{"paper_id":"037b7f86-26fb-468d-87d9-2fe51bf0520e","body_text":"A simple adeno-associated virus-based approach... | F1000Research <!-- --> <!-- --> <!-- This is commented out to fix display problems on mobile devices. We may use it again once we implement a responsive design that supports native device resolutions. --> \"use strict\";function _typeof(t){return(_typeof=\"function\"==typeof Symbol&&\"symbol\"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&\"function\"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?\"symbol\":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement(\"iframe\");r.style.cssText=\"display:none\",r.name=\"__tcfapiLocator\",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&\"boolean\"==typeof n[3]&&(e=n[3],\"function\"==typeof n[2]&&n[2](\"set\",!0)):\"ping\"===n[0]?\"function\"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:\"stub\"}):o.push(n)},n.addEventListener(\"message\",(function(t){var e=\"string\"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n=\"object\"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,\"*\")}),n.parameter)}),!1))};\"undefined\"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:[\"bam.nr-data.net\"]}}; ;NREUM.loader_config={accountID:\"438030\",trustKey:\"438030\",agentID:\"772317073\",licenseKey:\"97f8f67f26\",applicationID:\"772317073\"} ;NREUM.info={beacon:\"bam.nr-data.net\",errorBeacon:\"bam.nr-data.net\",licenseKey:\"97f8f67f26\",applicationID:\"772317073\",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{\"use strict\";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error(\"All info objects require an agent identifier!\");if(!a[e])throw new Error(\"Info for \".concat(e,\" was never set\"));return a[e]}function c(e,t){if(!e)throw new Error(\"All info objects require an agent identifier!\");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],\"info\")}var u=r(7056);const d=()=>{const e={blockSelector:\"[data-nr-block]\",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:\"*\",maskAllInputs:!0,get blockClass(){return\"nr-block\"},get ignoreClass(){return\"nr-ignore\"},get maskTextClass(){return\"nr-mask\"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=\",\".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error(\"All configuration objects require an agent identifier!\");if(!f[e])throw new Error(\"Configuration for \".concat(e,\" was never set\"));return f[e]}function h(e,t){if(!e)throw new Error(\"All configuration objects require an agent identifier!\");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],\"config\")}function g(e,t){if(!e)throw new Error(\"All configuration objects require an agent identifier!\");var r=l(e);if(r){for(var n=t.split(\".\"),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||\"object\"!=typeof e)return(0,n.Z)(\"Setting a Configurable requires an object as input\");if(!t||\"object\"!=typeof t)return(0,n.Z)(\"Setting a Configurable requires a model to set its initial properties\");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{\"object\"==typeof e[a]&&\"object\"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)(\"An error occurred while setting a property of a Configurable\",e)}return r}catch(e){(0,n.Z)(\"An error occured while setting a Configurable\",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n=\"1.236.0\",i=\"PROD\",o=\"CDN\"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n=\"undefined\"!=typeof window&&!!window.document,i=\"undefined\"!=typeof WorkerGlobalScope&&(\"undefined\"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||\"undefined\"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:\"undefined\"!=typeof WorkerGlobalScope&&(\"undefined\"!=typeof self&&self instanceof WorkerGlobalScope&&self||\"undefined\"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=\"\"+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&\"undefined\"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\\s](\\d+\\.\\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:\"\",ee:void 0};class o{constructor(e){try{if(\"object\"!=typeof e)return(0,n.Z)(\"shared context requires an object as input\");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)(\"An error occured while setting SharedContext\",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:\"\",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:\"feature\";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s=\"nr@context\";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&\"object\"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;f<d;f++)s[f].apply(a,r);var l=T()[c[e]];return l&&l.push([p,e,r,a]),a}}function b(e,t){n[e]=w(e).concat(t)}function y(e,t){var r=n[e];if(r)for(var i=0;i {r.d(t,{E:()=>n,p:()=>i});var n=r(2177).ee.get(\"handle\");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o=\"feature\"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener(\"test\",null,e),n._A.removeEventListener(\"test\",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i=\"xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx\";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split(\"\").map((e=>\"x\"===e?o(t,++r).toString(16):\"y\"===e?(3&o()|8).toString(16):e)).join(\"\")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n=\"NRBA\",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||\"\").indexOf(\"data:\"))return{protocol:\"data\"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement(\"a\"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split(\"://\");!o.port&&a[1]&&(o.port=a[1].split(\"/\")[0].split(\"@\").pop().split(\":\")[1]),o.port&&\"0\"!==o.port||(o.port=\"https\"===a[0]?\"443\":\"80\"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],\"/\"!==o.pathname.charAt(0)&&(o.pathname=\"/\"+o.pathname);var s=!t.protocol||\":\"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),\"/\"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){\"function\"==typeof console.warn&&(console.warn(\"New Relic: \".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&\"object\"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)(\"feat-\"+t,[],void 0,e,r):(0,i.p)(\"block-\"+t,[],void 0,e,r),(0,i.p)(\"rumresp-\"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)(\"feat-\"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)(\"rumresp-\"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if(\"object\"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit(\"internal-error\",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return\"undefined\"==typeof document||\"complete\"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)(\"load\",e,t)}function a(e){if(i())return e();(0,n.iz)(\"DOMContentLoaded\",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:\"bam.nr-data.net\",errorBeacon:\"bam.nr-data.net\"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)(\"visibilitychange\",(function(){if(t)return void(\"hidden\"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i=\"nr@original\";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n=\"\");var a,s,c,u=\"-\"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,\"fetch\",y),t.on(y+\"end\",(function(e,r){var n=this;if(r){var i=r.headers.get(\"content-length\");null!==i&&(n.rxSize=i),t.emit(y+\"done\",[null,r],n)}else t.emit(y+\"done\",[e],n)})),t}const O={},j=[\"pushState\",\"replaceState\"];function S(e){const t=function(e){return(e||n.ee).get(\"history\")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,\"-\")),t}var P=r(3239);const C={},R=[\"appendChild\",\"insertBefore\",\"replaceChild\"];function I(e){const t=function(e){return(e||n.ee).get(\"jsonp\")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\\.([^.]+)/,a=/^(\\w+)(\\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,\"dom-\"),t.on(\"dom-start\",(function(e){!function(e){if(!e||\"string\"!=typeof e.nodeName||\"script\"!==e.nodeName.toLowerCase())return;if(\"function\"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if(\"function\"!=typeof u.parent[u.key])return;var d={};function f(){t.emit(\"jsonp-end\",[],d),e.removeEventListener(\"load\",f,(0,P.m$)(!1)),e.removeEventListener(\"error\",l,(0,P.m$)(!1))}function l(){t.emit(\"jsonp-error\",[],d),t.emit(\"jsonp-end\",[],d),e.removeEventListener(\"load\",f,(0,P.m$)(!1)),e.removeEventListener(\"error\",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],\"cb-\",d),e.addEventListener(\"load\",f,(0,P.m$)(!1)),e.addEventListener(\"error\",l,(0,P.m$)(!1)),t.emit(\"new-jsonp\",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get(\"mutation\")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,\"fn-\")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get(\"promise\")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,\"executor-\",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,\"name\",{value:\"Promise\"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),[\"all\",\"race\"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a(\"all\"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit(\"propagate\",[null,!i],o,!1,!1),i=i||!e}}}})),[\"resolve\",\"reject\"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit(\"propagate\",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,[\"onreadystatechange\"],\"fn-\",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit(\"xhr-resolved\",[],e)),i.inPlace(e,f,\"fn-\",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,\"-xhr-\",E),r.on(\"send-xhr-start\",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on(\"open-xhr-start\",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on(\"fn-end\",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i=\"nr@seenError\"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i=\"sm\",o=\"cm\",a=\"storeSupportabilityMetrics\",s=\"storeEventMetrics\"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i=\"firstbyte\",o=\"domcontent\",a=\"windowload\"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i=\"bstResource\",o=\"resource\",a=\"-start\",s=\"-end\",c=\"fn\"+a,u=\"fn\"+s,d=\"pushState\"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=[\"click\",\"submit\",\"keypress\",\"keydown\",\"keyup\",\"change\"],a=999,s=\"fn-start\",c=\"fn-end\",u=\"cb-start\",d=\"api-ixn-\",f=\"remaining\",l=\"interaction\",h=\"spaNode\",g=\"jsonpNode\",p=\"fetch-start\",m=\"fetch-done\",v=\"fetch-body-\",b=\"jsonp-end\",y=n.Yu.ST,w=\"-start\",x=\"-end\",A=\"-body\",E=\"cb\"+x,T=\"jsTime\",_=\"fetch\"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();[\"setErrorHandler\",\"finished\",\"addToTrace\",\"inlineHit\",\"addRelease\",\"addPageAction\",\"setCurrentRouteName\",\"setPageViewName\",\"setCustomAttribute\",\"interaction\",\"noticeError\",\"setUserId\"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,\"api\");const h={};var g=a.ee.get(e),p=g.get(\"tracer\"),m=\"api-\",v=m+\"ixn-\";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?