{"paper_id":"03b08a63-c38b-42f9-b22c-52148cd254fe","body_text":"Ergosterol-depleted clinical isolates of Nakaseomyces glabratus can 1 \ndevelop multi-drug resistance without apparent fitness and virulence 2 \ndefects 3 \nAlexander M. Aldejohann1,2#, Nadja Thielemann 1#, Aina Martinez Zurita 3, Christoph 4 \nMüller4, Tom Gräfenhan5, Richard Kriz 6,7, Heimo Lagler6, Isabell S. Behr1, Nathalie 5 \nReus1, Annika Schöninger 1, Grit Walther 8, Lena-Marie Mazan 1, Hannah Wilhelm 1, 6 \nBirgit Willinger9, Christina A. Cuomo3,10, Oliver Kurzai1,8,11 and Ronny Martin1 7 \n 8 \n1Institute for Hygiene and Microbiology, University of Würzburg, Würzburg, Germany  9 \n2Infection Control and Antimicrobial Stewardship Unit, University Hospital Würzburg, Würzburg, 10 \nGermany 11 \n3Infectious Disease and Microbiome Program, Broad Institute of MIT and Harvard, Cambridge, 12 \nMassachusetts, USA 13 \n4Department of Pharmacy -Center for Drug Research, Ludwig Maximilians University Munich, Munich, 14 \nGermany 15 \n5Core Unit Systems Medicine, University of Würzburg, Würzburg, Germany 16 \n6Division of Infectious Diseases and Tropical Medicine, Department of Medicine I, Medical University of 17 \nVienna, Vienna, Austria 18 \n7Section Biomedical Science, Health Sciences, University of Applied Science Campus Wien, Vienna, 19 \nAustria 20 \n8National Reference Center for Invasive Fungal Infections, Leibniz Institute for Natural Product 21 \nResearch and Infection Biology- Hans Knoell Institute, Jena, Germany 22 \n9Division of Clinical Microbiology, Department of Laboratory Medicine, Medical University of Vienna, 23 \nVienna, Austria. 24 \n10Department of Molecular Microbiology and Immunology, Brown University, Providence, Rhode Island, 25 \nUSA 26 \n11Research Group Fungal Septomics, Leibniz Institute for Natural Product Research and Infection 27 \nBiology- Hans Knoell Institute, Jena, Germany 28 \n# These authors contributed equally to this work. Order was determined alphabetically. 29 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\n 30 \nCorresponding author: 31 \nRonny Martin 32 \nInstitute for Hygiene and Microbiology 33 \nJosef-Schneider-Straße 2 34 \nBuilding E1 35 \n97080 Würzburg, Germany 36 \nEmail: ronny.martin@uni-wuerzburg.de 37 \n  38 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nAbstract  39 \nObjectives: Nakaseomyces glabratus (formerly Candida glabrata) is a leading cause 40 \nof invasive candidiasis and rapidly develops antifungal drug resistance during 41 \ntreatment. An increasing number of clinical isolates shows reduced susceptibility to 42 \nechinocandins and azoles, leaving amphotericin B (AMB) as a last therapeutic option. 43 \nResistance of N. glabratus to this drug is rare and its underlying mechanisms are still 44 \nnot fully understood. Here, we describe two independent multidrug resistant  (MDR) 45 \nbloodstream isolates displaying resistance to AMB and anidulafungin (ANF) as well as 46 \na reduced susceptibility to azoles. 47 \nMethods: Whole-genome sequencing and sterol profiling were performed on nine 48 \nclinical N. glabratus isolates which were resistant to ANF and displayed resistance or 49 \nlow susceptibility to fluconazole (FLU) and AMB. The transcriptional response of 50 \nreference strain CBS138 and an AMB R+ANFR isolate was analyzed by RNA -seq. 51 \nFurthermore, PDR1 was deleted in the latter isolate to examine its influence on efflux 52 \npump gene expression. Additionally, fitness and virulence of the AMB R+ANFR isolate 53 \nwere examined in growth assays and a Galleria mellonella infection model.  54 \nResults: Loss of function mutations in the genes ERG3  and ERG4 is linked to 55 \nergosterol depletion and AMB resistance. Ergosterol depletion also contributed to a 56 \nPdr1-mediated up- regulation of ERG and ABC transporter genes  which was  57 \nassociated with low FLU susceptibility. The AMBR isolates displayed no fitness defects 58 \nand one of them was fully virulent in a G. mellonella infection model.  59 \nConclusions: These findings demonstrate that ergosterol depletion in N.  glabratus 60 \nleads to AMB resistance without affecting fitness or virulence. 61 \n 62 \n  63 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nIntroduction 64 \nInvasive candidiasis is a life -threatening fungal infection, caused by yeasts including  65 \nCandida albicans  and Nakaseomyces glabratus , and comprises bloodstream 66 \ninfections, but also dissemination to  organs like liver and kidney, accounting for 67 \napproximately 1.5 million cases per year with attributable mortality of up to 60% [1,2]. 