{"paper_id":"03b73502-757b-4384-ab60-d05a39eb9635","body_text":"Differential expression and prognostic value of proliferation markers in different histological types of ovarian cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Differential expression and prognostic value of proliferation markers in different histological types of ovarian cancer yurong wang, xia li This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3693253/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Purpose We will assess the expression of the Ki67 antigen in different histological types ofepithelial ovarian cancer and its correlation with pathological and clinical characteristics,and explore the clinical value of Ki67 antigen as a proliferation marker for diagnosis and prognosis. Methods The GEPIA and GEO databases was used to assessed the mRNA expression of MKI67 in ovarian cancer. The expression of MKI67 in both normal and cancerous ovarian cells was assessed using qRT-PCR. Immunohistochemical staining was detected the expression of Ki67 protein in 104 ovarian cancers,general information was gathered,such as the age of each patient to analyze the connection between the expression of Ki67 and the clinicopathological features of the patients. Kaplan-Meier analysis examines the relationship between ovarian cancer patients' prognosis and Ki67 expression. Results Ki67 was overexpressed in carcinoma ovarian cells and tissues compared with normal cells and tissues. Ki67 expression was significantly associated with FIGO stage (P<0.001), histologic subtype (P<0.001), involvement of unilateral/bilateral(P=0.007), and presence of lymph node metastasis(P=0.014). However, there was no association with other prognostic variables such age,tumor nature,or serum CA125. The expression of Ki67 was significantly different between serous carcinoma and endometrioid carcinoma (P=0.007) 、clear cell carcinoma (P <0.001). Moreover, its expression was significantly different between FIGO stage III and stages I (P=0.002) 、stage II (P=0.008). According to Kaplan-Meier analysis,the 3-year survival rate and PFS in the Ki67 high expression group were considerably poorer than in the low expression group (P<0.05). Conclusions In the tissues of ovarian cancer, Ki67 was highly expressed, and its expression levels was closely correlated with clinicopathological features including tumor FIGO stage, histologic subtype, unilateral / bilateral involvement, and lymph node metastasis. Patients with high expression have a reduced survival rate and a worse prognosis. Inactivation of the proliferation marker Ki67 will lead to proliferative cell-specific death, therefore maybe a potential strategy for ovarian cancer. Epithelial ovarian cancer Ki67 Proliferation Prognosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Ovarian cancer(OC),with the third-highest incidence rate among all gynecological malignancies,is one of the three principal malignant tumors of the female reproductive system,behind only uterine body cancer and cervical cancer [1] .80-95% of ovarian malignant tumors are epithelial ovarian cancer(EOC),which are the most prevalent pathological type of ovarian cancer. There are primarily five subtypes of ovarian cancer in histology:mucinous ovarian cancer,clear cell carcinoma, endometrioid carcinoma, low-grade serous carcinoma, and high-grade serous carcinoma, with incidence rates in turn 2.4%、5%、10%、70% [2] .Due to the ovary's deep pelvic location and the lack of early detection techniques, 60–70% of diagnoses take place after the tumor has reached an advanced stage (FIGO III/IV) and developed distant metastases [3] ,and among all gynecological cancers, ovarian cancer has the greatest fatality rate [4] . Cell proliferation plays a significant influence in the behavior, invasiveness, and susceptibility to chemotherapy of ovarian cancer. Determining proliferative activity is crucial for diagnosis and prognosis, and there are several ways to calculate the proliferation index [5] .Ki67, encoded by the MKI 67 gene, is a nuclear localization protein closely related to cell proliferation that is present in all active stages of the cell cycle but not in quiescent cells [6] . In contrast to surface epithelial-derived benign or borderline tumors, Ki67 antigen is overexpressed in malignant ovarian tumors. High expression of Ki67 antigen is associated with tumor aggressiveness, tumor metastasis, preserved tumor prognosis and poor response to chemotherapy, and its expression can be used as a diagnostic and prognostic tool to guide the clinical treatment of ovarian cancer [7, 8] . In this investigation,we will assess the expression of the Ki67 antigen in epithelial ovarian cancer and its correlation with pathological and clinical characteristics,and explore the clinical value of Ki67 antigen as a proliferation marker for diagnosis and prognosis. Materials And Methods Data acquisition In this study, GEPIA database (http://gepia.cancer-pku.cn/) was used to analyze the differential expression of Ki67 protein in ovarian cancer (p <0.01 & log2 | fold change |> 1 as the cut-off value), MKI67 in ovarian cancer tissues and normal tissues. Six datasets of ovarian cancer (GSE18520, GSE9891, GSE44104, GSE26193, GSE6008, GSE68335) were obtained from the GEO database (https://www.ncbi.nlm.nih.gov/geo/), A total of 719 samples (705 ovarian cancer samples, Normal tissue samples in 14 cases), multi-array mean expression measure (RMA) background correction, normalization, log2 conversion were performed for each GEO raw data using the \"limma\" software package of R software (version 4.2.2). Lastly, the “sva” R package was applied to eliminate differences between the 705 OV patient and 14 healthy control samples. And combining the expression of MKI67 with the clinicopathological information in the datasets. Using the online Kaplan-Meier plotter(http://kmplot.com/), the association between MKI67 gene expression and overall survival (OS), progression-free survival (PFS), and post-progression survival (PPS) in patients with ovarian cancer was examined. Sample collection In this study, including 104 epithelial ovarian cancer patients (73 serous cancer, 14 endometrioid cancer, 12 clear cell cancer, 5 mucinous cancer). While patients with other types of malignancies were excluded. Ovarian cancer tissues were obtained from ovarian cancer patients who had been subjected to surgical resection and were pathologically confirmed at the Affiliated Cancer Hospital of Xinjiang Medical University between 2016 and 2018. All of the patients used in our study were newly diagnosed with EOC and received no treatment before sample collection. The informed consent form and permission to utilize the tissue sections for study were approved by the Affiliated Cancer Hospital Ethics Committee of Xinjiang Medical University. Cell culture Human ovarian cancer cells (ascites source) SKOV3 and HO8910 were purchased from Xiangya Cell Bank of Central South University. Human ovarian cancer cell A2780 (source of solid tumors) was a gift from the research group of Yin Gang, Dean of Pathology, School of Basic Medicine, Xiangya School of Medicine, Central South University. The IOSE80 of human normal ovarian cells was presented by Professor Cheng Yan's research group from the Third Xiangya Hospital of Central South University. The same medium: RPMI-1640, FBS (10%), 100U / ml penicillin (1%), 100 mg/ml streptomycin (1%), and 5% CO 2 at 37 ° C were used to cultivate these cell lines. Reverse transcription-quantitative polymerase chain reaction (qRT-PCR) Following the manufacturer's instructions, total RNA was extracted from cell lines using the Reverse Transcription Kit (Vazyme, China). The extracted RNA was reverse transcribed into complementary DNA (cDNA) using HisScript Ⅱ (Vazyme, China). The ChamQ Uniwersal SYBR qPCR Master Mix kit was utilized for conducting quantitative real-time PCR reaction experiments, with β-actin as an internal reference, and the data were analyzed using the 2 -△△Ct method. The primer sequences are shown in Table 1. Table 1 qRT-PCR primer sequences Name Primer sequences MKI67-F AGGGAAAGGAGAAGCAGGAAATT MKI67-R TGTCCTCAGCCTTCTTTGGATTT β-actin-F CATGTACGTTGCTATCCAGGC β-actin-R CTCCTTAATGTCACGCACGAT Immunohistochemistry (IHC) Fresh ovarian cancer tissue obtained surgically removed was fixed in 10% formalin and paraffin embedding;serial sections with a thickness of 4μm were deparaffinized by incubation in xylene,and rehydrated in a succession of ethanol-water solutions that were graded, endogenous peroxidase activity was blocked by soaking in 3% hydrogen peroxide for 20min. After that, the sections were treated for 20 minutes at high temperatures in EDTA buffer (pH 9.0) in order to extract the antigen. After being rinsed in phosphate-buffered saline (PBS) (pH=7.2), the sections were add 5% BSA 37℃ blocking for 30min, then incubated with 1:100 dilution of mouse anti-human Ki67 monoclonal antibody (ZSGB-BIO, China) for 4℃ overnight. After bleaching in PBS buffer the next day, sheep anti-mouse secondary antibody (ZSGB-BIO, China) was added for 37℃ for 30min, and DAB solution (1:50) was developed for 5min. Hematoxylin counterstaining, ethanol gradient dehydration, transparent, neutral resin sealing sheet, microscopic observation and photographed. Quantitatively the Proliferative Index (PI)was expressed as Ki-67 labeling index(LI) when percentage of positively stained cells per 100 epithelial cells after counting at least 1000 cells in each case using high power objective of the microscope (x400). After going through several studies, the Ki-67 LI was grouped as high LI (>50% immunoreactive cells are positive) and low LI (<50% immunoreactive cells are positive) as there is no international consensus on cutoff value for percentage of expression. Follow-up Patients with ovarian cancer were followed up at 3 years after surgery, and their survival was recorded with the date of follow Beginning on day 1 postoperative, the follow-up period was completed until 31 December 2021 or with patient death as the endpoint event. Statistical analysis Data analysis was performed using the SPSS 27.0 software and GraphPad Prism 8.0. Measurement data are expressed as mean ± standard deviation ((x ± s).The associations between clinic-pathological data and protein expression levels were evaluated using chi-square or Fisher's exact tests. The association between Ki67 expression and the prognosis of patients with ovarian cancer was analyzed using Kaplan-Meier curves. T-test and ANOVA are employed if differences between groups are conform to normality, and if they are not conform, Kruskal-Wallis test is used, and p <0.05 was the threshold for statistical significance.