{"paper_id":"03a37d90-4e97-4c6c-a14b-5fa333d205d7","body_text":"Reverse Transcriptase-PCR-based techniques for the detection and identification of potato virus Y and tobacco mosaic virus in tobacco. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Reverse Transcriptase-PCR-based techniques for the detection and identification of potato virus Y and tobacco mosaic virus in tobacco. Reward Muzerengwa, Norman Muzhinji, Dahlia Garwe, Tawanda Jonathan Chisango, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5932739/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Symptomatological assays have been traditionally relied upon for the detection of tobacco mosaic virus (TMV) and potato virus Y (PVY), the two major economic consequential viruses infecting tobacco in Zimbabwe and globally. However, morphological methods are subjective and unreliable, as they are affected by abiotic factors and phytotoxicity, leading to misdiagnosis. The advent of polymerase chain reaction (PCR)-based assays has transformed pathogen diagnostics by offering robust diagnostic techniques to support disease management strategies that can avert yield losses. Reverse transcriptase‒polymerase chain reaction (RT‒PCR) protocols were developed for the identification of TMV and PVY in tobacco in Zimbabwe. The internal specific primer pairs amplified 480 bp of the coat protein for PVY, 420 bp for the protein movement gene, and 496 bp for the TMV virus genome. The effectiveness and reliability of the assays were analysed via sensitivity comparisons of the double-stranded RNA extraction method (dsRNA), double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) and RT‒PCR, which were conducted at weekly intervals after viral infection of tobacco plants. DsRNA was the least effective at detecting PVY after three weeks of infection. Compared with dsRNA, DAS-ELISA was more sensitive for detecting viruses after one week of infection for up to six weeks for PVY and after three weeks for TMV. However, RT‒PCR consistently detected viral infection throughout the duration of the study. The use of RT‒PCR is recommended for application since it has improved sensitivity and specificity. Molecular Biology Biotechnology and Bioengineering Virology General Microbiology Plant Physiology and Morphology Plant Molecular Biology and Genetics dsRNA DAS-ELISA Potato virus Y Tobacco mosaic virus Reverse transcriptase-PCR Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 INTRODUCTION Zimbabwe is regarded the largest producer of tobacco ( Nicotiana tabacum L.) in Africa and fourth in the world, after China, Brazil, and the United States of America (Munanga et al. 2017 ). Despite this, tobacco production in Zimbabwe encounters multiple constraints, with viral, bacterial, fungal and nematode infections being among the most problematic. These pathogens often lead to quantitative and qualitative yield losses as well as export earnings. Among the above-stated plant pathogens, viruses are highly important (Tsai 2022). Tobacco mosaic virus (TMV) is a rod-shaped plant virus that is highly stable and can survive for years in cigarettes made from infected tobacco leaves (Lee et al. 2021a ). TMV primarily infects tobacco leaves, causing mosaic patterns (Ji et al. 2023 ), and can also transmit the infection to other members of the Solanaceae family, such as potato, tomato, paprika, pepper and weeds (Adams 2005 ), impacting crop rotation strategies. Symptoms of TMV infection include light green or yellow patches of various shades and shapes on tobacco leaves, resulting in a characteristic mosaic pattern (Liu et al. 2010 ). TMV is transmitted by physical abrasion. Potato virus Y (PVY) has been identified as a consequential pathogen that affects solanaceous crops, including tomato, potato and tobacco (Torrance and Talianksy 2020 ). PVY has the capacity to cause significant crop losses, with susceptible cultivars resulting in up to a 40% reduction in yield and, in severe cases, complete crop failure (Kreuze et al. 2020 ). In the genus Potyvirus , family Potyviridae (the largest plant virus family) (Margaritopoulos et al. 2010 ), PVY has a flexuous filament shape without an envelope with a single-stranded positive-sense genomic RNA (ssRNA) (Chikh-Ali et al. 2010 ) of approximately 9.8 kb (Verma et al. 2021 ). The genome contains a single open reading frame (ORF) flanked by 3’ and 5’ non-translated regions (NTRs). Symptoms of PVY infection in tobacco include mosaic and necrotic leaves and, in severe cases, lead to falling leaves. Currently, five major PVY strains have been identified on the basis of symptomatology and serology, namely, PVY O , PVY C , PVY N , PVY NTN and PVY N−Wi (Manasseh et al. 2023 ). PVY is spread by aphids, especially the peach aphid Myzus persicae , in a non-persistent manner, making controlling the spread of this disease via pesticides challenging (Depta et al. 2023 ). The most common aphid responsible for its transmission is the peach aphid Myzus persicae (Gadhave et al. 2020 ). Some viral symptoms in tobacco can overlap with disorders caused by abiotic stressors such as nutrient deficiency and phytotoxicity (Lee et al. 2021a ). In some cases, infected plants are asymptomatic and act as reservoirs for the transmission of viral infection to healthy plants. Effective assays for the detection and identification of viruses, both in plants and vectors, play crucial roles in virus disease management (Hosseinzadeh et al. 2012). Common detection methods include the double-stranded RNA (dsRNA) extraction method, enzyme-linked immunosorbent assay (ELISA) and reverse transcriptase-polymerase chain reaction (RT‒PCR) (Blouin et al. 2016 ). RT‒PCR has emerged as a powerful and effective tool for the identification of plant viruses in plant material (Kasi Viswanath et al. 2023 ). ELISA and PCR are also very important for virus identification, but they require technical expertise (Fisher 2010 ). While ELISA and PCR are used as primary detection methods, they have limitations because of their specificity. Analysis employing dsRNA provides a non-specific alternative to more precise assays such as ELISA and PCR. Many viruses infecting plants (> 95%) are composed of single-stranded messenger-sense (+) RNA genomes (Modrow et al. 2013 ). When ssRNA viruses replicate in the host cell, they produce an intermediate phase, with a negative sense (-) RNA strand serving as a template, leading to the formation of a double-stranded RNA that is useful as a diagnostic tool (Modrow et al. 2013 ) The aim of this study was, therefore, to develop reverse transcriptase‒PCR-based methods for the identification of PVY strains and TMV in tobacco. Rapid and precise diagnosis of viruses is highly important to growers, who must promptly implement effective control strategies. Additionally, this study contributes to the understanding of the epidemiology of PVY and TMV in the tobacco-growing regions of Zimbabwe. MATERIALS AND METHODS Plant material and sources of viruses PVY-susceptible tobacco varieties (K RK26, T64 and TB4) and TMV-susceptible varieties (T64, K51, K RK26 and K RK29) were obtained from the Plant Breeding Division (PBD) and Plant Health Services (PHS) of Kutsaga Reseach Station, Zimbabwe. A total of six PVY-susceptible and TMV-susceptible tobacco varieties (TB4, T64, K RK26, T64, K RK29 and K51) were germinated, and three plants per cultivar were transplanted into individual 2 L greenhouse pots with peat-based compost at the 3–4-leaf stage. The plants were placed in the screen cage in preparation for inoculation and were subjected to virus inoculation at the 5–6 leaf stage under natural sunlight conditions in the greenhouse. Four tobacco plants, one each from T64, K RK26 and two from TB4 varieties with characteristic PVY symptoms, were collected from fields at Kutsaga Research Station and infested with cultured aphids on tobacco leaves for two days. Aphids from the infected plants were then placed on tobacco leaves of two PVY-susceptible plants after 48 hours of infestation at a stage of 5–6 leaves. The other plant mixture remained uninoculated and was used as a control. Two TMV-infected samples were used to infect TMV-susceptible plants through abrasion via cotton wool and infected sap. Non-specific virus diagnosis Symptom observations were carried out weekly for up to six weeks post inoculation. Sampling was performed weekly after inoculation, with 12 out of the 18 inoculated plants from each unit of observation (plants of the same cultivar infected with the same isolate) sampled for dsRNA analysis. The tobacco leaf tissue samples were collected from the upper, middle, and lower parts of the infected plants. Weekly viral indexing of the infected plants was performed via dsRNA analysis for up to six weeks. The plant material found to be positive for the presence of viruses via dsRNA analysis after gel electrophoresis was used for the specific detection of viruses via DAS-ELISA and RT‒PCR. Specific virus diagnosis DAS-ELISA DAS-ELISA was utilized for the specific identification of PVY O , PVY N , PVY NTN and TMV from material found to be positive in dsRNA analysis via the Bioreda DAS-ELISA Kit (catalogue number IgG112911) following the manufacturer’s recommended protocol. Briefly, purified monoclonal antibodies (IgG) were diluted in coating buffer as follows: 1:1000 for PVY IgG and 1:1000 for TMV IgG, followed by the addition of 200 µl of the mixture to each well of a microtiter plate. The plates were covered tightly and incubated at 37°C for 2–4 hours. After the incubation stage, the plate wells were washed 3–4 times with washing buffer. Antigen was extracted by homogenizing the tissue in extraction buffer (0.5 g of tissue in 5 ml of buffer). An amount of 200 µl was added per well. The extract of healthy tobacco was used as the negative control. The plates were closed tightly and then incubated in a moist chamber at 4–6°C for 18 hours after the wells were washed 3–4 times with washing buffer. The monoclonal conjugates were diluted 1:1000 for PVY and 1:1000 for TMV in conjugate buffer. A total of 200 µl was added per well, and the plates were covered tightly and incubated at 37°C for 5 hours. For