68 \nWhile C. albicans is the most virulent and best studied pathogen and still accounts for 69 \napproximately 50% of systemic Candida infections, non-albicans Candida species are 70 \nof increasing importance as they often develop antifungal drug resistance or even MDR 71 \n[1,4]. The recommended first -line treatment for s ystemic Candida infections are 72 \nechinocandins [5,6]. They bind the catalytic subunit of the ß -1,3-D-glucan synthetase 73 \nand inhibit the ß- 1,3-D-glucan biosynthesis, leading to disruption of cell wall integrity 74 \nand osmotic imbalance [7] . Echinocandin r esistance is mainly  caused by point 75 \nmutations in the hot spot regions of the FKS  genes which encode the enzyme’s 76 \ncatalytic subunit [8]. Echinocandin resistance in N.  glabratus is rare but increased in 77 \nrecent years [9]. Due to the intrinsically low susceptibility of N. glabratus to azoles and 78 \na high proportion of azole- resistant isolates , acquisition of echinocandin resistance 79 \noften results in MDR , leaving liposomal AMB as an indispensable option, despite 80 \nsevere side effects for the patients  such as high nephrotoxicity or serum electrolyte 81 \nchanges [1,5,6]. AMB binding to ergosterol leads  to either formation of small ion 82 \nchannels or ergosterol extraction from  the cell membrane [10-12]. AMB resistance is 83 \nstill very rare among Candida species. Ergosterol depletion seems to be the major 84 \nresistance mechanism but is often linked to high fitness costs [7,13,14].  85 \nHere, we describe AMB  resistance in two independent clinical N.  glabratus isolates 86 \nand show that combined mutations in ERG3  and ERG4 are responsible for the 87 \nresistance but do not result in fitness defects . One of the isolates also displayed 88 \ndecreased susceptibility to anidulafungin and azoles. The latter wa s Pdr1-dependent 89 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nand likely triggered by ergosterol depletion. Thus, ergosterol depletion in the context 90 \nof AMB resistance can directly result in MDR phenotypes in N. glabratus. 91 \n  92 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nMaterial and Methods 93 \n 94 \nStrains and media 95 \nAll strains used in this study are listed in Table S1. They were routinely grown in YPD 96 \nmedium (20g/L glucose, 10g/L yeast extract, 20g/L peptone) at 37°C unless otherwise 97 \nindicated. 98 \n 99 \nAntifungal drug susceptibility testing (AFST) 100 \nAFST was either performed with EUCAST-based broth microdilution [15] or with Etests 101 \n(Biomérieux) according to manufacturer’s instructions. 102 \n 103 \nPlasmid and strain construction 104 \nThe procedures of plasmid and strain construction can be found in the supplement  105 \n(Data S4). Oligonucleotide primers and plasmids are listed in Table S2 and S3.  106 \n 107 \nDNA Isolation and whole-genome sequencing (WGS) 108 \nThe ZR Fungal/Bacterial DNA MiniPrep kit (Zymo Research, Irvine, CA, USA) was 109 \nused to extract fungal genomic DNA. Genomic libraries were constructed and 110 \nbarcoded using the NEBNext Ultra DNA Library Prep kit for Illumina (New England 111 \nBiolabs, Ipswich, MA, USA)  and then sequenced using the Illumina platform. Further 112 \ndetails of the data analysis are available in the supplement (Data S4).  113 \n 114 \nMeasurement of sterol components 115 \nThe sterol composition of clinical N.  glabratus isolates was determined by gas 116 \nchromatography- mass spectrometry (GC-MS) as previously described [16]. 117 \n 118 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nCell wall composition analysis 119 \nDetails of the staining and measurement of N. glabratus cell wall components by flow 120 \ncytometry are listed in the supplement (Data S4). 121 \n 122 \nTranscriptome analysis 123 \nFungal cells were grown overnight in YPD at 37°C. 1x10 6 cells / mL were then added 124 \nto prewarmed YPD with or without 1 µg/mL AMB and grown for 1 h at 37°C. Cells were 125 \nharvested by centrifugation and total RNA was isolated as previously described [17]. 126 \nLibrary preparation and RNA -sequencing was performed by the Core Unit SysMed 127 \nWürzburg. Details of the data analysis are available in the supplement (Data S4).  128 \n 129 \nData availability 130 \nSequencing data are available in the National Center for Biotechnology (NCBI) 131 \nSequence Read Archive (SRA) under BioProject PRJNA1299776. 132 \n 133 \nGene expression analysis 134 \n100 ng/µl total RNA from the same conditions as used for the transcriptome analysis  135 \nwere the template for RT-qPCR using the Luna Universal One-Step RT-qPCR Kit with 136 \nSYBR Green (New England Biolabs). Table S2 lists all used oligonucleotide primers. 137 \nGene expression was calculated with the ∆∆Ct method [18].  RDN5.8 and a control 138 \nRNA (5h YPD, 37°C)  were used for normalization. Data from independent biological 139 \ntriplicates were compared with a two- tailed, unpaired student’s t-test and p values ≤ 140 \n0.05 were regarded as statistically significant. 