(*P<0.05；**P<0.01；***P<0.001；****P<0.0001). Results 2.1 Database data analysis the expression and clinical significance of MKI67 in ovarian cancer The GEPIA database and the Kaplan-Meier plotter database online analysis is indicated: Compared to normal ovarian tissues, ovarian cancer tissues MKI67 was higher expressed. (Figure 1A、1B, log2FC cut-off value >1, P <0.01). Ovarian cancer patients with high MKI67 expression, overall survival (OS) (Figure 1C, HR=1.23, P=0.00079), progression-free survival (PFS) (Figure 1D, HR=1.17, and P=0.028) and post-progression survival (PPS) (Figure 1E, HR=1.22, P=0.042) were significantly shorter than those with low MKI 67 expression. It esting that high expression of MKI67 is substantially associated with poor prognosis of patients. Integrating six ovarian cancer datasets from the GEO database, the statistical analysis of several histological subtypes of epithelial ovarian carcinoma (serous carcinoma, endometrioid carcinoma, clear cell carcinoma, mucinous carcinoma) and various FIGO stages was indicated: compared with normal ovarian tissue, MKI67 mRNA expression was increased in serous carcinoma, endometrioid carcinoma, clear cell carcinoma, and mucinous carcinoma (Figure 2A). However, the difference in MKI67 expression between the subtypes was not statistically significant. In the different FIGO stages of ovarian cancer, the expression of MKI67 was significantly different between the early stage (FIGO I/II) and advanced stage (FIGO III/IV) in serous carcinoma (Figure 2B), clear cell carcinoma (Figure 2D). There was no significant difference in expression between early and late stages with endometrioid carcinoma (Figure 2C) and mucinous carcinoma (Figure 2E). 2.2 MKI67 expression in normal ovarian cells and ovarian cancer cells The mRNA expression levels of MKI67 in human normal ovarian cells IOSE80 and ovarian cancer cells SKOV3, HO8910, A2780 were determined by qRT-PCR is shown in Figure 3. It can be concluded higher expression of MKI67 in ovarian cancer cells SKOV3, HO8910, and A2780 than in normal ovarian cells IOSE80. 2.3 Correlation of Ki67 expression with clinicopathologic variables in EOC The correlation of Ki67 expression with clinicopathologic variables is summarized in Table 2. It was found that Ki67 expression was significantly associated with FIGO stage (P<0.001), histologic subtype (P<0.001), involvement of unilateral/bilateral(P=0.007), and presence of lymph node metastasis(P=0.014). However, there was no association with other prognostic variables such age,tumor nature,or serum CA125. 2.4 Ki67 expression in the tissues of ovarian cancer and its prognostic relationship with ovarian cancer patients The expression of Ki67 was studied in 104 epithelial ovarian cancer patients by immunohistochemistry (Figure 4, Figure 5). 13 of the 73 serous carcinomas showed low expression, while 60 had high expression; Of the 14 endometrioid carcinomas, half had high expression and the other low. 12 clear cell carcinomas they had 9 of low expression and 3 of high expression; 5 mucinous carcinomas they had 3 of low expression and 2 of high expression. In the histological subtypes, mean Ki67 expression was highest in serous carcinomas (66.92±14.50) and lowest in clear cell carcinomas (45.83±13.79). Its expression was significantly different between serous carcinoma and endometrioid carcinoma (P=0.007) 、clear cell carcinoma (P <0.001). In the FIGO stage, the expression of mean Ki67 was highest in stage III (67.64±14.37), which was significantly different between stage III and stage I (P=0.002) 、stage II (P=0.008), as shown in Table 2、Table 3. Table 2 Ki67 expression and clinicopathological features in ovarian cancer patients / n (%) Characteristics Expression of Ki67 c 2 P Low（n=32） High（n=72） Age（years） ≥50 17（30.36） 39（69.64） 0.010 0.992 <50 15（31.25） 33（68.75） Tumour nature Solid 3（13.64） 19（86.36） 3.979 0.137 Solid and cystic 22（34.38） 42（65.62） Cystic 7（38.89） 11（61.11） Laterality Unilateral 22（43.14） 29（56.86） 7.186 0.007 Bilateral 10（18.87） 43（81.13） Histologic subtype Serous carcinoma(SC) 13（17.81） 60（82.19） 20.355 <0.001 Endometrioid carcinoma(EC) 7（50.00） 7（50.00） Clear cell carcinoma(CC) 9（75.00） 3（25.00） Mucinous carcinoma(MC) 3（60.00） 2（40.00） FIGO stage I 11（64.71） 6（35.29） 23.939 <0.001 II 13（48.15） 14（51.85） III 8（15.09） 45（84.91） IV 0（0.00） 7（100.00） Lymphatic metastasis Present 3（11.54） 23（88.46） 6.019 0.014 Absent 29（37.18） 49（62.82） CA125 levels(U/ml) >35 27（28.42） 68（71.58） 1.711 0.191 <35 5（55.56） 4（44.44） Table 3 Expression levels of Ki67 in different histological subtypes and FIGO stages Variable Ki67 LI: percentage of cells staining Median（`x±s） P Histologic subtype Serous carcinoma(SC) （66.92±14.50） <0.001 Endometrioid carcinoma(EC) （52.86±15.41） Clear cell carcinoma(CC) （45.83±13.79） Mucinous carcinoma(MC) （52.00±8.37） FIGO stage I （51.76±16.67） <0.001 II （55.93±16.47） III （67.64±14.37） IV （65.71±7.89） Relation between expression levels of Ki67 and 3-year survival of ovarian cancer in these patients: the 3-year follow-up results showed that 56 of 104 patients survived and 48 died, with a survival rate of 53.85% (56/104). According to the Kaplan-Meier survival curve analysis, the 3-year survival rate of the high Ki67 expression group of 48.61% (35/72) was significantly lower compared to the low expression group's 65.63% (21/32) .(Log rank c 2 =4.207，P=0.04),as Figure 6A. The relationship between Ki67expression level and PFS in ovarian cancer: 30 of 104 patients progressed, 74 did not, with a PFS of 71.20% (74/104). Kaplan-Meier survival curve analysis showed that the PFS of Ki67 high expression was 65.28% (47/72) and significantly lower than the low expression with 84.38%(27/32). (Log rank c 2 =4.446, P=0.035),as Figure 6B. Discussion Ovarian cancer has always been the most lethal gynecological malignancy in women in the world, and can occur at various ages, more than 80% of which are epithelial ovarian cancer, and the pathological histology is relatively diverse [2] . Ovarian cancer is usually asymptomatic early, in the later, it causes some gastrointestinal symptoms such anemia, weight loss, abdominal distension, lower abdominal discomfort, and appetite loss [9] . It has been reported that 74% of patients were diagnosed at the advanced stage because of the insidious onset of ovarian cancer, and the survival rate of patients with advanced ovarian cancer has not improved significantly in nearly 30 years due to the lack of effective treatment for advanced cases [10, 11] . At present, although pathological examination is the gold standard for the diagnosis of ovarian cancer, it is not conducive to early screening because it is an invasive examination. In recent years, along with the ongoing advancement of clinical molecular subtyping research, an increasing number of molecular genes have been identified as special biological markers for tumor diagnosis and prognosis. If clinical can explore a molecular markers closely linked with ovarian cancer prognosis, can provide effective guidance for clinical targeted treatment, so as to reduce the occurrence of poor prognosis. The Ki67 antigen was originally discovered in the 1980s and the protein was defined by the prototype monoclonal antibody Ki67, produced by immunization mice with the nucleus of the Hodgkin's lymphoma cell line L428 [12] . According to the results of cell cycle studies, Ki67 antigen was expressed in G1, S, G2 (cell division cycle) or in mitotic nucleus, but not in resting cells in G0 phase [13] . In this study, qRT-PCR was used to measure the expression of MKI67 mRNA in both ovarian cancer and normal cells, and we came to the conclusion that its expression was substantially higher in ovarian cancer cells than in normal ovarian cells. Ki67 expression was higher in epithelial ovarian cancer than in both benign and borderline tumors [14, 15] . Mahadevappa A et al. studied 40 epithelial ovarian tumors and found that the mean Ki67 marker index was highest in serous carcinoma (65.03±21.67) and lowest in transitional cell carcinoma. They also recorded no significant correlation of CA125 levels with the expression of Ki67. In our study was also observed the expression of Ki67 was highest in serous carcinoma (66.92±14.50) and no correlation between its expression and CA125 levels. Many studies have reported differences in Ki67 expression in different histological subtypes and showed different distribution of immunostaining in serous, endometrioid, clear cell, mucinous [16-18] . In a retrospective study of 500 ovarian tumors by Kobel et al, Ki67 immunohistochemical expression and other biomarkers were evaluated and yielded significant differences in proliferation index between the different subtypes [19] . In this study ,we found that Ki67 expression was significantly different in histological subtypes, and its expression was statistically significant between serous carcinoma and endometrioid carcinoma, clear cell carcinoma. In addition,we also found that in the FIGO