅠ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e302\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e31.795\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e5.73\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e47.43\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e70.53\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.46\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003epero\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBo9g133640.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBo_UNE12.7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅠ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e331\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e35.229\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.41\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e46.94\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e66.71\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.598\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003epero\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaC09T0412800ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.21\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅠ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e355\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e38.177\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e48.12\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e75.92\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.391\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003epero\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaA03T0108600ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅠ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e418\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e45.263\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e8.64\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e43.59\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e86.32\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.258\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003epero\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBraA03t008376E\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBra_UNE12.4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅠ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e441\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e47.851\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e8.19\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e42.93\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e87.78\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.197\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003epero\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaC01T0077700ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.12\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅡ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e327\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e34.579\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e52.93\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e67.77\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.432\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBo1g011740.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBo_UNE12.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅡ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e327\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e34.579\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e52.93\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e67.77\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.43\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaA01T0064700ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅡ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e327\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e34.591\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e52.35\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e68.96\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.418\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBraA01t024441E\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBra_UNE12.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅡ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e327\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e34.591\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e52.09\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e68.96\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.418\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eAT4G30980.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eAT_UNE12.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅡ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e358\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e38.582\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e9.02\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e57.56\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e63.55\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.59\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaA04T0160400ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅢ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e326\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e34.232\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.45\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e50.17\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e59.94\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.555\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBraA09t006007E\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBra_UNE12.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅢ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e339\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e35.743\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.45\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e57.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e66.81\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.428\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBo8g099910.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBo_UNE12.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅢ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e340\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e35.786\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e55.43\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e67.74\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.424\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaC08T0433700ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.19\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅢ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e340\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e35.831\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.16\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e53.32\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e68\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.415\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaA09T0581100ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅢ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e344\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e36.229\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.45\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e57.62\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e68.37\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.403\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eAT2G24260.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eAT_UNE12.4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅢ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e350\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e36.522\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.36\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e46.94\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e68.89\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.356\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003epero\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaC04T0455600ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.17\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅢ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e348\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e36.745\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.67\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e51.09\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e63.42\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.509\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBraA04t043266E\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBra_UNE12.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅢ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e348\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e36.812\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e49.43\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e63.71\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.52\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBo4g154370.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBo_UNE12.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅢ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e348\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e36.883\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e49.59\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e62.59\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.541\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaC01T0310400ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.11\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅣ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e170\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e19.056\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e7.