141 \n 142 \nAssessment of in vivo pathogenicity in Galleria mellonella larvae 143 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nPrior to the inoculation with N. glabratus, Galleria mellonella larvae weighing 220-280 144 \nmg fasted for 24 hours. Larvae were wiped with 70% ethanol, clustered into groups of 145 \n15 and placed in individual petri dishes for observation. N. glabratus CBS138 and NRZ-146 \n2016-252 were grown overnight at 37 °C on Sabouraud dextrose agar . Fungal cells 147 \nwere then harvested and suspended in sterile phosphate-buffered saline (PBS). Each 148 \nlarva within a group was injected with 10 µL of the yeast cell suspension with 2x109 149 \ncolony-forming units /mL, resulting in the inoculation of 2x10 7 yeast cells into each 150 \nlarva. The control group larvae were injected with sterile PBS. The infected larvae were 151 \nincubated at 37°C. Larvae of the intervention groups were injected with AMB (5 mg / 152 \nkg body weight) one hour after inoculation. Larval survival, indicated by melani sation 153 \nand mobility, was periodically monitored during the next seven days . Survival rates 154 \nwere visualized using Kaplan-Meier plots. 155 \n  156 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nResults 157 \nERG3 mutations are enriched among MDR isolates 158 \nWe have previously analyzed the emergence of echinocandin-resistant clinical isolates 159 \nof N. glabratus in Germany [9]. Based on this work, we further examined strains, which 160 \ndisplayed (i) resistance to the echinocandin ANF  without harboring FKS hot spot 161 \nmutations and (ii) additional resistance to either FLU or AMB (=MDR isolates, Figure 162 \n1 A). Whole-genome sequencing was performed for all six identified MDR isolates and 163 \nthree isolates with isolated ANF  resistance (ANFR) and one control isolate (AMBS, 164 \nANFS, FLUI). The MDR strains formed no clear cluster but showed an enrichment of 165 \nERG3 mutations (Figure 1 A, B). The two AMB R strains were genetically unrelated. 166 \nTheir respective closest relatives were AMB S and displayed a high genetic variation 167 \ncompared to the AMBR strains (Figure 1 B, C).  We identified putative loss of function 168 \nmutations in the ERG3  genes of the strains NRZ -2017-099 (M1*), NRZ -2016-252 169 \n(Q26*) and NRZ-2016-150 (K133del) (Figure 1 A). The latter two strains also displayed 170 \nputative loss of function mutations in the ERG4 genes: T158fs and Y327* (Figure 1 A).  171 \nDespite identifying several FKS mutations in our strains, only the isolate NRZ-2017-172 \n099 harbored two mutations which might explain ANF resistance: K1323N in FKS1 and 173 \nT970fs in FKS2  (Figure 1 A). Despite displaying ANF resistance, no FKS mutations 174 \nwere identified in NRZ-2016-252, NRZ-2016-191 and NRZ-2017-475 (Figure 1 A).  175 \n 176 \nCell wall composition of MDR isolates  177 \nTherefore, we used flow cytometry to measure the amounts of chitin, glucan and 178 \nmannan within the isolates as an altered composition is sometimes associated with 179 \nechinocandin resistance. There was  no clear link to ANF  resistance, but the 180 \nAMBR+ANFR isolate NRZ-2016-252 and the ANF R strain NRZ-2016-191 which both 181 \nharbor no FKS mutation, tend to have more of chitin, glucose and mannan (Figure S1). 182 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\n 183 \nErgosterol depletion correlates with resistance to AMB 184 \nWe additionally  examined the sterol composition of the strains  which exhibited 185 \nresistance to AMB or azoles. With a percentage of 77%, ergosterol was the main sterol 186 \nin the reference strain CBS138  (Figure 2 A , Table S 5). The ERG3 mutations M1*, 187 \nV101del and C223F in the isolates NRZ-2017-099, NRZ-2017-128 and NRZ-2018-172 188 \nwere associated with  decreased ergosterol levels and the  accumulation of ergosta-189 \n7,22-dien-3β-ol and ergost -7-en-3β-ol, indicating that the function of the sterol C5-190 \ndesaturase Erg3 is disturbed or lost (Figure 2 A). The AMBR + ANFR isolates NRZ-191 \n2016-252 and NRZ-2016-150 had extremely low ergosterol concentrations (0.1-1%) 192 \nwhile ergosta-7,22,24(28)-trien-3β-ol increased up to 85% (Figure 2, Table S5). This 193 \nis only possible if neither Erg3 nor Erg4 work properly, fitting to the identified mutations 194 \nin both strains (Figures 1A and 2 B). Strains with low ergosterol concentration of 4-6% 195 \nare still susceptible to AMB, indicating  that a complete depletion is required  for AMB 196 \nresistance (Figure 2 B). 197 \n 198 \nAbsence of functional ERG3 and ERG4 induces resistance to AMB and ANF 199 \nWe hypothesized that  the simultaneous loss of function in Erg3 and Erg4 enzymes 200 \ncause AMB resistance and also lead to resistance against ANF and low susceptibility 201 \nto FLU. To confirm this, we replaced the ERG3Q26* allele in NRZ-2016-252 with the wild 202 \ntype allele of CBS138. The resulting mutant became susceptible to AMB and ANF  203 \n(Figure 3 A ). Surprisingly, the strain was FLU R, maybe caused by the still present 204 \nERG4T158fs mutation (Figure 3 A). Additionally, we deleted ERG3 and ERG4 in the 205 \nbackground strain HTL. The resulting double mutant displayed AMB and ANF 206 \nresistance and a low susceptibility to FLU, similar to NRZ-2016-252 (Figure 3 B).  