stage, the expression of mean Ki67 was highest in stage III (67.64±14.37), which was significantly different between stage III and stage I (P=0.002) 、stage II (P=0.008). Several studies have examined the association between Ki67 antigen expression and long-term survival, reporting that the proliferation index is a good prognostic predictor in epithelial ovarian cancer patients. The ovarian cancer patients with high Ki67 expression had a poor median survival than tumor patients with low Ki67 expression [16, 20] . Our study also reached a similar conclusion that both 3-year survival and PFS were lower in the high Ki67 expression group than in the low Ki67 expression group. The evaluation of the proliferation index by Ki67 expression determines the proliferative potential of epithelial ovarian cancer in the diagnosis of different histological subtypes, high grade and advanced stages, which helps to tailor the postoperative chemotherapy regimen and thus improve the prognosis. Recent studies suggest that since Ki67 is ubiquitously expressed in all proliferating cells, it may be an attractive therapeutic target for cancer [21] . Inactivation of the proliferation marker Ki67 will lead to proliferative cell-specific death, therefore it could be a potential strategy to treating ovarian cancer as well as numerous other malignancies. Declarations ACKNOWLEDGMENTS We would like to thank everyone who provided assistance to us when we were writing this manuscript. Thanks to all the peer reviewers for their opinions and suggestions. ETHICS STATEMENT The studies involving human participants were reviewed and approved by the Affiliated Cancer Hospital Ethics Committee of Xinjiang Medical University. FUNDING The Natural Science Foundation of the Xinjiang Uygur Autonomous Region provided funding for this research. (Grant No.: 2018D01C273). DATA AVAILABILITY Expression profile data analyzed in this study were obtained from Gene Expression Omnibus (GEO) at GSE18520, GSE9891, GSE44104, GSE26193, GSE6008 and GSE68335. CONFLICT OF INTEREST The authors declare no potential conflicts of interest. References Ordulu Z, Watkins J, Ritterhouse LL. Molecular Pathology of Ovarian Epithelial Neoplasms: Predictive, Prognostic, and Emerging Biomarkers[J]. Surgical Pathology Clinics, 2021,14(3):415-428. Lheureux S, Braunstein M, Oza AM. Epithelial ovarian cancer: Evolution of management in the era of precision medicine[J]. Ca-Cancer J Clin, 2019,69(4):280-304. Maringe C, Walters S, Butler J, et al. Stage at diagnosis and ovarian cancer survival: Evidence from the International Cancer Benchmarking Partnership[J]. Gynecol Oncol, 2012,127(1):75-82. Siegel RL, Miller KD, Fuchs HE, et al. Cancer statistics, 2022[J]. Ca-Cancer J Clin, 2022,72(1):7-33. Mahadevappa A, Krishna SM, Vimala MG. Diagnostic and Prognostic Significance of Ki-67 Immunohistochemical Expression in Surface Epithelial Ovarian Carcinoma[J]. J Clin Diagn Res, 2017,11(2):EC08-EC12. Scholzen T, Gerdes J. The Ki-67 protein: from the known and the unknown[J]. J Cell Physiol, 2000,182(3):311-22. Ibrahim TR, Raouf SMA, Abdelgawad M, et al. Clinicopathological and Prognostic Value of Immunohistochemical Expression of CD44 (Stem Cell Marker) and Ki67 in Serous Ovarian Cancer[J]. J Clin Diagn Res, 2020,14(1):XC01-XC07. Kaya R, Takanashi H, Nakajima A, et al. Prognostic significance of Ki67 during neoadjuvant chemotherapy in primary unresectable ovarian cancer[J]. J Obstet Gynaecol Re, 2021,47(11):3979-3989. Jiang R, Zhu J, Kim JW, et al. Study of upfront surgery versus neoadjuvant chemotherapy followed by interval debulking surgery for patients with stage IIIC and IV ovarian cancer, SGOG SUNNY (SOC-2) trial concept[J]. J Gynecol Oncol, 2020,31(5):e86. Cheung J, Lokman NA, Abraham RD, et al. Reduced Gonadotrophin Receptor Expression Is Associated with a More Aggressive Ovarian Cancer Phenotype[J]. Int J Mol Sci, 2020,22(1). Liu C, Yu M, Li Y, et al. Lidocaine inhibits the metastatic potential of ovarian cancer by blocking Na(V) 1.5-mediated EMT and FAK/Paxillin signaling pathway[J]. Cancer Med-Us, 2021,10(1):337-349. Gerdes J, Schwab U, Lemke H, et al. Production of a mouse monoclonal antibody reactive with a human nuclear antigen associated with cell proliferation[J]. Int J Cancer, 1983,31(1):13-20. Gerdes J, Lemke H, Baisch H, et al. Cell cycle analysis of a cell proliferation-associated human nuclear antigen defined by the monoclonal antibody Ki-67[J]. J Immunol, 1984,133(4):1710-5. Khouja MH, Baekelandt M, Nesland JM, et al. The clinical importance of Ki-67, p16, p14, and p57 expression in patients with advanced ovarian carcinoma[J]. Int J Gynecol Pathol, 2007,26(4):418-25. Choudhury M, Goyal S, Pujani M. A cytohistological study of Ki-67 expression in ovarian tumors[J]. Indian J Pathol Micr, 2011,54(1):21-4. Heeran MC, Hogdall CK, Kjaer SK, et al. Prognostic value of tissue protein expression levels of MIB-1 (Ki-67) in Danish ovarian cancer patients. From the 'MALOVA' ovarian cancer study[J]. Apmis, 2013,121(12):1177-86. Aune G, Stunes AK, Tingulstad S, et al. The proliferation markers Ki-67/MIB-1, phosphohistone H3, and survivin may contribute in the identification of aggressive ovarian carcinomas[J]. Int J Clin Exp Patho, 2011,4(5):444-53. Sylvia MT, Kumar S, Dasari P. The expression of immunohistochemical markers estrogen receptor, progesterone receptor, Her-2-neu, p53 and Ki-67 in epithelial ovarian tumors and its correlation with clinicopathologic variables[J]. Indian J Pathol Micr, 2012,55(1):33-7. Kobel M, Kalloger SE, Boyd N, et al. Ovarian carcinoma subtypes are different diseases: implications for biomarker studies[J]. Plos Med, 2008,5(12):e232. Liu P, Sun YL, Du J, et al. CD105/Ki67 coexpression correlates with tumor progression and poor prognosis in epithelial ovarian cancer[J]. Int J Gynecol Cancer, 2012,22(4):586-92. Li LT, Jiang G, Chen Q, et al. Ki67 is a promising molecular target in the diagnosis of cancer (review)[J]. Mol Med Rep, 2015,11(3):1566-72. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3693253\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":255400797,\"identity\":\"8c0e9af8-5393-4939-9a53-3b6b6e3866b8\",\"order_by\":0,\"name\":\"yurong wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"yurong\",\"middleName\":\"\",\"lastName\":\"wang\",\"suffix\":\"\"},{\"id\":255400798,\"identity\":\"0f3b97ad-5207-4aa9-b97d-0df9505decd4\",\"order_by\":1,\"name\":\"xia li\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA50lEQVRIie3Qv2vCQBTA8RcOLsujWSOof8OVA13Ev+UOIVPnkjEgZCrOFfwjAgHnJze4BOeIi0szZXEUCmri0ul6Y6H3HR/vw/0A8Pn+YC8MgCCdYQSgukGQ/UZ4T6pkPMicSb+WGynoOXAgIb7SNWe6rNVXiTAbFcSas/1iXO0+DlxvK0pOCIksiE+FnTAifEe93WcdMbog5LGdBNnum8e6XEJHbi6EkcFcSBH2p5AL4coMKzWOH285bsRCrg2fWEkUVfLSpjeMPt+Suk3no9V+2VjJj1ABdF/FHPcfheS+6/P5fP+qOwKpSWy24XnGAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"xia\",\"middleName\":\"\",\"lastName\":\"li\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2023-12-01 15:44:30\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3693253/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3693253/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":47675397,\"identity\":\"730f4caa-c2c2-4394-ab4a-c052ef70660f\",\"added_by\":\"auto\",\"created_at\":\"2023-12-06 04:16:29\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":548732,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eMKI67 is highly expressed in ovarian cancer and is associated with a poor prognosis in ovarian cancer. (A)(B) MKI67 expression in ovarian cancer. (C)(D)(E) Association between MKI67 expression and OS, PFS, and PPS in ovarian cancer patients.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3693253/v1/ebc739e3b9fa0ead16ed2f6a.png\"},{\"id\":47675746,\"identity\":\"8b5b2693-16de-489a-a2a2-fccc1a350137\",\"added_by\":\"auto\",\"created_at\":\"2023-12-06 04:24:29\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":148821,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eExpression of MKI67 was correlated with the clinicopathological features of ovarian cancer.(A) Expression of MKI67 in different histological subtypes of epithelial ovarian cancer and normal tissue. N: Normal tissue; SC: serous carcinoma; EC: endometrioid carcinoma; CC: clear cell carcinoma; MC: mucinous carcinom. (B)(C)(D)(E) Expression of MKI67 in different FIGO stages in SC, EC, CC, and MC.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3693253/v1/85d32e28c8de216e1cdb8690.png\"},{\"id\":47675400,\"identity\":\"108389d7-2b9d-49ca-b055-53241e1ae5b3\",\"added_by\":\"auto\",\"created_at\":\"2023-12-06 04:16:29\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":53880,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe mRNA levels of MKI67 were determined by qRT-PCR\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3693253/v1/42f1786711dcedef54999eca.png\"},{\"id\":47675420,\"identity\":\"4e242db6-9024-4e71-9cfb-66cc188e8de9\",\"added_by\":\"auto\",\"created_at\":\"2023-12-06 04:16:29\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":5034594,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eExpression of Ki67 in SC (A), EC (B), CC (C), and MC (D) in different subtypes of ovarian cancer.(upper ×200,under ×400).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3693253/v1/540eeeb1c27491967ec61815.png\"},{\"id\":47675414,\"identity\":\"cf2b31a7-68bf-4675-8bd0-6208438683d9\",\"added_by\":\"auto\",\"created_at\":\"2023-12-06 04:16:29\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":5556000,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eExpression of Ki67 in different FIGO stages I (A), II (B), III (C), and IV (D) in serous ovarian cancer.(upper ×200,under ×400).