\"session\":void 0)(t,r)}function y(){}[\"setErrorHandler\",\"finished\",\"addToTrace\",\"inlineHit\",\"addRelease\"].forEach((e=>h[e]=x(m,e,!0,\"api\"))),h.addPageAction=x(m,\"addPageAction\",!0,n.D.pageAction),h.setCurrentRouteName=x(m,\"routeName\",!0,n.D.spa),h.setPageViewName=function(t,r){if(\"string\"==typeof t)return\"/\"!==t.charAt(0)&&(t=\"/\"+t),(0,i.OP)(e).customTransaction=(r||\"http://custom.transaction\")+t,x(m,\"setPageViewName\",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if(\"string\"==typeof e){if([\"string\",\"number\"].includes(typeof t)||null===t)return b(e,t,\"setCustomAttribute\",r);(0,f.Z)(\"Failed to execute setCustomAttribute.\\nNon-null value must be a string or number type, but a type of was provided.\"))}else(0,f.Z)(\"Failed to execute setCustomAttribute.\\nName must be a string type, but a type of was provided.\"))},h.setUserId=function(e){if(\"string\"==typeof e||null===e)return b(\"enduser.id\",e,\"setUserId\",!0);(0,f.Z)(\"Failed to execute setUserId.\\nNon-null value must be a string type, but a type of was provided.\"))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a=\"function\"==typeof t;return(0,o.p)(v+\"tracer\",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?\"\":\"no-\")+\"fn-start\",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit(\"fn-err\",[arguments,this,\"string\"==typeof e?new Error(e):e],r),e}finally{p.emit(\"fn-end\",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,[\"API/\"+t+\"/called\"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,\"api\")})).catch((()=>(0,f.Z)(\"Downloading runtime APIs failed...\")))}return[\"actionText\",\"setName\",\"setAttribute\",\"save\",\"ignore\",\"onEnd\",\"getContext\",\"end\",\"get\"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){\"string\"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,[\"API/noticeError/called\"],void 0,n.D.metrics,g),(0,o.p)(\"err\",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,\"api\"),(0,h.Qy)(e,A,\"exposed\"),(0,h.EZ)(\"activatedFeatures\",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:\"ajax\",jserrors:\"jserrors\",metrics:\"metrics\",pageAction:\"page_action\",pageViewEvent:\"page_view_event\",pageViewTiming:\"page_view_timing\",sessionReplay:\"session_replay\",sessionTrace:\"session_trace\",spa:\"spa\"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:\"page_action-aggregate\",147:\"metrics-aggregate\",242:\"session-manager\",317:\"jserrors-aggregate\",348:\"page_view_timing-aggregate\",412:\"lazy-feature-loader\",439:\"async-api\",538:\"recorder\",590:\"session_replay-aggregate\",675:\"compressor\",733:\"session_trace-aggregate\",786:\"page_view_event-aggregate\",873:\"spa-aggregate\",898:\"ajax-aggregate\"}[e]||e)+\".\"+{78:\"ac76d497\",147:\"3dc53903\",148:\"1a20d5fe\",242:\"2a64278a\",317:\"49e41428\",348:\"bd6de33a\",412:\"2f55ce66\",439:\"30bd804e\",538:\"1b18459f\",590:\"cf0efb30\",675:\"ae9f91a8\",733:\"83105561\",786:\"06482edd\",860:\"03a8b7a5\",873:\"e6b09d52\",898:\"998ef92b\"}[e]+\"-1.236.0.min.js\"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t=\"NRBA:\",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName(\"script\"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:\"timeout\",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{\"undefined\"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:\"Module\"}),Object.defineProperty(e,\"__esModule\",{value:!0})},i.j=364,i.p=\"https://js-agent.newrelic.com/\",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&(\"load\"===r.type?\"missing\":r.type),a=r&&r.target&&r.target.src;s.message=\"Loading chunk \"+t+\" failed.\\n(\"+o+\": \"+a+\")\",s.name=\"ChunkLoadError\",s.type=o,s.request=a,n[1](s)}}),\"chunk-\"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,\"\".concat(e,\".enabled\"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,\"privacy.cookies_enabled\");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)(\"A problem occurred when starting up session manager. This page will not start or extend any session.\",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,\"aggregate\");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)(\"Downloading and initializing \".concat(this.featureName,\" failed...\"),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,\"session_trace.enabled\")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),(\"undefined\"==typeof PerformanceNavigationTiming||c.Tt)&&\"undefined\"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)(\"timing\",[\"load\",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if(\"count\"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r=\"\",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean(\"hidden\"===document.visibilityState),(0,N.N)((()=>(0,s.p)(\"docHidden\",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)(\"pagehide\",(()=>(0,s.p)(\"winPagehide\",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem(\"__nr_flags\").split(\",\"),console&&\"function\"==typeof console.log&&(L.console=!0,-1!==R.indexOf(\"dev\")&&(L.dev=!0),-1!==R.indexOf(\"nr_dev\")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on(\"internal-error\",(function(e){z(e.stack)})),L.dev&&H.ee.on(\"fn-err\",(function(e,t,r){z(r.stack)})),L.dev&&(z(\"NR AGENT IN DEVELOPMENT MODE\"),z(\"flags: \"+(0,b.D)(L,(function(e,t){return e})).join(\", \")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on(\"fn-start\",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on(\"fn-err\",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)(\"err\",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on(\"fn-end\",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on(\"internal-error\",(function(t){(0,s.p)(\"ierr\",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener(\"unhandledrejection\",(t=>{const r=function(e){let t=\"Unhandled Promise Rejection: \";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)(\"err\",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){\"function\"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)(\"err\",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)(\"ierr\",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||\"Uncaught error with no additional information\",this.sourceURL=t,this.line=r}let U=1;const q=\"nr@id\";function G(e){const t=typeof e;return!e||\"object\"!==t&&\"function\"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if(\"string\"==typeof e&&e.length)return e.length;if(\"object\"==typeof e){if(\"undefined\"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if(\"undefined\"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!(\"undefined\"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||\"\").toString()||null,i=(r.agentID||\"\").toString()||null,o=(r.trustKey||\"\").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return\"00-\"+t+\"-\"+e+\"-01\"}generateTraceContextStateHeader(e,t,r,n,i){return i+\"@nr=0-1-\"+r+\"-\"+n+\"-\"+e+\"----\"+t}generateTraceHeader(e,t,r,n,i,o){if(!(\"function\"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:\"Browser\",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,\"distributed_tracing\")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener(\"load\",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener(\"progress\",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader(\"X-NewRelic-ID\",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader(\"newrelic\",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader(\"traceparent\",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader(\"tracestate\",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{\"abort\"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),(\"load\"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||\"function\"!=typeof t.onload)&&\"function\"==typeof o.end)&&o.end(t)}catch(e){try{n.emit(\"internal-error\",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set(\"newrelic\",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set(\"traceparent\",t.traceContextParentHeader),t.traceContextStateHeader&&e.set(\"tracestate\",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;\"string\"==typeof i?r=i:\"object\"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&\"object\"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(\"\"+(i&&i instanceof Y&&i.method||n.method||\"GET\")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,\"string\"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i(\"xhr\",[this.params,o,this.startTime,this.endTime,\"fetch\"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||\"agent\")),this.start()):(0,l.Z)(\"Failed to initial the agent. Could not determine the runtime environment.\")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t=\"features\";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)(\"\".concat(t.featureName,\" is enabled but one or more dependent features has been disabled (\").concat((0,D.P)(n),\"). This may cause unintended consequences or missing data...