207 \n 208 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nPdr1 links ergosterol depletion and low susceptibility to FLU 209 \nTo better understand the fungal cell response to AMB, we examined the transcriptomes 210 \nof the AMBS strain CBS138 and the AMBR isolate NRZ-2016-252 after 1 h incubation 211 \nin YPD with or without 1 µg/ml AMB at 37°C. 1203 genes were differentially expressed 212 \nin CBS138 in response to AMB (Figure 4 A, dataset S6). Interestingly, 68% of them 213 \nwere differentially expressed in the AMB R strain NRZ-2016-252 in absence of AMB , 214 \nindicating that this strain is already well -adapted to AMB (Figure 4 A, dataset S 6). 215 \nAmong the upregulated genes in the AMBR strain were stress-related genes (UPC2B, 216 \nTYE7, ICL1, ICL2, HSP12, RAD27), efflux pumps (CDR1, PDH1, FLR1 and FLR2) and 217 \nergosterol biosynthesis genes (Figure 4 B and C, dataset S6). The two latter groups 218 \nare known targets of the transcription factor Pdr1 [19,20]. Especially the up-regulation 219 \nof the efflux pump genes might explain the low FLU susceptibility of NRZ -2016-252. 220 \nDeletion of  the PDR1 gene caused a dramatic decline of CDR1, FLR1  and PDH1 221 \ntranscription in NRZ -2016-252 (Figure 5 A). Compared to NRZ-2016-252, the pdr1 ∆ 222 \nderivate was extremely susceptible to fluconazole, indicating that up regulation of 223 \nCDR1 and PDH1 in NRZ-2016-252 was required for the low FLU susceptibility of NRZ-224 \n2016-252 (Figure 5 B ). NRZ-2016-252 pdr1∆ remained AMB and ANF resistant, 225 \nillustrating that Pdr1 was not required for resistance to these drugs (Figure 5 B). 226 \n 227 \nAMBR isolates display no severe fitness defects or attenuated virulence 228 \nAs AMB resistance is often linked to profound fitness defects, we examined the growth 229 \ndynamics of the AMBR isolates under different conditions. No apparent growth defects 230 \nwere observed in YPD medium at 37°C where both strains showed similar dynamics 231 \nas the  reference strain CBS138 (Figure 6 A). We then tested the growth of these 232 \nstrains, the isolate NRZ -2016-191 and the reference strain CBS138 under several 233 \nstress conditions. Despite the ergosterol depletion, both AMB R isolates showed good 234 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nstress resilience at 37°C and robust growth at 42°C (Figure 6 B). Only NRZ-2016-252 235 \ndisplayed a growth delay under osmotic stress conditions (1.5 M NaCl) and was also 236 \nmore susceptible to combined stressors such as 42°C and 1.5 M NaCl  or 0.0125% 237 \nSDS (Figure 6 B, C).  238 \nFinally, we analyzed the virulence of the AMBR strain NRZ-2016-252 in Galleria 239 \nmellonella. The isolate displayed no attenuated virulence compared to CBS138 (Figure 240 \n7). After treatment with AMB, 86% of the larvae (12/14) survived the infection with 241 \nCBS138 after 7 days (Figure 7) which was not the case for NRZ -2016-252-infected 242 \nlarvae which died within the first 4 days, independent from the addition of AMB (Figure 243 \n7). 244 \n  245 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nDiscussion  246 \nOur study showed that loss of function mutations in the ERG3 and ERG4 genes led to 247 \nergosterol depletion and consequently AMB resistance, similar to previous findings for 248 \nClavispora lusitaniae and Candida auris (syn. Candidozyma auris) [21,22]. Absence of 249 \nfunctional Erg3 and Erg4 resulted in a massive shift from ergosterol to  ergosta-250 \n7,22,24(28)-trien-3ßol in the two AMBR isolates which was also reported for AMB R 251 \nC. auris strains [22]. This understudied sterol has a similar binding affinity to liver X 252 \nreceptors as ergosterol and is often enriched in ergosterol lacking fungal strains  [23-253 \n25]. The primary effect of ergosterol depletion is AMB resistance as the drug can no 254 \nlonger bind to its target ergosterol. Additionally, it induced a transcriptional adaptation 255 \nagainst AMB even in its absence, including the up-regulation of Pdr1-controlled genes 256 \nCDR1 and PDH1. The increased expression of these ABC transporter genes led to an 257 \nincreased efflux pump activity and therefore to reduced susceptibility to FLU which is 258 \nin accordance with previous observations [19,20]. The observed association between 259 \nAMBR and ANF R without underlying FKS hot spot mutations could not be fully 260 \nexplained. Changes in the cell wall and the cell membrane caused by the absence of 261 \nergosterol may reduce the accessibility of the ß -1,3-D glucan synthase for 262 \nanidulafungin. Similar to previous works [26], our strains  were susceptible to 263 \nmicafungin, either caused by a higher affinity or less interaction with the altered cell 264 \nmembrane. 