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3693253/v1/d97e09b83133da5113907663.png\"},{\"id\":47675422,\"identity\":\"56d12f3f-f67f-4a0c-9c04-e7ec927e9b70\",\"added_by\":\"auto\",\"created_at\":\"2023-12-06 04:16:29\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":127217,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePrognostic relationship between Ki67 protein expression and ovarian cancer patients\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3693253/v1/b462dc71f5ea686b7bdcd97e.png\"},{\"id\":48318695,\"identity\":\"e83036b7-90ca-4a05-8f4d-4ef5f4d66eec\",\"added_by\":\"auto\",\"created_at\":\"2023-12-16 11:37:27\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":3581230,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3693253/v1/1c049f51-b93e-4534-8417-b19bddd9e378.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Differential expression and prognostic value of proliferation markers in different histological types of ovarian cancer\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eOvarian cancer(OC),with the third-highest incidence rate among all gynecological malignancies,is one of the three principal malignant tumors of the female reproductive system,behind only uterine body cancer and cervical cancer\\u003csup\\u003e[1]\\u003c/sup\\u003e.80-95% of ovarian malignant tumors are epithelial ovarian cancer(EOC),which are the most prevalent pathological type of ovarian cancer. There are primarily five subtypes of ovarian cancer in histology:mucinous ovarian cancer,clear cell carcinoma, endometrioid carcinoma, low-grade serous carcinoma, and high-grade serous carcinoma, with incidence rates in turn 2.4%、5%、10%、70%\\u003csup\\u003e[2]\\u003c/sup\\u003e.Due to the ovary\\u0026apos;s deep pelvic location and the lack of early detection techniques, 60\\u0026ndash;70% of diagnoses take place after the tumor has reached an advanced stage (FIGO III/IV) and developed distant metastases\\u003csup\\u003e[3]\\u003c/sup\\u003e,and among all gynecological cancers, ovarian cancer has the greatest fatality rate\\u003csup\\u003e[4]\\u003c/sup\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003eCell proliferation plays a significant influence in the behavior, invasiveness, and susceptibility to chemotherapy of ovarian cancer. Determining proliferative activity is crucial for diagnosis and prognosis, and there are several ways to calculate the proliferation index\\u003csup\\u003e[5]\\u003c/sup\\u003e.Ki67, encoded by the MKI 67 gene, is a nuclear localization protein closely related to cell proliferation that is present in all active stages of the cell cycle but not in quiescent cells\\u003csup\\u003e[6]\\u003c/sup\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003eIn contrast to surface epithelial-derived benign or borderline tumors, Ki67 antigen is overexpressed in malignant ovarian tumors. High expression of Ki67 antigen is associated with tumor aggressiveness, tumor metastasis, preserved tumor prognosis and poor response to chemotherapy, and its expression can be used as a diagnostic and prognostic tool to guide the clinical treatment of ovarian cancer\\u003csup\\u003e[7, 8]\\u003c/sup\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003eIn this investigation,we will assess the expression of the Ki67 antigen in epithelial ovarian cancer and its correlation with pathological and clinical characteristics,and explore the clinical value of Ki67 antigen as a proliferation marker for diagnosis and prognosis.\\u003c/p\\u003e\"},{\"header\":\"Materials And Methods\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eData acquisition\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eIn this study, GEPIA database (http://gepia.cancer-pku.cn/) was used to analyze the differential expression of Ki67 protein in ovarian cancer (p \\u0026lt;0.01 \\u0026amp; log2 | fold change |\\u0026gt; 1 as the cut-off value), MKI67 in ovarian cancer tissues and normal tissues. Six datasets of ovarian cancer (GSE18520, GSE9891, GSE44104, GSE26193, GSE6008, GSE68335) were obtained from the GEO database (https://www.ncbi.nlm.nih.gov/geo/), A total of 719 samples (705 ovarian cancer samples, Normal tissue samples in 14 cases), multi-array mean expression measure (RMA) background correction, normalization, log2 conversion were performed for each GEO raw data using the \\u0026quot;limma\\u0026quot; software package of R software (version 4.2.2).\\u0026nbsp;Lastly, the\\u0026nbsp;\\u0026ldquo;sva\\u0026rdquo;\\u0026nbsp;R package was applied to eliminate differences between the 705 OV patient and 14 healthy control samples. And combining the expression of MKI67 with the clinicopathological information in the datasets.\\u0026nbsp;Using the online Kaplan-Meier plotter(http://kmplot.com/), the association between MKI67 gene expression and overall survival (OS), progression-free survival (PFS), and post-progression survival (PPS) in patients with ovarian cancer was examined.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eSample collection\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eIn this study, including 104\\u0026nbsp;epithelial\\u0026nbsp;ovarian cancer patients\\u0026nbsp;(73 serous cancer, 14 endometrioid cancer, 12 clear cell cancer, 5 mucinous cancer).\\u0026nbsp;While patients with other types of malignancies were excluded.\\u0026nbsp;Ovarian cancer tissues were obtained from ovarian cancer patients who had been subjected to surgical resection and were pathologically confirmed at the Affiliated Cancer Hospital of Xinjiang Medical University between 2016 and 2018.\\u0026nbsp;All of the patients used in our study were newly diagnosed with EOC and received no treatment before sample collection. The informed consent form and permission to utilize the tissue sections for study were approved by the Affiliated Cancer Hospital Ethics Committee of Xinjiang Medical University.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCell culture\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eHuman ovarian cancer cells (ascites source) SKOV3 and HO8910 were purchased from Xiangya Cell Bank of Central South University. Human ovarian cancer cell A2780 (source of solid tumors) was a gift from the research group of Yin Gang, Dean of Pathology, School of Basic Medicine, Xiangya School of Medicine, Central South University. The IOSE80 of human normal ovarian cells was presented by Professor Cheng Yan\\u0026apos;s research group from the Third Xiangya Hospital of Central South University. The same medium: RPMI-1640, FBS (10%), 100U / ml penicillin (1%), 100 mg/ml streptomycin (1%), and 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e at 37 \\u0026deg; C were used to cultivate these cell lines.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eReverse transcription-quantitative polymerase chain reaction (qRT-PCR)\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFollowing the manufacturer\\u0026apos;s instructions, total RNA was extracted from cell lines using the Reverse Transcription Kit (Vazyme, China). The extracted RNA was reverse transcribed into complementary DNA (cDNA) using HisScript Ⅱ (Vazyme, China). The ChamQ Uniwersal SYBR qPCR Master Mix kit was utilized for conducting quantitative real-time PCR reaction experiments, with \\u0026beta;-actin as an internal reference, and the data were analyzed using the 2 \\u003csup\\u003e-△△Ct\\u0026nbsp;\\u003c/sup\\u003emethod. The primer sequences are shown in Table 1.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTable 1 qRT-PCR\\u0026nbsp;primer sequences\\u003c/p\\u003e\\n\\u003cdiv\\u003e\\n \\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.234042553191486%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eName\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"62.765957446808514%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ePrimer sequences\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.234042553191486%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eMKI67-F\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"62.765957446808514%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAGGGAAAGGAGAAGCAGGAAATT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.234042553191486%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eMKI67-R\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"62.765957446808514%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTGTCCTCAGCCTTCTTTGGATTT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.234042553191486%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026beta;-actin-F\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"62.765957446808514%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCATGTACGTTGCTATCCAGGC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.234042553191486%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026beta;-actin-R\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"62.765957446808514%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCTCCTTAATGTCACGCACGAT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n \\u003c/table\\u003e\\n\\u003c/div\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eImmunohistochemistry (IHC)\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFresh ovarian cancer tissue obtained surgically removed was fixed in 10% formalin and paraffin embedding;serial sections with a thickness of\\u0026nbsp;4\\u0026mu;m\\u0026nbsp;were deparaffinized by incubation in xylene,and rehydrated in a succession of ethanol-water solutions that were graded, endogenous peroxidase activity was blocked by soaking in 3% hydrogen peroxide for 20min.\\u0026nbsp;After that, the sections were treated for 20 minutes at high temperatures in EDTA buffer (pH 9.0) in order to extract the antigen.\\u0026nbsp;After being rinsed in phosphate-buffered saline (PBS) (pH=7.2), the sections were\\u0026nbsp;add 5% BSA 37℃ blocking for 30min,\\u0026nbsp;then incubated with\\u0026nbsp;1:100 dilution of mouse anti-human Ki67\\u0026nbsp;monoclonal\\u0026nbsp;antibody (ZSGB-BIO, China) for 4℃ overnight.