\")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)(\"Failed to initialize all enabled instrument classes (agent aborted) -\",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)(\"bst\",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)(\"bstHist\",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get(\"tracer\"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get(\"events\"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit(\"newURL\",[\"\"+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,\"xhr-resolved\"],this.featureName),f.buffer([ve],this.featureName),u.buffer([\"setTimeout\"+le,\"clearTimeout\"+fe,ve],this.featureName),d.buffer([ve,\"new-xhr\",\"send-xhr\"+fe],this.featureName),l.buffer([me+fe,me+\"-done\",me+he+fe,me+he+le],this.featureName),h.buffer([\"newURL\"],this.featureName),g.buffer([ve],this.featureName),s.buffer([\"propagate\",be,ge,\"executor-err\",\"resolve\"+fe],this.featureName),o.buffer([ve,\"no-\"+ve],this.featureName),a.buffer([\"new-jsonp\",\"cb-start\",\"jsonp-error\",\"jsonp-end\"],this.featureName),y(l,me+fe),y(l,me+\"-done\"),y(a,\"new-jsonp\"),y(a,\"jsonp-end\"),y(a,\"cb-start\"),h.on(\"pushState-end\",m),h.on(\"replaceState-end\",m),window.addEventListener(\"hashchange\",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener(\"load\",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener(\"popstate\",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:\"spa\"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is \"complete\" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event \"completion\" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', \"PixelInitialized\", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { \"@context\": \"https://schema.org\", \"@type\": \"ScholarlyArticle\", \"mainEntityOfPage\": { \"@type\": \"WebPage\", \"@id\": \"https://f1000research.com/articles/9-1441\" }, \"headline\": \"A simple adeno-associated virus-based approach for the generation of cardiac genetic models in rats\", \"datePublished\": \"2020-12-10T14:47:51\", \"dateModified\": \"2020-12-10T14:47:51\", \"author\": [ { \"@type\": \"Person\", \"name\": \"Michal Schlesinger-Laufer\" }, { \"@type\": \"Person\", \"name\": \"Guy Douvdevany\" }, { \"@type\": \"Person\", \"name\": \"Lilac Haimovich-Caspi\" }, { \"@type\": \"Person\", \"name\": \"Yaniv Zohar\" }, { \"@type\": \"Person\", \"name\": \"Rona Shofty\" }, { \"@type\": \"Person\", \"name\": \"Izhak Kehat\" } ], \"publisher\": { \"@type\": \"Organization\", \"name\": \"F1000Research\", \"logo\": { \"@type\": \"ImageObject\", \"url\": \"https://f1000research.com/img/AMP/F1000Research_image.png\", \"height\": 480, \"width\": 60 } }, \"image\": { \"@type\": \"ImageObject\", \"url\": \"https://f1000research.com/img/AMP/F1000Research_image.png\", \"height\": 1200, \"width\": 150 }, \"description\": \"Background: Heart failure is a major health problem and progress in this field relies on better understanding of the mechanisms and development of novel therapeutics using animal models. The rat may be preferable to the mouse as a cardiovascular disease model due to its closer physiology to humans and due to its large size that facilitates surgical and monitoring procedures. However, unlike the mouse, genetic manipulation of the rat genome is challenging. Methods: Here we developed a simple, refined, and robust cardiac-specific rat transgenic model based on an adeno-associated virus (AAV) 9 containing a cardiac troponin T promoter. This model uses a single intraperitoneal injection of AAV and does not require special expertise or equipment. Results: We characterize the AAV dose required to achieve a high cardiac specific level of expression of a transgene in the rat heart using a single intraperitoneal injection to neonates. We show that at this AAV dose GFP expression does not result in hypertrophy, a change in cardiac function or other evidence for toxicity. Conclusions: The model shown here allows easy and fast transgenic based disease modeling of cardiovascular disease in the rat heart, and can also potentially be expanded to deliver Cas9 and gRNAs or to deliver small hairpin (sh)RNAs to also achieve gene knockouts and knockdown in the rat heart.\" } { \"@context\": \"http://schema.org\", \"@type\": \"BreadcrumbList\", \"itemListElement\": [ { \"@type\": \"ListItem\", \"position\": \"1\", \"item\": { \"@id\": \"https://f1000research.com/\", \"name\": \"Home\" } }, { \"@type\": \"ListItem\", \"position\": \"2\", \"item\": { \"@id\": \"https://f1000research.com/browse/articles\", \"name\": \"Browse\" } }, { \"@type\": \"ListItem\", \"position\": \"3\", \"item\": { \"@id\": \"https://f1000research.com/articles/9-1441\", \"name\": \"A simple adeno-associated virus-based approach for the generation...\" } } ] } Home Browse A simple adeno-associated virus-based approach for the generation... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Schlesinger-Laufer M, Douvdevany G, Haimovich-Caspi L et al. A simple adeno-associated virus-based approach for the generation of cardiac genetic models in rats [version 1; peer review: 2 approved] . F1000Research 2020, 9 (ISF):1441 ( https://doi.org/10.12688/f1000research.27675.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Method Article A simple adeno-associated virus-based approach for the generation of cardiac genetic models in rats [version 1; peer review: 2 approved] Michal Schlesinger-Laufer 1 , Guy Douvdevany https://orcid.org/0000-0001-7561-0119 2 , Lilac Haimovich-Caspi 2 , Yaniv Zohar 3 , Rona Shofty 1 , Izhak Kehat https://orcid.org/0000-0002-4388-1579 2 Michal Schlesinger-Laufer 1 , Guy Douvdevany https://orcid.org/0000-0001-7561-0119 2 , [...] Lilac Haimovich-Caspi 2 , Yaniv Zohar 3 , Rona Shofty 1 , Izhak Kehat https://orcid.org/0000-0002-4388-1579 2 PUBLISHED 10 Dec 2020 Author details Author details 1 The Pre-Clinical Research Authority Unit, Technion - Israel Institute of Technology, 1 Efron Street, P.O. Box 9697, Haifa, 3109601, Israel 2 Faculty of Medicine, Technion - Israel Institute of Technology, 1 Efron Street, P.O. Box 9697, Haifa, 3109601, Israel 3 Department of Pathology, Rambam Medical Center, HaAliya HaShniya St 8, Haifa, 3109601, Israel Michal Schlesinger-Laufer Roles: Formal Analysis, Investigation Guy Douvdevany Roles: Investigation Lilac Haimovich-Caspi Roles: Investigation Yaniv Zohar Roles: Investigation Rona Shofty Roles: Methodology, Supervision Izhak Kehat Roles: Conceptualization, Methodology, Project Administration, Supervision OPEN PEER REVIEW DETAILS REVIEWER STATUS Abstract Background: Heart failure is a major health problem and progress in this field relies on better understanding of the mechanisms and development of novel therapeutics using animal models. The rat may be preferable to the mouse as a cardiovascular disease model due to its closer physiology to humans and due to its large size that facilitates surgical and monitoring procedures. However, unlike the mouse, genetic manipulation of the rat genome is challenging. Methods: Here we developed a simple, refined, and robust cardiac-specific rat transgenic model based on an adeno-associated virus (AAV) 9 containing a cardiac troponin T promoter. This model uses a single intraperitoneal injection of AAV and does not require special expertise or equipment. Results : We characterize the AAV dose required to achieve a high cardiac specific level of expression of a transgene in the rat heart using a single intraperitoneal injection to neonates. We show that at this AAV dose GFP expression does not result in hypertrophy, a change in cardiac function or other evidence for toxicity. Conclusions: The model shown here allows easy and fast transgenic based disease modeling of cardiovascular disease in the rat heart, and can also potentially be expanded to deliver Cas9 and gRNAs or to deliver small hairpin (sh)RNAs to also achieve gene knockouts and knockdown in the rat heart. READ ALL READ LESS Keywords Cardiac research, animal models, Adeno-associated virus Corresponding Author(s) Izhak Kehat ( [email protected] ) Close Corresponding author: Izhak Kehat Competing interests: No competing interests were disclosed. Grant information: This work was supported by funding from the Israel Science Foundation (grant no. 1385/20), and the Randy L. and Melvin R. Berlin Family Regenerative Medicine Research Grant (grant no. 1018852). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2020 Schlesinger-Laufer M et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Schlesinger-Laufer M, Douvdevany G, Haimovich-Caspi L et al. A simple adeno-associated virus-based approach for the generation of cardiac genetic models in rats [version 1; peer review: 2 approved] . F1000Research 2020, 9 (ISF):1441 ( https://doi.org/10.12688/f1000research.27675.1 ) First published: 10 Dec 2020, 9 (ISF):1441 ( https://doi.org/10.12688/f1000research.27675.1 ) Latest published: 10 Dec 2020, 9 (ISF):1441 ( https://doi.org/10.12688/f1000research.27675.1 ) Abbreviations Adeno-Associated Virus (AAV); Viral genomes (vg); Short hairpin RNAs (shRNA); Fractional shortening (FS%); left ventricular end diastolic dimeter (LVIDd); enhanced green fluorescent protein (eGFP); cardiac troponin T (cTnT) Introduction Cardiovascular disease is the leading global cause of mortality and is expected to account for >22.2 million deaths by 2030 1 . Despite some progress in the medical treatment of heart failure, the 5-year mortality is still dismal, at about 50%, a worse prognosis than in most cancers. With the continued aging of the population, an increase in the number of new patients is estimated. Unless there is substantial progress in prevention and treatment, heart failure will remain a major health problem 2 . Continuous progress in therapy relies on a better understanding of the pathobiology of heart failure, and studies to discover new mechanisms and test new therapeutics are direly needed 3 . Animal modeling of cardiovascular disease is challenging, and most models aim to create the etiological factors leading to cardiac disease either by surgery, selective breeding, or genetic modifications. Small animal models, particularly mice and rats, are essential models in cardiac research allowing for relatively rapid, high through-put, and cost effective means of studying cardiac physiology, disease, and novel therapeutic targets 4 . The rat has several advantages over the mouse for cardiovascular research. It offers some of the advantages of a larger animal but with reduced costs, and it is preferable for surgical procedures. Technically it is more feasible to create ischemia, pressure, or volume overload models by coronary artery ligation, aortic banding, or shunt procedures respectively in the rat than in the mouse 5 , and those models are well established in the literature 6 . It is easier to perform physiological monitoring in the rat, and in many cases, the physiology is more similar to humans 7 . Rats also have a greater ability to increase their heart rate during exercise, have a more positive FFR (force-frequency relationship) and have slightly slower kinetics of contraction and relaxation as compared to mice 8 . Indeed, the rat became the initial small animal model of choice for cardiovascular research 9 . Functional genomics aimed at studying the effects of changes in gene expressions by targeted mutagenesis or transgenesis allowed many insights into signaling pathways involved in the pathogenesis of heart failure 10 . With