the colour reaction, 1 mg/ml p-nitrophenyl phosphate was dissolved in substrate buffer. A volume of 200 µl was added, and the mixture was incubated at ambient temperature in the dark. Observations were made after 30–120 min for colour changes, and the well plates were placed in an ELISA plate reader (Bioline, India) for optical density (OD) readings. The cut-off point was determined by adding the mean 93 s + 10%, where the mean is the mean of the mean values and s = standard deviation. Reverse-transcriptase PCR amplification Total viral RNA wa s isolated from virus-infected plants using the TRIzol TM LS Reagent (Thermo Fisher Scientific) following the manufacturer’s recommended protocol. Plant tissue (50–100 mg) was homogenized with 1 ml of TRIzol™ reagent via a homogenizer. The homogenized sample was incubated for 5 minutes at room temperature, centrifugation was performed at 1200 × g for 3‒5 minutes, and the supernatant was discarded. A total of 200 µl of chloroform was added per 1 ml of TRIzol™ Reagent, and the tissue was incubated at 15–30°C for 15 min, vortexed only halfway through and centrifuged at 1200 × g for 15 min. The aqueous phase was transferred to a new tube, and the lower phase was discarded. Isopropanol alcohol (500 µl) was added, mixed gently and incubated for 10 min. The tubes were spun at 1200 × g for 10 min. The supernatant was removed, and the pellet was washed with 1 ml of ice-cold 75% ethanol, which was then centrifuged at 1200 × g for 15 min. The RNA pellet was air-dried for 15 min, dissolved in RNase-free water and stored in a -20°C refrigerator. The isolated RNA was reverse transcribed to cDNA via the Omniscript Reverse Transcriptase (Qiagen) two-tube RT‒PCR protocol. Reverse transcription was conducted in a 20 µl reaction mixture comprising 2 µl of 10x Buffer RT, 5 mM each dNTP, 10 µM Oligo-dT primer, 10 U/µl RNase inhibitor, 1 µl Omniscript Reverse Transcriptase, 5 µl RNase-free water and 5 µl template RNA. PCR amplification Each cDNA sample was amplified via species-specific primers (Table 1 ). The 25 µl PCR mixture contained 5 µl of reverse transcriptase, 2.5 µl of Taq polymerase (1.25units), 10× buffer (1.5 mM), dNTPs (25 mM), MgCl 2 (1.5 mM), 0.3 µl of each primer, 0.5 µl of Taq DNA polymerase (1 U) and 10 µl of ultrapure water. Table 1 Primer names and sequences used for detection of PVY and TMV. Primer name Primer Sequence 5’-3’ Annealing Temperature References PVY3S-F ACGTCCAAAATGAGAATGCC 55⁰C Shalaby et al. 2002 PVYA4-R TGGTGTTCGTGATGTGACCT 55⁰C TMV1-F GACCTGACAAAAATGGAGAAGATC 58⁰ C Silva et al. 2008 TMV2 –R GAAAGGGGACAGAAACCCGCTG 58⁰C TMV (T5)-F AAAATGAGGGATATGGTC 58⁰C Liu et al. 2010 TMV (T3)-R AAAATGAGGGATATGGTC 58⁰C PVY O A-F ACGTCCAAAATGAGAGAATGCC 63⁰C Singh et al. 1998 PVY O A-R TGGTGTTCGGATGTGACCT 63⁰C PVY O B-F CAACTAGATGGATTTGGCGACC 66⁰C Lorenzen et al. 2006 PVY O B-R CCCAAGTTCAGGGCATGCAT 66⁰C PVY N B-F GTCGATCACGAAACGCAGACT 60⁰C Lorenzen et al. 2006 PVY N B-R TGATCCACAACTTCACCGCTAACT 60⁰C For TMV primers, RT‒PCR was performed via 50 µl of cDNA in a 250 µl reaction that contained ultra-pure water at a volume of 60 µl, 10 × buffer at a volume of 25 µl, dNTPs (2.5 mM) at a volume of 20 µl, MgCl 2 (25 mM) at a volume of 15 µl, primers (10 µl each) at a volume of 20 µl and Taq polymerase (5 U/µl) at a volume of 2 µl. The PCR program consisted of denaturing at 94°C for 3 min for 35 cycles at 94°C for 30 s, 58°C for 45 s, and 72°C for 1 min, ending with a final extension for 5 min at 72°C. For the PVY O specific primers, RT‒PCR was conducted with 5 µl of cDNA in a 50 µl reaction mixture containing ultra-pure water at a volume of 26.5 µl, buffer (10×) at a volume of 5 µl, dNTPs (2.5 mM) at a volume of 4 µl, MgCl 2 (25 mM) at a volume of 3 µl, primers (25 µm each) at a volume of 3 µl and Taq polymerase (5 U/µl) at 0.5 µl. The PCR conditions consisted of denaturation at 94°C for 3 min; 30 cycles of 94°C for 30 s, 63°C for 1 min, and 72°C for 1 min; and a final extension of 5 min. For alternative primers (PVY O and PVY N ), PCR for both primers was performed with 2 µl of cDNA in a 50 µl reaction mixture containing ultra-pure water at a volume of 32.75 µl, buffer (10×) at a volume of 5 µl, 2.5 mM dNTPs, 25 mM MgCl 2 , and 10 µm primers at a volume of 1 µl and Taq (5 U/µl) at a volume of 0.25 µl. The touch-down PCR program consisted of denaturation at 94°C for 2 min; 12 cycles of 94°C for 10 s, 66°C for 30 s (minus 0.5°C per cycle), and 60 s at 72°C; and 20 cycles of 92°C for 10 s, 60°C for 30 s, and 72°C for 60 s, ending with a final extension for 7 min at 72°C. The PCR amplicons and dsRNA samples were visualized on a 1.5% agarose gel stained with ethidium bromide using a UVITECH gel documentation system. These results were analysed via SPSS version 20 for statistical calculations and Microsoft Excel 2016 for bar graph and error bar construction. The cut-off point for the ELISA readings was determined by calculating the mean of the three readings of each sample. RESULTS Symptomatology The plants that were infected with the respective isolates presented characteristic TMV symptoms (Fig. 1 a) and PVY (Fig. 1 b and c) three to four weeks post-inoculation. The symptoms of the samples resembled those of infected plants obtained from tobacco fields at Kutsaga Research Station. Detection of PVY PVY detection on inoculated plants was conducted weekly using dsRNA, DAS-ELISA and RT-PCR simultaneously. In the first and second weeks, only das-ELISA and RT‒PCR yielded positive results for PVY in infected plants, whereas dsRNA did not (Table 2 , Figs. 2 , 3 and 4 ). However, from the third to the sixth week, all the methods yielded positive PVY results in all the samples (Figs. 2 , 3 and 4 ). Table 2 Weekly detection of PVY in infected leaves via different methods Method Cultivar Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 dsRNA K RK 26 - - + + + + T64 - - + + + + TB4 - - + + + + Das-ELISA K RK 26 + + + + + + T64 + + + + + + TB4 + + + + + + RT‒PCR K RK 26 - + + - + + T64 + + - + + + TB4 + + + + + + During the first two weeks of infection, the dsRNA method did not detect PVY in tobacco (Table 2 ). In contrast, ELISA successfully detected PVY in all the PVY-inoculated samples (K RK 26, T64 and TB4) one and two weeks after inoculation (Table 2 , Figs. 2 and 3 ). In RT‒PCR, an expected band size of 480 bp was detected in K RK26 after one week of infection. K RK 26, T64, and TB4 produced the expected band size of 480 bp after 2 weeks of infection (Fig. 4 ). As the virus multiplied and reached a stage of approximately 3 weeks, evidence of virus infection was proven by bands for all the PVY samples produced after running samples on gel (Fig. 4 ). At week three and four, the dsRNA method successfully detected viral infection in the infected plants (Fig. 3 ). All the samples tested positive via ELISA after four weeks of infection, as the samples were above the cut-off value of 0.123 OD. The expected band size of 480 bp was detected via RT‒PCR in all the samples except for T64 after 4 weeks of infection (Fig. 4 ). All the samples tested positive for PVY from 4 weeks to 6 weeks via dsRNA, ELISA and RT‒PCR (Fig. 2 , 3 , 4 ). Detection of TMV The TMV was analysed at weekly intervals via dsRNA, DAS-ELISA and RT‒PCR concurrently. RT‒PCR produced the expected band size of 422 bp for TMV (Fig. 5 c). DAS-ELISA produced positive results for most samples after three weeks of infection (Fig. 5 b). For all the methods, the samples were positive for TMV from two to three weeks of infection (Table 3 , Fig. 5 ). Table 3 Weekly detection of TMV in infected leaves via different methods Method Cultivar Week 1 Week 2 Week 3 DsRNA K51 + + + T64 + + + T29 - + + KRK 26 + + + ELISA K51 - + + T64 - + + T29 - + + KRK26 - - - RT‒PCR K51 + + + T64 + + + T29 + + + K RK 26 - + + DISCUSSION This study was carried out to develop RT‒PCR-based assays for the detection and identification of TMV and PVY in tobacco that would improve both detection sensitivity and specificity compared with the ELISA systems and dsRNA methods currently in use. On the basis of symptoms, most of the PVY- and TMV-inoculated samples presented necrotic spots and mosaic patterns, as expected. However, other samples took time to show symptoms, which could have been due to the time at which the inoculation was performed (Tsai et al. 2022 ). Summer is normally an unfavourable time of the year for virus replication because of heat (Tsai et al. 2022 ; Scholthof 2008 ). For the main objective, an RT‒PCR-based protocol was successfully developed for the detection and identification of TMV and PVY throughout the duration of the study. These data support the contention that the viral titre clearly influences the detection capability of the method, providing the first basis for why scientists in Zimbabwe should not rely only on the dsRNA method (Cardoso et al. 2023 ; Lukacs 1994). This finding was also in accordance with that of Fisher ( 2010 ), who reported that dsRNA was non-specific. The findings of Ghosh and Bapat ( 2005 ) indicate that DAS-ELISA can be used for detection as early as the first week post infection. Seo et al. ( 2023 ) reported that ELISA is an efficient method for detecting PVY in plant tissues with both primary and secondary infections. The dsRNA method was found to be better than symptomatology, as PVY can be detected at one month post infection. These findings support the importance of developing PCR-based methods that are reliable and efficient (Tian et al. 2022). However, ELISA and PCR had better sensitivity than did dsRNA. RT‒PCR is slightly more sensitive than ELISA and more reliable because of the amplification of DNA (Gunay et al. 2022). This finding is in agreement with most studies by Singh et al. ( 2004 ) and Ghosh and Bapat ( 2005 ). The primer sets facilitating the use of a single protocol were reported by Liu et al. ( 2010 ) and Silva et al. (2008). This finding highlights the advantages of molecular techniques over morphological analysis since it can take up to 14 to 21 days for the viruses to be detected via eyeball methods. Taken together, these findings may suggest that even with slightly lower reliability, RT‒PCR may become