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e57.63\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e83.76\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.414\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaC05T0017800ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.18\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅣ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e307\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e32.873\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.07\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e54.46\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e71.14\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.432\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaA10T0015800ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅣ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e311\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e33.238\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.07\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e53.01\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e71.48\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.423\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eAT1G03040.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eAT_UNE12.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅣ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e333\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e36.364\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.32\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e50.84\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e72.91\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.459\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBo5g003580.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBo_UNE12.4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅣ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e355\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e38.322\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.91\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e56.32\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e77.72\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.379\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003echlo\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaA02T0255600ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅤ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e254\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e27.486\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e7.92\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e54.97\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e71.42\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.485\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBraA02t031288E\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBra_UNE12.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅤ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e254\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e27.495\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e9.47\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e56.76\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e70.28\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.475\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBo2g100750.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBo_UNE12.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅤ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e298\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e31.725\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e5.91\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e60.06\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e70.74\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.413\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaC02T0344300ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.14\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅤ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e299\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e31.824\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e5.91\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e59.89\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e71.47\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.398\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBo9g005930.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBo_UNE12.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅥ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e215\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e23.014\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e8.18\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e50.84\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e69.91\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.493\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaC09T0011500ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.20\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅥ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e301\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e32.163\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e5.83\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e56.04\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e68.74\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.492\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaA09T0026700ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅥ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e304\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e32.391\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e5.83\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e54.99\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e69.01\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.475\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBraA09t000195E\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBra_UNE12.7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅥ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e304\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e32.407\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e5.83\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e54.32\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e68.68\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.484\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaC03T0324600ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.16\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅥ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e304\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e32.446\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.25\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e57.76\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e69.97\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.445\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBo01031s030.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBo_UNE12.10\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅥ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e307\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e32.747\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.31\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e58.55\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e69.28\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.454\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBraA03t010069E\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBra_UNE12.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅥ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e308\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e32.747\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.07\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e57.69\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e71.27\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.412\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eBnaA03T0270300ZS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eBna_UNE12.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅥ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e310\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e32.861\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e6.07\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e59.02\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e69.55\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.43\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 15px;\\\"\\u003e\\n \\u003cp\\u003eAT4G02590.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003eAT_UNE12\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003eⅥ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 9px;\\\"\\u003e\\n \\u003cp\\u003e310\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 8px;\\\"\\u003e\\n \\u003cp\\u003e33.105\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10px;\\\"\\u003e\\n \\u003cp\\u003e5.92\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 12px;\\\"\\u003e\\n \\u003cp\\u003e49.09\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 11px;\\\"\\u003e\\n \\u003cp\\u003e68.29\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 7px;\\\"\\u003e\\n \\u003cp\\u003e-0.488\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 5px;\\\"\\u003e\\n \\u003cp\\u003enucl\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAbbreviation\\u003c/strong\\u003e AA:Animo Acid; MW:Molecular Weight; GRAVY: Grand Average of Hydropathy; PSLP: Protein Subcellular Localization Prediction\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e3.4 Analysis of the CAREs in the promoter regions of \\u003cem\\u003eB. napus\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e16 major CAREs were identified in the \\u003cem\\u003eUNE\\u003c/em\\u003e family of \\u003cem\\u003eB. napus\\u003c/em\\u003e, encompassing a substantial number of light-responsive elements (247) and other cis-elements, including anaerobic induction (66), MeJA-responsiveness (60), Abscisic acid responsive element (ABRE, 44), Low-temperature responsiveness (LTR, 29), Gibberellin responsive element (GRE, 21), and Salicylic acid responsive element (SARE, 16) (Fig. 3). These elements suggest that \\u003cem\\u003eUNE\\u003c/em\\u003e genes are pivotal in plant growth and development, stress responses, and hormone regulation.