the sequencing of the mouse genome and the development of many genetically modified mouse lines in the last 20 years, the mouse has become widely used as a tool in generating complex myocardial phenotypes 11 . However, functional genomic research in the rat has been limited due to difficulties in manipulation of the rats genome 7 . As a result, despite being the most remote rodent from humans in terms of contractile function, the mouse became the most used animal model for cardiovascular research. Here we aimed to develop a simplified cardiac-specific rat transgenic model based on a single adeno-associated virus (AAV) injection. We show that we can achieve a robust high level and specific cardiac expression of transgene in the rat heart. This model will allow easy and fast transgenic based disease modeling of cardiovascular disease in the rat heart. Methods Animals A total of 15 HsdHan: Wistar rat pups were used in this study. Sample size of n=5 per group was calculated based on preliminary mice experiments with 80% power to detect 1.5-fold increase in mean GFP fluorescence. All pups were born at the SPF unit of the pre-clinical research authority at the Technion (Israel Institute of Technology; IIT). Health monitoring was carried out in accordance with FELASA recommendations 12 . Each litter was housed with the dam, weened at 3 weeks and separated by sex. Rats were group housed in IVC racks in Sealsafe Plus GR900 TECNIPLAST cages, on Sani chips bedding (Teklad ENVIGO) and Tek-fresh bedding (Teklad ENVIGO). Disposable play tunnels were added as environmental enrichment. Rats were maintained under climate-controlled conditions of 12:12 hrs light/dark cycle, temperature range 21±2°C, a relative humidity of 30–70% and fed ad libitum a commercial food – pellet diet (Altromin 1414 IRR). Ad libitum reverse osmosis acidified water (pH of 3.0±0.2) was accessible in polycarbonate water bottles covered with stainless steel lids. All efforts were made to ameliorate any suffering of animals, and treatment consisted of a single intraperitoneal injection, anesthesia during echocardiography, and euthanasia at the end of protocol. Daily monitoring by a veterinarian ensured animal well-being. Studies were conducted at the Technion (IIT), Faculty of Medicine, Haifa, Israel, after obtaining approval from the institute’s IACUC. All proceedings complied with the Animal Welfare Act of 1966 (P.L. 89-544), as amended by the Animal Welfare Act of 1970 (P.L.91-579) and 1976 (P.L. 94-279) . Animals allocation to control and experimental groups was done randomly. Cages were arranged on the racks by a technician unaware of the experimental plan. Cages were then allocated to the control, ‘low dose’, and ‘high dose’ groups according to their order on the rack without prior examination of the rats in the cages to avoid bias. Viral injection, echocardiography, euthanasia, and sample analysis were each done on all the animals in the same day to minimize confounders. Echocardiography and histology (H&E) analyses were performed by an investigator unaware of the group allocation of the animals. Because the GFP fluorescence was obvious, the investigator performing the fluorescence microscopy could not be blinded to the treatment. To avoid bias in the GFP fluorescence analysis, we performed and show analysis of the entire heart sections. High power fields were picked at random without looking at the green fluorescence. AAV production The following plasmids were used for AAV production: pENN.AAV.cTNT.PI.eGFP.WPRE.rBG was a gift from James M. Wilson ( Addgene plasmid #105543 ; RRID:Addgene_105543); pAdDeltaF6 was a gift from James M. Wilson ( Addgene plasmid #112867 ; RRID:Addgene_112867); pAAV2/9n was a gift from James M. Wilson ( Addgene plasmid #112865 ; RRID:Addgene_112865). AAV was produced as previously described in detail 13 . In brief, ten 150 mm dishes of HEK293T cells (ATCC) were triple transfected using polyethylenimine (PEI). Media containing virus was collected after 72 hours and combined with the media and lysate that were collected after 120 hours. Both lysate and media were purified over iodixanol gradient (Optiprep, Sigma D1556-250ML) via ultracentrifugation. Buffer was exchanged to PBS via amicons (Millipore, UFC910008). AAV titration was conducted to determine viral particle load by qPCR with AAV transfer plasmid as a positive control to create a standard curve using WPRE primers. AAV injection We used two viral stock concentrations - a ‘low dose’ of 4×10 12 viral genomes (vg)/ml, and a ‘high dose’ of 2.6×10 13 viral genomes (vg)/ml concentrations. Five-day-old rat pups (n=5 pups per group) received a single 50 µl intra-peritoneal injection of saline (control group), 2×10 11 viral genomes (low dose), or 1.3×10 12 viral genomes (high dose) using a 30-gauge needle. Injections were performed in all the animals in the morning at the animal facility. Rats were maintained in house and analyzed at 12 weeks of age. Gravimetry After euthanasia the animal weight was measured on a laboratory scale (Precisa BJ 610C). The heart was harvested, washed with cold PBS, and blotted on Kimwipe tissue paper, and the weight measured on a laboratory scale (Precisa XT 220A). Echocardiography At 12 weeks of age, rats were anesthetized with 2% Isoflurane; body temperature was maintained by placing the rats on a warm 40°C heating plate. Breathing and heart rate were monitored throughout the procedure. Echocardiography was performed using a High-Resolution Ultrasound Imaging system Vevo2100 (Visual Sonics, Fujifilm) using a MS 250 13–24 MHz linear array transducer. Measurements were performed on parasternal short axis view at the level of the papillary muscles using M-Mode. Fractional shortening (FS%) was calculated as follows: FS (%) = [(LVIDd − LVIDs) /LVIDd] × 100. All values were based on the median of 3 independent measurements for each rat. Histology and immunofluorescence Hearts were fixed in ice cold 4% formaldehyde in PBS for 2 hours, then placed in cryopreservation solution containing 30% sucrose in PBS at 4°C overnight. The next day hearts were washed in cold PBS, embedded in optimal cutting temperature compound and snap frozen in 2-methylbutane immersed in liquid nitrogen. Sectioning of the hearts was performed in a cryostat (Leica) at 5 µm intervals. Hematoxylin and eosin (H&E) staining was performed using standard protocols and imaged with 3DHistech Pannoramic 250 Flash III automatic slide scanner. For immunofluorescence, cardiac sections were permeabilized with 1% Triton and blocked with a solution containing 5% bovine serum. Primary antibody monoclonal Anti-sarcomeric-alpha-Actinin (catalog number A7811, clone EA-53, Sigma-Aldrich) was incubated overnight at 4°C. Secondary antibody (Jackson ImmunoResearch, catalog number 715-175-151) was incubated for 1 hour at room temperature. Nuclei were counterstained with DAPI for 10 min at room temperature. Slides were imaged with Axio Observer inverted fluorescent microscope (Zeiss) using an X-cite metal-halide light source and a high-resolution camera (Hamamatsu Orca R2) and with 3DHistech Pannoramic 250 Flash III slide scanner. RNA extraction, reverse transcription, and quantitative real time PCR (qRT-PCR) RNA was purified from apical segments of hearts using TRI-Reagent (Sigma-Aldrich), according to the manufacturer's protocol. RNA was then reverse transcribed with 5x All-In-One Reverse Transcriptase MasterMix (Applied Biological Materials, Inc). Quantitative real‐time PCR was performed with iTaq universal SYBR green supermix (Bio‐Rad) using Bio‐Rad CFX96 real‐time system (model C100 Touch). Cycling conditions were: step 1 - 95°C for 3 minutes, step 2 - 95°C for 10 sec, step 3 - 55°C for 30 sec and read plate. Steps 2–3 were repeated 39 times. Expression data were normalized to the expression of Gapdh and ribosomal protein L4 (Rpl4). For each reaction we used technical duplicates, no-RT, and negative controls. The primers used for qRT-PCR are shown in Table 1 . Table 1. Primers used. Gene Forward primer Reverse primer Gapdh GACATGCCGCCTGGAGAAAC AGCCCAGGATGCCCTTTAGT Rpl4 GCCGCTGGTGGTTGAAGATAA CGTCGGTTTCTCATTTTGCCC eGFP CTACCCCGACCACATGAAGC AAGAAGATGGTGCGCTCCTG WPRE GGCTGTTGGGCACTGACAAT CCGAAGGGACGTAGCAGAAG Statistical analysis A two-tailed Student t-test was used to compare each experimental group with the control group. Results AAV injection Recombinant AAVs are the leading platform for in vivo delivery of gene therapies. To test the ability to transduce the rat heart with a single intraperitoneal AAV injection, we generated AAV 2/9 vectors, encoding for the green fluorescent protein eGFP under the control of the cardiac troponin T (cTnT) promoter, referred to as AAV9-cTnT-eGFP. Five -day-old rats were allocated to receive a single intraperitoneal control, ‘low dose’, or ‘high dose’ virus injection. Analysis of viral cardiotoxicity One of the most promising feature of AAV as a gene therapy vector is its low toxicity 14 . To verify that the viral transduction did not result in cardiac toxicity, we performed a gravimetric analysis of the injected rats. Bodyweight analysis did not show any significant change in either the low or high dose virus injected groups, as compared to control saline injected rats ( Figure 1A ). Similarly, the heart weight, normalized to body weight, did not significantly change following viral transduction, indicating no significant cardiac atrophy or hypertrophy ( Figure 1B ). To assess structural damage to the heart, necrosis, or signs of inflammation, we performed a histological analysis of the hearts with H&E staining. As shown in the representative images of control and high doses injected rat hearts ( Figure 1C ), viral transduction did not result in area of necrosis or in inflammatory cell infiltrate in the heart. Figure 1. Rats injected with AAV9-cTnT-eGFP show no signs of toxicity. A . Gravimetric analysis show no difference in body weight between rats injected with ‘high dose’ or ‘low dose’ AAV9-cTnT-eGFP and control saline injected rats. Black bars show average and each dot represent a measurement from one rat. N.S = not statistically significant from control by Student t-test. B . Gravimetric analysis shows no difference in heart weight normalized to body weight between rats injected with ‘high dose’ or ‘low dose’ AAV9-cTnT-eGFP and control saline injected rats. Black bars show average and each dot represent a measurement from