265 \nStrikingly, AMB R isolate NRZ -2016-252 was fully  virulent in a Galleria mellonella  266 \ninfection model. Its overall in -vitro and in-vivo fitness contradicts the hypothesis that 267 \nacquisition of AMB resistance is associated with high fitness costs [14, 22]. Especially, 268 \nthe bloodstream was previously discussed as an environment too hostile for the 269 \nsurvival of AMB resistant strains [14], however our two AMBR isolates were obtained 270 \nfrom blood cultures. We presume that the acquisition of AMB resistance alone made 271 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nthe strains not more susceptible to the harsh conditions within the bloodstream. 272 \nSuppressor mutations might have bypassed some defects caused by ergosterol 273 \ndepletion.  274 \nWe described N. glabratus bloodstream isolates with stable AMB resistance without 275 \napparent fitness and virulence defects. In combination with the intrinsically low 276 \nsusceptibility to azoles and the emerging echinocandin resistance, these findings 277 \nunderline the threat of an increasing MDR and extensively drug resistance (XDR) in 278 \nthis major human fungal pathogen. A close resistance monitoring is therefore urgently 279 \nneeded.   280 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nAcknowledgements 281 \nThis work was supported by the German Research Foundation (DFG) through the TRR 282 \n124 FungiNet “Pathogenic fungi and their human host: Networks of Interaction”, DFG 283 \nproject number 210879364, project C3 (O. K.) and  NIH NIAID grant U19AI110818 to 284 \nthe Broad Institute (C.A.C.). We want to thank Elke Huprich, Ina Gaube, Barbara 285 \nConrad, Sabrina Speiser and Margarete Göbel for their excellent technical support to 286 \nthis project.  287 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nReferences 288 \n 289 \n[1] Lass-Florl C, Kanj SS, Govender NP, Thompson GR, 3rd, Ostrosky -Zeichner L, Govrins MA. 290 \nInvasive candidiasis. Nat Rev Dis Primers. 2024;10(1):20. 291 \n[2] Holmes CL, Albin OR, Mobley HLT, Bachman MA. Bloodstream infections: mechanisms of 292 \npathogenesis and opportunities for intervention. Nat Rev Microbiol. 2025;23(4):210- 24. 293 \n[3] Denning DW. Global incidence and mortality of severe fungal disease. Lancet Infect Dis. 294 \n2024;24(7):e428-e38. 295 \n[4] Arendrup MC, Patterson TF. Multidrug- Resistant Candida: Epidemiology, Molecular 296 \nMechanisms, and Treatment. J Infect Dis. 2017;216(suppl_3):S445-S51. 297 \n[5] Pappas PG, Kauffman CA, Andes DR, Clancy CJ, Marr KA, Ostrosky-Zeichner L, et al. Clinical 298 \nPractice Guideline for the Management of Candidiasis: 2016 Update by the Infectious Diseases 299 \nSociety of America. Clin Infect Dis. 2016;62(4):e1-50. 300 \n[6] Cornely OA, Sprute R, Bassetti M, Chen SC, Groll AH, Kurzai O, et al. Global guideline for the 301 \ndiagnosis and management of candidiasis: an initiative of the ECMM in cooperation with ISHAM 302 \nand ASM. Lancet Infect Dis. 2025;25(5):e280-e93. 303 \n[7] Lee Y, Puumala E, Robbins N, Cowen LE. Antifungal Drug Resistance: Molecular Mechanisms 304 \nin Candida albicans and Beyond. Chem Rev. 2021;121(6):3390-411. 305 \n[8] Perlin DS. Resistance to echinocandin- class antifungal drugs. Drug Resist Updat. 306 \n2007;10(3):121-30. 307 \n[9] Aldejohann AM, Herz M, Martin R, Walther G, Kurzai O. Emergence of resistant Candida 308 \nglabrata in Germany. JAC Antimicrob Resist. 2021;3(3):dlab122. 309 \n[10] Ermishkin LN, Kasumov KM, Potzeluyev VM. Single ionic channels induced in lipid bilayers by 310 \npolyene antibiotics amphotericin B and nystatine. Nature. 1976;262(5570):698-9. 311 \n[11] Mouri R, Konoki K, Matsumori N, Oishi T, Murata M. Complex formation of amphotericin B in 312 \nsterol-containing membranes as evidenced by surface plasmon resonance. Biochemistry. 313 \n2008;47(30):7807-15. 314 \n[12] Anderson TM, Clay MC, Cioffi AG, Diaz KA, Hisao GS, Tuttle MD, et al. Amphotericin forms an 315 \nextramembranous and fungicidal sterol sponge. Nat Chem Biol. 2014;10(5):400- 6. 316 \n[24] Barrero AF, Oltra JE, Robinson J, Burke PV, Jimenez D, Oliver E. Sterols in erg mutants of 317 \nPhycomyces: metabolic pathways and physiological effects. Steroids. 2002;67(5):403- 9. 318 \n[13] Ellis D. Amphotericin B: spectrum and resistance. J Antimicrob Chemother. 2002;49 Suppl 1:7-319 \n10. 320 \n[14] Vincent BM, Lancaster AK, Scherz -Shouval R, Whitesell L, Lindquist S. Fitness trade- offs 321 \nrestrict the evolution of resistance to amphotericin B. PLoS Biol. 2013;11(10):e1001692.  