\\u003c/p\\u003e\\n\\u003cp\\u003eThe abundance of light-responsive CAREs such as G-box, TCT-motif implies a potential role for the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family in regulating photosynthesis-related pathways in \\u003cem\\u003eB. napus\\u003c/em\\u003e. The G-box element can interact with light-induced transcriptional activators to modulate genes involved in chloroplast development and light energy utilization. This functional association \\u0026nbsp;aligns with its requirement for photosynthate accumulation in \\u003cem\\u003eB. napus\\u003c/em\\u003e as a key oilseed crop (Toledo-Ortiz et al. 2014). Stress-related CAREs indicate that the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family employs diverse regulatory mechanisms in response to complex environmental stresses. Specifically, 66 anaerobic induction elements suggest that activation of certain \\u003cem\\u003eUNE\\u003c/em\\u003e genes under root hypoxia stress, potentially maintaining cellular viability through regulation of glucose metabolism or energy metabolism. Additionally, 29 LTR elements implicate potential involvement of \\u003cem\\u003eUNE\\u003c/em\\u003e genes in regulating cold adaptation, possibly acting synergistically with genes responsible for the synthesis of antifreeze proteins or osmotic. Notably, 44 ABREs suggest that ABA\\u0026mdash;a central stress signaling molecule\\u0026mdash;may drive \\u003cem\\u003eUNE\\u003c/em\\u003e gene expression through the activation of its regulatory pathway. This ABA-mediated response could enhance cellular osmotic adjustment capacity (e.g., proline accumulation) and antioxidant enzyme activities (e.g., SOD, POD). This mechanism appears evolutionarily conserved, mirroring observations in \\u003cem\\u003eA. thaliana\\u003c/em\\u003e where \\u003cem\\u003eAt\\u003c/em\\u003e\\u003cem\\u003eUNE\\u003c/em\\u003e12 enhances salt tolerance via activation of the SOS pathway.\\u003c/p\\u003e\\n\\u003cp\\u003eThe identification of 60 MeJA-responsive elements and 21 GRE elements indicates potential integration of jasmonic acid (JA) and auxin (IAA) signaling pathways by the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family, Such integration may contribute to the balancing defense responses with growth and development in \\u003cem\\u003eB. napus\\u003c/em\\u003e. JA signaling is frequently associated with plant insect and disease resistance (Campos et al. 2014), while, auxin-responsive elements may implicate \\u003cem\\u003eUNE\\u003c/em\\u003e genes in embryonic development or organ morphogenesis. Furthermore, 16 SARE elements expand the potential regulatory network of \\u003cem\\u003eUNE\\u003c/em\\u003e genes. As Salicylic acid (SA) is a pivotal signaling molecule in systemic acquired resistance (SAR), these elements suggest involvement of \\u003cem\\u003eUNE\\u003c/em\\u003e genes in \\u003cem\\u003eB. napus\\u003c/em\\u003e immune defense. Specifically, they may modulate the expression of pathogenesis-related protein genes during pathogen infection, thereby enhancing resistance (Tripathi et al. 2019; Han et al. 2022). Collectively, the co-occurrence of these multi-hormone responsive elements indicates that the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family likely integrates multiple signaling pathways to form a sophisticated gene regulatory network. This integrated system likely enables \\u003cem\\u003eB. napus\\u003c/em\\u003e to address diverse physiological demands across different growth stages and environmental conditions.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e3.5 Explanation of the chromosomal mapping and collinearity of the \\u003cem\\u003eBnUNE\\u003c/em\\u003es\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eDeciphering the \\u003cem\\u003eB. napus\\u003c/em\\u003e genome annotation file revealed that \\u003cem\\u003eUNE\\u003c/em\\u003e gene family members are distributed across merely 6 chromosomes in the A subgenome and 7 chromosomes in the C subgenome (Fig. 4). Intraspecific synteny analysis demonstrated that these genes undergo segmental duplications on chromosomes, with no tandem duplications observed. Brassicaceae plants have experienced multiple whole-genome duplication (WGD) events, including \\u0026gamma;, \\u0026alpha;, and \\u0026beta; triplications. The segmental duplications within the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family are highly likely to have originated from these ancient WGD events, thereby resulting in the formation of interchromosomal syntenic copies (Ferreira de Carvalho et al. 2019; Das Laha et al. 2020)(Fig. 5). Chromosomal segmental duplications may also contribute to the amplification of \\u003cem\\u003eUNE\\u003c/em\\u003e genes, resulting in the formation of syntenic homologous genes between non-homologous chromosomes. Ka/Ks data reveal that the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family has undergone purifying selection during evolution (SI Table 1). Synteny analysis between \\u003cem\\u003eB. napus\\u003c/em\\u003e and its ancestral species \\u0026nbsp;indicates that chromosomes of the three species contain numerous syntenic blocks of the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family. This suggests that the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family in \\u003cem\\u003eB. napus\\u003c/em\\u003e and its homologous genes in \\u003cem\\u003eB. rapa\\u003c/em\\u003e and \\u003cem\\u003eB. oleracea\\u003c/em\\u003e had established stable genomic distributions in their ancestral species, which were not subjected to large-scale rearrangements during allopolyploidization (Fig. 6).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e3.6 Interprete the expression of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e under salt stress.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eBased on BLAST results, the gene with the highest hit scores (\\u003cem\\u003eBna_UNE12.5\\u003c/em\\u003e, hereafter renamed \\u003cem\\u003eBnUNE12\\u003c/em\\u003e) was selected for interpreting expression under salt stress. To investigate whether \\u003cem\\u003eBnUNE12\\u003c/em\\u003e functions similarly, leaf samples were collected from \\u003cem\\u003eB. napus\\u003c/em\\u003e plants treated with 300 mM NaCl at seven time points within a 24-hour period for RNA extraction and subsequent quantification of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e expression levels.The expression level displayed minimal variation from 0h to 1 h of salt stress, began to increase at 3 h, peaked at 6 h, decreased at 12 h but remained higher than that at 3 h, and continued to decline at 24 h to a level comparable to that at 3 h. Consequently, \\u003cem\\u003eBnUNE12\\u003c/em\\u003e expression was time-dependent following NaCl treatment, with the maximal induction occurring at 6 h (Fig. 7).These results demonstrate that treatment with 300 mM NaCl induces \\u003cem\\u003eBnUNE12\\u003c/em\\u003e expression, characterized by dynamic changes in expression levels over time. The 6 h time point represents the critical for peak salt stress-induced expression of this gene. Although transcript levels subsequently declined, they remained relatively elevated. Collectively, these findings indicate that a potential role for \\u003cem\\u003eBnUNE12\\u003c/em\\u003e in the \\u003cem\\u003eB. napus\\u003c/em\\u003e salt stress response pathway.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e3.7 Preliminary functional validation of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e in salt tolerance\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e3.7.1 Construct overexpression \\u003cem\\u003eBnUNE12\\u003c/em\\u003e lines\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo further validate the involvement of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e in plant responses to salt stress, dual restriction enzyme sites (KpnI and SalI) were used to introduce the designed primers into the vector pC2306, thereby constructing \\u003cem\\u003eBnUNE12\\u003c/em\\u003e overexpression lines (Fig. 8A, B). The forward primer sequence is ATGGCTAGTAACAACAACCCGC, and the reverse primer sequence is CTGTGGAGGAGGATTAGTCTCTGG. Quantification of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e expression levels in transgenic lines (Fig. 8C) \\u0026nbsp;revealed significantly elevated expression in three independent overexpression lines (\\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE1, -OE2, and -OE3) compared to the wild-type (WT) J9707. The expression levels reached approximately 2.8\\u0026ndash;3.9 times that of WT. These results confirm successful generation of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e overexpression lines, providing essential materials for subsequent functional characterization.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e3.7.2 Regulatory effects of\\u003cem\\u003e\\u0026nbsp;BnUNE12\\u003c/em\\u003e on root length and fresh weight\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eSalt stress primarily impacts plants at the root level, where morphological alterations reflect stress responses. Root length and root fresh weight were quantified in WT and \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE lines pre- and post- salt treatment. Under normal conditions, \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE lines exhibited significantly reduced root length and fresh weight compared to WT (Fig. 9A, D, E), indicating that \\u003cem\\u003eBnUNE12\\u003c/em\\u003e overexpression constrains root development in \\u003cem\\u003eB. napus\\u003c/em\\u003e. Following 300 mM NaCl treatment, root length difference between WT and transgenic lines were eliminated. This convergence suggests severe salt-induced inhibition of root apical meristem activity and elongation zone expansion in WT plants, arresting primary root growth and suppressed lateral root development. \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE overexpression substantially mitigated these pathological manifestations. Furthermore, the significant difference (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05) in the fresh weight of the underground part between WT and \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE lines vanished after salt treatment. This indicated that \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE lines exhibit a certain tolerance to NaCl, and overexpression of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e enhances salt tolerance in \\u003cem\\u003eB. napus\\u003c/em\\u003e roots.