one rat. N.S = not statistically significant from control by Student t-test. C . Representative hematoxylin & eosin stained cardiac sections at low (top) and high (bottom) magnification, showing normal histology with no foci of necrosis or inflammatory cell infiltrates even in rats injected with ‘high dose’ AAV9-cTnT-eGFP (right). Control Saline injected rat heart is shown on the left. Bar = 100 µm. To assess any function impairment, we performed two-dimensional echocardiography as well as M-mode measurements in all the rats. This echocardiographic analysis showed that neither the low nor the high dose injected rats had cardiac dimensions and contractile function that significantly differed from the control saline injected rats. Specifically, the left ventricular end diastolic dimeter (LVIDd) and the fractional shortening percent (FS%) were not-significantly changed in the low or high dose injected groups, as compared with the control saline injected rats ( Figure 2 ). Figure 2. Rats injected with AAV9-cTnT-eGFP have normal cardiac dimensions and function. A . Representative echocardiographic images in two-dimensional short axis view (top) and M-mode (bottom) magnification, showing normal cardiac dimensions, wall thickness and contractile function even in rats injected with ‘high dose’ AAV9-cTnT-eGFP (right). Control saline injected rat heart is shown on the left. B . Echocardiographic measurements of left ventricular internal diameter in end diastole (LVIDd) showing no significant changes between rats injected with ‘high dose’ or ‘low dose’ AAV9-cTnT-eGFP and control saline injected rats. Black bars show average and each dot represent measurement from one rat. N.S = not statistically significant from control by Student t-test. C . Echocardiographic measurements of left ventricular fractional shortening (FS%) showing no decrement in cardiac function between rats injected with ‘high dose’ or ‘low dose’ AAV9-cTnT-eGFP and control saline injected rats. Black bars show average and each dot represent measurement from one rat. N.S = not statistically significant from control by Student t test. Together these data show that cardiac transduction with a single intraperitoneal injection of AAV9 in a dose of up to 1.3×10 12 viral genomes does not result in any significant cardiotoxicity, cardiac atrophy, cardiac hypertrophy, or functional impairment. This approach may, therefore, be useful for cardiac studies in the rat. Analysis of viral transduction efficiency AAVs can achieve high transduction efficiency in vivo . To assess the efficiency of our simplified approach, we analyzed cardiac sections from the control and transduced rats for eGFP green fluorescence. As can be seen in the images ( Figure 3A–F ) the transduction with the low dose of AAV9-cTnT-eGFP resulted in only a low number of GFP positive cells in the heart. In contrast, transduction with the high AAV9-cTnT-eGFP dose resulted in robust and high GFP expression in the entire heart, including both the right and left ventricles in all animals, as compared with control, saline injected rat hearts, that showed no GFP green fluorescent signal. Figure 3. High cardiac expression of GFP in adult rats injected with AAV9-cTnT-eGFP. A – C . Low magnification images of cardiac sections of rats with GFP fluorescence (green) and DAPI nuclear stain (blue) showing no green GFP fluorescence in control saline injected rats ( A ), few transduced GFP positive cardiomyocytes in the low dose AAV9-cTnT-eGFP injected rats ( B ), and robust high GFP expression in the high dose AAV9-cTnT-eGFP injected rats ( C ). Each image was taken from a different rat. Bar = 5 mm. D – F . High magnification images from the same rats shown in A – C , showing no green GFP fluorescence in control saline injected rats ( D ), few transduced GFP positive cardiomyocytes in the low dose AAV9-cTnT-eGFP injected rats ( E ), and robust high GFP expression in the high dose AAV9-cTnT-eGFP injected rats ( F ). Each image was taken from a different rat. Bar = 200 µm. To ensure that the bright green fluorescent signal was originating from the transduced cardiomyocytes in the heart, we performed a higher magnification analysis coupled with sarcomeric α actinin fluorescent immunostaining, to label the cardiomyocytes. As shown in the representative images ( Figure 4A–D ), transduction with the high dose of AAV9-cTnT-eGFP resulted in green GFP fluorescence in almost all the cardiomyocytes. Importantly non-cardiomyocytes cells in the heart were not labeled by eGFP ( Figure 4D ). Figure 4. Cardiomyocyte specific expression of GFP in adult rats injected with AAV9-cTnT-eGFP. A – B . Representative images of cardiac sections of control rats ( A – low magnification, Bar= 100 µm; B - High magnification Bar= 20 µm). C – D . Representative images of cardiac sections of ‘high dose’ AAV injected rats ( C – low magnification, Bar= 100 µm; D - High magnification Bar= 20 µm). For all panels ( A – D ) staining with sarcomeric α actinin immunostaining (red), eGFP fluorescence (green) and DAPI nuclear stain (blue). Left column of panels shows a composite of actinin (red) and DAPI (blue) channels, middle column shows a composite of GFP (green) and DAPI (blue) channels, and right column of panels shows a composite of all three actinin (red), GFP (green) and DAPI (blue) channels. No green GFP fluorescence is seen in cardiomyocytes from control saline injected rats ( A – B ), and ~100% of cardiomyocytes show green GFP fluorescence in the high dose AAV9-cTnT-eGFP injected rats ( C – D ). Importantly, non-cardiomyocyte cells, likely cardiac fibroblasts, identified by the lack of sarcomeric α actinin immunostaining do not show GFP fluorescence even in the high dose AAV9-cTnT-eGFP injected rats, demonstrating the expression is restricted to cardiomyocytes ( D , arrows). Bar = 20 µm. Finally, we quantified the transduction efficiency. We measured the mean GFP signal in individual cardiomyocytes chosen from random high power fields ( Figure 5A ). This analysis showed a cardiomyocyte mean ± standard deviation GFP intensity of 4.24±0.71, 6.14±5.48, and 34.53±16.15 in arbitrary units in the control, low dose, and high dose injected hearts respectively (N=3 rats, n=~900 cardiomyocytes, in each group). Using a value of mean + three standard deviations of the signal intensity in the control cardiomyocytes as the cutoff for GFP expression, this would be translated to transduction efficiency (mean ± standard deviation) of 0.25± 0.35%, 20.75±7.53%, and 99.66±0.28% of the cardiomyocytes in the control, low dose, and high dose injected hearts respectively. Next, we quantified GFP mRNA expression levels using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). This analysis showed that cardiac GFP expression achieved with the low dose AAV9-cTnT-eGFP injection was 1.47±0.68 fold higher than that of the background (saline injected animals), while the expression achieved with the high dose AAV9-cTnT-eGFP injection was 32.6±11.5 higher ( Figure 5B ). AAV9 is known to efficiently transduce the heart but has a general distribution of expression throughout the body, most notably the liver 15 . To direct the expression specifically to the cardiomyocytes in the heart, we used the cardiac troponin T promoter in our viral vectors, because of its well-documented ability to drive strong, cardiomyocyte-selective transgene expression. We therefore also quantified the expression level in two additional tissues, the kidney and liver. The qRT-PCR showed that GFP expression in the kidney or liver was undetected, even in the high dose AAV9-cTnT-eGFP injected rats ( Figure 5B ). Figure 5. Quantification shows high transduction efficiency. A . A violin scatter plot of mean cardiomyocyte GFP intensity measured from random high power magnification of cardiac sections. Each point represents measurements from one cardiomyocytes in the control, low dose, and high dose AAV9-cTnT-eGFP injected rats, black bars show the mean intensity (N=3 rats, n=~900 cardiomyocytes, in each group). B . Quantitative reverse transcriptase PCR of normalized GFP expression showing very modest expression in the low dose AAV9-cTnT-eGFP rat hearts and high expression in the high dose AAV9-cTnT-eGFP rat hearts. No GFP expression was detectable in the liver or kidney even in the high dose AAV9-cTnT-eGFP rats. N=5 rats. Bars show the average ± standard error. * Student t-test vs. control p<0.05. Discussion Some of its special features make AAV the preferred in vivo gene transfer vector. It is not associated with human or rat disease, it has a wide and promiscuous tropism, it is minimally immunogenic, and has a long-lived and efficient gene transfer ability 15 . There are several serotypes of AAV that show different tropism to target tissues. AAV9 is the most cardiotropic serotype in the mouse and rat, and provides high level and stable expression in the heart 16 . We showed here that combining the cardiotropic feature of AAV9 with the cardiac specific activity of the cTnT promoter resulted in a high but also specific expression in cardiomyocytes. We also showed that even in the high dose group we did not see expression in non-cardiomyocytes in the heart, there were no expression in the liver, and no signs of cardiotoxicity, inflammation, or functional impairment. Therefore, our approach is both safe and efficacious, and enables a scalable expression of a transgene in the adult rat heart. There are several delivery methods for cardiac gene transfer: one method which has been described in mouse and rat is the direct intramyocardial injection, an invasive procedure that includes left thoracotomy surgery, and requires high skills 16 , 17 . Another common delivery method is intracoronary delivery via aortic root injection. This also requires invasive surgery and the use of potentially harmful vasodilators 6 . The intravenous injection was described in mouse models 5 , 18 , 19 , but in the rat, this approach resulted in low cardiac transgene expression 20 . The efficiency of intra-venous delivery was shown to be increased by using ultrasound-targeted microbubble destruction, but this approach required continuous viral infusion through a centrally placed venous catheter and appropriate ultrasound equipment 20 . Compared with these methods an intraperitoneal injection is simple, does not require special expertise or equipment, is safe for the animal, and does not elicit