competitive with ELISA if it is used in multiplex formats for the identification of multiple viruses in field samples in a single run. RT‒PCR has greater sensitivity potential because the amplification step, as opposed to ELISA, which, in its most popular format, is a protein detection technique without amplification (Lee et al. 2021b ). Further studies have been initiated in Zimbabwean tobacco research laboratories on the use of multiplex RT‒PCR and quantitative real-time PCR for the identification and quantification of viral titres and viral concentrations in tobacco that target TMV and PVY. CONCLUSIONS RT‒PCR is very important as a routine plant virus detection tool for virus disease diagnosis and surveys where precise detection is of concern. This method has several advantages, including the ability of RT‒PCR protocols to readily detect and identify PVY and TMV in infected tobacco samples. Such an assay will help growers, crop agronomists, and plant health professionals not depend exclusively on symptomatology and/or time-consuming diagnostic procedures and permit early detection of viral infection. Declarations Ethics Approval and consent to participate Not applicable Consent for publication All the authors consented to the publication of the manuscript. Competing interests The authors declare that they have no competing interests. Funding There is no source of funding for the current research. Authors’ Contributions RM conceptualized the idea of the manuscript and contributed to the conception of work, carried out the experimental work, interpreting the literature, analysing the data and wrote the initial draft of the manuscript. NM, DG and TJC supervised RM’s work, reviewed and commented on the manuscript. MN and FM reviewed and commented on the manuscript. All the authors listed have a substantial and intellectual contribution to the work. All authors read and approved the final manuscript. ACKNOWLEDGEMENTS The Tobacco Research Board of Zimbabwe (TRB), Kutsaga Research Station, is acknowledged for providing facilities for this study. Availability of data and materials The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request. References Adams MJ (2005) Molecular criteria for genus and species discrimination within the family Potyviridae. Arch Virol 150:459–479 Blouin AG, Ross HA, Hobson-Peters J, O’Brien CA, Warren B, MacDiarmid R (2016) A new virus discovered by immunocapture of double-stranded RNA, a rapid method for virus enrichment in metagenomic studies. Mol Ecol Resour 16:1255–1263. 10.1111/1755-0998.1252 Cardoso FMH, Elias A, Pereira I, Maurício I, Matos O (2023) Improved dsRNA isolation and purification method validated by viral dsRNA detection using novel primers in Saccharomyces cerevisiae . Methods X 11:102435. 10.1016/j.mex.2023.102435 Chikh-Ali M, Maoka T, Natsuaki T, Natsuaki KT (2010) PVY NTN–NW , a novel recombinant strain of Potato virus Y predominating in potato fields in Syria. Plant Pathol 59:31–41 Depta A, Doroszewska T, Czubacka A (2023) Possibilities of using Nicotiana species in breeding for virus resistance. Pol J Agron 52:97–109. https://doi.org/10.26114/pja.iung.520.2023.52.11 Fisher L (2010) A standard modified dsRNA protocol. Journal of virology Gadhave KR, Gautam S, Rasmussen DA, Srinivasan R (2020) Aphid Transmission of Potyvirus: The Largest Plant-Infecting RNA Virus Genus. Viruses 17(7):773. 10.3390/v12070773 Ghosh SB, Bapat VA (2005) Development of RT–PCR based method for the detection of potato virus Y, in tobacco and potato. Indian J Biotechnol 5:232–235 Gunay A, Usta M (2020) First investigation of five tobacco viruses using PCR based methods in tobacco plants grown in Adiyaman, Turkey. Fresenius Environ Bull Vol 29(12):11624–11632 Hosseinzadeh H (2012) In: Nasrollanejad S, Khateri H (eds) Serological detection of on some important host crops in the north region of Iran. Archives Of Phytopathology And Plant Protection Ji Y, Guo Y, Deng H, Zhang J, Wang Y, Dai E et al (2023) Rapid diagnosis of Tobacco mosaic virus in tobacco using time-resolved fluorescence immunoassay. Food Agricultural Immunol 34(1):10–20 Kasi Viswanath K, Hamid A, Ateka E, Pappu HR (2023) CRISPR/Cas, Multiomics, and RNA Interference in Virus Disease Management. Phytopathology 113(9):1661–1676. 10.1094/PHYTO-01-23-0002-V Epub 2023 Nov 2. PMID: 37486077 Kreuze JF, Souza-Dias JAC, Jeevalatha A, Figueira AR, Valkonen JPT, Jones RAC (2020) Viral Diseases in Potato. In: Campos H, Ortiz O (eds) The Potato Crop. Springer, Cham Lee KZ, Pussepitiyalage VB, Lee Y, Loesch-Fries LS, Harris MT, Hemmati S et al (2021a) Engineering tobacco mosaic virus and its virus-like-particles for synthesis of biotemplated nanomaterials. Biotechnol J 16(4):2000311 Lee HJ, Cho IS, Ju HJ, Jeong RD (2021b) Development of a reverse transcription droplet digital PCR assay for sensitive detection of peach latent mosaic viroid. Mol Cell Probes 58:101746. 10.1016/j.mcp.2021.101746 Liu Y, Wang Z, Qian Y, Mu J, Shen L, Wang F et al (2010) Rapid detection of tobacco mosaic virus using the reverse transcription loop-mediated isothermal amplification method. Arch Virol 155(10):1681–1685. 10.1007/s00705-010-0746-5 Lorenzen JH, Piche LM, Gudmestad NC, Meacham T, Shiel P (2006) A multiplex PCR assay to characterize Potato virus Y isolates and identify strain mixtures. Plant Dis 90:935–940 Lorenzen JH, Meacham T, Berger PH, Shiel PJ, Crosslin JM, Hamm PB et al (2006) Whole genome characterization of Potato virus Y isolates collected in the western USA and their comparison to isolates from Europe and Canada. Arch Virol 151:1055–1074 Lukács N (1994) Detection of virus infection in plants and differentiation between coexisting viruses by monoclonal antibodies to double-stranded RNA. J Virol Methods 47(3):255–272. 10.1016/0166-0934(94)90023-x Manasseh R, Berim A, Kappagantu M, Moyo L, Gang DR, Pappu HR (2023) Pathogen-triggered metabolic adjustments to potato virus Y infection in potato. Front Plant Sci 13. 10.3389/fpls.2022.1031629 Margaritopoulos JT, Dovas CI, Gounaris J, Skouras PJ, Olympia M, Kanavaki OM et al (2010) Molecular Analysis of the Coat Protein of Potato virus Y Isolates in Greece Suggests Multiple Introduction from Different Genetic Pools. J Phytopathol 02 Modrow S, Falke D, Truyen U, Schätzl H (2013) Viruses with Single-Stranded, Positive-Sense RNA Genomes. Molecular Virology 185–349. 10.1007/978-3-642-20718-1_14 . PMCID: PMC7169642 Mumford RA, Boonham N, Tomlinson J, Barker I (2006) Advances in molecular phytodiagnostics - new solutions for old problems. Eur J Plant Pathol 116:1–19 Munanga W, Mugabe FT, Kufazvinei C, Dimbi S (2017) Development of a low cost and energy efficient tobacco curing barn in Zimbabwe. Afr J Agric Res 12:2704–2712 Scholthof KBG (2008) Tobacco Mosaic Virus: The Beginning of Plant Pathology. Online APSnet Features doi: 10.1094/APSnet Features-2008-0408. Seo H, Cho S-H, Vo TTB, Lee A, Cho S, Kang S et al (2023) M13KO7 bacteriophage enables Potato Virus Y detection. Microbiol Spectr 11(6):e0144623. 10.1128/spectrum.01446-23 Shalaby AA, Nakhla MK, Soliman AM, Mazyard HM, Hadidi A, Maxwell DP (2002) Development of a highly sensitive multiplex reverse transcription-polymerase chain reaction (m-RT–PCR) method for detection of three potato viruses in a single reaction and nested PCR. Arab Journal of Biotechnology Vol.5.No. (2) July: 275–286 Silva RMd S, ERd, Pedroso JC, Arakava R, Almeida AMR, Barboza AAL et al (2008) Detection and identification of tmv infecting tomato under protected cultivation in paraná state. Brazilian Archives Biology Technol 51(5):903–909. https://doi.org/10.1590/s1516-89132008000500005 Singh RP, Dilworth AD, Singh M, McLaren DL (2004) Evaluation of a simple membrane-based nucleic acid preparation protocol for RT–PCR detection of potato viruses from aphid and plant tissues. J Virol Methods 121:163–170 Singh RP, Singh M, Mcdonald JG (1998) Screening by a 3-primer PCR of North American PVY N isolates for European type members of the tuber necrosis including PVY NTN subgroups. Can J Plant Pathol 20:227–233 Torrance L, Talianksy ME (2020) Potato Virus Y Emergence and Evolution from the Andes of South America to Become a Major Destructive Pathogen of Potato and Other Solanaceous Crops Worldwide. Viruses 12:1430. 10.3390/v12121430 Tsai WA, Brosnan CA, Mitter N et al (2022) Perspectives on plant virus diseases in a climate change scenario of elevated temperatures. Stress Biology 2:37. https://doi.org/10.1007/s44154-022-00058-x Verma N, Tiwari BS, Pandya A (2021) Field Deployable Vertical Flow Based Immunodevice for Detection of Potato Virus Y in Potato Leaves. ACS Agricultural Science & Technology Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-5932739\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":409293845,\"identity\":\"cc65e2af-033c-4e5b-a854-62555cb46aaf\",\"order_by\":0,\"name\":\"Reward Muzerengwa\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIiWNgGAWjYHAD5gNAQkKGFC1sCSAtPKRo4TEAkwTVmU87/vBxRcUduw3Hz3x+daPGgoeB/fDRDfi0yNxOSDY8c+ZZ8oYzudusc44BHcaTlnYDnxYJ6YRjko1th5PNDuRuM85hA2qR4DEjoCWx/WfjP6CW82+eGef8I0pLMhtjY8NhO7MbOcyPc9uI0pLGLNlw7HCC/Y1nZsy5fRI8bIT9kv7wY0PNYXvJ/uTHn3O+1cnxsx8+hlcLDCQ2AONSAsRiI0Y5CNgDMfMHYlWPglEwCkbByAIA4ztJbQ0i2WMAAAAASUVORK5CYII=\",\"orcid\":\"https://orcid.org/0009-0009-2680-1627\",\"institution\":\"National Biotechnology Authority, Zimbabwe\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Reward\",\"middleName\":\"\",\"lastName\":\"Muzerengwa\",\"suffix\":\"\"},{\"id\":409296130,\"identity\":\"e3dfb4af-d80b-41ca-ba94-5e618f84ea22\",\"order_by\":1,\"name\":\"Norman Muzhinji\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of the Free State, South Africa\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Norman\",\"middleName\":\"\",\"lastName\":\"Muzhinji\",\"suffix\":\"\"},{\"id\":409296504,\"identity\":\"da0fb9ea-f90a-4b25-8f70-e23290b40474\",\"order_by\":2,\"name\":\"Dahlia Garwe\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tobacco Research Board, Kutsaga Research Station, Zimbabwe\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dahlia\",\"middleName\":\"\",\"lastName\":\"Garwe\",\"suffix\":\"\"},{\"id\":409296505,\"identity\":\"f3b217e5-791e-4d96-8615-61c397a98b93\",\"order_by\":3,\"name\":\"Tawanda