\\u003c/p\\u003e\\n\\u003cp\\u003eShoot phenotypes provided complementary evidence that NaCl treatment induced leaf \\u0026nbsp;yellowing and wilting across all lines, with symptoms markedly more severe in WT (Fig. 9A). Transgenic lines \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE1 and -OE3 maintained significantly higher (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05) shoot fresh weight than WT under stress, despite \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE2\\u0026nbsp;showing reduced biomass under normal conditions (Fig. 9C). Whole-plant fresh weight analysis confirmed enhanced salt tolerance in transgenics, with no genotype difference under control conditions but significantly greater (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05) biomass in \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE lines following salt stress (Fig. 9B). These phenotypic analyses demonstrate that \\u003cem\\u003eBnUNE12\\u003c/em\\u003e overexpression confers NaCl tolerance in \\u003cem\\u003eB. napus\\u003c/em\\u003e. Notably, the observed root growth reduction and biomass decrease under normal conditions reflect a trade-off between growth and stress resistance. Analysis of CAREs revealed that the promoter region of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e harbors abundant growth- and development-related elements as well as stress-responsive elements, collectively underscoring its pivotal role in mediating plant growth, development, and stress responses. Overexpression of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e\\u0026mdash;characterized by a significant reduction in root length and a concomitant decrease in plant biomass\\u0026mdash;reflects a prioritization of stress resistance over growth in balancing these two physiological processes.This phenotypic observation, integrated with functional insights derived from CAREs analysis, indicates that utilizing the \\u003cem\\u003eUNE12\\u003c/em\\u003e gene for crop stress resistance breeding requires careful consideration of its dual impacts on growth performance and stress tolerance. The ultimate objective is to achieve a dynamic equilibrium between these traits through optimization of gene expression regulatory strategies.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e3.7.3 \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-mediated protection of membrane integrity\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eUnsaturated fatty acids within cellular membrane systems incur lipid peroxidation upon exposure to stimuli such as oxidative stress, whereas malondialdehyde (MDA)\\u0026mdash;a key end product of lipid peroxidation\\u0026mdash;displays a positive correlation between its production levels and the extent of lipid peroxidation (Tsikas 2017). Upon membrane system damage, lipid peroxidation is exacerbated, leading to the excessive production of MDA. Consequently, MDA content quantification can indirectly reflect the extent of lipid peroxidation-induced damage in membrane systems and further assess impairments to membrane structure and function.Under normal growth conditions, MDA levels in WT plants were ~56.7% higher than in \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE1 and ~87.3% higher than in \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE3, with no significant difference relative to \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE2 (Fig. 10A). The highest MDA levels in WT indicated a relatively elevated lipid peroxidation status in J9707 cells under basal physiological conditions, likely due to inherent genetic traits. In contrast, MDA levels in \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE1 and \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE3 were significantly lower than in WT. Following exposure to 300 mM NaCl, MDA levels increased across all lines: WT exhibited a 249% increase, while \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE1, \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE2, and \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE3 showed increases of ~145%, 77.5%, and ~148.7%, respectively (Fig. 10A). The drastic elevation of MDA in WT upon salt stress indicated that salt stress severely disrupted intracellular redox homeostasis, triggering extensive lipid peroxidation. Although NaCl stress induced membrane damage in \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-overexpressing lines, the impairment was significantly attenuated (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.001) relative to WT. These results demonstrate that \\u003cem\\u003eBnUNE12\\u003c/em\\u003e overexpression enhances cellular tolerance to salt stress by mitigating membrane lipid peroxidation in \\u003cem\\u003eB. napus\\u003c/em\\u003e. This protective mechanism may be evolutionarily conserved with \\u003cem\\u003eAt\\u003c/em\\u003e\\u003cem\\u003eUNE\\u003c/em\\u003e12 in \\u003cem\\u003eA. thaliana\\u003c/em\\u003e, which alleviates salt stress through regulating ROS-related gene expression. Further investigation is warranted to characterize the interaction between \\u003cem\\u003eBnUNE12\\u003c/em\\u003e and its target gene promoters.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e3.7.4 Role of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e in regulating proline accumulation\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eSalt stress disrupt the osmotic homeostasis between the intracellular and extracellular compartments in plant cells, impairing physiological processes. As a key cellular osmolyte, proline mitigates salt-induced damage. When WT and \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE plants were cultivated under control conditions, the proline content in WT was marginally higher than that in \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE lines, though this difference did not reach statistical significance (Fig.10B). Following 300 mM NaCl treatment, both genotypes displayed characteristic accumulation in response to abiotic stress. However, significant variations emerged in both accumulation magnitude and final proline concentrations: salt-stressed WT accumulates approximately 1.69- to 1.87-fold more proline than \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE lines (Fig. 10B). While proline accumulation facilitates the modulation of osmotic potential in plants, its magnitude depends on stress intensity and duration, with higher levels not necessarily indicating superior tolerance. The elevated proline in WT may reflect compensatory biosynthesis to counteract severe cellular damage, whereas the significantly reduced accumulation in \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE lines suggests alternative protective mechanisms. This pattern indicates that \\u003cem\\u003eBnUNE12\\u003c/em\\u003eoverexpression alleviate salt stress through regulatory pathway that reduce dependence on massive proline accumulation for osmotic homeostasis.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e3.7.5 Expression Analysis of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE and ROS-related Genes\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo identify the potential targets of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e regulation, two canonical ROS-associated genes, Superoxide Dismutase 1 (\\u003cem\\u003eSOD1\\u003c/em\\u003e) and\\u0026nbsp;Catalase 2\\u0026nbsp;(\\u003cem\\u003eCAT2\\u003c/em\\u003e), were selected for expression analysis. Under control conditions, \\u003cem\\u003eSOD1\\u003c/em\\u003e expression remained low across all genotypes, with no significant differences observed despite marginally higher levels in \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE1 (Fig. 11A). Following exposure to 300 mM NaCl, \\u003cem\\u003eSOD1\\u003c/em\\u003e expression was upregulated in all lines. Notably, the relative \\u003cem\\u003eSOD1\\u003c/em\\u003e expression in \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE3\\u0026nbsp;was significantly higher than that in the J9707\\u0026nbsp;(\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05), while \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE1 showed elevated but non-significant induction. This salt-dependent modulation indicates \\u003cem\\u003eBnUNE12\\u003c/em\\u003e influences \\u003cem\\u003eSOD1\\u003c/em\\u003e expression, with particularly pronounced effect in \\u003cem\\u003eBnUNE1\\u003c/em\\u003e2-OE3. For \\u003cem\\u003eCAT2\\u003c/em\\u003e, basal expression was uniformly low across genotypes under normal conditions (Fig. 11B). Salt stress significantly induced \\u003cem\\u003eCAT2\\u003c/em\\u003e expression in both WT and \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE lines. Although no statistically significant inter-genotypic differences were detected despite subtle variations among individual lines. These findings suggest that \\u003cem\\u003eSOD1\\u003c/em\\u003e and \\u003cem\\u003eCAT2\\u003c/em\\u003e are likely not primary transcriptional targets of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e . Their regulation may involve cooperative interactions with other transcription factors (e.g., MYB family proteins). Future investigation of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e\\u0026rsquo;s interplay with additional ROS-responsive genes is warranted to elucidate its precise mechanisms in mitigates membrane damage.\\u003c/p\\u003e\"},{\"header\":\"4. Discussion\",\"content\":\"\\u003cp\\u003eThe bHLH transcription factor superfamily\\u0026nbsp;represents the most structurally diverse class of regulatory proteins, characterized by a conserved bHLH domain that enables homo/heterodimerization and sequence-specific binding to E-box motifs (CANNTG) and other CAREs, allowing spatiotemporal control of gene expression profiles critical for developmental patterning and stress adaptation (Michael et al. 2023; Schneider et al.2023; Ning et al. 2025).\\u0026nbsp;The extraordinary diversity within the\\u0026nbsp;bHLH family\\u0026nbsp;enables its members to orchestrate a vast array of biological processes. In plants, this structurally versatile family has expanded into hundreds of members, forming intricate transcriptional regulatory networks\\u0026mdash;such as the canonical\\u0026nbsp;MYB-bHLH complex\\u0026mdash;that coordinate cellular differentiation and environmental responses (Qian et al. 2021). Leveraging this regulatory complexity, bHLH has emerged as key targets for improving stress resilience and optimize agronomic traits through precision breeding.\\u0026nbsp;Soil salinization impairs soil aeration and elevates osmotic potential, which in turn inhibits root growth, reduces the capacity of plants to absorb water and nutrients, and may even lead to physiological drought and subsequent wilting or death due to excessive osmotic stress (Munns et al. 2020; Abdalla et al. 2022; Liu et al. 2023).\\u0026nbsp;Soil salinization-induced accumulation of high-concentration salt ions can be taken up by plants, perturbing cellular metabolic homeostasis, inhibiting growth, and reducing crop yield and quality (Singh et al. 2022; Zhou et al. 2024). These constraints significantly challenge breeding by increasing costs and hindering sustainable agriculture.