considerable stress. Intraperitoneal injection of AAV8 vectors was shown to be effective for cardiac transduction in the mouse 21 . Neonatal gene transfer has some advantages from an immunological point of view since neonates have an immature immune system and inoculation at this period has shown to induce tolerance to the transgene products 22 , and relatively lower vector doses are needed. Here we show for the first time, to the best of our knowledge, that a single intraperitoneal injection of AAV9 based vectors in neonatal rats is sufficient to achieve a near complete and long-lasting transduction of the adult rat heart. The ‘low dose’ used in our study of 2x10 11 viral genomes is similar to the dose used in mice 21 , however this dose resulted in low percentage of transduced cardiomyocytes in rats. In contrast, the ‘high dose’ of 1.3×10 12 viral genomes was sufficient for a near complete transduction. Defining this range will allow future researchers to titrate the AAV dose to the desired level of transgene expression. The use of AAVs is not without disadvantages. A major limitation of using AAV vectors is the relatively small transgene size (~ 4.7 kilobases) that can be cloned to the virus backbone; therefore, our approach cannot be used effectively for the expression of large genes. Recombinant AAV constructs in which the transgene does not encode a potentially tumorigenic gene product or a toxin molecule and is produced in the absence of a helper virus can usually be handled in a Biosafety Level 1 facility, but otherwise, a Biosafety Level 2 or higher may be required. The targeting of animal genomes to add, remove, or substitute coding or non-coding sequences has revolutionized cardiovascular research. The development of the CRISPR technology has further facilitated and expanded these tools 23 . This approach has already been utilized in the rat 24 , but has not gained a wide-spread use as in the mouse, and generation of gene modified rats remains a difficult, time- and resources- consuming endeavor. Here we showed that a single intraperitoneal injection of AAV9 vectors encoding a transgene under the control of the cTnT promoter to neonatal rats resulted in a highly robust and highly specific cardiomyocyte transgene expression in the adult rat heart, with no signs of cardiotoxicity. In the future, this approach could be expanded to deliver Cas9 and gRNAs 25 , or to deliver small hairpin (sh)RNAs or artificial microRNA (amiRNAs) 26 by AAVs to also achieve gene knockouts and knockdown in the rat heart. Data availability Underlying data Figshare: A simple Adeno Associated Virus (AAV) -Based Approach for The Generation of Cardiac Genetic Models in Rats_ Fig 1, https://doi.org/10.6084/m9.figshare.13148633.v2 27 This project contains the following underlying data: - Raw histological images as shown in Figure 1C in TIF format Figshare: A simple Adeno Associated Virus (AAV) -Based Approach for The Generation of Cardiac Genetic Models in Rats_figure 2, https://doi.org/10.6084/m9.figshare.13259624.v1 28 This project contains the following underlying data: - Raw echocardiographic images as shown in Figure 2A in JPG format Figshare: A simple Adeno Associated Virus (AAV) -Based Approach for The Generation of Cardiac Genetic Models in Rats_Fig 3, https://doi.org/10.6084/m9.figshare.13148663.v1 29 This project contains the following underlying data: - Raw immunofluorescence images as shown in Figure 3 in TIF format Figshare: A simple Adeno Associated Virus (AAV) -Based Approach for The Generation of Cardiac Genetic Models in Rats_Fig 4, https://doi.org/10.6084/m9.figshare.13148678.v2 30 This project contains the following underlying data: - Raw GFP signal images as shown in Figure 4 in TIF format Figshare: A simple Adeno Associated Virus (AAV) -Based Approach for The Generation of Cardiac Genetic Models in Rats_gravimetry_echo_GFP fluorescence_qPCR, https://doi.org/10.6084/m9.figshare.13259366 31 This project contains the following underlying data: - gravimetric analysis.xlsx - Echo data.xlsx - GFP fluorescence analysis.xlsx - qPCR raw data.xlsx Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0). Faculty Opinions recommended References 1. Virani SS, Alonso A, Benjamin EJ, et al. : Heart Disease and Stroke Statistics-2020 Update: A Report From the American Heart Association. Circulation. 2020; 141 (9): e139–e596. PubMed Abstract | Publisher Full Text 2. Braunwald E: Heart failure. JACC Heart Fail. 2013; 1 (1): 1–20. PubMed Abstract | Publisher Full Text 3. Braunwald E: The war against heart failure: the Lancet lecture. Lancet. 2015; 385 (9970): 812–824. PubMed Abstract | Publisher Full Text 4. Recchia FA, Lionetti V: Animal models of dilated cardiomyopathy for translational research. Vet Res Commun. 2007; 31 Suppl 1 : 35–41. PubMed Abstract | Publisher Full Text 5. Pawlowski WP, Grelon M, Armstrong S: METHODS IN MOLECULAR BIOLOGY TM Series Editor. 2013. Publisher Full Text 6. Sakata S, Lebeche D, Sakata N, et al. : Restoration of mechanical and energetic function in failing aortic-banded rat hearts by gene transfer of calcium cycling proteins. J Mol Cell Cardiol. 2007; 42 (4): 852–861. PubMed Abstract | Publisher Full Text | Free Full Text 7. Iannaccone PM, Jacob HJ: Rats! Dis Model Mech. 2009; 2 (5–6): 206–210. PubMed Abstract | Publisher Full Text | Free Full Text 8. Milani-Nejad N, Janssen PML: Small and large animal models in cardiac contraction research: advantages and disadvantages. Pharmacol Ther. 2014; 141 (3): 235–249. PubMed Abstract | Publisher Full Text | Free Full Text 9. Hasenfuss G: Animal models of human cardiovascular disease, heart failure and hypertrophy. Cardiovasc Res. 1998; 39 (1): 60–76. PubMed Abstract | Publisher Full Text 10. Breckenridge RA: Animal Models of Myocardial Disease. Animal Models for the Study of Human Disease. (Elsevier). 2013; 145–171. Publisher Full Text 11. Molkentin JD, Robbins J: With great power comes great responsibility: using mouse genetics to study cardiac hypertrophy and failure. J Mol Cell Cardiol. 2009; 46 (2): 130–136. PubMed Abstract | Publisher Full Text | Free Full Text 12. FELASA working group on revision of guidelines for health monitoring of rodents and rabbits, Mähler Convenor M, Berard M, et al. : FELASA recommendations for the health monitoring of mouse, rat, hamster, guinea pig and rabbit colonies in breeding and experimental units. Lab Anim. 2014; 48 (3): 178–192. PubMed Abstract | Publisher Full Text 13. Challis RC, Kumar SR, Chan KY, et al. : Systemic AAV vectors for widespread and targeted gene delivery in rodents. Nat Protoc. 2019; 14 (2): 379–414. PubMed Abstract | Publisher Full Text 14. Wang D, Tai PWL, Gao G: Adeno-associated virus vector as a platform for gene therapy delivery. Nat Rev Drug Discov. 2019; 18 (5): 358–378. PubMed Abstract | Publisher Full Text | Free Full Text 15. Zincarelli C, Soltys S, Rengo G, et al. : Analysis of AAV serotypes 1-9 mediated gene expression and tropism in mice after systemic injection. Mol Ther. 2008; 16 (6): 1073–1080. PubMed Abstract | Publisher Full Text 16. Bish LT, Morine K, Sleeper MM, et al. : Adeno-associated virus (AAV) serotype 9 provides global cardiac gene transfer superior to AAV1, AAV6, AAV7, and AAV8 in the mouse and rat. Hum Gene Ther. 2008; 19 (12): 1359–1368. PubMed Abstract | Publisher Full Text | Free Full Text 17. Palomeque J, Chemaly ER, Colosi P, et al. : Efficiency of eight different AAV serotypes in transducing rat myocardium in vivo . Gene Ther. 2007; 14 (13): 989–997. PubMed Abstract | Publisher Full Text 18. Bostick B, Ghosh A, Yue Y, et al. : Systemic AAV-9 transduction in mice is influenced by animal age but not by the route of administration. Gene Ther. 2007; 14 (22): 1605–1609. PubMed Abstract | Publisher Full Text 19. Bostick B, Yue Y, Lai Y, et al. : Adeno-associated virus serotype-9 microdystrophin gene therapy ameliorates electrocardiographic abnormalities in mdx mice. Hum Gene Ther. 2008; 19 (8): 851–856. PubMed Abstract | Publisher Full Text | Free Full Text 20. Müller OJ, Schinkel S, Kleinschmidt JA, et al. : Augmentation of AAV-mediated cardiac gene transfer after systemic administration in adult rats. Gene Ther. 2008; 15 (23): 1558–1565. PubMed Abstract | Publisher Full Text 21. Wang Z, Zhu T, Qiao C, et al. : Adeno-associated virus serotype 8 efficiently delivers genes to muscle and heart. Nat Biotechnol. 2005; 23 (3): 321–328. PubMed Abstract | Publisher Full Text 22. Zhang J, Xu L, Haskins ME, et al. : Neonatal gene transfer with a retroviral vector results in tolerance to human factor IX in mice and dogs. Blood. 2004; 103 (1): 143–151. PubMed Abstract | Publisher Full Text 23. Miano JM, Zhu QM, Lowenstein CJ: A CRISPR Path to Engineering New Genetic Mouse Models for Cardiovascular Research. Arterioscler Thromb Vasc Biol. 2016; 36 (6): 1058–1075. PubMed Abstract | Publisher Full Text | Free Full Text 24. Li W, Teng F, Li T, et al. : Simultaneous generation and germline transmission of multiple gene mutations in rat using CRISPR-Cas systems. Nat Biotechnol. 2013; 31 (8): 684–686. PubMed Abstract | Publisher Full Text 25. Zhao H, Li Y, He L, et al. : In Vivo AAV-CRISPR/Cas9-Mediated Gene Editing Ameliorates Atherosclerosis in Familial Hypercholesterolemia. Circulation. 2020; 141 (1): 67–79. PubMed Abstract | Publisher Full Text 26. Fechner H, Vetter R, Kurreck J, et al. : Silencing Genes in the Heart. In: Methods Mol Biol. (Humana Press Inc,). 2017; 1521 : 17–39. PubMed Abstract | Publisher Full Text 27. Kehat I: A simple Adeno Associated Virus (AAV) -Based Approach for The Generation of Cardiac Genetic Models in Rats_ Fig 1. figshare. Figure. 2020. http://www.doi.org/10.6084/m9.figshare.13148633.v2 28. Kehat I: A simple Adeno Associated Virus (AAV) -Based Approach for The Generation of Cardiac Genetic Models in Rats_figure 2. figshare. Figure. 2020. http://www.doi.org/10.6084/m9.figshare.13259624.v1 29. Kehat I: A simple Adeno Associated Virus (AAV) -Based Approach for The Generation of Cardiac Genetic Models in Rats_Fig 3. figshare. Media. 2020. http://www.doi.org/10.6084/m9.figshare.13148663.v1 30. Kehat I: A simple Adeno Associated Virus (AAV) -Based Approach for The Generation of Cardiac Genetic Models in Rats_Fig 4. figshare. Figure. 2020. http://www.doi.org/10.6084/m9.figshare.13148678.v2 31. Kehat I: A simple Adeno Associated Virus (AAV) -Based Approach for The Generation of Cardiac Genetic Models in Rats_gravimetry_echo_GFP fluorescence_qPCR. figshare. dataset. 