Jonathan Chisango\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Chinhoyi University of Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tawanda\",\"middleName\":\"Jonathan\",\"lastName\":\"Chisango\",\"suffix\":\"\"},{\"id\":409296506,\"identity\":\"d72cc86b-1c90-4564-9f9c-69037906f176\",\"order_by\":4,\"name\":\"Makomborero Nyoni\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Agricultural Research Council, South Africa\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Makomborero\",\"middleName\":\"\",\"lastName\":\"Nyoni\",\"suffix\":\"\"},{\"id\":409296507,\"identity\":\"fa618ed5-a532-4f28-b358-505d8f2a8647\",\"order_by\":5,\"name\":\"Frank Magama\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tobacco Research Board, Kutsaga Research Station, Zimbabwe\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Frank\",\"middleName\":\"\",\"lastName\":\"Magama\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-01-30 21:50:06\",\"currentVersionCode\":1,\"declarations\":{\"humanSubjects\":false,\"vertebrateSubjects\":false,\"conflictsOfInterestStatement\":false,\"humanSubjectEthicalGuidelines\":false,\"humanSubjectConsent\":false,\"humanSubjectClinicalTrial\":false,\"humanSubjectCaseReport\":false,\"vertebrateSubjectEthicalGuidelines\":false},\"doi\":\"10.21203/rs.3.rs-5932739/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-5932739/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":75284027,\"identity\":\"93edd2bf-430f-420b-9206-b99d47d36c8e\",\"added_by\":\"auto\",\"created_at\":\"2025-02-03 03:55:32\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":317053,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePVY and TMV symptoms in inoculated plants. \\u003cstrong\\u003ea\\u003c/strong\\u003e - TMV discolouration between veins, \\u003cstrong\\u003eb\\u003c/strong\\u003e - PVY necrotic spots and \\u003cstrong\\u003ec\\u003c/strong\\u003e - mosaic pattern induced by PVY\\u003csup\\u003eO\\u003c/sup\\u003e.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5932739/v1/025f301071ed1c6c4045c5a8.png\"},{\"id\":75283470,\"identity\":\"05db741c-7552-43aa-8ae3-6e62c03145d8\",\"added_by\":\"auto\",\"created_at\":\"2025-02-03 03:47:32\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":191870,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003edsRNA\\u003cstrong\\u003e \\u003c/strong\\u003edetection results \\u003cstrong\\u003ea\\u003c/strong\\u003e. Two weeks after inoculation \\u003cstrong\\u003eb\\u003c/strong\\u003e. Four weeks after inoculation, \\u003cstrong\\u003ec\\u003c/strong\\u003e. Six weeks after inoculation. Lanes 1-K RK 26, 2-T64, 3-TB4, 4-K RK26, 5-PVY positive control, 6-tissue-cultured tobacco (negative control), 7-DNA ladder mixture.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5932739/v1/6140ac50c81979c555a1cb75.png\"},{\"id\":75283473,\"identity\":\"b9fd4faa-f113-4c97-8d6b-90f47702fdd6\",\"added_by\":\"auto\",\"created_at\":\"2025-02-03 03:47:32\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":30639,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePVY detection results by DAS-ELISA. \\u003cstrong\\u003ea\\u003c/strong\\u003e. Two weeks after inoculation \\u003cstrong\\u003eb\\u003c/strong\\u003e. Four weeks after inoculation, \\u003cstrong\\u003ec\\u003c/strong\\u003e. Six weeks after inoculation one week after inoculation das-ELISA.\\u003cstrong\\u003e Cut-off = \\u003c/strong\\u003emean + 3σ + 10\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5932739/v1/cf622496459bdbb1ffa87f79.png\"},{\"id\":75283475,\"identity\":\"3eb64671-3891-4307-ac13-476c512a64f9\",\"added_by\":\"auto\",\"created_at\":\"2025-02-03 03:47:32\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":163410,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePVY detection results by RT‒PCR. \\u003cstrong\\u003ea\\u003c/strong\\u003e. Two weeks after inoculation \\u003cstrong\\u003eb\\u003c/strong\\u003e. Four weeks after inoculation,\\u003cstrong\\u003e c\\u003c/strong\\u003e. Six weeks after inoculation, Lane 1-K RK 26, 2- T64, 3-TB4, 4-PVY positive control, 5-PVY positive, 6-tissue cultured tobacco (negative control), 7-DNA ladder mix.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5932739/v1/2e92f185ee16b032f2792b4a.png\"},{\"id\":75283483,\"identity\":\"dbdd000a-5cba-4eb3-a949-964733499390\",\"added_by\":\"auto\",\"created_at\":\"2025-02-03 03:47:33\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":105898,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eDetection of TMV infection in tobacco using three methods: \\u003cstrong\\u003ea\\u003c/strong\\u003e. dsRNA, \\u003cstrong\\u003eb\\u003c/strong\\u003e. DAS-ELISA, and \\u003cstrong\\u003ec\\u003c/strong\\u003e. RT‒PCR. Lanes 1-K51, 2-T64, 3-K RK29, 4-K RK 26, 5-TMV positive control, 6-tissue cultured tobacco (negative control), 7-DNA ladder mixture. Th\\u003cstrong\\u003ee cut-off\\u003c/strong\\u003e = (0.955857 + (3 × 0.25934)) × 1.1 = \\u003cstrong\\u003e1.907\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5932739/v1/baf0151714a7bb3595c4000d.png\"},{\"id\":75284774,\"identity\":\"5c460a68-f133-4986-ae04-7ed42cdca74c\",\"added_by\":\"auto\",\"created_at\":\"2025-02-03 04:11:33\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1415159,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5932739/v1/6e49b6c7-3379-4e37-a094-1f71408eb3e0.pdf\"}],\"financialInterests\":\"The authors declare no competing interests.\",\"formattedTitle\":\"\\u003cp\\u003e\\u003cstrong\\u003eReverse Transcriptase-PCR-based techniques for the detection and identification of potato virus Y and tobacco mosaic virus in tobacco.\\u003c/strong\\u003e\\u003c/p\\u003e\",\"fulltext\":[{\"header\":\"INTRODUCTION\",\"content\":\"\\u003cp\\u003eZimbabwe is regarded the largest producer of tobacco (\\u003cem\\u003eNicotiana tabacum\\u003c/em\\u003e L.) in Africa and fourth in the world, after China, Brazil, and the United States of America (Munanga et al. \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). Despite this, tobacco production in Zimbabwe encounters multiple constraints, with viral, bacterial, fungal and nematode infections being among the most problematic. These pathogens often lead to quantitative and qualitative yield losses as well as export earnings. Among the above-stated plant pathogens, viruses are highly important (Tsai 2022).\\u003c/p\\u003e \\u003cp\\u003eTobacco mosaic virus (TMV) is a rod-shaped plant virus that is highly stable and can survive for years in cigarettes made from infected tobacco leaves (Lee et al. \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2021a\\u003c/span\\u003e). TMV primarily infects tobacco leaves, causing mosaic patterns (Ji et al. \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e), and can also transmit the infection to other members of the \\u003cem\\u003eSolanaceae\\u003c/em\\u003e family, such as potato, tomato, paprika, pepper and weeds (Adams \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e), impacting crop rotation strategies. Symptoms of TMV infection include light green or yellow patches of various shades and shapes on tobacco leaves, resulting in a characteristic mosaic pattern (Liu et al. \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e). TMV is transmitted by physical abrasion.\\u003c/p\\u003e \\u003cp\\u003ePotato virus Y (PVY) has been identified as a consequential pathogen that affects solanaceous crops, including tomato, potato and tobacco (Torrance and Talianksy \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). PVY has the capacity to cause significant crop losses, with susceptible cultivars resulting in up to a 40% reduction in yield and, in severe cases, complete crop failure (Kreuze et al. \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). In the genus \\u003cem\\u003ePotyvirus\\u003c/em\\u003e, family \\u003cem\\u003ePotyviridae\\u003c/em\\u003e (the largest plant virus family) (Margaritopoulos et al. \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e), PVY has a flexuous filament shape without an envelope with a single-stranded positive-sense genomic RNA (ssRNA) (Chikh-Ali et al. \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e) of approximately 9.8 kb (Verma et al. \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). The genome contains a single open reading frame (ORF) flanked by 3\\u0026rsquo; and 5\\u0026rsquo; non-translated regions (NTRs). Symptoms of PVY infection in tobacco include mosaic and necrotic leaves and, in severe cases, lead to falling leaves. Currently, five major PVY strains have been identified on the basis of symptomatology and serology, namely, PVY\\u003csup\\u003eO\\u003c/sup\\u003e, PVY\\u003csup\\u003eC\\u003c/sup\\u003e, PVY\\u003csup\\u003eN\\u003c/sup\\u003e, PVY\\u003csup\\u003eNTN\\u003c/sup\\u003e and PVY\\u003csup\\u003eN\\u0026minus;Wi\\u003c/sup\\u003e (Manasseh et al. \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). PVY is spread by aphids, especially the peach aphid \\u003cem\\u003eMyzus persicae\\u003c/em\\u003e, in a non-persistent manner, making controlling the spread of this disease via pesticides challenging (Depta et al. \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). The most common aphid responsible for its transmission is the peach aphid \\u003cem\\u003eMyzus persicae\\u003c/em\\u003e (Gadhave et al. \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eSome viral symptoms in tobacco can overlap with disorders caused by abiotic stressors such as nutrient deficiency and phytotoxicity (Lee et al. \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2021a\\u003c/span\\u003e). In some cases, infected plants are asymptomatic and act as reservoirs for the transmission of viral infection to healthy plants. Effective assays for the detection and identification of viruses, both in plants and vectors, play crucial roles in virus disease management (Hosseinzadeh et al. 2012). Common detection methods include the double-stranded RNA (dsRNA) extraction method, enzyme-linked immunosorbent assay (ELISA) and reverse transcriptase-polymerase chain reaction (RT‒PCR) (Blouin