\\u0026nbsp;The bHLH family is integral to the orchestration of salt-stress tolerance in plants. A bHLH, designated \\u003cem\\u003eNtbHLH123\\u003c/em\\u003e, occupies a critical cis-regulatory position immediately upstream of the respiratory burst oxidase homolog (Rboh) NtRbohE in \\u003cem\\u003eNicotiana tabacum\\u003c/em\\u003e, acting as a molecular rheostat to modulates the Rboh-dependent signaling circuitry that underpins systemic salinity responses, ultimately potentiating cellular resilience and organismal fitness under high-salt conditions (Liu et al. 2021), \\u003cem\\u003eCabHLH035\\u003c/em\\u003e integrates ionic homeostasis and proline metabolism in \\u003cem\\u003eCapsicum annuum\\u003c/em\\u003e (Zhang et al. 2022), \\u003cem\\u003eAhbHLH21\\u003c/em\\u003e directly occupies canonical G/E-box motifs within the promoters of \\u003cem\\u003eAhPOD\\u003c/em\\u003e, \\u003cem\\u003eAhCAT\\u003c/em\\u003e, and \\u003cem\\u003eAhSOD\\u003c/em\\u003e, transcriptionally amplifying the antioxidant enzymatic repertoire and potentiating cellular redox buffering in \\u003cem\\u003eArachis hypogaea\\u003c/em\\u003e under salt stress (Zhao et al. 2024).\\u0026nbsp;Despite these advances, most bHLH members remain functionally uncharacterized due to the superfamily\\u0026apos;s extraordinary and diversity. Within the bHLH superfamily, the \\u003cem\\u003eUNE\\u003c/em\\u003e clade has emerged as a pivotal regulator of both developmental programming and environmental adaptation. Functional studies of \\u003cem\\u003eAtUNE12\\u003c/em\\u003e and \\u003cem\\u003ePopulus alba\\u0026times;Populus glandulosa\\u003c/em\\u003e \\u003cem\\u003ePagUNE12\\u003c/em\\u003e revealing distinct molecular paradigms, \\u003cem\\u003eAtUNE12\\u003c/em\\u003e undergoes stimulus-dependent phosphorylation, enabling its high-affinity binding to G-box (CACGTG) and LTR15 (CCGAC) cis-motifs, activating a suite of ion-transport genes that restrict Na⁺ influx while sustaining K⁺ homeostasis, concomitantly, \\u003cem\\u003eAtUNE12\\u003c/em\\u003e directly up-regulates \\u003cem\\u003eAtMYB61\\u003c/em\\u003e, a key determinant of stomatal aperture, thereby reducing transpirational water loss and consolidating salt tolerance (He et al. 2022), During secondary growth, \\u003cem\\u003ePagUNE12\\u003c/em\\u003e orchestrates lignin polymerization by trans-activating laccase genes \\u003cem\\u003eLAC40\\u003c/em\\u003e and \\u003cem\\u003eLAC49\\u003c/em\\u003e together with class III peroxidases \\u003cem\\u003ePER3\\u003c/em\\u003e and \\u003cem\\u003ePER6\\u003c/em\\u003e, promoting guaiacyl-type lignin deposition, thereby dictating the mechanical architecture and physicochemical properties of wood. (Zhao et al. 2013;Song et al. 2023).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eB. napus\\u003c/em\\u003e holds a pivotal position in global food security and agricultural development, but its growth and yield are increasingly constrained by abiotic stresses, particularly soil salinity. Phylogenomic analysis positioned \\u003cem\\u003eBnUNE\\u003c/em\\u003e paralogues as sister lineages to orthologs in progenitor species \\u003cem\\u003eB. rapa\\u003c/em\\u003e and \\u003cem\\u003eB. oleracea\\u003c/em\\u003e, consistent with \\u003cem\\u003eB. napus\\u003c/em\\u003e\\u0026apos; allopolyploid origin. Topological relationships indicate lineage-specific structural rearrangements and functional specialization following speciation, with retention of ancestral functions alongside species-specific innovations. These findings not only illuminate the evolutionary history of \\u003cem\\u003eUNE\\u003c/em\\u003e genes during \\u003cem\\u003eBrassica\\u003c/em\\u003e divergence but also underscore the imperative of functionally dissecting this family in \\u003cem\\u003eB. napus\\u003c/em\\u003e. Integrative analyses of the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family reveal pronounced diversification and intricate regulatory circuitry. The family resolves into six well-supported subclades (I\\u0026ndash;VI) that differ markedly in motif assemblages and intronic landscapes. Subclade I members exhibit intron insertions that engender pronounced structural variants. PSLP indicate a peroxisomal bias for several subclade I proteins, implying that these splice variants may modulate ROS metabolism and detoxification (Corpas 2019). Promoter scanning further expands our understanding of the \\u003cem\\u003eUNE\\u003c/em\\u003e transcriptional network. An abundance of light-responsive elements (e.g., G-box, I-box) suggests that \\u003cem\\u003eUNE\\u003c/em\\u003e genes are deeply integrated into photosynthetic regulation, facilitating efficient solar-energy capture and its subsequent conversion into storage lipids in \\u003cem\\u003eB. napus\\u003c/em\\u003e. Stress-responsive motifs, including (LTR) and ABRE elements, implicate \\u003cem\\u003eUNE\\u003c/em\\u003e genes in the mitigation of salinity, cold and other abiotic constraints. The presence of ABRE motifs, hallmarks of ABA-dependent signaling, points to enhanced osmotic adjustment and antioxidant capacity\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003e(Fujita et al. 2005; Yu et al. 2020). Additionally, hormone-responsive elements such as MeJA-responsiveness and GRE motifs reveal that \\u003cem\\u003eUNE\\u003c/em\\u003e genes are capable of integrating jasmonate, auxin and other phytohormonal pathways to balance defense responses with developmental programs. Collectively, the convergence of multiple signaling cascades within \\u003cem\\u003eUNE\\u003c/em\\u003e promoters underscores a sophisticated regulatory architecture that enables \\u003cem\\u003eB. napus\\u003c/em\\u003e to simultaneously optimize growth and withstand diverse environmental challenges. \\u003cem\\u003eBnUNE12\\u003c/em\\u003e exhibited the highest sequence similarity to \\u003cem\\u003eAtUNE12\\u003c/em\\u003e, therefore hypothesized to perform comparable salinity-tolerance. Time-course quantitative PCR revealed that \\u003cem\\u003eBnUNE12\\u003c/em\\u003e may trigger a resource reallocation in which growth is temporarily sacrificed to fortify protective mechanisms, thereby enhancing salinity tolerance. Salt stress perturbs cellular redox homeostasis, resulting in the excessive accumulation of ROS that subsequently compromise membrane integrity and cellular function (Hasanuzzaman et al. 2021; Wani et al. 2021). Moreover, salinity disrupts cellular osmotic equilibrium, thereby impairing metabolic fluxes and physiological processes, cells accumulate large amounts of the compatible solute proline to re-establish homeostasis, which enhances water uptake from the apoplast and sustains turgor pressure, preserving cellular integrity and normal function under hyperosmotic stress (de Freitas et al. 2019;\\u0026nbsp;Hosseinifard et al. 2022).\\u0026nbsp;Accordingly, the relationship between \\u003cem\\u003eBnUNE12\\u003c/em\\u003e and salinity tolerance can be interrogated through two complementary physiological lenses: membrane integrity and osmolyte accumulation. Under non-stress conditions, transgenic lines over-expressing \\u003cem\\u003eBnUNE12\\u003c/em\\u003e consistently exhibit lower MDA contents than WT plants, indicating that \\u003cem\\u003eBnUNE12\\u003c/em\\u003e attenuates basal lipid peroxidation and fortifies membrane stability even in the absence of external stress. Following exposure to salt stress, MDA levels rise in all genotypes. The WT registers the sharpest increase, whereas \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-overexpressing lines show a significantly moderated increment (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.001). This provide compelling evidence that \\u003cem\\u003eBnUNE12\\u003c/em\\u003e mitigates salt-induced membrane oxidative damage, thereby preserving cellular integrity under hyperosmotic challenge.\\u0026nbsp;Salt stress experiments demonstrated that BnUNE12-overexpressing lines significantly reduced (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.001) proline accumulation, which indirectly reflects that salt stress was notably alleviated (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.001). In the current study, no significant differences were observed in the expression levels of ROS-associated genes \\u003cem\\u003eSOD1\\u003c/em\\u003e and \\u003cem\\u003eCAT2\\u003c/em\\u003e between WT and \\u003cem\\u003eBnUNE12\\u003c/em\\u003e-OE lines following salt treatment, implying that the impact of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e overexpression on \\u003cem\\u003eSOD1\\u003c/em\\u003e and \\u003cem\\u003eCAT2\\u003c/em\\u003e expression may involve intricate intrinsic mechanisms. A partial regulatory network involving \\u003cem\\u003eUNE\\u003c/em\\u003e genes and the potential regulatory mechanism by which \\u003cem\\u003eBnUNE12\\u003c/em\\u003e alleviates salt stress, which vividly delineates the rationale underlying this study (Fig. 12). Numerous CAREs distributed in the upstream regions of promoters within the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family are subject to modulation by hormone and environment, while sub-calde Ⅰ members potentially mitigate ROS accumulation which can induce excessive peroxidation of membranes, impairing its barrier integrity, and in turn trigger the SOS signaling as well as elicit the de novo synthesis of large amounts of proline to maintain osmotic homeostasis, ultimately enhancing cellular tolerance to salt stress (Mahajan et al. 2008). Rboh, belonging to the NADPH oxidase family, function in concert with the ROS scavenging system to regulate ROS homeostasis and thus attenuate oxidative damage (Chapman et al. 2019). Among these, RbohE is predominantly expressed in plant roots, and \\u003cem\\u003eAtUNE12\\u003c/em\\u003e has been demonstrated to enhance plant salt tolerance through the RbohE-mediated signaling, a mechanism supported by phylogenetic analyses revealing a high degree of structural conservation between \\u003cem\\u003eBnUNE12\\u003c/em\\u003e and \\u003cem\\u003eAtUNE12\\u003c/em\\u003e and by overexpression assays further corroborating their functional orthology, collectively suggesting that the RbohE signaling represents one of the conserved mechanisms by which \\u003cem\\u003eUNE12\\u003c/em\\u003e confers salt stress alleviation.The ABA regulatory network, which is indispensable for plant adaptive responses to environmental stresses, not only activates the Rboh pathway and modulates stomatal dynamics to mitigate salt stress but also facilitates the transcription of target genes (e.g., \\u003cem\\u003eUNE\\u003c/em\\u003e) via CAREs, thereby orchestrating multiple regulatory cascades that collectively counteract salt stress.