\\u0026nbsp;After bleaching in PBS buffer the next day, sheep anti-mouse secondary antibody (ZSGB-BIO, China) was added for 37℃ for 30min, and DAB solution (1:50) was developed for 5min. Hematoxylin counterstaining, ethanol gradient dehydration, transparent, neutral resin sealing sheet, microscopic observation and photographed.\\u0026nbsp;Quantitatively the Proliferative Index (PI)was expressed as Ki-67 labeling index(LI) when percentage of positively stained cells per 100 epithelial cells after counting at least 1000 cells in each case using high power objective of the microscope (x400). After going through several studies, the Ki-67 LI was grouped as high LI (\\u0026gt;50% immunoreactive cells are positive) and low LI (\\u0026lt;50% immunoreactive cells are positive) as there is no international consensus on cutoff value for percentage of expression.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFollow-up\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003ePatients with ovarian cancer were followed up at 3 years after surgery, and their survival was recorded with the date of follow Beginning on day 1 postoperative, the follow-up period was completed until 31 December 2021 or with patient death as the endpoint event.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eStatistical analysis\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eData analysis was performed using the SPSS 27.0 software and GraphPad Prism 8.0. Measurement data are expressed as mean \\u0026plusmn; standard deviation ((x \\u0026plusmn; s).The associations between clinic-pathological data and protein expression levels were evaluated using chi-square or Fisher\\u0026apos;s exact tests. The association between Ki67 expression and the prognosis of patients with ovarian cancer was analyzed using Kaplan-Meier curves.\\u0026nbsp;T-test and ANOVA are employed if differences between groups are conform to normality, and if they are not conform, Kruskal-Wallis test is used, and\\u0026nbsp;\\u003cem\\u003ep\\u003c/em\\u003e\\u0026lt;0.05 was the threshold for statistical significance.(*P\\u0026lt;0.05；**P\\u0026lt;0.01；***P\\u0026lt;0.001；****P\\u0026lt;0.0001).\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003e2.1 Database data analysis the expression and clinical significance of MKI67 in ovarian cancer\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe GEPIA database and the Kaplan-Meier plotter database online analysis is indicated: Compared to normal ovarian tissues, ovarian cancer tissues MKI67 was higher expressed. (Figure 1A、1B, log2FC cut-off\\u0026nbsp;value\\u0026nbsp;\\u0026gt;1, P \\u0026lt;0.01). Ovarian cancer patients with high MKI67 expression, overall survival (OS) (Figure 1C, HR=1.23, P=0.00079), progression-free survival (PFS) (Figure 1D, HR=1.17, and P=0.028) and post-progression survival (PPS) (Figure 1E, HR=1.22, P=0.042) were significantly shorter than those with low MKI 67 expression. It esting that high expression of MKI67 is substantially associated with poor prognosis of patients.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eIntegrating six ovarian cancer datasets from the GEO database, the statistical analysis of several histological subtypes of epithelial ovarian carcinoma (serous carcinoma, endometrioid carcinoma, clear cell carcinoma, mucinous carcinoma) and various FIGO stages was indicated: compared with normal ovarian tissue, MKI67 mRNA expression was increased in serous carcinoma, endometrioid carcinoma, clear cell carcinoma, and mucinous carcinoma (Figure 2A). However, the difference in MKI67 expression between the subtypes was not statistically significant. In the different FIGO stages of ovarian cancer, the expression of MKI67 was significantly different between the early stage (FIGO I/II) and advanced stage (FIGO III/IV) in serous carcinoma (Figure 2B), clear cell carcinoma (Figure 2D). There was no significant difference in expression between early and late stages with endometrioid carcinoma (Figure 2C) and mucinous carcinoma (Figure 2E).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e2.2 MKI67 expression in normal ovarian cells and ovarian cancer cells\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe mRNA expression levels of MKI67 in human normal ovarian cells IOSE80 and ovarian cancer cells SKOV3, HO8910, A2780 were determined by qRT-PCR is shown in Figure 3. It can be concluded higher expression of MKI67 in ovarian cancer cells SKOV3, HO8910, and A2780 than in normal ovarian cells IOSE80.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e2.3\\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003eCorrelation of Ki67 expression with clinicopathologic variables in EOC\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe correlation of Ki67 expression with clinicopathologic variables is summarized in Table 2. It was found that Ki67 expression was significantly associated with FIGO stage (P\\u0026lt;0.001), histologic subtype (P\\u0026lt;0.001), involvement of unilateral/bilateral(P=0.007), and presence of lymph node metastasis(P=0.014). However, there was no association with other prognostic variables such age,tumor nature,or serum CA125.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e2.4 Ki67 expression in the tissues of ovarian cancer and its prognostic relationship with ovarian cancer patients\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe expression of Ki67 was studied in 104 epithelial ovarian cancer patients by immunohistochemistry (Figure 4, Figure 5). 13 of the 73 serous carcinomas showed low expression, while 60 had high expression; Of the 14 endometrioid carcinomas, half had high expression and the other low. 12 clear cell carcinomas they had 9 of low expression and 3 of high expression; 5 mucinous carcinomas they had 3 of low expression and 2 of high expression. In the histological subtypes, mean Ki67 expression was highest in serous carcinomas (66.92\\u0026plusmn;14.50) and lowest in clear cell carcinomas (45.83\\u0026plusmn;13.79). Its expression was significantly different between serous carcinoma and endometrioid carcinoma (P=0.007)\\u0026nbsp;、clear cell carcinoma (P \\u0026lt;0.001). In the FIGO stage, the expression of mean Ki67 was highest in stage III (67.64\\u0026plusmn;14.37), which was significantly different between stage III and stage I (P=0.002)\\u0026nbsp;、stage II (P=0.008), as shown in Table 2、Table 3.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTable 2 \\u0026nbsp;Ki67 expression and clinicopathological features in ovarian cancer patients / n (%)\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.634408602150536%\\\" rowspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003eCharacteristics\\u003c/p\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"35.66308243727599%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eExpression of Ki67\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.440860215053764%\\\" rowspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ec\\u003csup\\u003e2\\u003c/sup\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.261648745519713%\\\" rowspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eP\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"100%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;Low（n=32） \\u0026nbsp; \\u0026nbsp;High（n=72）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.634408602150536%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAge（years）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.741935483870968%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.921146953405017%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.440860215053764%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.261648745519713%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.634408602150536%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026ge;50\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.741935483870968%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e17（30.36）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.921146953405017%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e39（69.64）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.440860215053764%\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e0.010\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.261648745519713%\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e0.992\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"51.344743276283616%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026lt;50\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.205378973105134%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e15（31.25）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.449877750611247%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e33（68.75）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.634408602150536%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTumour nature\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.741935483870968%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.921146953405017%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.440860215053764%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.261648745519713%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.634408602150536%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eSolid\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.741935483870968%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e3（13.64）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.921146953405017%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e19（86.36）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.440860215053764%\\\" rowspan=\\\"3\\\"\\u003e\\n \\u003cp\\u003e3.979\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.261648745519713%\\\" rowspan=\\\"3\\\"\\u003e\\n \\u003cp\\u003e0.137\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"51.344743276283616%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eSolid and cystic\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.205378973105134%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e22（34.38）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.449877750611247%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e42（65.62）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"51.344743276283616%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCystic\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.205378973105134%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e7（38.89）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.449877750611247%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e11（61.11）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.634408602150536%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eLaterality\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.741935483870968%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.921146953405017%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.440860215053764%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.261648745519713%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.634408602150536%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eUnilateral\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.741935483870968%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e22（43.14）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.921146953405017%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e29（56.86）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.440860215053764%\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e7.186\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.261648745519713%\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e0.007\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"51.344743276283616%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eBilateral\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.205378973105134%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e10（18.87）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.449877750611247%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e43（81.13）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.634408602150536%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHistologic subtype\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.741935483870968%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.921146953405017%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.440860215053764%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.261648745519713%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.634408602150536%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eSerous carcinoma(SC)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.741935483870968%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e13（17.81）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.921146953405017%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e60（82.19）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.440860215053764%\\\" rowspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003e20.355\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.261648745519713%\\\" rowspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003e\\u0026lt;0.001\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"51.344743276283616%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eEndometrioid carcinoma(EC)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.205378973105134%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e7（50.00）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.449877750611247%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e7（50.00）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"51.344743276283616%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eClear cell carcinoma(CC)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.205378973105134%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e9（75.00）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.449877750611247%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e3（25.00）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"51.344743276283616%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eMucinous carcinoma(MC)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.205378973105134%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e3（60.00）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.449877750611247%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e2（40.00）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.634408602150536%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eFIGO stage\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.741935483870968%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.921146953405017%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.440860215053764%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.261648745519713%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.634408602150536%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eI\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.741935483870968%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e11（64.71）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.921146953405017%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e6（35.29）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.440860215053764%\\\" rowspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003e23.939\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.261648745519713%\\\" rowspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003e\\u0026lt;0.001\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"51.344743276283616%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eII\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.205378973105134%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e13（48.15）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.449877750611247%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e14（51.85）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"51.344743276283616%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eIII\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.205378973105134%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e8（15.09）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.449877750611247%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e45（84.91）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"51.344743276283616%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eIV\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.205378973105134%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e0（0.00）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.449877750611247%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e7（100.00）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.634408602150536%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eLymphatic metastasis\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.741935483870968%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.921146953405017%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.440860215053764%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.261648745519713%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.634408602150536%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ePresent\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.741935483870968%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e3（11.54）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.921146953405017%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e23（88.46）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.440860215053764%\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e6.019\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.261648745519713%\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e0.014\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"51.344743276283616%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAbsent\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.205378973105134%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e29（37.18）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.449877750611247%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e49（62.82）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.634408602150536%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCA125 levels(U/ml)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.741935483870968%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.921146953405017%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.440860215053764%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.261648745519713%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.634408602150536%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026gt;35\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.741935483870968%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e27（28.42）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.921146953405017%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e68（71.58）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.440860215053764%\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e1.711\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.261648745519713%\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e0.191\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"51.344743276283616%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026lt;35\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.205378973105134%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e5（55.56）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.449877750611247%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e4（44.44）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003eTable 