et al. \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eRT‒PCR has emerged as a powerful and effective tool for the identification of plant viruses in plant material (Kasi Viswanath et al. \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). ELISA and PCR are also very important for virus identification, but they require technical expertise (Fisher \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e). While ELISA and PCR are used as primary detection methods, they have limitations because of their specificity. Analysis employing dsRNA provides a non-specific alternative to more precise assays such as ELISA and PCR. Many viruses infecting plants (\\u0026gt;\\u0026thinsp;95%) are composed of single-stranded messenger-sense (+) RNA genomes (Modrow et al. \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). When ssRNA viruses replicate in the host cell, they produce an intermediate phase, with a negative sense (-) RNA strand serving as a template, leading to the formation of a double-stranded RNA that is useful as a diagnostic tool (Modrow et al. \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e)\\u003c/p\\u003e \\u003cp\\u003eThe aim of this study was, therefore, to develop reverse transcriptase‒PCR-based methods for the identification of PVY strains and TMV in tobacco. Rapid and precise diagnosis of viruses is highly important to growers, who must promptly implement effective control strategies. Additionally, this study contributes to the understanding of the epidemiology of PVY and TMV in the tobacco-growing regions of Zimbabwe.\\u003c/p\\u003e\"},{\"header\":\"MATERIALS AND METHODS\",\"content\":\"\\u003cp\\u003ePlant material and sources of viruses\\u003c/p\\u003e \\u003cp\\u003ePVY-susceptible tobacco varieties (K RK26, T64 and TB4) and TMV-susceptible varieties (T64, K51, K RK26 and K RK29) were obtained from the Plant Breeding Division (PBD) and Plant Health Services (PHS) of Kutsaga Reseach Station, Zimbabwe. A total of six PVY-susceptible and TMV-susceptible tobacco varieties (TB4, T64, K RK26, T64, K RK29 and K51) were germinated, and three plants per cultivar were transplanted into individual 2 L greenhouse pots with peat-based compost at the 3\\u0026ndash;4-leaf stage. The plants were placed in the screen cage in preparation for inoculation and were subjected to virus inoculation at the 5\\u0026ndash;6 leaf stage under natural sunlight conditions in the greenhouse. Four tobacco plants, one each from T64, K RK26 and two from TB4 varieties with characteristic PVY symptoms, were collected from fields at Kutsaga Research Station and infested with cultured aphids on tobacco leaves for two days. Aphids from the infected plants were then placed on tobacco leaves of two PVY-susceptible plants after 48 hours of infestation at a stage of 5\\u0026ndash;6 leaves. The other plant mixture remained uninoculated and was used as a control. Two TMV-infected samples were used to infect TMV-susceptible plants through abrasion via cotton wool and infected sap.\\u003c/p\\u003e \\u003cp\\u003eNon-specific virus diagnosis\\u003c/p\\u003e \\u003cp\\u003eSymptom observations were carried out weekly for up to six weeks post inoculation. Sampling was performed weekly after inoculation, with 12 out of the 18 inoculated plants from each unit of observation (plants of the same cultivar infected with the same isolate) sampled for dsRNA analysis. The tobacco leaf tissue samples were collected from the upper, middle, and lower parts of the infected plants. Weekly viral indexing of the infected plants was performed via dsRNA analysis for up to six weeks. The plant material found to be positive for the presence of viruses via dsRNA analysis after gel electrophoresis was used for the specific detection of viruses via DAS-ELISA and RT‒PCR.\\u003c/p\\u003e \\u003cp\\u003eSpecific virus diagnosis\\u003c/p\\u003e \\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDAS-ELISA\\u003c/h2\\u003e \\u003cp\\u003eDAS-ELISA was utilized for the specific identification of PVY\\u003csup\\u003eO\\u003c/sup\\u003e, PVY\\u003csup\\u003eN\\u003c/sup\\u003e, PVY\\u003csup\\u003eNTN\\u003c/sup\\u003e and TMV from material found to be positive in dsRNA analysis via the Bioreda DAS-ELISA Kit (catalogue number IgG112911) following the manufacturer\\u0026rsquo;s recommended protocol. Briefly, purified monoclonal antibodies (IgG) were diluted in coating buffer as follows: 1:1000 for PVY IgG and 1:1000 for TMV IgG, followed by the addition of 200 \\u0026micro;l of the mixture to each well of a microtiter plate. The plates were covered tightly and incubated at 37\\u0026deg;C for 2\\u0026ndash;4 hours. After the incubation stage, the plate wells were washed 3\\u0026ndash;4 times with washing buffer. Antigen was extracted by homogenizing the tissue in extraction buffer (0.5 g of tissue in 5 ml of buffer). An amount of 200 \\u0026micro;l was added per well. The extract of healthy tobacco was used as the negative control. The plates were closed tightly and then incubated in a moist chamber at 4\\u0026ndash;6\\u0026deg;C for 18 hours after the wells were washed 3\\u0026ndash;4 times with washing buffer. The monoclonal conjugates were diluted 1:1000 for PVY and 1:1000 for TMV in conjugate buffer. A total of 200 \\u0026micro;l was added per well, and the plates were covered tightly and incubated at 37\\u0026deg;C for 5 hours. For the colour reaction, 1 mg/ml p-nitrophenyl phosphate was dissolved in substrate buffer. A volume of 200 \\u0026micro;l was added, and the mixture was incubated at ambient temperature in the dark. Observations were made after 30\\u0026ndash;120 min for colour changes, and the well plates were placed in an ELISA plate reader (Bioline, India) for optical density (OD) readings. The cut-off point was determined by adding the mean 93 s\\u0026thinsp;+\\u0026thinsp;10%, where the mean is the mean of the mean values and s\\u0026thinsp;=\\u0026thinsp;standard deviation.\\u003c/p\\u003e \\u003cp\\u003eReverse-transcriptase PCR amplification\\u003c/p\\u003e \\u003cp\\u003eTotal viral RNA wa\\u003cb\\u003es\\u003c/b\\u003e isolated from virus-infected plants using the TRIzol \\u003csup\\u003eTM\\u003c/sup\\u003e LS Reagent (Thermo Fisher Scientific) following the manufacturer\\u0026rsquo;s recommended protocol. Plant tissue (50\\u0026ndash;100 mg) was homogenized with 1 ml of TRIzol\\u0026trade; reagent via a homogenizer. The homogenized sample was incubated for 5 minutes at room temperature, centrifugation was performed at 1200 \\u0026times; g for 3‒5 minutes, and the supernatant was discarded. A total of 200 \\u0026micro;l of chloroform was added per 1 ml of TRIzol\\u0026trade; Reagent, and the tissue was incubated at 15\\u0026ndash;30\\u0026deg;C for 15 min, vortexed only halfway through and centrifuged at 1200 \\u0026times; g for 15 min. The aqueous phase was transferred to a new tube, and the lower phase was discarded. Isopropanol alcohol (500 \\u0026micro;l) was added, mixed gently and incubated for 10 min. The tubes were spun at 1200 \\u0026times; g for 10 min. The supernatant was removed, and the pellet was washed with 1 ml of ice-cold 75% ethanol, which was then centrifuged at 1200 \\u0026times; g for 15 min. The RNA pellet was air-dried for 15 min, dissolved in RNase-free water and stored in a -20\\u0026deg;C refrigerator.\\u003c/p\\u003e \\u003cp\\u003eThe isolated RNA was reverse transcribed to cDNA via the Omniscript Reverse Transcriptase (Qiagen) two-tube RT‒PCR protocol. Reverse transcription was conducted in a 20 \\u0026micro;l reaction mixture comprising 2 \\u0026micro;l of 10x Buffer RT, 5 mM each dNTP, 10 \\u0026micro;M Oligo-dT primer, 10 U/\\u0026micro;l RNase inhibitor, 1 \\u0026micro;l Omniscript Reverse Transcriptase, 5 \\u0026micro;l RNase-free water and 5 \\u0026micro;l template RNA.\\u003c/p\\u003e \\u003cp\\u003ePCR amplification\\u003c/p\\u003e \\u003cp\\u003eEach cDNA sample was amplified via species-specific primers (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). The 25 \\u0026micro;l PCR mixture contained 5 \\u0026micro;l of reverse transcriptase, 2.5 \\u0026micro;l of \\u003cem\\u003eTaq\\u003c/em\\u003e polymerase (1.25units), 10\\u0026times; buffer (1.5 mM), dNTPs (25 mM), MgCl\\u003csub\\u003e2\\u003c/sub\\u003e (1.5 mM), 0.3 \\u0026micro;l of each primer, 0.5 \\u0026micro;l of \\u003cem\\u003eTaq\\u003c/em\\u003e DNA polymerase (1 U) and 10 \\u0026micro;l of ultrapure water.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePrimer names and sequences used for detection of PVY and TMV.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer name\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ePrimer Sequence 5\\u0026rsquo;-3\\u0026rsquo;\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAnnealing Temperature\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eReferences\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePVY3S-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eACGTCCAAAATGAGAATGCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e55⁰C\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eShalaby et al. \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e2002\\u003c/span\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePVYA4-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTGGTGTTCGTGATGTGACCT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e55⁰C\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTMV1-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGACCTGACAAAAATGGAGAAGATC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e58⁰ C\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eSilva et al. 2008\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTMV2 \\u0026ndash;R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGAAAGGGGACAGAAACCCGCTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e58⁰C\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTMV (T5)-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAAAATGAGGGATATGGTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e58⁰C\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eLiu et al. \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTMV (T3)-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAAAATGAGGGATATGGTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e58⁰C\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePVY\\u003csup\\u003eO\\u003c/sup\\u003e A-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eACGTCCAAAATGAGAGAATGCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e63⁰C\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eSingh et al. \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e1998\\u003c/span\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePVY\\u003csup\\u003eO\\u003c/sup\\u003e A-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTGGTGTTCGGATGTGACCT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e63⁰C\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePVY\\u003csup\\u003eO\\u003c/sup\\u003e B-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCAACTAGATGGATTTGGCGACC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e66⁰C\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eLorenzen et al. \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePVY\\u003csup\\u003eO\\u003c/sup\\u003e B-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCCAAGTTCAGGGCATGCAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e66⁰C\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePVY\\u003csup\\u003eN\\u003c/sup\\u003e B-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGTCGATCACGAAACGCAGACT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e60⁰C\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eLorenzen et al. \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePVY\\u003csup\\u003eN\\u003c/sup\\u003e B-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTGATCCACAACTTCACCGCTAACT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e60⁰C\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eFor TMV primers, RT‒PCR was performed via 50 \\u0026micro;l of cDNA in a 250 \\u0026micro;l reaction that contained ultra-pure water at a volume of 60 \\u0026micro;l, 10 \\u0026times; buffer at a volume of 25 \\u0026micro;l, dNTPs (2.5 mM) at a volume of 20 \\u0026micro;l, MgCl\\u003csub\\u003e2\\u003c/sub\\u003e (25 mM) at a volume of 15 \\u0026micro;l, primers (10 \\u0026micro;l each) at a volume of 20 \\u0026micro;l and \\u003cem\\u003eTaq\\u003c/em\\u003e polymerase (5 U/\\u0026micro;l) at a volume of 2 \\u0026micro;l. The PCR program consisted of denaturing at 94\\u0026deg;C for 3 min for 35 cycles at 94\\u0026deg;C for 30 s, 58\\u0026deg;C for 45 s, and 72\\u0026deg;C for 1 min, ending with a final extension for 5 min at 72\\u0026deg;C. For the PVY\\u003csup\\u003eO\\u003c/sup\\u003e specific primers, RT‒PCR was conducted with 5 \\u0026micro;l of cDNA in a 50 \\u0026micro;l reaction mixture containing ultra-pure water at a volume of 26.5 \\u0026micro;l, buffer (10\\u0026times;) at a volume of 5 \\u0026micro;l, dNTPs (2.5 mM) at a volume of 4 \\u0026micro;l, MgCl\\u003csub\\u003e2\\u003c/sub\\u003e (25 mM) at a volume of 3 \\u0026micro;l, primers (25 \\u0026micro;m each) at a volume of 3 \\u0026micro;l and \\u003cem\\u003eTaq\\u003c/em\\u003e polymerase (5 U/\\u0026micro;l) at 0.5 \\u0026micro;l. The PCR conditions consisted of denaturation at 94\\u0026deg;C for 3 min; 30 cycles of 94\\u0026deg;C for 30 s, 63\\u0026deg;C for 1 min, and 72\\u0026deg;C for 1 min; and a final extension of 5 min. For alternative primers (PVY\\u003csup\\u003eO\\u003c/sup\\u003e and PVY\\u003csup\\u003eN\\u003c/sup\\u003e), PCR for both primers was performed with 2 \\u0026micro;l of cDNA in a 50 \\u0026micro;l reaction mixture containing ultra-pure water at a volume of 32.75 \\u0026micro;l, buffer (10\\u0026times;) at a volume of 5 \\u0026micro;l, 2.5 mM dNTPs, 25 mM MgCl\\u003csub\\u003e2\\u003c/sub\\u003e, and 10 \\u0026micro;m primers at a volume of 1 \\u0026micro;l and \\u003cem\\u003eTaq\\u003c/em\\u003e (5 U/\\u0026micro;l) at a volume of 0.25 \\u0026micro;l. The touch-down PCR program consisted of denaturation at 94\\u0026deg;C for 2 min; 12 cycles of 94\\u0026deg;C for 10 s, 66\\u0026deg;C for 30 s (minus 0.5\\u0026deg;C per cycle), and 60 s at 72\\u0026deg;C; and 20 cycles of 92\\u0026deg;C for 10 s, 60\\u0026deg;C for 30 s, and 72\\u0026deg;C for 60 s, ending with a final extension for 7 min at 72\\u0026deg;C.\\u003c/p\\u003e \\u003cp\\u003eThe PCR amplicons and dsRNA samples were visualized on a 1.5% agarose gel stained with ethidium bromide using a UVITECH gel documentation system. These results were analysed via SPSS version 20 for statistical calculations and Microsoft Excel 2016 for bar graph and error bar construction. The cut-off point for the ELISA readings was determined by calculating the mean of the three readings of each sample.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"RESULTS\",\"content\":\"\\u003cp\\u003eSymptomatology\\u003c/p\\u003e \\u003cp\\u003eThe plants that were infected with the respective isolates presented characteristic TMV symptoms (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea) and PVY (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eb and c) three to four weeks post-inoculation. The symptoms of the samples resembled those of infected plants obtained from tobacco fields at Kutsaga Research Station.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e Detection of PVY\\u003c/p\\u003e \\u003cp\\u003ePVY detection on inoculated plants was conducted weekly using dsRNA, DAS-ELISA and RT-PCR simultaneously. In the first and second weeks, only das-ELISA and RT‒PCR yielded positive results for PVY in infected plants, whereas dsRNA did not (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, \\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e and \\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). However, from the third to the sixth week, all the methods yielded positive PVY results in all the samples (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, \\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e and \\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eWeekly detection of PVY in infected leaves via different methods\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"8\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c8\\\" colnum=\\\"8\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMethod\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCultivar\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eWeek 1\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eWeek 2\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eWeek 3\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eWeek 4\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eWeek 5\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003eWeek 6\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003edsRNA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eK RK 26\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eT64\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTB4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eDas-ELISA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eK RK 26\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eT64\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTB4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRT‒PCR\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eK RK 26\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eT64\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTB4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eDuring the first two weeks of infection, the dsRNA method did not detect PVY in tobacco (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). In contrast, ELISA successfully detected PVY in all the PVY-inoculated samples (K RK 26, T64 and TB4) one and two weeks after inoculation (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e and \\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). In RT‒PCR, an expected band size of 480 bp was detected in K RK26 after one week of infection. K RK 26, T64, and TB4 produced the expected band size of 480 bp after 2 weeks of infection (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). As the virus multiplied and reached a stage of approximately 3 weeks, evidence of virus infection was proven by bands for all the PVY samples produced after running samples on gel (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eAt week three and four, the dsRNA method successfully detected viral infection in the infected plants (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). All the samples tested positive via ELISA after four weeks of infection, as the samples were above the cut-off value of 0.123 OD. The expected band size of 480 bp was detected via RT‒PCR in all the samples except for T64 after 4 weeks of infection (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). All the samples tested positive for PVY from 4 weeks to 6 weeks via dsRNA, ELISA and RT‒PCR (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, \\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e, \\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eDetection of TMV\\u003c/p\\u003e \\u003cp\\u003eThe TMV was analysed at weekly intervals via dsRNA, DAS-ELISA and RT‒PCR concurrently. RT‒PCR produced the expected band size of 422 bp for TMV (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ec). DAS-ELISA produced positive results for most samples after three weeks of infection (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eb). For all the methods, the samples were positive for TMV from two to three weeks of infection (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab3\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 3\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eWeekly detection of TMV in infected leaves via different methods\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"5\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMethod\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCultivar\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eWeek 1\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eWeek 2\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eWeek 