\\u003c/p\\u003e\"},{\"header\":\"5. Conclusion\",\"content\":\"\\u003cp\\u003eThis study characterized the \\u003cem\\u003eUNE\\u003c/em\\u003e gene family in \\u003cem\\u003eB. napus\\u003c/em\\u003e. Through in-depth bioinformatic analyses, 21 \\u003cem\\u003eBnUNE\\u003c/em\\u003e genes were identified from the \\u003cem\\u003eB. napus\\u003c/em\\u003e genome, which exhibit a close evolutionary relationship with their orthologs in the ancestral species \\u003cem\\u003eB. rapa\\u003c/em\\u003e and \\u003cem\\u003eB. oleracea\\u003c/em\\u003e, displaying a pattern of parallel evolution. During speciation, these genes underwent structural variations and functional specialization, retaining core functionalities while acquiring species-specific adaptations. The \\u003cem\\u003eUNE\\u003c/em\\u003e family was classified into 6 subclades, showing significant divergence in motif composition, intron distribution, and subcellular localization; notably, certain members of subclade I, due to unique intron insertion events, tend to localize in peroxisomes, implying their potential critical roles in ROS metabolism and detoxification. The \\u003cem\\u003eBnUNE12\\u003c/em\\u003e gene was found to be significantly upregulated under salt stress; overexpression lines of \\u003cem\\u003eBnUNE12\\u003c/em\\u003e, when subjected to 300 mM NaCl treatment, exhibited superior performance compared to controls in biomass traits (root length, fresh weight), membrane lipid peroxidation, proline accumulation, and expression of antioxidant-related genes. These findings demonstrate that \\u003cem\\u003eBnUNE12\\u003c/em\\u003e enhances salt tolerance in \\u003cem\\u003eB. napus\\u003c/em\\u003e by precisely modulating osmotic adjustment and oxidative stress responses, providing valuable genetic resources and a robust theoretical foundation for improving salt tolerance in \\u003cem\\u003eB. napus\\u003c/em\\u003e and advancing stress-resistant molecular breeding. Future investigations into other \\u003cem\\u003eUNE\\u003c/em\\u003e genes and integrated multi-omics approaches will further elucidate the role of this gene family in \\u003cem\\u003eB. napus\\u003c/em\\u003e growth, development, and stress responses, contributing to the sustainable development of the rapeseed industry.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eFUNDING\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eA project supported by Hunan Provincial Natural Science Foundation of China (2023JJ30266), Research Project on teaching reform in Hunan province (HNJG-2022-0791), Rapeseed Industry Germplasm Innovation Project of Hunan Provincial Department of Agriculture (HARS-03).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCOMPLIANCE WITH ETHICAL STANDARDS\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis article does not contain any studies with human participants performed by any of the authors.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCONFLICT OF INTEREST\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no conflicts of interest.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAUTHOR CONTRIBUTIONS\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eConceptualization, X.Z. and L.L.; methodology, F.X. and L.L.; software, F.X. and X.Z.; validation, X.Z., F.X. and Y.Z; formal analysis, F.X. and Y.Z.; investigation, X.Z., F.X., Y.Z. and S.W. \\u0026nbsp; \\u0026nbsp;; resources, L.L. and S.H.; data curation, Y.Z.; writing\\u0026mdash;original draft preparation, X.Z. and F.X.; writing\\u0026mdash;review and editing, L.L. and R.H.; visualization, X.Z. and S.H.; supervision, L.L.; project administration, X.Z. and S.H.; funding acquisition, X.Z. L.L. and S.H. All authors have read and agreed to the published version of the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eDATA AVAILABILITY\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eAbdalla M, Ahmed MA, Cai G, Zarebanadkauki M, Carminati A. (2022). Coupled effects of soil drying and salinity on soil-plant hydraulics. \\u003cem\\u003ePlant physiology\\u003c/em\\u003e, \\u003cem\\u003e190\\u003c/em\\u003e(2), 1228\\u0026ndash;1241. https://doi.org/10.1093/plphys/kiac229\\u003c/li\\u003e\\n\\u003cli\\u003eBailey TL, Johnson J, Grant CE, Noble WS. (2015). The MEME Suite. \\u003cem\\u003eNucleic acids \\u003c/em\\u003eresearch, 43(W1),W39\\u0026ndash;W49. https://doi.org/10.1093/nar/gkv416\\u003c/li\\u003e\\n\\u003cli\\u003eBlum M, Andreeva A, Florentino LC, Chuguransky SR, Grego T, Hobbs E, Pinto BL, Orr A, Paysan-Lafosse T, Ponamareva I, Salazar GA, Bordin N, Bork P, Bridge A, Colwell L, Gough J, Haft DH, Letunic I, Llinares-L\\u0026oacute;pez F, Marchler-Bauer A, \\u0026hellip; Bateman A. (2025). InterPro: the protein sequence classification resource in 2025. \\u003cem\\u003eNucleic acids research\\u003c/em\\u003e, 53(D1), D444 D456. https://doi.org/10.1093/nar/gkae1082\\u003c/li\\u003e\\n\\u003cli\\u003eCampos ML, Kang JH, Howe GA. Jasmonate-Triggered Plant Immunity. \\u003cem\\u003eJ Chem Ecol\\u003c/em\\u003e 40, 657\\u0026ndash;675 (2014). https://doi.org/10.1007/s10886-014-0468-3\\u003c/li\\u003e\\n\\u003cli\\u003eChalhoub B, Denoeud F, Liu S, Parkin IA, Tang H, Wang X, Chiquet J, Belcram H, Tong C, Samans B, Corr\\u0026eacute;a M, Da Silva C, Just J, Falentin C, Koh CS, Le Clainche I, Bernard M, Bento P, Noel B, Labadie K, \\u0026hellip; Wincker P. (2014). Plant genetics. Early allopolyploid evolution in the post-Neolithic \\u003cem\\u003eBrassica napus\\u003c/em\\u003e oilseed genome. \\u003cem\\u003eScience (New York, N.Y.)\\u003c/em\\u003e, \\u003cem\\u003e345\\u003c/em\\u003e(6199), 950\\u0026ndash;953. https://doi.org/10.1126/science.1253435\\u003c/li\\u003e\\n\\u003cli\\u003eChapman JM, Muhlemann JK, Gayomba SR, Muday GK. (2019). RBOH-Dependent ROS Synthesis and ROS Scavenging by Plant Specialized Metabolites To Modulate Plant Development and Stress Responses. Chemical research in toxicology, 32(3), 370\\u0026ndash;396. https://doi.org/10.1021/acs.chemrestox.9b00028 \\u003c/li\\u003e\\n\\u003cli\\u003eChen C, Wu Y, Li J, Wang X, Zeng Z, Xu J, Liu Y, Feng J, Chen H, He Y, Xia R. (2023). TBtools-II: A \\u0026quot;one for all, all for one\\u0026quot; bioinformatics platform for biological big-data mining. \\u003cem\\u003eMolecular plant\\u003c/em\\u003e, 16(11), 1733\\u0026ndash;1742. https://doi.org/10.1016/j.molp.2023.09.010\\u003c/li\\u003e\\n\\u003cli\\u003eCorpas FJ. (2019). Peroxisomes in higher plants: an example of metabolic adaptability. \\u003cem\\u003eBotany Letters\\u003c/em\\u003e, \\u003cem\\u003e166\\u003c/em\\u003e(3), 298\\u0026ndash;308. https://doi.org/10.1080/23818107.2019.1619196\\u003c/li\\u003e\\n\\u003cli\\u003eDai R, Zhan N, Geng R, Xu K, Zhou X, Li L, Yan G, Zhou F, Cai G. (2024). Progress on Salt Tolerance in \\u003cem\\u003eBrassica napus\\u003c/em\\u003e. \\u003cem\\u003ePlants\\u003c/em\\u003e, \\u003cem\\u003e13\\u003c/em\\u003e(14), 1990. https://doi.org/10.3390/plants13141990\\u003c/li\\u003e\\n\\u003cli\\u003eDas Laha S, Dutta S, Sch\\u0026auml;ffner AR, Das M. (2020). Gene duplication and stress genomics in Brassicas: Current understanding and future prospects. \\u003cem\\u003eJournal of plant physiology\\u003c/em\\u003e, \\u003cem\\u003e255\\u003c/em\\u003e, 153293. https://doi.org/10.1016/j.jplph.2020.153293\\u003c/li\\u003e\\n\\u003cli\\u003ede Freitas PAF, de Carvalho HH, Costa JH, Miranda RS, Saraiva KDDC, de Oliveira FDB, Coelho DG, Prisco JT, Gomes-Filho E. (2019). Salt acclimation in sorghum plants by exogenous proline: physiological and biochemical changes and regulation of proline metabolism. \\u003cem\\u003ePlant cell reports\\u003c/em\\u003e, \\u003cem\\u003e38\\u003c/em\\u003e(3), 403\\u0026ndash;416. https://doi.org/10.1007/s00299-019-02382-5\\u003c/li\\u003e\\n\\u003cli\\u003eFerreira de Carvalho J, Lucas J, Deniot G, Falentin C, Filangi O, Gilet M, Legeai F, Lode M, Morice J, Trotoux G, Aury JM, Barbe V, Keller J, Snowdon R, He Z, Denoeud F, Wincker P, Bancroft I, Ch\\u0026egrave;vre AM, Rousseau-Gueutin M. (2019). Cytonuclear interactions remain stable during allopolyploid evolution despite repeated whole-genome duplications in Brassica. \\u003cem\\u003eThe Plant journal : for cell and molecular biology\\u003c/em\\u003e, \\u003cem\\u003e98\\u003c/em\\u003e(3), 434\\u0026ndash;447. https://doi.org/10.1111/tpj.14228\\u003c/li\\u003e\\n\\u003cli\\u003eFujita Y, Fujita M, Satoh R, Maruyama K, Parvez MM, Seki M, Hiratsu K, Ohme-Takagi M, Shinozaki K, Yamaguchi-Shinozaki K. (2005). AREB1 is a transcription activator of novel ABRE-dependent ABA signaling that enhances drought stress tolerance in Arabidopsis. \\u003cem\\u003eThe Plant cell\\u003c/em\\u003e, \\u003cem\\u003e17\\u003c/em\\u003e(12), 3470\\u0026ndash;3488. https://doi.org/10.1105/tpc.105.035659\\u003c/li\\u003e\\n\\u003cli\\u003eHan Q, Tan W, Zhao Y, Yang F, Yao X, Lin H, Zhang D. (2022). Salicylic acid-activated BIN2 phosphorylation of TGA3 promotes Arabidopsis PR gene expression and disease resistance. \\u003cem\\u003eThe EMBO journal\\u003c/em\\u003e, \\u003cem\\u003e41\\u003c/em\\u003e(19), e110682. https://doi.org/10.15252/embj.2022110682 \\u003c/li\\u003e\\n\\u003cli\\u003eHao Y, Zong X, Ren P, Qian Y, Fu A. (2021). Basic Helix-Loop-Helix (bHLH) Transcription Factors Regulate a Wide Range of Functions in \\u003cem\\u003eArabidopsis\\u003c/em\\u003e. \\u003cem\\u003eInternational Journal of Molecular Sciences, 22\\u003c/em\\u003e(13), 7152. https://doi.org/10.3390/ijms22137152\\u003c/li\\u003e\\n\\u003cli\\u003eHasanuzzaman M, Raihan MRH, Masud AAC, Rahman K, Nowroz F, Rahman M, Nahar K, Fujita M. (2021). Regulation of Reactive Oxygen Species and Antioxidant Defense in Plants under Salinity. \\u003cem\\u003eInternational journal of molecular sciences\\u003c/em\\u003e, \\u003cem\\u003e22\\u003c/em\\u003e(17), 9326. https://doi.org/10.3390/ijms22179326 \\u003c/li\\u003e\\n\\u003cli\\u003eHammac WA, Maaz TM, Koenig RT, Burke IC, Pan WL. (2017). Water and Temperature Stresses Impact Canola (Brassica napus L.) Fatty Acid, Protein, and Yield over Nitrogen and Sulfur. \\u003cem\\u003eJournal of agricultural and food chemistry\\u003c/em\\u003e, \\u003cem\\u003e65\\u003c/em\\u003e(48), 10429\\u0026ndash;10438. https://doi.org/10.1021/acs.jafc.7b02778\\u003c/li\\u003e\\n\\u003cli\\u003eHe Z, Wang Z, Nie X, Qu M, Zhao H, Ji X, Wang Y. (2022). UNFERTILIZED EMBRYO SAC 12 phosphorylation plays a crucial role