322 \n[15] The European Committee on Antimicrobial Susceptibility Testing. Overview of antifungal 323 \nECOFFs and clinical breakpoints for yeasts, moulds and dermatophytes using the EUCAST 324 \nE.Def 7.3, E.Def 9.4 and E.Def 11.0 procedures. Version 3, 2022. http://www.eucast.org  325 \n[16] Muller C, Binder U, Bracher F, Giera M. Antifungal drug testing by combining minimal inhibitory 326 \nconcentration testing with target identification by gas chromatography -mass spectrometry. Nat 327 \nProtoc. 2017;12(5):947-63. 328 \n[17] Martin R, Moran GP, Jacobsen ID, Heyken A, Domey J, Sullivan DJ, et al. The Candida 329 \nalbicans-specific gene EED1 encodes a key regulator of hyphal extension. PLoS One. 330 \n2011\n;6(4):e18394. 331 \n[18] Pfaffl MW. A new mathematical model for relative quantification in real -time RT-PCR. Nucleic 332 \nAcids Res. 2001;29(9):e45. 333 \n[19] Vu BG, Thomas GH, Moye- Rowley WS. Evidence that Ergosterol Biosynthesis Modulates 334 \nActivity of the Pdr1 Transcription Factor in Candida glabrata. mBio. 2019;10(3). 335 \n[20] Vu BG, Stamnes MA, Li Y, Rogers PD, Moye- Rowley WS. The Candida glabrata Upc2A 336 \ntranscription factor is a global regulator of antifungal drug resistance pathways. PLoS Genet. 337 \n2021;17(9):e1009582. 338 \n[21] Kannan A, Asner SA, Trachsel E, Kelly S, Parker J, Sanglard D. Comparative Genomics for the 339 \nElucidation of Multidrug Resistance in Candida lusitaniae. mBio. 2019;10(6). 340 \n[22] Massic L, Doorley LA, Jones SJ, Richardson I, Siao DD, Siao L, et al. Acquired Amphotericin B 341 \nResistance Attributed to a Mutated ERG3 in Candidozyma auris. bioRxiv. 2025. 342 \n[23] Renaud RL, Subden RE, Pierce AM, Oehlschlager AC. Sterol composition ofNeurospora 343 \ncrassa. Lipids. 1978;13(1):56-8. 344 \n[25] Taank Y, Randhawa V, Agnihotri N. Ergosterol and its metabolites as agonists of Liver X 345 \nreceptor and their anticancer potential in colorectal cancer. J Steroid Biochem Mol Biol. 346 \n2024;243:106572. 347 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\n[26] Healey KR, Katiyar SK, Castanheira M, Pfaller MA, Edlind TD. Candida glabrata mutants 348 \ndemonstrating paradoxical reduced caspofungin susceptibility but increased micafungin 349 \nsusceptibility. Antimicrob Agents Chemother. 2011; 55(8):3947-9. 350 \n  351 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nFigure Legends 352 \nFigure 1 . Resistance profile and genetic characteristics of MDR  N. glabratus 353 \nisolates 354 \n(A). Summary of antifungal susceptibility testing (AFST) and underlying mutations in 355 \npossible resistance genes. AFST was performed with broth microdilution and based 356 \non EUCAST clinical breakpoints, the isolates were determined as susceptible (S), 357 \nincreased-dose-dependent (I) or resistant (R). Shown mutations in the indicated genes 358 \nwere identified by whole genome sequencing (WGS).  (B) WGS- based phylogenetic 359 \ntree of the examined N. glabratus isolates. (C) Genetic diversity of AMBR isolates NRZ-360 \n2016-252 and NRZ-2016-150 and their closest relatives NRZ -2016-191 and NRZ-361 \n2017-476.  362 \n 363 \nFigure 2. Sterol composition analysis of CBS138 and the clinical isolates.  364 \n(A) Sterol composition of the indicated strains was analyzed by  gas chromatography- 365 \nmass spectrometry (GC-MS). Shown are the percentages of the single sterols in the 366 \nindicated strains. (B) Illustration of the effects of the absence of either Erg3 and/  or 367 \nErg4 in AMBS and AMBR strains. Shown are branches of the ergosterol biosynthesis 368 \npathway in absence of Erg3 and/ or Erg4 leading to the production of non-physiological 369 \npredecessors. 370 \n 371 \nFigure 3. Absence of ERG3 and ERG4 is required for resistance to AMB and ANF. 372 \n(A) Integration of a wild type ERG3  allele into the AMB R isolate NRZ -2016-252 373 \nincreased susceptibility to AMB and ANF but not to FLU. The indicated strains were 374 \nplated onto RPMI1640 medium and E-test stripes for AMB, ANF and FLU were applied. 375 \nThe plates were then grown for 48h at 37°C before pictures were taken. (B) ERG4 and 376 \nERG3 were deleted in the N. glabratus HTL background strain.  HTL and the 377 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nerg4∆/ erg3∆ double mutants were plated and antifungal drug susceptibility was 378 \ndetermined with E-tests as described in (A).  379 \n 380 \nFigure 4. Transcriptional response of AMBS and AMBR strains to AMB. 381 \nThe AMBS strain CBS138 and the AMB R strain NRZ-2016-252 were grown for 1h in 382 \nYPD with 1 µg/ml AMB (AMB) or without 1 µg/ml AMB (YPD) prior to RNA isolation. 