3\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eDsRNA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eK51\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eT64\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eT29\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eKRK 26\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eELISA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eK51\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eT64\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eT29\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eKRK26\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRT‒PCR\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eK51\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eT64\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eT29\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eK RK 26\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e\"},{\"header\":\"DISCUSSION\",\"content\":\"\\u003cp\\u003eThis study was carried out to develop RT‒PCR-based assays for the detection and identification of TMV and PVY in tobacco that would improve both detection sensitivity and specificity compared with the ELISA systems and dsRNA methods currently in use. On the basis of symptoms, most of the PVY- and TMV-inoculated samples presented necrotic spots and mosaic patterns, as expected. However, other samples took time to show symptoms, which could have been due to the time at which the inoculation was performed (Tsai et al. \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e). Summer is normally an unfavourable time of the year for virus replication because of heat (Tsai et al. \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e; Scholthof \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e). For the main objective, an RT‒PCR-based protocol was successfully developed for the detection and identification of TMV and PVY throughout the duration of the study. These data support the contention that the viral titre clearly influences the detection capability of the method, providing the first basis for why scientists in Zimbabwe should not rely only on the dsRNA method (Cardoso et al. \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e; Lukacs 1994). This finding was also in accordance with that of Fisher (\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e), who reported that dsRNA was non-specific. The findings of Ghosh and Bapat (\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e) indicate that DAS-ELISA can be used for detection as early as the first week post infection. Seo et al. (\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e) reported that ELISA is an efficient method for detecting PVY in plant tissues with both primary and secondary infections.\\u003c/p\\u003e \\u003cp\\u003eThe dsRNA method was found to be better than symptomatology, as PVY can be detected at one month post infection. These findings support the importance of developing PCR-based methods that are reliable and efficient (Tian et al. 2022). However, ELISA and PCR had better sensitivity than did dsRNA. RT‒PCR is slightly more sensitive than ELISA and more reliable because of the amplification of DNA (Gunay et al. 2022). This finding is in agreement with most studies by Singh et al. (\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e2004\\u003c/span\\u003e) and Ghosh and Bapat (\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eThe primer sets facilitating the use of a single protocol were reported by Liu et al. (\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e) and Silva et al. (2008). This finding highlights the advantages of molecular techniques over morphological analysis since it can take up to 14 to 21 days for the viruses to be detected via eyeball methods.\\u003c/p\\u003e \\u003cp\\u003eTaken together, these findings may suggest that even with slightly lower reliability, RT‒PCR may become competitive with ELISA if it is used in multiplex formats for the identification of multiple viruses in field samples in a single run. RT‒PCR has greater sensitivity potential because the amplification step, as opposed to ELISA, which, in its most popular format, is a protein detection technique without amplification (Lee et al. \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2021b\\u003c/span\\u003e). Further studies have been initiated in Zimbabwean tobacco research laboratories on the use of multiplex RT‒PCR and quantitative real-time PCR for the identification and quantification of viral titres and viral concentrations in tobacco that target TMV and PVY.\\u003c/p\\u003e\"},{\"header\":\"CONCLUSIONS\",\"content\":\"\\u003cp\\u003eRT‒PCR is very important as a routine plant virus detection tool for virus disease diagnosis and surveys where precise detection is of concern. This method has several advantages, including the ability of RT‒PCR protocols to readily detect and identify PVY and TMV in infected tobacco samples. Such an assay will help growers, crop agronomists, and plant health professionals not depend exclusively on symptomatology and/or time-consuming diagnostic procedures and permit early detection of viral infection.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003ch2\\u003e\\u003cstrong\\u003eEthics Approval and consent to participate\\u003c/strong\\u003e\\u003c/h2\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\\n\\u003ch2\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/h2\\u003e\\n\\u003cp\\u003eAll the authors consented to the publication of the manuscript.\\u003c/p\\u003e\\n\\u003ch2\\u003eCompeting interests\\u003c/h2\\u003e\\n\\u003cp\\u003eThe authors declare that they have no competing interests.\\u003c/p\\u003e\\n\\u003ch2\\u003eFunding\\u003c/h2\\u003e\\n\\u003cp\\u003eThere is no source of funding for the current research.\\u003c/p\\u003e\\n\\u003ch2\\u003eAuthors\\u0026rsquo; Contributions\\u003c/h2\\u003e\\n\\u003cp\\u003eRM conceptualized the idea of the manuscript and contributed to the conception of work, carried out the experimental work, interpreting the literature, analysing the data and wrote the initial draft of the manuscript. NM, DG and TJC supervised RM\\u0026rsquo;s work, reviewed and commented on the manuscript. MN and FM reviewed and commented on the manuscript. All the authors listed have a substantial and intellectual contribution to the work. All authors read and approved the final manuscript.\\u003c/p\\u003e\\n\\u003ch2\\u003eACKNOWLEDGEMENTS\\u003c/h2\\u003e\\n\\u003cp\\u003eThe Tobacco Research Board of Zimbabwe (TRB), Kutsaga Research Station, is acknowledged for providing facilities for this study.\\u003c/p\\u003e\\n\\u003ch2\\u003eAvailability of data and materials\\u003c/h2\\u003e\\n\\u003cp\\u003eThe datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eAdams MJ (2005) Molecular criteria for genus and species discrimination within the family Potyviridae. Arch Virol 150:459\\u0026ndash;479\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBlouin AG, Ross HA, Hobson-Peters J, O\\u0026rsquo;Brien CA, Warren B, MacDiarmid R (2016) A new virus discovered by immunocapture of double-stranded RNA, a rapid method for virus enrichment in metagenomic studies. Mol Ecol Resour 16:1255\\u0026ndash;1263. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/1755-0998.1252\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/1755-0998.1252\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCardoso FMH, Elias A, Pereira I, Maur\\u0026iacute;cio I, Matos O (2023) Improved dsRNA isolation and purification method validated by viral dsRNA detection using novel primers in \\u003cem\\u003eSaccharomyces cerevisiae\\u003c/em\\u003e. Methods X 11:102435. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.mex.2023.102435\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.mex.2023.102435\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChikh-Ali M, Maoka T, Natsuaki T, Natsuaki KT (2010) PVY\\u003csup\\u003eNTN\\u0026ndash;NW\\u003c/sup\\u003e, a novel recombinant strain of Potato virus Y predominating in potato fields in Syria. Plant Pathol 59:31\\u0026ndash;41\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDepta A, Doroszewska T, Czubacka A (2023) Possibilities of using \\u003cem\\u003eNicotiana\\u003c/em\\u003e species in breeding for virus resistance. Pol J Agron 52:97\\u0026ndash;109. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.26114/pja.iung.520.2023.52.11\\u003c/span\\u003e\\u003cspan address=\\\"10.26114/pja.iung.520.2023.52.11\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFisher L (2010) A standard modified dsRNA protocol. Journal of virology\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGadhave KR, Gautam S, Rasmussen DA, Srinivasan R (2020) Aphid Transmission of Potyvirus: The Largest Plant-Infecting RNA Virus Genus. Viruses 17(7):773. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3390/v12070773\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/v12070773\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGhosh SB, Bapat VA (2005) Development of RT\\u0026ndash;PCR based method for the detection of potato virus Y, in tobacco and potato. Indian J Biotechnol 5:232\\u0026ndash;235\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGunay A, Usta M (2020) First investigation of five tobacco viruses using PCR based methods in tobacco plants grown in Adiyaman, Turkey. Fresenius Environ Bull Vol 29(12):11624\\u0026ndash;11632\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHosseinzadeh H (2012) In: Nasrollanejad S, Khateri H (eds) Serological detection of on some important host crops in the north region of Iran. Archives Of Phytopathology And Plant Protection\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJi Y, Guo Y, Deng H, Zhang J, Wang Y, Dai E et al (2023) Rapid diagnosis of Tobacco mosaic virus in tobacco using time-resolved fluorescence immunoassay. Food Agricultural Immunol 34(1):10\\u0026ndash;20\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKasi Viswanath K, Hamid A, Ateka E, Pappu HR (2023) CRISPR/Cas, Multiomics, and RNA Interference in Virus Disease Management. Phytopathology 113(9):1661\\u0026ndash;1676. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1094/PHYTO-01-23-0002-V\\u003c/span\\u003e\\u003cspan address=\\\"10.1094/PHYTO-01-23-0002-V\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003eEpub 2023 Nov 2. PMID: 37486077\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKreuze JF, Souza-Dias JAC, Jeevalatha A, Figueira AR, Valkonen JPT, Jones RAC (2020) Viral Diseases in Potato. In: Campos H, Ortiz O (eds) The Potato Crop. Springer, Cham\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLee KZ, Pussepitiyalage VB, Lee Y, Loesch-Fries LS, Harris MT, Hemmati S et al (2021a) Engineering tobacco mosaic virus and its virus-like-particles for synthesis of biotemplated nanomaterials. Biotechnol J 16(4):2000311\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLee HJ, Cho IS, Ju HJ, Jeong RD (2021b) Development of a reverse transcription droplet digital PCR assay for sensitive detection of peach latent mosaic viroid. Mol Cell Probes 58:101746. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.mcp.2021.101746\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.mcp.2021.101746\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu Y, Wang Z, Qian Y, Mu J, Shen L, Wang F et al (2010) Rapid detection of tobacco mosaic virus using the reverse transcription loop-mediated isothermal amplification method. Arch Virol 155(10):1681\\u0026ndash;1685. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s00705-010-0746-5\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00705-010-0746-5\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLorenzen JH, Piche LM, Gudmestad NC, Meacham T, Shiel P (2006) A multiplex PCR assay to characterize \\u003cem\\u003ePotato virus Y\\u003c/em\\u003e isolates and identify strain mixtures. Plant Dis 90:935\\u0026ndash;940\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLorenzen JH, Meacham T, Berger PH, Shiel PJ, Crosslin JM, Hamm PB et al (2006) Whole genome characterization of \\u003cem\\u003ePotato virus Y\\u003c/em\\u003e isolates collected in the western USA and their comparison to isolates from Europe and Canada. Arch Virol 151:1055\\u0026ndash;1074\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLuk\\u0026aacute;cs N (1994) Detection of virus infection in plants and differentiation between coexisting viruses by monoclonal antibodies to double-stranded RNA. J Virol Methods 47(3):255\\u0026ndash;272. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/0166-0934(94)90023-x\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/0166-0934(94)90023-x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eManasseh R, Berim A, Kappagantu M, Moyo L, Gang DR, Pappu HR (2023) Pathogen-triggered metabolic adjustments to potato virus Y infection in potato. Front Plant Sci 13. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3389/fpls.2022.1031629\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fpls.2022.1031629\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMargaritopoulos JT, Dovas CI, Gounaris J, Skouras PJ, Olympia M, Kanavaki OM et al (2010) Molecular Analysis of the Coat Protein of Potato virus Y Isolates in Greece Suggests Multiple Introduction from Different Genetic Pools. J Phytopathol 02\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eModrow S, Falke D, Truyen U, Sch\\u0026auml;tzl H (2013) Viruses with Single-Stranded, Positive-Sense RNA Genomes. Molecular Virology 185\\u0026ndash;349. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/978-3-642-20718-1_14\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/978-3-642-20718-1_14\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e. PMCID: PMC7169642\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMumford RA, Boonham N, Tomlinson J, Barker I (2006) Advances in molecular phytodiagnostics - new solutions for old problems. Eur J Plant Pathol 116:1\\u0026ndash;19\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMunanga W, Mugabe FT, Kufazvinei C, Dimbi S (2017) Development of a low cost and energy efficient tobacco curing barn in Zimbabwe. Afr J Agric Res 12:2704\\u0026ndash;2712\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eScholthof KBG (2008) Tobacco Mosaic Virus: The Beginning of Plant Pathology. Online APSnet Features doi: 10.1094/APSnet Features-2008-0408.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSeo H, Cho S-H, Vo TTB, Lee A, Cho S, Kang S et al (2023) M13KO7 bacteriophage enables Potato Virus Y detection. Microbiol Spectr 11(6):e0144623. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1128/spectrum.01446-23\\u003c/span\\u003e\\u003cspan address=\\\"10.1128/spectrum.01446-23\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShalaby AA, Nakhla MK, Soliman AM, Mazyard HM, Hadidi A, Maxwell DP (2002) Development of a highly sensitive multiplex reverse transcription-polymerase chain reaction (m-RT\\u0026ndash;PCR) method for detection of three potato viruses in a single reaction and nested PCR. Arab Journal of Biotechnology Vol.5.No. (2) July: 275\\u0026ndash;286\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSilva RMd S, ERd, Pedroso JC, Arakava R, Almeida AMR, Barboza AAL et al (2008) Detection and identification of tmv infecting tomato under protected cultivation in paran\\u0026aacute; state. Brazilian Archives Biology Technol 51(5):903\\u0026ndash;909. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1590/s1516-89132008000500005\\u003c/span\\u003e\\u003cspan address=\\\"10.1590/s1516-89132008000500005\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSingh RP, Dilworth AD, Singh M, McLaren DL (2004) Evaluation of a simple membrane-based nucleic acid preparation protocol for RT\\u0026ndash;PCR detection of potato viruses from aphid and plant tissues. J Virol Methods 121:163\\u0026ndash;170\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSingh RP, Singh M, Mcdonald JG (1998) Screening by a 3-primer PCR of North American PVY\\u003csup\\u003eN\\u003c/sup\\u003e isolates for European type members of the tuber necrosis including PVY\\u003csup\\u003eNTN\\u003c/sup\\u003e subgroups. Can J Plant Pathol 20:227\\u0026ndash;233\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTorrance L, Talianksy ME (2020) Potato Virus Y Emergence and Evolution from the Andes of South America to Become a Major Destructive Pathogen of Potato and Other Solanaceous Crops Worldwide. Viruses 12:1430. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3390/v12121430\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/v12121430\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTsai WA, Brosnan CA, Mitter N et al (2022) Perspectives on plant virus diseases in a climate change scenario of elevated temperatures. Stress Biology 2:37. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s44154-022-00058-x\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s44154-022-00058-x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVerma N, Tiwari BS, Pandya A (2021) Field Deployable Vertical Flow Based Immunodevice for Detection of Potato Virus Y in Potato Leaves. ACS Agricultural Science \\u0026amp; Technology\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"No funding\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":true,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"dsRNA, DAS-ELISA, Potato virus Y, Tobacco mosaic virus, Reverse transcriptase-PCR\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-5932739/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-5932739/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eSymptomatological assays have been traditionally relied upon for the detection of tobacco mosaic virus (TMV) and potato virus Y (PVY), the two major economic consequential viruses infecting tobacco in Zimbabwe and globally. However, morphological methods are subjective and unreliable, as they are affected by abiotic factors and phytotoxicity, leading to misdiagnosis. The advent of polymerase chain reaction (PCR)-based assays has transformed pathogen diagnostics by offering robust diagnostic techniques to support disease management strategies that can avert yield losses. Reverse transcriptase‒polymerase chain reaction (RT‒PCR) protocols were developed for the identification of TMV and PVY in tobacco in Zimbabwe. The internal specific primer pairs amplified 480 bp of the coat protein for PVY, 420 bp for the protein movement gene, and 496 bp for the TMV virus genome. The effectiveness and reliability of the assays were analysed via sensitivity comparisons of the double-stranded RNA extraction method (dsRNA), double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) and RT‒PCR, which were conducted at weekly intervals after viral infection of tobacco plants. DsRNA was the least effective at detecting PVY after three weeks of infection. Compared with dsRNA, DAS-ELISA was more sensitive for detecting viruses after one week of infection for up to six weeks for PVY and after three weeks for TMV. However, RT‒PCR consistently detected viral infection throughout the duration of the study. The use of RT‒PCR is recommended for application since it has improved sensitivity and specificity.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Reverse Transcriptase-PCR-based techniques for the detection and identification of potato virus Y and tobacco mosaic virus in tobacco.\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-02-03 03:47:28\",\"doi\":\"10.21203/rs.3.rs-5932739/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"28696729-f167-4f03-a3f8-01ee70deab29\",\"owner\":[],\"postedDate\":\"February 3rd, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":43646634,\"name\":\"Molecular Biology\"},{\"id\":43646635,\"name\":\"Biotechnology and Bioengineering\"},{\"id\":43646636,\"name\":\"Virology\"},{\"id\":43646637,\"name\":\"General Microbiology\"},{\"id\":43646638,\"name\":\"Plant Physiology and Morphology\"},{\"id\":43646639,\"name\":\"Plant Molecular Biology and Genetics\"}],\"tags\":[],\"updatedAt\":\"2025-02-03T03:47:28+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-02-03 03:47:28\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-5932739\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-5932739\",\"identity\":\"rs-5932739\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}