3 \\u0026nbsp;Expression levels of Ki67 in different histological subtypes and FIGO stages\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"571\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.19298245614035%\\\"\\u003e\\n \\u003cp\\u003eVariable\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"42.98245614035088%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eKi67 LI:\\u0026nbsp;percentage of cells staining Median（`x\\u0026plusmn;s）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"19.82456140350877%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eP\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.19298245614035%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHistologic subtype\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"42.98245614035088%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"19.82456140350877%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.19298245614035%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eSerous carcinoma(SC)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"42.98245614035088%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e（66.92\\u0026plusmn;14.50）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"19.82456140350877%\\\" rowspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003e\\u0026lt;0.001\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"46.38949671772429%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eEndometrioid carcinoma(EC)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"53.61050328227571%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e（52.86\\u0026plusmn;15.41）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"46.38949671772429%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eClear cell carcinoma(CC)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"53.61050328227571%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e（45.83\\u0026plusmn;13.79）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"46.38949671772429%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eMucinous carcinoma(MC)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"53.61050328227571%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e（52.00\\u0026plusmn;8.37）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.19298245614035%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eFIGO stage\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"42.98245614035088%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"19.82456140350877%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"37.19298245614035%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eI\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"42.98245614035088%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e（51.76\\u0026plusmn;16.67）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"19.82456140350877%\\\" rowspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003e\\u0026lt;0.001\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"46.38949671772429%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eII\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"53.61050328227571%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e（55.93\\u0026plusmn;16.47）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"46.38949671772429%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eIII\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"53.61050328227571%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e（67.64\\u0026plusmn;14.37）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"46.38949671772429%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eIV\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"53.61050328227571%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e（65.71\\u0026plusmn;7.89）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003eRelation between expression levels of Ki67 and 3-year survival of ovarian cancer in these patients: the 3-year follow-up results showed that 56 of 104 patients survived and 48 died, with a survival rate of 53.85% (56/104). According to the Kaplan-Meier survival curve analysis, the 3-year survival rate of the high Ki67 expression group of 48.61% (35/72) was significantly lower compared to the low expression group\\u0026apos;s 65.63% (21/32) .(Log rank\\u0026nbsp;c\\u003csup\\u003e2\\u0026nbsp;\\u003c/sup\\u003e=4.207，P=0.04),as Figure 6A.\\u003c/p\\u003e\\n\\u003cp\\u003eThe relationship between Ki67expression level and PFS in ovarian cancer: 30 of 104 patients progressed, 74 did not, with a PFS of 71.20% (74/104). Kaplan-Meier survival curve analysis showed that the PFS of Ki67 high expression was 65.28% (47/72) and significantly lower than the low expression with 84.38%(27/32). (Log rank\\u0026nbsp;c\\u003csup\\u003e2\\u003c/sup\\u003e =4.446, P=0.035),as Figure 6B.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eOvarian cancer has always been the most lethal gynecological malignancy in women in the world, and can occur at various ages, more than 80% of which are epithelial ovarian cancer, and the pathological histology is relatively diverse\\u003csup\\u003e[2]\\u003c/sup\\u003e. Ovarian cancer is usually asymptomatic early, in the later, it causes some gastrointestinal symptoms\\u0026nbsp;such anemia, weight loss, abdominal distension, lower abdominal discomfort, and appetite loss\\u003csup\\u003e[9]\\u003c/sup\\u003e. It has been reported that 74% of patients were diagnosed at the advanced stage because of the insidious onset of ovarian cancer, and the survival rate of patients with advanced ovarian cancer has not improved significantly in nearly 30 years due to the lack of effective treatment for advanced cases\\u003csup\\u003e[10, 11]\\u003c/sup\\u003e. At present, although pathological examination is the gold standard for the diagnosis of ovarian cancer, it is not conducive to early screening because it is an invasive examination. In recent years, along with the ongoing advancement of clinical molecular subtyping research, an increasing number of molecular genes have been identified as special biological markers for tumor diagnosis and prognosis. If clinical can explore a molecular markers closely linked with ovarian cancer prognosis, can provide effective guidance for clinical targeted treatment, so as to reduce the occurrence of poor prognosis. The Ki67 antigen was originally discovered in the 1980s and the protein was defined by the prototype monoclonal antibody Ki67, produced by immunization mice with the nucleus of the Hodgkin\\u0026apos;s lymphoma cell line L428\\u003csup\\u003e[12]\\u003c/sup\\u003e. According to the results of cell cycle studies, Ki67 antigen was expressed in G1, S, G2 (cell division cycle) or in mitotic nucleus, but not in resting cells in G0 phase\\u003csup\\u003e[13]\\u003c/sup\\u003e. In this study, qRT-PCR was used to measure the expression of MKI67 mRNA in both ovarian cancer and normal cells, and we came to the conclusion that its expression was substantially higher in ovarian cancer cells than in normal ovarian cells.\\u003c/p\\u003e\\n\\u003cp\\u003eKi67 expression was higher in epithelial ovarian cancer than in both benign and borderline tumors\\u003csup\\u003e[14, 15]\\u003c/sup\\u003e. Mahadevappa A et al. studied 40 epithelial ovarian tumors and found that the mean Ki67 marker index was highest in serous carcinoma (65.03\\u0026plusmn;21.67) and lowest in transitional cell carcinoma. They also recorded no significant correlation of CA125 levels with the expression of Ki67.\\u0026nbsp;In our study was also observed the expression of Ki67 was highest in serous carcinoma (66.92\\u0026plusmn;14.50) and no correlation between its expression and CA125 levels. Many studies have reported differences in Ki67 expression in different histological subtypes and showed different distribution of immunostaining in serous, endometrioid, clear cell, mucinous\\u003csup\\u003e[16-18]\\u003c/sup\\u003e. In a retrospective study of 500 ovarian tumors by Kobel et al, Ki67 immunohistochemical expression and other biomarkers were evaluated and yielded significant differences in proliferation index between the different subtypes\\u003csup\\u003e[19]\\u003c/sup\\u003e. In this study ,we found that Ki67 expression was significantly different in histological subtypes, and its expression was statistically significant between serous carcinoma and endometrioid carcinoma, clear cell carcinoma. In addition,we also found that in the FIGO stage,\\u0026nbsp;the expression of mean Ki67 was highest in stage III (67.64\\u0026plusmn;14.37), which was significantly different between stage III and stage I (P=0.002)\\u0026nbsp;、stage II (P=0.008).\\u003c/p\\u003e\\n\\u003cp\\u003eSeveral studies have examined the association between Ki67 antigen expression and long-term survival, reporting that the proliferation index is a good prognostic predictor in epithelial ovarian cancer patients. The ovarian cancer patients with high Ki67 expression had a poor median survival than tumor patients with low Ki67 expression\\u003csup\\u003e[16, 20]\\u003c/sup\\u003e. Our study also reached a similar conclusion that both 3-year survival and PFS were lower in the high Ki67 expression group than in the low Ki67 expression group.\\u003c/p\\u003e\\n\\u003cp\\u003eThe evaluation of the proliferation index by Ki67 expression determines the proliferative potential of epithelial ovarian cancer in the diagnosis of different histological subtypes, high grade and advanced stages, which helps to tailor the postoperative chemotherapy regimen and thus improve the prognosis. Recent studies suggest that since Ki67 is ubiquitously expressed in all proliferating cells, it may be an attractive therapeutic target for cancer\\u003csup\\u003e[21]\\u003c/sup\\u003e. Inactivation of the proliferation marker Ki67 will lead to proliferative cell-specific death, therefore it could be a potential strategy to treating ovarian cancer as well as numerous other malignancies.