383 \n(A) Comparison of upregulated genes in CBS138 and NRZ -2016-252 in AMB and of 384 \ngenes upregulated in NRZ-2016-252 compared to CBS138 in YPD. Example genes 385 \nup-regulated in NRZ-2016-252 compared to CBS138 in presence of absence of AMB 386 \nare shown in the box. (B) Vulcano plot of differentially expressed genes in NRZ-2016-387 \n252 compared to CBS138 after 1 h growth in YPD at 37°C. (C ) Comparison of ERG  388 \ngene expression in NRZ-2016-252 and CBS138 in either YPD or YPD + AMB.  389 \n 390 \nFigure 5. Deletion of PDR1 led to downregulation of efflux pump genes in NRZ -391 \n2016-252 and increased susceptibility to FLU. 392 \n(A) Expression of efflux pump genes in NRZ-2016-252 and NRZ-2016-252 pdr1∆ after 393 \n1 h growth in YPD medium at 37°C. Gene expression was normalized against CBS138 394 \n(1h YPD, 37°C) and the RDN5.8 gene. Asterisks indicate significant changes in gene 395 \nexpression between the two N. glabratus strains (two-tailed, unpaired student’s t-test, 396 \np ≤ 0.05).  (B) The indicated strains were plated onto RPMI1640 medium, and E- test 397 \nstripes for AMB, ANF and FLU were applied. Pictures were taken after an incubation 398 \nfor 48h at 37°C. 399 \n 400 \nFigure 6. AMB R isolates show no fitness defects under single but under 401 \ncombinatory stress conditions. 402 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\n(A) Growth curve of CBS138, NRZ -2016-252 and NRZ -2016-150 grown in YPD 403 \nmedium at 37°C for 11 h. The optical density of the three strains was measured by 404 \nphotometry at 600 nm. (B) The indicated N. glabratus strains were grown on YPD with 405 \nor without 1.5 M sodium chloride or 100 µM menadione to induce osmotic and oxidate 406 \nstress. The plates were incubated at 37°C for 3 days prior to photography, except one 407 \nplate which was incubated at 42°C. (C) The same N. glabratus strains were grown on 408 \nYPD at 42°C with or without 200 µg/ml Congo Red to initiate cell wall stress, 1.5 M 409 \nNaCl for osmotic stress, 100 µM menadione for oxidative stress and 0.0125% SDS for 410 \ncell membrane stress. The plates were grown for 3 days prior to photography. 411 \n 412 \nFigure 7. N. glabratus NRZ-2016-252 shows resistance against AMB under in 413 \nvivo conditions. 414 \nGalleria mellonella  larvae were infected with 2x10 7 N. glabratus cells. The infected 415 \nlarvae were treated with 5 mg AMB per kg body weight and incubated for up to 7 days 416 \nat 37°C. The evaluation of survival of the larvae, indicated by melanisation and mobility, 417 \nwas first monitored 12 h post infection and then periodically each 24 h. Survival rates 418 \nwere visualized by Kaplan-Meier plots. 419 \n 420 \nFigure S1. Cell wall composition of MDR N. glabratus isolates. 421 \nThe indicated N. glabratus  strains were grown in YPD at 37°C, harvested and then 422 \nstained for chitin, ß- 1,3-D-glucan and mannan. The amounts of the three cell wall 423 \ncomponents were measured by flow cytometry. The values were normalized against 424 \nthe values of the control strain CBS138. 425 \n 426 \n  427 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nFigure 1 428 \n 429 \n  430 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nFigure 2 431 \n 432 \n 433 \n  434 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nFigure 3 435 \n 436 \n  437 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nFigure 4 438 \n 439 \n  440 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nFigure 5 441 \n 442 \n  443 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nFigure 6 444 \n 445 \n  446 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nFigure 7 447 \n 448 \n  449 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nFigure S1 450 \n 451 \n  452 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nTable S1. N. glabratus strains used in this study. 453 \n 454 \nStrain Genotype Source \nCBS138 wild type Gillum et al, 1984 \nNRZ-2015-067 wild type Aldejohann et al., 2021 \nNRZ-2016-150 wild type Aldejohann et al., 2021 \nNRZ-2016-191 wild type Aldejohann et al., 2021 \nNRZ-2016-252 wild type Aldejohann et al., 2021 \nNRZ-2017-099 wild type Aldejohann et al., 2021 \nNRZ-2017-128 wild type Aldejohann et al., 2021 \nNRZ-2017-475 wild type Aldejohann et al., 2021 \nNRZ-2017-476 wild type Aldejohann et al., 2021 \nNRZ-2018-032 wild type Aldejohann et al., 2021 \nNRZ-2018-172 wild type Aldejohann et al., 2021 \nHTL his3::FRT, trp1::FRT, leu2::FRT Jacobsen et al., 2010 \nerg3∆ HTL, erg3::ScHIS3 This work. \nerg4∆ HTL, erg4::ScLEU2 This work. \nerg4∆ erg3∆ HTL, erg4::ScLEU2, erg3::ScHIS3 This work. \nNRZ-2016-252 ERG3WT NRZ-2016-252, erg3Q26*::ERG3 This work. \nNRZ-2016-252 pdr1∆ NRZ-2016-252, pdr1::NAT1 This work. \n 455 \n  456 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nTable S2. Oligonucleotide primers used in this study. 