2020. http://www.doi.org/10.6084/m9.figshare.13259366.v2 Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 10 Dec 2020 ADD YOUR COMMENT Comment Author details Author details 1 The Pre-Clinical Research Authority Unit, Technion - Israel Institute of Technology, 1 Efron Street, P.O. Box 9697, Haifa, 3109601, Israel 2 Faculty of Medicine, Technion - Israel Institute of Technology, 1 Efron Street, P.O. Box 9697, Haifa, 3109601, Israel 3 Department of Pathology, Rambam Medical Center, HaAliya HaShniya St 8, Haifa, 3109601, Israel Michal Schlesinger-Laufer Roles: Formal Analysis, Investigation Guy Douvdevany Roles: Investigation Lilac Haimovich-Caspi Roles: Investigation Yaniv Zohar Roles: Investigation Rona Shofty Roles: Methodology, Supervision Izhak Kehat Roles: Conceptualization, Methodology, Project Administration, Supervision Competing interests No competing interests were disclosed. Grant information This work was supported by funding from the Israel Science Foundation (grant no. 1385/20), and the Randy L. and Melvin R. Berlin Family Regenerative Medicine Research Grant (grant no. 1018852). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (1) version 1 Published: 10 Dec 2020, 9:1441 https://doi.org/10.12688/f1000research.27675.1 Copyright © 2020 Schlesinger-Laufer M et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Schlesinger-Laufer M, Douvdevany G, Haimovich-Caspi L et al. A simple adeno-associated virus-based approach for the generation of cardiac genetic models in rats [version 1; peer review: 2 approved] . F1000Research 2020, 9 (ISF):1441 ( https://doi.org/10.12688/f1000research.27675.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 1 VERSION 1 PUBLISHED 10 Dec 2020 Views 0 Cite How to cite this report: van Berlo JH. Reviewer Report For: A simple adeno-associated virus-based approach for the generation of cardiac genetic models in rats [version 1; peer review: 2 approved] . F1000Research 2020, 9 (ISF):1441 ( https://doi.org/10.5256/f1000research.30591.r77191 ) The direct URL for this report is: https://f1000research.com/articles/9-1441/v1#referee-response-77191 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 04 Feb 2021 Jop H. van Berlo , Lillehei Heart Institute, University of Minnesota, Minneapolis, MN, USA Approved VIEWS 0 https://doi.org/10.5256/f1000research.30591.r77191 The method article by Schlesinger-Laufer et al describes a simplified method for obtaining cardiomyocyte-specific expression of a gene of interest in rats. The authors provide a good rationale for why this method is useful and needed. The manuscript provides sufficient ... Continue reading READ ALL The method article by Schlesinger-Laufer et al describes a simplified method for obtaining cardiomyocyte-specific expression of a gene of interest in rats. The authors provide a good rationale for why this method is useful and needed. The manuscript provides sufficient details to replicate the results presented. The simplified method of generating a transgenic rat involves a single intraperitoneal injection of adeno-associated viral particles that can be readily produced in cell culture or purchased from commercial sources. The authors inject the AAV particles into neonatal rats in their experiments and evaluate expression at the adult stage. The authors show that there is dose-dependent gene transduction efficiency. This is an important and timely report that will help investigators to implement transgenesis in their rat-based cardiovascular research. I only have a couple of minor comments to further improve the manuscript. The methodology for measuring transduction efficiency is not very clear. Why is mean GFP intensity used as a determinant to establish a threshold for determining GFP expression? The control rat hearts should not have any GFP expression, and it makes more sense to use this as the baseline to establish threshold levels to distinguish autofluorescence from GFP expression. The numbers reported are 5 animals for each group, but the text only mentions quantification on 3 animals, while the figures show 4 replicates for each group. Why this discrepancy? Was any thresholding done to the images prior to measuring GFP expression? Is the rationale for developing the new method (or application) clearly explained? Yes Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Yes If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: cardiovascular physiology and pathology I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT van Berlo JH. Reviewer Report For: A simple adeno-associated virus-based approach for the generation of cardiac genetic models in rats [version 1; peer review: 2 approved] . F1000Research 2020, 9 (ISF):1441 ( https://doi.org/10.5256/f1000research.30591.r77191 ) The direct URL for this report is: https://f1000research.com/articles/9-1441/v1#referee-response-77191 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Elrod J and Hildebrand A. Reviewer Report For: A simple adeno-associated virus-based approach for the generation of cardiac genetic models in rats [version 1; peer review: 2 approved] . F1000Research 2020, 9 (ISF):1441 ( https://doi.org/10.5256/f1000research.30591.r76025 ) The direct URL for this report is: https://f1000research.com/articles/9-1441/v1#referee-response-76025 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 04 Jan 2021 John Elrod , Center for Translational Medicine, Temple University, Philadelphia, USA Alycia Hildebrand , Temple University, Philadelphia, PA, USA Approved VIEWS 0 https://doi.org/10.5256/f1000research.30591.r76025 Overview: The manuscript “A simple adeno-associated virus-based approach for the generation of cardiac genetic models in rats” by Kehat et al. details the development of a simplified method for the cardiac-restricted genetic expression of constructs by i.p. delivery of ... Continue reading READ ALL Overview: The manuscript “A simple adeno-associated virus-based approach for the generation of cardiac genetic models in rats” by Kehat et al. details the development of a simplified method for the cardiac-restricted genetic expression of constructs by i.p. delivery of AAV. The rationale for the current study is the need in the scientific community to have the ability to manipulate the rat genome to better utilize the many positive characteristics =this animal model has to offer such as the ability to perform surgical procedures, and how the rat is more physiologically similar to the human and the development of newer HFpEF models etc. The study verifies the benefits of using AAVs as a gene therapy due to the low cardiac toxicity, as well as the ability to have high expression restricted to cardiomyocytes with no evidence of inflammation or functional impairment as is often associated with tamoxifen and Cre-dependent models. The authors propose that a single intraperitoneal injection of AAV9 with a cardiac troponin T promotor creates a robust cardiac specific transgenic rat model with minimal no adverse effects or extra-cardiac expression. The manuscript is well written and without any major flaws. Minor Concerns: The manuscript would benefit by including one schematic at the beginning showing the timeline of AAV delivery and when physiological and experimental assessment was performed. What is the quantification of GFP transduction for all of the hearts in Fig3B and Fig3C? In Fig5, the authors quantify n=3 in each group, however in figure 3, n=4 and in the methods n=5. Please clarify. What are the authors' thoughts on why Fig3C has 1 of the 4 mice with more intense GFP transduction? Is this due to different imaging setting due to background or something? The authors did not discuss direct cardiac injection at day 1 or day 2, which does not require open heart surgery. What are your thoughts on this method as a way to increase efficacy while decreasing the viral load required? Is the rationale for developing the new method (or application) clearly explained? Yes Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Yes If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Cardiac physiology, heart failure, genetic mouse models, metabolism, mitochondria, calcium signaling We confirm that we have read this submission and believe that we have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Elrod J and Hildebrand A. Reviewer Report For: A simple adeno-associated virus-based approach for the generation of cardiac genetic models in rats [version 1; peer review: 2 approved] . F1000Research 2020, 9 (ISF):1441 ( https://doi.org/10.5256/f1000research.30591.r76025 ) The direct URL for this report is: https://f1000research.com/articles/9-1441/v1#referee-response-76025 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 10 Dec 2020 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 Version 1 10 Dec 20 read read John Elrod , Temple University, Philadelphia, USA Alycia Hildebrand , Temple University, Philadelphia, USA Jop H. van Berlo , University of Minnesota, Minneapolis, USA Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2021 van Berlo J. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 04 Feb 2021 | for Version 1 Jop H. van Berlo , Lillehei Heart Institute, University of Minnesota, Minneapolis, MN, USA 0 Views copyright © 2021 van Berlo J. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The method article by Schlesinger-Laufer et al describes a simplified method for obtaining cardiomyocyte-specific expression of a gene of interest in rats. The authors provide a good rationale for why this method is useful and needed. The manuscript provides sufficient details to replicate the results presented. The simplified method of generating a transgenic rat involves a single intraperitoneal injection of adeno-associated viral particles that can be readily produced in cell culture or purchased from commercial sources. The authors inject the AAV particles into neonatal rats in their experiments and evaluate expression at the adult stage. The authors show that there is dose-dependent gene transduction efficiency. This is an important and timely report that will help investigators to implement transgenesis in their rat-based cardiovascular research. I only have a couple of minor comments to further improve the manuscript. The methodology for measuring transduction efficiency is not very clear. Why is mean GFP intensity used as a determinant to establish a threshold for determining GFP expression? The control rat hearts should not have any GFP expression, and it makes more sense to use this as the baseline to establish threshold levels to distinguish autofluorescence from GFP expression. The numbers reported are 5 animals for each group, but the text only mentions quantification on 3 animals, while the figures show 4 replicates for each group. Why this discrepancy? Was any thresholding done to the images prior to measuring GFP expression? Is the rationale for developing the new method (or application) clearly explained? Yes Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Yes If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise cardiovascular physiology and pathology I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) van Berlo JH. Peer Review Report For: A simple adeno-associated virus-based approach for the generation of cardiac genetic models in rats [version 1; peer review: 2 approved] . F1000Research 2020, 9 (ISF):1441 ( https://doi.org/10.5256/f1000research.30591.r77191) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/9-1441/v1#referee-response-77191 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2021 Elrod J et al. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 04 Jan 2021 | for Version 1 John Elrod , Center for Translational Medicine, Temple University, Philadelphia, USA Alycia Hildebrand , Temple University, Philadelphia, PA, USA 0 Views copyright © 2021 Elrod J et al. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Overview: The manuscript “A simple adeno-associated virus-based approach for the generation of cardiac genetic models in rats” by Kehat et al. details the development of a simplified method for the cardiac-restricted genetic expression of constructs by i.p. delivery of AAV. The rationale for the current study is the need in the scientific community to have the ability to manipulate the rat genome to better utilize the many positive characteristics =this animal model has to offer such as the ability to perform surgical procedures, and how the rat is more physiologically similar to the human and the development of newer HFpEF models etc. The study verifies the benefits of using AAVs as a gene therapy due to the low cardiac toxicity, as well as the ability to have high expression restricted to cardiomyocytes with no evidence of inflammation or functional impairment as is often associated with tamoxifen and Cre-dependent models. The authors propose that a single intraperitoneal injection of AAV9 with a cardiac troponin T promotor creates a robust cardiac specific transgenic rat model with minimal no adverse effects or extra-cardiac expression. The manuscript is well written and without any major flaws. Minor Concerns: The manuscript would benefit by including one schematic at the beginning showing the timeline of AAV delivery and when physiological and experimental assessment was performed. What is the quantification of GFP transduction for all of the hearts in Fig3B and Fig3C? In Fig5, the authors quantify n=3 in each group, however in figure 3, n=4 and in the methods n=5. Please clarify. What are the authors' thoughts on why Fig3C has 1 of the 4 mice with more intense GFP transduction? Is this due to different imaging setting due to background or something? The authors did not discuss direct cardiac injection at day 1 or day 2, which does not require open heart surgery. What are your thoughts on this method as a way to increase efficacy while decreasing the viral load required? Is the rationale for developing the new method (or application) clearly explained? Yes Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Yes If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Cardiac physiology, heart failure, genetic mouse models, metabolism, mitochondria, calcium signaling We confirm that we have read this submission and believe that we have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Elrod J and Hildebrand A. Peer Review Report For: A simple adeno-associated virus-based approach for the generation of cardiac genetic models in rats [version 1; peer review: 2 approved] . F1000Research 2020, 9 (ISF):1441 ( https://doi.org/10.5256/f1000research.30591.r76025) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/9-1441/v1#referee-response-76025 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = \"A simple adeno-associated virus-based approach...\".replace(\"'\", ''); var linkedInUrl = \"http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/9-1441/v1\" + \"&title=\" + encodeURIComponent(lTitle) + \"&summary=\" + encodeURIComponent('Read the article by '); var deliciousUrl = \"https://del.icio.us/post?url=https://f1000research.com/articles/9-1441/v1&title=\" + encodeURIComponent(lTitle); var redditUrl = \"http://reddit.com/submit?url=https://f1000research.com/articles/9-1441/v1\" + \"&title=\" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Schlesinger-Laufer M et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : \"facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com\", services_expanded : \"facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com\", services_custom : [ { name: \"LinkedIn\", url: linkedInUrl, icon:\"/img/icon/at_linkedin.svg\" }, { name: \"Mendeley\", url: \"http://www.mendeley.com/import/?url=https://f1000research.com/articles/9-1441/v1/mendeley\", icon:\"/img/icon/at_mendeley.svg\" }, { name: \"Reddit\", url: redditUrl, icon:\"/img/icon/at_reddit.svg\" }, ] }; var addthis_share = { url: \"https://f1000research.com/articles/9-1441\", templates : { twitter : \"A simple adeno-associated virus-based approach for the generation.... Schlesinger-Laufer M et al., published by \" + \"@F1000Research\" + \", https://f1000research.com/articles/9-1441/v1\" } }; if (typeof(addthis) != \"undefined\"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(\".f1r-shares-twitter\").attr(\"href\", \"https://twitter.com/intent/tweet?text=\" + addthis_share.templates.twitter); $(\".f1r-shares-facebook\").attr(\"href\", \"https://www.facebook.com/sharer/sharer.php?u=\" + addthis_share.url); $(\".f1r-shares-linkedin\").attr(\"href\", addthis_config.services_custom[0].url); $(\".f1r-shares-reddit\").attr(\"href\", addthis_config.services_custom[2].url); $(\".f1r-shares-mendelay\").attr(\"href\", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(\".addthis_button_expanded\").each(function(){ var count = $(this).text(); if (count !== \"\" && count != \"0\") $(this).removeClass(\"is-hidden\"); else $(this).addClass(\"is-hidden\"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get(\"/articles/acj/27675/30591\") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay(\"articles\", \"article\", \"30591\"); $(document).ready(function() { $( \"#frame1\" ).on('load', function() { var mydiv = $(this).contents().find(\"div\"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(\".interactive-living-figure-label .icon-more-info\"), titleLivingFigure = tooltipLivingFigure.attr(\"title\"); tooltipLivingFigure.simpletip({ fixed: true, position: [\"-115\", \"30\"], baseClass: 'small-tooltip', content:titleLivingFigure + \" \" }); tooltipLivingFigure.removeAttr(\"title\"); $(\"body\").on(\"click\", \".cite-living-figure\", function(e) { e.preventDefault(); var ref = $(this).attr(\"data-ref\"); $(this).closest(\".living-figure-list-container\").find(\"#\" + ref).fadeIn(200); }); $(\"body\").on(\"click\", \".close-cite-living-figure\", function(e) { e.preventDefault(); $(this).closest(\".popup-window-wrapper\").fadeOut(200); }); $(document).on(\"mouseup\", function(e) { var metricsContainer = $(\".article-metrics-popover-wrapper\"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(\".article-metrics-close-button\").click(); } }); var articleId = $('#articleId').val(); if($(\"#main-article-count-box\").attachArticleMetrics) { $(\"#main-article-count-box\").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(\".new_figshare_widget\"); if (figshareWidget.length > 0) { window.figshare.load(\"f1000\", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr(\"figshare_articleId\") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { \"77191\": 14, \"76025\": 35, \"76027\": 0, \"76026\": 0, }; $(\".referee-response-container,.js-referee-report\").each(function(index, el) { var reportId = $(el).attr(\"data-reportid\"), reportCount = reportIds[reportId] || 0; $(el).find(\".comments-count-container,.js-referee-report-views\").html(reportCount); }); var uuidInput = $(\"#article_uuid\"), oldUUId = uuidInput.val(), newUUId = \"74165213-654c-4979-999f-cd5bb224070b\"; uuidInput.val(newUUId); $(\"a[href*='article_uuid=']\").each(function(index, el) { var newHref = $(el).attr(\"href\").replace(oldUUId, newUUId); $(el).attr(\"href\", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: \"f1000research\", displayName: \"F1000Research\", hostName: \"f1000research.com\", id: \"1\", editorialEmail: \"research@f1000.com\", infoEmail: \"info@f1000.com\", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(\".cookie-warning\").is(\":visible\")) { $(\".sticky\").css(\"margin-bottom\", \"35px\"); $(\".devices\").addClass(\"devices-and-cookie-warning\"); } $(\".cookie-warning .close-button\").click(function (e) { $(\".devices\").removeClass(\"devices-and-cookie-warning\"); $(\".sticky\").css(\"margin-bottom\", \"0\"); }); $(\"#tweeter-feed .tweet-message\").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(\".partner\").on(\"mouseenter mouseleave\", function() { $(this).find(\".gray-scale, .colour\").toggleClass(\"is-hidden\"); }); }); <!-- Sign in --> Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $(\"a[id=googleSignInButton]\").click(function(event){ event.preventDefault(); $(\"input[id=oAuthSystem]\").val(\"GOOGLE\"); $(\"form[id=oAuthForm]\").submit(); }); $(\"a[id=facebookSignInButton]\").click(function(event){ event.preventDefault(); $(\"input[id=oAuthSystem]\").val(\"FACEBOOK\"); $(\"form[id=oAuthForm]\").submit(); }); $(\"a[id=orcidSignInButton]\").click(function(event){ event.preventDefault(); $(\"input[id=oAuthSystem]\").val(\"ORCID\"); $(\"form[id=oAuthForm]\").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($(\"#sign-in-form-gfb-popup\")); $(\".target-field\").each(function () { var uris = $(this).val().split(\"/\"); if (uris.pop() === \"login\") { $(this).val(uris.toString().replace(\",\",\"/\")); } }); });","source_license":"CC-BY-4.0","license_restricted":false}