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eACKNOWLEDGMENTS\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe would like to thank everyone who provided assistance to us when we were writing this manuscript. Thanks to all the peer reviewers for their opinions and suggestions.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eETHICS STATEMENT\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe studies involving human participants were reviewed and approved\\u0026nbsp;by the Affiliated Cancer Hospital Ethics Committee of Xinjiang Medical University.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eFUNDING\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe Natural Science Foundation of the Xinjiang Uygur Autonomous Region provided funding for this research. (Grant No.: 2018D01C273).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eDATA \\u0026nbsp; AVAILABILITY\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eExpression profile data analyzed in this study were obtained from Gene Expression Omnibus (GEO) at\\u0026nbsp;GSE18520, GSE9891, GSE44104, GSE26193, GSE6008 and GSE68335.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eCONFLICT OF INTEREST\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare no potential conflicts of interest.\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eOrdulu Z, Watkins J, Ritterhouse LL. Molecular Pathology of Ovarian Epithelial Neoplasms: Predictive, Prognostic, and Emerging Biomarkers[J]. Surgical Pathology Clinics, 2021,14(3):415-428.\\u003c/li\\u003e\\n\\u003cli\\u003eLheureux S, Braunstein M, Oza AM. Epithelial ovarian cancer: Evolution of management in the era of precision medicine[J]. Ca-Cancer J Clin, 2019,69(4):280-304.\\u003c/li\\u003e\\n\\u003cli\\u003eMaringe C, Walters S, Butler J, et al. Stage at diagnosis and ovarian cancer survival: Evidence from the International Cancer Benchmarking Partnership[J]. Gynecol Oncol, 2012,127(1):75-82.\\u003c/li\\u003e\\n\\u003cli\\u003eSiegel RL, Miller KD, Fuchs HE, et al. Cancer statistics, 2022[J]. Ca-Cancer J Clin, 2022,72(1):7-33.\\u003c/li\\u003e\\n\\u003cli\\u003eMahadevappa A, Krishna SM, Vimala MG. Diagnostic and Prognostic Significance of Ki-67 Immunohistochemical Expression in Surface Epithelial Ovarian Carcinoma[J]. J Clin Diagn Res, 2017,11(2):EC08-EC12.\\u003c/li\\u003e\\n\\u003cli\\u003eScholzen T, Gerdes J. The Ki-67 protein: from the known and the unknown[J]. J Cell Physiol, 2000,182(3):311-22.\\u003c/li\\u003e\\n\\u003cli\\u003eIbrahim TR, Raouf SMA, Abdelgawad M, et al. Clinicopathological and Prognostic Value of Immunohistochemical Expression of CD44 (Stem Cell Marker) and Ki67 in Serous Ovarian Cancer[J]. J Clin Diagn Res, 2020,14(1):XC01-XC07.\\u003c/li\\u003e\\n\\u003cli\\u003eKaya R, Takanashi H, Nakajima A, et al. Prognostic significance of Ki67 during neoadjuvant chemotherapy in primary unresectable ovarian cancer[J]. J Obstet Gynaecol Re, 2021,47(11):3979-3989.\\u003c/li\\u003e\\n\\u003cli\\u003eJiang R, Zhu J, Kim JW, et al. Study of upfront surgery versus neoadjuvant chemotherapy followed by interval debulking surgery for patients with stage IIIC and IV ovarian cancer, SGOG SUNNY (SOC-2) trial concept[J]. J Gynecol Oncol, 2020,31(5):e86.\\u003c/li\\u003e\\n\\u003cli\\u003eCheung J, Lokman NA, Abraham RD, et al. Reduced Gonadotrophin Receptor Expression Is Associated with a More Aggressive Ovarian Cancer Phenotype[J]. Int J Mol Sci, 2020,22(1).\\u003c/li\\u003e\\n\\u003cli\\u003eLiu C, Yu M, Li Y, et al. Lidocaine inhibits the metastatic potential of ovarian cancer by blocking Na(V) 1.5-mediated EMT and FAK/Paxillin signaling pathway[J]. Cancer Med-Us, 2021,10(1):337-349.\\u003c/li\\u003e\\n\\u003cli\\u003eGerdes J, Schwab U, Lemke H, et al. Production of a mouse monoclonal antibody reactive with a human nuclear antigen associated with cell proliferation[J]. Int J Cancer, 1983,31(1):13-20.\\u003c/li\\u003e\\n\\u003cli\\u003eGerdes J, Lemke H, Baisch H, et al. Cell cycle analysis of a cell proliferation-associated human nuclear antigen defined by the monoclonal antibody Ki-67[J]. J Immunol, 1984,133(4):1710-5.\\u003c/li\\u003e\\n\\u003cli\\u003eKhouja MH, Baekelandt M, Nesland JM, et al. The clinical importance of Ki-67, p16, p14, and p57 expression in patients with advanced ovarian carcinoma[J]. Int J Gynecol Pathol, 2007,26(4):418-25.\\u003c/li\\u003e\\n\\u003cli\\u003eChoudhury M, Goyal S, Pujani M. A cytohistological study of Ki-67 expression in ovarian tumors[J]. Indian J Pathol Micr, 2011,54(1):21-4.\\u003c/li\\u003e\\n\\u003cli\\u003eHeeran MC, Hogdall CK, Kjaer SK, et al. Prognostic value of tissue protein expression levels of MIB-1 (Ki-67) in Danish ovarian cancer patients. From the \\u0026apos;MALOVA\\u0026apos; ovarian cancer study[J]. Apmis, 2013,121(12):1177-86.\\u003c/li\\u003e\\n\\u003cli\\u003eAune G, Stunes AK, Tingulstad S, et al. The proliferation markers Ki-67/MIB-1, phosphohistone H3, and survivin may contribute in the identification of aggressive ovarian carcinomas[J]. Int J Clin Exp Patho, 2011,4(5):444-53.\\u003c/li\\u003e\\n\\u003cli\\u003eSylvia MT, Kumar S, Dasari P. The expression of immunohistochemical markers estrogen receptor, progesterone receptor, Her-2-neu, p53 and Ki-67 in epithelial ovarian tumors and its correlation with clinicopathologic variables[J]. Indian J Pathol Micr, 2012,55(1):33-7.\\u003c/li\\u003e\\n\\u003cli\\u003eKobel M, Kalloger SE, Boyd N, et al. Ovarian carcinoma subtypes are different diseases: implications for biomarker studies[J]. Plos Med, 2008,5(12):e232.\\u003c/li\\u003e\\n\\u003cli\\u003eLiu P, Sun YL, Du J, et al. CD105/Ki67 coexpression correlates with tumor progression and poor prognosis in epithelial ovarian cancer[J]. Int J Gynecol Cancer, 2012,22(4):586-92.\\u003c/li\\u003e\\n\\u003cli\\u003eLi LT, Jiang G, Chen Q, et al. Ki67 is a promising molecular target in the diagnosis of cancer (review)[J]. Mol Med Rep, 2015,11(3):1566-72.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Epithelial ovarian cancer, Ki67, Proliferation, Prognosis\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3693253/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3693253/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cem\\u003ePurpose\\u003c/em\\u003e\\u003cstrong\\u003e \\u003c/strong\\u003eWe will assess the expression of the Ki67 antigen in different histological types ofepithelial ovarian cancer and its correlation with pathological and clinical characteristics,and explore the clinical value of Ki67 antigen as a proliferation marker for diagnosis and prognosis.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eMethods\\u003c/em\\u003e\\u003cstrong\\u003e \\u003c/strong\\u003eThe GEPIA and GEO databases was used to assessed the mRNA expression of MKI67 in ovarian cancer. The expression of MKI67 in both normal and cancerous ovarian cells was assessed using qRT-PCR. Immunohistochemical staining was detected the expression of Ki67 protein in 104 ovarian cancers,general information was gathered,such as the age of each patient to analyze the connection between the expression of Ki67 and the clinicopathological features of the patients. Kaplan-Meier analysis examines the relationship between ovarian cancer patients' prognosis and Ki67 expression.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eResults\\u003c/em\\u003e\\u003cstrong\\u003e \\u003c/strong\\u003e\\u0026nbsp;Ki67 was overexpressed in carcinoma ovarian cells and tissues compared with normal cells and tissues. Ki67 expression was significantly associated with FIGO stage (P\\u0026lt;0.001), histologic subtype (P\\u0026lt;0.001), involvement of unilateral/bilateral(P=0.007), and presence of lymph node metastasis(P=0.014). However, there was no association with other prognostic variables such age,tumor nature,or serum CA125. The expression of Ki67 was significantly different between serous carcinoma and endometrioid carcinoma (P=0.007) 、clear cell carcinoma (P \\u0026lt;0.001). Moreover, its expression was significantly different between FIGO stage III and stages I (P=0.002) 、stage II (P=0.008). According to Kaplan-Meier analysis,the 3-year survival rate and PFS in the Ki67 high expression group were considerably poorer than in the low expression group (P\\u0026lt;0.05).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eConclusions\\u003c/em\\u003e\\u003cstrong\\u003e \\u003c/strong\\u003eIn the tissues of ovarian cancer, Ki67 was highly expressed, and its expression levels was closely correlated with clinicopathological features including tumor FIGO stage, histologic subtype, unilateral / bilateral involvement, and lymph node metastasis. Patients with high expression have a reduced survival rate and a worse prognosis. Inactivation of the proliferation marker Ki67 will lead to proliferative cell-specific death, therefore maybe a potential strategy for ovarian cancer.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Differential expression and prognostic value of proliferation markers in different histological types of ovarian cancer\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2023-12-06 04:16:24\",\"doi\":\"10.21203/rs.3.rs-3693253/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"19267825-6749-4bde-8001-d561d817f6ec\",\"owner\":[],\"postedDate\":\"December 6th, 2023\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2023-12-16T11:29:19+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2023-12-06 04:16:24\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3693253\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3693253\",\"identity\":\"rs-3693253\",\"version\":[\"v1\"]},\"buildId\":\"-HB7Z8yhvgn0wM9Nzuekk\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}