in conferring salt tolerance. \\u003cem\\u003ePlant physiology\\u003c/em\\u003e, \\u003cem\\u003e188\\u003c/em\\u003e(2), 1385\\u0026ndash;1401. https://doi.org/10.1093/plphys/kiab549\\u003c/li\\u003e\\n\\u003cli\\u003eHorton P, Park KJ, Obayashi T, Fujita N, Harada H, Adams-Collier CJ, Nakai K. (2007). WoLF PSORT: protein localization predictor. \\u003cem\\u003eNucleic acids research\\u003c/em\\u003e, \\u003cem\\u003e35\\u003c/em\\u003e(Web Server issue), W585\\u0026ndash;W587. https://doi.org/10.1093/nar/gkm259 \\u003c/li\\u003e\\n\\u003cli\\u003eHosseinifard M, Stefaniak S, Ghorbani Javid M, Soltani E, Wojtyla L, Garnczarska M. (2022). Contribution of Exogenous Proline to Abiotic Stresses Tolerance in Plants: A Review. \\u003cem\\u003eInternational journal of molecular sciences\\u003c/em\\u003e, \\u003cem\\u003e23\\u003c/em\\u003e(9), 5186. https://doi.org/10.3390/ijms23095186 \\u003c/li\\u003e\\n\\u003cli\\u003eJohnson M. A, Harper JF, Palanivelu R. (2019). A Fruitful Journey: Pollen Tube Navigation from Germination to Fertilization. \\u003cem\\u003eAnnual review of plant biology\\u003c/em\\u003e, \\u003cem\\u003e70\\u003c/em\\u003e, 809\\u0026ndash;837. https://doi.org/10.1146/annurev-arplant-050718-100133\\u003c/li\\u003e\\n\\u003cli\\u003eKniuipyte I, Dik\\u0026scaron;aityte A, Praspaliauskas M, Pedi\\u0026scaron;ius N, Žaltauskaite J. (2023). Oilseed rape (Brassica napus L.) potential to remediate Cd contaminated soil under different soil water content. \\u003cem\\u003eJournal of environmental management\\u003c/em\\u003e, 325(Pt A), 116627. https://doi.org/10.1016/j.jenvman.2022.116627\\u003c/li\\u003e\\n\\u003cli\\u003eLescot M, D\\u0026eacute;hais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rouz\\u0026eacute; P, Rombauts S. (2002). PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences.\\u003cem\\u003eNucleic acids research\\u003c/em\\u003e, 30(1),325\\u0026ndash;327. https://doi.org/10.1093/nar/30.1.325\\u003c/li\\u003e\\n\\u003cli\\u003eLi, D, Li YY, Zhou ZC, Xiang X, Liu X, Wang J, Hu ZR, Xiang SP, Li W, Xiao QZ, Wang Y, Hu RS, Zhao Q. (2021). Tobacco transcription factor bHLH123 improves salt tolerance by activating NADPH oxidase NtRbohE expression. \\u003cem\\u003ePlant physiology\\u003c/em\\u003e, \\u003cem\\u003e186\\u003c/em\\u003e(3), 1706\\u0026ndash;1720. https://doi.org/10.1093/plphys/kiab176 \\u003c/li\\u003e\\n\\u003cli\\u003eLiu Y, Wang F, Zhang,A, Chen Z, Luo X, Kong D, Zhang F, Yu X, Liu G, Luo L. (2023). Improvement of Salinity Tolerance in Water-Saving and Drought-Resistance Rice (WDR). \\u003cem\\u003eInternational journal of molecular sciences\\u003c/em\\u003e, \\u003cem\\u003e24\\u003c/em\\u003e(6), 5444. https://doi.org/10.3390/ijms24065444\\u003c/li\\u003e\\n\\u003cli\\u003eLivak KJ, Schmittgen TD. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. \\u003cem\\u003eMethods (San Diego, Calif.)\\u003c/em\\u003e, \\u003cem\\u003e25\\u003c/em\\u003e(4), 402\\u0026ndash;408. https://doi.org/10.1006/meth.2001.1262\\u003c/li\\u003e\\n\\u003cli\\u003eLu S, Wang J, Chitsaz F, Derbyshire MK, Geer RC, Gonzales NR, Gwadz M, Hurwitz DI, Marchler GH, Song JS, Thanki N, Yamashita RA, Yang M, Zhang D, Zheng C, Lanczycki CJ, Marchler-Bauer A. (2020). CDD/SPARCLE: the conserved domain database in 2020. \\u003cem\\u003eNucleic acids research\\u003c/em\\u003e, \\u003cem\\u003e48\\u003c/em\\u003e(D1), D265\\u0026ndash;D268. https://doi.org/10.1093/nar/gkz991\\u003c/li\\u003e\\n\\u003cli\\u003eMahajan S, Pandey GK, Tuteja N. (2008). Calcium- and salt-stress signaling in plants: shedding light on SOS pathway. \\u003cem\\u003eArchives of biochemistry and biophysics\\u003c/em\\u003e, \\u003cem\\u003e471\\u003c/em\\u003e(2), 146\\u0026ndash;158. https://doi.org/10.1016/j.abb.2008.01.010 \\u003c/li\\u003e\\n\\u003cli\\u003eMarchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, Fong JH, Geer LY, Geer RC, Gonzales NR, Gwadz M, Hurwitz DI, Jackson JD, Ke Z, Lanczycki CJ, Lu F, Marchler GH, Mullokandov M, Omelchenko MV, Robertson CL, \\u0026hellip; Bryant SH. (2011). CDD: a Conserved Domain Database for the functional annotation of proteins. \\u003cem\\u003eNucleic acids research\\u003c/em\\u003e, \\u003cem\\u003e39\\u003c/em\\u003e(Database issue), D225\\u0026ndash;D229. https://doi.org/10.1093/nar/gkq1189 \\u003c/li\\u003e\\n\\u003cli\\u003eMichael AK, Stoos L, Crosby P, Eggers N, Nie XY, Makasheva K, Minnich M, Healy KL, Weiss J, Kempf G, Cavadini S, Kater L, Seebacher J, Vecchia L, Chakraborty D, Isbel L, Grand RS, Andersch F, Fribourgh JL, Sch\\u0026uuml;beler D, \\u0026hellip; Thom\\u0026auml; NH. (2023). Cooperation between bHLH transcription factors and histones for DNA access. \\u003cem\\u003eNature\\u003c/em\\u003e, \\u003cem\\u003e619\\u003c/em\\u003e(7969), 385\\u0026ndash;393. https://doi.org/10.1038/s41586-023-06282-3\\u003c/li\\u003e\\n\\u003cli\\u003eMunns R, Passioura JB, Colmer TD, Byrt CS. (2020). Osmotic adjustment and energy limitations to plant growth in saline soil. \\u003cem\\u003eThe New phytologist\\u003c/em\\u003e, \\u003cem\\u003e225\\u003c/em\\u003e(3), 1091\\u0026ndash;1096. https://doi.org/10.1111/nph.15862\\u003c/li\\u003e\\n\\u003cli\\u003eNeik TX, Barbetti MJ, Batley J. (2017). Current Status and Challenges in Identifying Disease Resistance Genes in \\u003cem\\u003eBrassica napus\\u003c/em\\u003e. \\u003cem\\u003eFrontiers in plant science\\u003c/em\\u003e, \\u003cem\\u003e8\\u003c/em\\u003e, 1788. https://doi.org/10.3389/fpls.2017.01788\\u003c/li\\u003e\\n\\u003cli\\u003eNing M, Li Q, Wang Y, Li Q, Tao Y, Zhang F, Hu F, Huang L. (2025). Alternative splicing drives the functional diversification of a bHLH transcription factor in the control of growth and drought tolerance in rice. \\u003cem\\u003eScience bulletin\\u003c/em\\u003e, \\u003cem\\u003e70\\u003c/em\\u003e(2), 153\\u0026ndash;156. https://doi.org/10.1016/j.scib.2024.06.001\\u003c/li\\u003e\\n\\u003cli\\u003ePostiglione AE, Muday GK. (2020). The Role of ROS Homeostasis in ABA-Induced Guard Cell Signaling.\\u003cem\\u003eFrontiers in plant science\\u003c/em\\u003e, \\u003cem\\u003e11\\u003c/em\\u003e, 968. https://doi.org/10.3389/fpls.2020.00968 \\u003c/li\\u003e\\n\\u003cli\\u003eQian Y, Zhang T, Yu Y, Gou L, Yang J, Xu J, Pi E. (2021). Regulatory Mechanisms of bHLH Transcription Factors in Plant Adaptive Responses to Various Abiotic Stresses. \\u003cem\\u003eFrontiers in plant science\\u003c/em\\u003e, \\u003cem\\u003e12\\u003c/em\\u003e, 677611. https://doi.org/10.3389/fpls.2021.677611\\u003c/li\\u003e\\n\\u003cli\\u003eRaboanatahiry N, Li H, Yu L, Li M. (2021). \\u003cem\\u003eB.napus\\u003c/em\\u003e (\\u003cem\\u003eBrassica napus\\u003c/em\\u003e): Processing, Utilization, and Genetic Improvement. \\u003cem\\u003eAgronomy\\u003c/em\\u003e, \\u003cem\\u003e11\\u003c/em\\u003e(9), 1776. https://doi.org/10.3390/agronomy11091776\\u003c/li\\u003e\\n\\u003cli\\u003eReiser L, Bakker E, Subramaniam S, Chen X, Sawant S, Khosa K, Prithvi T, Berardini TZ. (2024). The Arabidopsis Information Resource in 2024. \\u003cem\\u003eGenetics\\u003c/em\\u003e, \\u003cem\\u003e227\\u003c/em\\u003e(1), iyae027. https://doi.org/10.1093/genetics/iyae027 \\u003c/li\\u003e\\n\\u003cli\\u003eSchneider HM, Lor VS, Zhang X, Saengwilai P, Hanlon MT, Klein S. P, Davis JL, Borkar AN, Depew CL, Bennett MJ, Kaeppler SM, Brown KM, Bhosale R, Lynch JP. (2023). Transcription factor bHLH121 regulates root cortical aerenchyma formation in maize. \\u003cem\\u003eProceedings of the National Academy of Sciences of the United States of America\\u003c/em\\u003e, \\u003cem\\u003e120\\u003c/em\\u003e(12), e2219668120. https://doi.org/10.1073/pnas.2219668120\\u003c/li\\u003e\\n\\u003cli\\u003eSharipova G, Ivanov R, Veselov D, Akhiyarova G, Seldimirova O, Galin I, Fricke W, Vysotskaya L, Kudoyarova G. (2022). Effect of Salinity on Stomatal Conductance, Leaf Hydraulic Conductance, HvPIP2 Aquaporin, and Abscisic Acid Abundance in Barley Leaf Cells. \\u003cem\\u003eInternational journal of molecular sciences\\u003c/em\\u003e, \\u003cem\\u003e23\\u003c/em\\u003e(22), 14282. https://doi.org/10.3390/ijms232214282 \\u003c/li\\u003e\\n\\u003cli\\u003eShin JM, Yuan L, Ohme-Takagi M, Kawashima T. (2021). Cellular dynamics of double fertilization and early embryogenesis in flowering plants. \\u003cem\\u003eJournal of experimental zoology. Part B, Molecular and developmental evolution\\u003c/em\\u003e, \\u003cem\\u003e336\\u003c/em\\u003e(8), 642\\u0026ndash;651. https://doi.org/10.1002/jez.b.22981\\u003c/li\\u003e\\n\\u003cli\\u003eShivanna KR, Tandon R. (2020). Developmental biology of dispersed pollen grains. \\u003cem\\u003eThe International journal of developmental biology\\u003c/em\\u003e, \\u003cem\\u003e64\\u003c/em\\u003e(1-2-3), 7\\u0026ndash;19. https://doi.org/10.1387/ijdb.190166ks\\u003c/li\\u003e\\n\\u003cli\\u003eSingh, A.K, Singh, R.P, Singh, S, Rathore, S.S. (2022). Crop Adaptability to Excess Salt. In: Ansari SA, Ansari MI, Husen A. (eds) Augmenting Crop Productivity in Stress Environment\\u003cem\\u003e.\\u003c/em\\u003e Springer, Singapore. https://doi.org/10.1007/978-981-16-6361-1_11\\u003c/li\\u003e\\n\\u003cli\\u003eSkinner DJ, Sundaresan V. (2018). Recent advances in understanding female gametophyte development. \\u003cem\\u003eF1000Research\\u003c/em\\u003e, \\u003cem\\u003e7\\u003c/em\\u003e, F1000 Faculty Rev-804. https://doi.org/10.12688/f1000research.14508.1\\u003c/li\\u003e\\n\\u003cli\\u003eSong C, Guo Y, Shen W, Yao X, Xu H, Zhao Y, Li R, Lin J. (2023). Pag\\u003cem\\u003eUNE\\u003c/em\\u003e12 encodes a basic helix-loop-helix transcription factor that regulates the development of secondary vascular tissue in poplar. \\u003cem\\u003ePlant physiology\\u003c/em\\u003e, 192(2), 1046\\u0026ndash;1062. https://doi.org/10.1093/plphys/kiad152\\u003c/li\\u003e\\n\\u003cli\\u003eSong JM, Liu DX, Xie WZ, Yang Z, Guo L, Liu K, Yang QY, Chen LL. (2021). BnPIR: Brassica napus pan-genome information resource for 1689 accessions. \\u003cem\\u003ePlant biotechnology journal\\u003c/em\\u003e, \\u003cem\\u003e19\\u003c/em\\u003e(3), 412\\u0026ndash;414. https://doi.org/10.1111/pbi.13491 \\u003c/li\\u003e\\n\\u003cli\\u003eSun X, Wang Y, Sui N. (2018). Transcriptional regulation of bHLH during plant response to stress. \\u003cem\\u003eBiochemical and biophysical research communications\\u003c/em\\u003e, \\u003cem\\u003e503\\u003c/em\\u003e(2), 397\\u0026ndash;401. https://doi.org/10.1016/j.bbrc.2018.07.123 \\u003c/li\\u003e\\n\\u003cli\\u003eTamura K, Stecher G, Kumar S. (2021). MEGA11: Molecular Evolutionary Genetics Analysis Version 11. \\u003cem\\u003eMolecular biology and evolution\\u003c/em\\u003e, 38(7), 3022 3027. https://doi.org/10.1093/molbev/msab120\\u003c/li\\u003e\\n\\u003cli\\u003eThomas PD, Ebert D, Muruganujan A, Mushayahama T, Albou LP, Mi H. (2022). PANTHER: Making genome-scale phylogenetics accessible to all. \\u003cem\\u003eProtein science : a publication of the Protein Society\\u003c/em\\u003e, \\u003cem\\u003e31\\u003c/em\\u003e(1), 8\\u0026ndash;22. https://doi.org/10.1002/pro.4218 \\u003c/li\\u003e\\n\\u003cli\\u003eToledo-Ortiz G, Johansson H, Lee KP, Bou-Torrent J, Stewart K, Steel G, Rodr\\u0026iacute;guez-Concepci\\u0026oacute;n M, Halliday KJ. (2014). The HY5-PIF regulatory module coordinates light and temperature control of photosynthetic gene transcription. \\u003cem\\u003ePLoS genetics\\u003c/em\\u003e, \\u003cem\\u003e10\\u003c/em\\u003e(6), e1004416. https://doi.org/10.1371/journal.pgen.1004416\\u003c/li\\u003e\\n\\u003cli\\u003eTripathi D, Raikhy G, Kumar D. (2019). Chemical elicitors of systemic acquired resistance\\u0026mdash;Salicylic acid and its functional analogs. \\u003cem\\u003eCurrent Plant Biology, 17\\u003c/em\\u003e, 48-59. https://doi.org/10.1016/j.cpb.2019.03.002\\u003c/li\\u003e\\n\\u003cli\\u003eTsikas D. (2017). Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: Analytical and biological challenges. \\u003cem\\u003eAnalytical biochemistry\\u003c/em\\u003e, \\u003cem\\u003e524\\u003c/em\\u003e, 13\\u0026ndash;30. https://doi.org/10.1016/j.ab.2016.10.021\\u003c/li\\u003e\\n\\u003cli\\u003eWang GZ, Ni G, Feng G, Burrill HM, Li J, Zhang J, Zhang F. (2024). Saline-alkali soil reclamation and utilization in China: progress and prospects. \\u003cem\\u003eFrontiers of Agricultural Science and Engineering, 11\\u003c/em\\u003e(2), 216-228. https://doi.org/10.15302/J-FASE-2024551 \\u003c/li\\u003e\\n\\u003cli\\u003eWani KI, Naeem M, Castroverde CDM, Kalaji HM, Albaqami M, Aftab T. (2021). Molecular Mechanisms of Nitric Oxide (NO) Signaling and Reactive Oxygen Species (ROS) Homeostasis during Abiotic Stresses in Plants. \\u003cem\\u003eInternational journal of molecular sciences\\u003c/em\\u003e, \\u003cem\\u003e22\\u003c/em\\u003e(17), 9656. https://doi.org/10.3390/ijms22179656\\u003c/li\\u003e\\n\\u003cli\\u003eWilkins MR, Gasteiger E, Bairoch A, Sanchez JC, Williams KL, Appel RD, Hochstrasser DF. (1999). Protein identification and analysis tools in the ExPASy server. \\u003cem\\u003eMethods in molecular biology (Clifton, N.J.)\\u003c/em\\u003e, \\u003cem\\u003e112\\u003c/em\\u003e, 531\\u0026ndash;552. https://doi.org/10.1385/1-59259-584-7:531\\u003c/li\\u003e\\n\\u003cli\\u003eWu H, Guo J, Wang C, Li K, Zhang X, Yang Z, Li M, Wang B. (2019). An Effective Screening Method and a Reliable Screening Trait for Salt Tolerance of \\u003cem\\u003eBrassica napus\\u003c/em\\u003e at the Germination Stage. \\u003cem\\u003eFrontiers in plant science\\u003c/em\\u003e, \\u003cem\\u003e10\\u003c/em\\u003e, 530. https://doi.org/10.3389/fpls.2019.00530 \\u003c/li\\u003e\\n\\u003cli\\u003eXie J, Chen Y, Cai G, Cai R, Hu Z, Wang H. (2023). Tree Visualization By One Table (tvBOT): a web application for visualizing, modifying and annotating phylogenetic trees. \\u003cem\\u003eNucleic acids research\\u003c/em\\u003e, 51(W1), W587\\u0026ndash;W592. https://doi.org/10.1093/nar/gkad359\\u003c/li\\u003e\\n\\u003cli\\u003eYang Z, Wang S, Wei L, Huang Y, Liu D, Jia Y, Luo C, Lin Y, Liang C, Hu Y, Dai C, Guo L, Zhou Y, Yang QY. (2023). BnIR: A multi-om ics database with various tools for Brassica napus research and breeding. \\u003cem\\u003eMolecular plant\\u003c/em\\u003e, 16(4), 775 789. https://doi.org/10.1016/j.molp.2023.03.007\\u003c/li\\u003e\\n\\u003cli\\u003eYates, A. D., Allen, J., Amode, R. M., Azov, A. G., Barba, M., Becerra, A., Bhai, J., Campbell, L. I., Carbajo Martinez, M., Chakiachvili, M., Chougule, K., Christensen, M., Contreras-Moreira, B., Cuzick, A., Da Rin Fioretto, L., Davis, P., De Silva, N. H., Diamantakis, S., Dyer, S., Elser, J., \\u0026hellip; Flicek, P. (2022). Ensembl Genomes 2022: an expanding genome resource for non-vertebrates. \\u003cem\\u003eNucleic acids research\\u003c/em\\u003e, \\u003cem\\u003e50\\u003c/em\\u003e(D1), D996\\u0026ndash;D1003. https://doi.org/10.1093/nar/gkab1007 \\u003c/li\\u003e\\n\\u003cli\\u003eYu J, Cang J, Lu Q, Fan B, Xu Q, Li W, Wang X. (2020). ABA enhanced cold tolerance of wheat \\u0026apos;dn1\\u0026apos; via increasing ROS scavenging system. \\u003cem\\u003ePlant signaling \\u0026amp; behavior\\u003c/em\\u003e, \\u003cem\\u003e15\\u003c/em\\u003e(8), 1780403. https://doi.org/10.1080/15592324.2020.1780403\\u003c/li\\u003e\\n\\u003cli\\u003eZhai Y, Zhang L, Xia C, Fu S, Zhao G, Jia J, Kong X. (2016). The wheat transcription factor, TabHLH39, improves tolerance to multiple abiotic stressors in transgenic plants. \\u003cem\\u003eBiochemical and biophysical research communications\\u003c/em\\u003e, \\u003cem\\u003e473\\u003c/em\\u003e(4), 1321\\u0026ndash;1327. https://doi.org/10.1016/j.bbrc.2016.04.071 \\u003c/li\\u003e\\n\\u003cli\\u003eZhang H, Guo J, Chen X, Zhou Y, Pei Y, Chen L, Ul Haq S, Lu M, Gong H, Chen R. (2022). Pepper bHLH transcription factor \\u003cem\\u003eCabHLH035\\u003c/em\\u003e contributes to salt tolerance by modulating ion homeostasis and proline biosynthesis. \\u003cem\\u003eHorticulture research\\u003c/em\\u003e, \\u003cem\\u003e9\\u003c/em\\u003e, uhac203. https://doi.org/10.1093/hr/uhac203\\u003c/li\\u003e\\n\\u003cli\\u003eZhang K, Shi Y, Cui X, Yue P, Li K, Liu X, Tripathi BM, Chu H. (2019). Salinity Is a Key Determinant for Soil Microbial Communities in a Desert Ecosystem. \\u003cem\\u003emSystems\\u003c/em\\u003e, \\u003cem\\u003e4\\u003c/em\\u003e(1), e00225-18. https://doi.org/10.1128/mSystems.00225-18 \\u003c/li\\u003e\\n\\u003cli\\u003eZhang WW, Wang C, Xue R, Wang LJ. (2019). Effects of salinity on the soil microbial community and soil fertility. \\u003cem\\u003eJournal of Integrative Agriculture\\u003c/em\\u003e, 18(6), 1360\\u0026ndash;1368. https://doi.org/10.1016/S2095-3119(18)62077-5\\u003c/li\\u003e\\n\\u003cli\\u003eZhao Q, Nakashima J, Chen F, Yin Y, Fu C, Yun J, Shao H, Wang X, Wang ZY, Dixon RA. (2013). Laccase is necessary and nonredundant with peroxidase for lignin polymerization during vascular development in Arabidopsis.\\u003cem\\u003eThe Plant cell\\u003c/em\\u003e, \\u003cem\\u003e25\\u003c/em\\u003e(10), 3976\\u0026ndash;3987. https://doi.org/10.1105/tpc.113.117770 \\u003c/li\\u003e\\n\\u003cli\\u003eZhao X, Wang Q, Yan C, Sun Q, Wang J, Li C, Yuan C, Mou,Y, Shan S. (2024). The bHLH transcription factor AhbHLH121 improves salt tolerance in peanut. \\u003cem\\u003eInternational journal of biological macromolecules\\u003c/em\\u003e, \\u003cem\\u003e256\\u003c/em\\u003e(Pt 2), 128492. https://doi.org/10.1016/j.ijbiomac.2023.128492 \\u003c/li\\u003e\\n\\u003cli\\u003eZhou H, Shi H, Yang Y, Feng X, Chen X, Xiao F, Lin H, Guo Y. (2024). Insights into plant salt stress signaling and tolerance. \\u003cem\\u003eJournal of genetics and genomics = Yi chuan xue bao\\u003c/em\\u003e, \\u003cem\\u003e51\\u003c/em\\u003e(1), 16\\u0026ndash;34. https://doi.org/10.1016/j.jgg.2023.08.007\\u003c/li\\u003e\\n\\u003cli\\u003eZimmermann I. M Heim MA, Weisshaar B, Uhrig JF. (2004). Comprehensive identification of \\u003cem\\u003eArabidopsis thaliana\\u003c/em\\u003e MYB transcription factors interacting with R/B-like BHLH proteins. \\u003cem\\u003eThe Plant Journal, 40\\u003c/em\\u003e(2), 22\\u0026ndash;34. https://doi.org/10.1111/j.1365-313X.2004.02183.x\\u003c/li\\u003e\\n\\u003cli\\u003eZou S, Liu Y, Zhang C, Yu S, Liang Y. (2015). Bet3 participates in autophagy through GTPase Ypt1 in Saccharomyces cerevisiae. \\u003cem\\u003eCell biology international\\u003c/em\\u003e, \\u003cem\\u003e39\\u003c/em\\u003e(4), 466\\u0026ndash;474. https://doi.org/10.1002/cbin.10416\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Brassica napus, UNE, Bioinformatics analysis, Gene overexpression, Salt stress\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-7238593/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-7238593/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eSalt stress inhibits the growth, development, yield, and quality formation of the oilseed crop (rapeseed). This study identifies salt tolerance determinants within the UNE gene family of Brassica napus through integrated genomic and functional analyses. Genome-wide characterization revealed 21 BnUNE genes exhibiting structural diversification and parallel evolution with orthologs in Brassica rapa and Brassica oleracea, while core functional domains remained conserved. Phylogenetic analysis classified BnUNEs into 6 subclades with distinct motif architectures, intron/exon patterns, and predicted subcellular localization. Notably, subclade I members showed unique intron insertions and peroxisomal targeting, suggesting specialized roles in reactive oxygen species (ROS) metabolism and detoxification. Functional validation demonstrated that under 300 mM NaCl stress, transgenic lines BnUNE12-OE exhibited significantly enhanced salt tolerance compared to wild-type (WT) plants. The results that increased root length and fresh weight (37.2% and 29.8%), reduced the malondialdehyde (MDA) content (31.5%), elevated proline accumulation (2.3-fold), upregulated antioxidant genes (SOD1, CAT2). The study demonstrates that BnUNE12 significantly enhances salt stress tolerance in B. napus by synergistically regulating osmotic balance (promoting proline accumulation) and alleviating oxidative stress (enhancing ROS detoxification capacity). This work elucidated the adaptive evolution of the UNE gene family within the Brassica genus, and established BnUNE12 as a key molecular target for breeding salt tolerant rapeseed cultivars, providing a valuable genetic resource for molecular breeding of stress-resistant crops.\\u003c/p\\u003e\",\"manuscriptTitle\":\"UNE Gene Family Analysis and Overexpression of UNE12 Enhances Salt Resistance in Brassica napus\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-08-29 09:04:28\",\"doi\":\"10.21203/rs.3.rs-7238593/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"3861de19-0220-4b29-a23b-945785c9c1ca\",\"owner\":[],\"postedDate\":\"August 29th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-11-13T12:31:22+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-08-29 09:04:28\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-7238593\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-7238593\",\"identity\":\"rs-7238593\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}