457 \n 458 \nName Sequence in 5’ to 3’ direction Usage \nScHIS3p-CgERG3-OL \n \naacagcactaagcttttatacaaaaacaaataAACACAGTC\nCTTTCCCGCAATTTTCTTTTT \nplasmid construction \nScHIS3t-CgERG3-OL \n \ncgagacaccggtgtttcctgtAATATGAAATGCTTTTCTT\nGTTGTTCTTACG \nplasmid construction \n5'CgERG3-ScHIS3-OL \n \nAAAAAGAAAATTGCGGGAAAGGACTGTGTTtatt\ntgtttttgtataaaagcttagtgctgtt \nplasmid construction \n3'CgERG3-ScHIS3-OL \n \nCGTAAGAACAACAAGAAAAGCATTTCATATTac\naggaaacaccggtgtctcg \nplasmid construction \n5'CgERG3-SacII-OL \n \nGGGGATCCACTAGTTCTAGAGCGGCCGCCAgt\naaagtcagtgttggcgacca \nplasmid construction \n3'CgERG3-SacII-OL \n \nTCACTAAAGGGAACAAAAGCTGGAGCTCCAtgc\ntagtcagcagccgtgggt \nplasmid construction \nScLEU2p-CgERG4-OL \n \nccaagacagacactttttttgagatcaacaATCTATTACATT\nATGGGTGGTATGTTGGAA \nplasmid construction \nScLEU2t-CgERG4-OL \n \ngggttataatgcatcttttctttatggcatGTGTTTTTTATTTGT\nTGTATTTTTTTTTTTTTAG \nplasmid construction \n5'CgERG4-ScLEU2p-\nOL \nTTCCAACATACCACCCATAATGTAATAGATtgttg\natctcaaaaaaagtgtctgtcttgg \nplasmid construction \n3'CgERG4-ScLEU2t-\nOL \nCTAAAAAAAAAAAAATACAACAAATAAAAAACA\nCatgccataaagaaaagatgcattataaccc \nplasmid construction \n5'CgERG4-PstIoverlap \n \nGACGGTATCGATAAGCTTGATATCGAATTCagc\ngcctgctgctaaaacactg \nplasmid construction \n3'CgERG4-PstIoverlap \n \nGGCCGCTCTAGAACTAGTGGATCCCCCGGGg\ngaaggtcgtctataccaagttga \nplasmid construction \nScNAT1p-CgPDR1-OL \n \ngtcattctttagctacgttattgagagaatCATAGCTTCAAAA\nTGTTTCTACTCCTTTTT \nplasmid construction \nScNAT1t-CgPDR1-OL \n \ntgagagatattgtagtgttatcgctaGCAAATTAAAGCCTT\nCGAGCGTCCCAAAAC \nplasmid construction \n5'CgPDr1-ScNAT1-OL \n \nAAAAAGGAGTAGAAACATTTTGAAGCTATGattc\ntctcaataacgtagctaaagaatgac \nplasmid construction \n3'CgPDR1-ScNAT1-\nOL \nGTTTTGGGACGCTCGAAGGCTTTAATTTGCtag\ncgataacactacaatatctctca \nplasmid construction \n5'CgPDR1-SacII-OL \n \nGGGGATCCACTAGTTCTAGAGCGGCCGCCAta\ncatcgtaacaaacatttcctcatagatc \nplasmid construction \n3'CgPDR1-SacII-OL \n \nTCACTAAAGGGAACAAAAGCTGGAGCTCCAag\nagttacagacgaccaacgtg \nplasmid construction \npSK forward_2 GATGTGCTGCAAGGCGATTAAGTTG deletion cassette \namplification \npSK revers ACACAGGAAACAGCTATGACCATGA deletion cassette \namplification \nX2-NAT1 CTGTGCTTGGGTGTTTTGAAGTGGTAC verification  \nX3-NAT1 TACGACGGCACCGCCTCGGA verification \nX2-ScHIS3 GAGTGTACTAGAGGAGGCCAAGA verification \nX3-ScHIS3 TGTGGTGATAGGTGGCAAGTGG verification \nX2-ScLEU2 GCGTCATCTTCTAACACCGTATATG verification \nX3-ScLEU2 ACAAGGAGGAGGGCACCACA verification \nG1-CgERG3 CTACGAGAACAAGAGCTAAGAGTAT verification \nG4-CgERG3 GATGTAGGAAAAGTAATGTGTGCG verification \nG1-CgERG4-NEB GAAGGAGAATGCGGGTCCAG verification \nG4-CgERG4-NEB GCTGCTTCTGCTGCTGGTTATG verification \nG1-CgPDR1 TGATTGTACCCATACAGAAGAAAACTTAGA verification \nG4-CgPDR1 ATGACTGATTCTTTTGGTAATTATTTGATTCAG verification \nR1-CgERG2 ATGTCATCCTATTTGGTACCGCAG gene expression \nR2-CgERG2 GTTTTGATCCATAGCGTATTGCTTTG gene expression \nR1-CgERG3 CACTCCATTCGCCTCCCAC gene expression \nR2-CgERG3 GATGTAGGAAAAGTAATGTGTGCG gene expression \nR1-CgERG4 ACGGTTGGTACAGATATGCCAG gene expression \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nR2-CgERG4 TGCAGTATTCAACCCAGTCCTTG gene expression \nR1-CgERG5 GACTACCAAGCTCCAAAGGGTTC gene expression \nR2-CgERG5 TGGAGTGACCTTGTGCTTGAAGTC gene expression \nR1-CgERG6 ATGAAGAGCACCGTAAGATCGCTTA gene expression \nR2-CgERG6 CATACAGTTAGTGAATTTTCTACCGAAG gene expression \nR1-CgERG11 AGTCTCCCCAGGTTACACTCAC gene expression \nR2-CgERG11 ACACCCAATTGACAGTAAGCGAAC gene expression \nR1-CgCDR1 CCAGGTGGCAGAAGCAGCA gene expression \nR2-CgCDR1 ATGGTCCCAAGTACTCGCCAC gene expression \nR1-CgFLR1 AGCATCAAAGTCGCAGCTAAGAG gene expression \nR2-CgFLR1 GACTGAAGCAACATACTTTGGATAG gene expression \nR1-CgFLR2 GTGTTATCCAGAATACGTTGCATC gene expression \nR2-CgFLR2 TCTGGACTAAATCTTGATCTTGCTC gene expression \nR1-CgPDH1 TGTGGTGTGATGGCTACTCCAG gene expression \nR2-CgPDH1 AGTACCTGCTACATTCAGATAAGGAG gene expression \nR1-CgSNQ2 TGTGGTGTTGTTCAGCCCGTTTC gene expression \nR2-CgSNQ2 AGTTTGTCCAGCTGGGGGATC gene expression \n 459 \nlow case: restriction sites 460 \n  461 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint \n\nTable S3. Plasmids used in this study. 462 \n 463 \nStrain Features Source \npSK Bluescript Beta lactamase gene Agilent \npSK-SCH9-NAT1 Beta lactamase gene, NAT1 gene with 1000bp \nhomology regions for the integration into the CgSCH9 \nlocus \nPohlers et al., \n2017 \npSK-CgERG3-ScHIS3 Beta lactamase gene, ScHIS3 gene with 1000bp \nhomology regions for the integration into the CgERG3 \nlocus \nThis work. \npSK-CgERG4-ScLEU2 Beta lactamase gene, ScLEU2 gene with 1000bp \nhomology regions for the integration into the CgERG4 \nlocus \nThis work. \npSK-CgPDR1-NAT1 Beta lactamase gene, NAT1 gene with 1000bp \nhomology regions for the integration into the CgPDR1 \nlocus \nThis work. \npSK-CgERG3WT-\nNAT1 \nBeta lactamase gene, ERG3WT (from CBS138, \nincluding promoter and terminator) gene with 1000bp \nhomology regions for the integration into the CgERG3 \nlocus \nThis work. \n 464 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 28, 2025. ; https://doi.org/10.1101/2025.08.28.672802doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}