{"paper_id":"02c3f6dc-2b21-46f0-9240-c196b402435e","body_text":"Juglone induces apoptosis in Sf9 cells through reactive oxygen species-mediated caspase-dependent mitochondrial pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Juglone induces apoptosis in Sf9 cells through reactive oxygen species-mediated caspase-dependent mitochondrial pathway Lihua Liu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7414469/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Juglone is a naphthoquinone compound that has been shown to have insecticidal activity, but its mechanism of action remains to be fully elucidated. The results of this study indicate that juglone inhibits Sf9 cell proliferation in a time- and concentration-dependent manner. Typical apoptotic features, such as cell membrane blebs and apoptotic bodies were observed by microscopy and DAPI staining. Additionally, a series of DNA fragments appearing as a ladder-like pattern of bands at intervals of about 200 bp, a hallmark of apoptosis, were detected by the DNA fragmentation assay. Flow cytometry analysis revealed that juglone induced G2/M phase arrest of Sf9 cells, as indicated by significant increase in the proportion of G2/M phase cells from 28.8 to 55.74%, and the proportion of apoptotic cells from 5.05 to 33.12% compared to control cells, implying that juglone can induce apoptosis in Sf9 cells. In addition, intracellular biochemical assays confirmed that in Sf9 cells juglone also significantly induced the loss of mitochondrial membrane potential, the production of reactive oxygen species (ROS) and the mRNA expression levels of key apoptotic genes (Apaf-1, Caspase-3, Caspase-9, Cytochrome C) in the mitochondrial apoptosis pathway. Thus, it was confirmed that, in Sf9 cells, juglone induces cell apoptosis by activating the caspase-dependent mitochondrial apoptosis pathway through excessive production of ROS. The findings of this study provide a new perspective for studying the toxicology and mode of action of juglone at the cellular level. Biological sciences/Biochemistry Biological sciences/Cell biology Biological sciences/Molecular biology Juglone Sf9 cells Reactive oxygen species Apoptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Juglone is a naphthoquinone compound that has been shown to have insecticidal activity, but its mechanism of action remains to be fully elucidated. The results of this study indicate that juglone inhibits Sf9 cell proliferation in a time- and concentration-dependent manner. Typical apoptotic features, such as cell membrane blebs and apoptotic bodies were observed by microscopy and DAPI staining. Additionally, a series of DNA fragments appearing as a ladder-like pattern of bands at intervals of about 200 bp, a hallmark of apoptosis, were detected by the DNA fragmentation assay. Flow cytometry analysis revealed that juglone induced G2/M phase arrest of Sf9 cells, as indicated by significant increase in the proportion of G2/M phase cells from 28.8 to 55.74%, and the proportion of apoptotic cells from 5.05 to 33.12% compared to control cells, implying that juglone can induce apoptosis in Sf9 cells. In addition, intracellular biochemical assays confirmed that in Sf9 cells juglone also significantly induced the loss of mitochondrial membrane potential, the production of reactive oxygen species (ROS) and the mRNA expression levels of key apoptotic genes (Apaf-1, Caspase-3, Caspase-9, Cytochrome C) in the mitochondrial apoptosis pathway. Thus, it was confirmed that, in Sf9 cells, juglone induces cell apoptosis by activating the caspase-dependent mitochondrial apoptosis pathway through excessive production of ROS. The findings of this study provide a new perspective for studying the toxicology and mode of action of juglone at the cellular level. Resistance to pesticides, residual pesticides, and environmental pollution of chemical pesticides have always been and continue to be pressing problems to be solved in agricultural production. One of the key means of solving these problems is to develop and environmentally friendly plant-derived pesticides with characteristics of non-target biosafety, low toxicity and low residue. The development and application of plant-based pesticides such as azadirachtin camptothecin, and matrine have well established that plant-based pesticides have broad application prospects in the pesticide industry. China is rich in plant resources, including nearly a thousand species of plants with insecticidal or bactericidal activity. They can produce alkaloids, terpenoids, naphthoquinones, flavonoids, essential oils and other secondary metabolites with different properties, including insecticidal or bactericidal activity, which can be used as natural products to find a lead compound with insecticidal activity, which is a prerequisite for the development of green pesticides. Juglone (5-hydroxy-1,4-naphthalenedione) is a kind of hydroxy-naphthoquinone compound isolated from the fresh root bark, branch bark and green fruit peel of Juglans mandshurica (monkey nuts or tigernut), which besides having various biological activities, such as antitumor 1 , antibacterial 2 , antiviral 3 and antioxidant, it also has insecticidal activity. Previous studies have shown that juglone has strong contact and gastric toxic effects on the larvae of gypsy moth and cabbage armyworm. In addition, juglone has also been found to have toxic effects on various agricultural pests, such as brown planthopper, cauliflower butterfly 4 , nematode 5 , cotton aphid 6 , etc. Although the insecticidal activity of juglone has been studied, its mechanism of action remains unknown. In recent years, induction of cell apoptosis has been considered as one of the effective mechanisms for controlling pests 7 . Apoptosis is a programmed cell death process regulated by a series of related genes. Apoptosis plays an important role in in-dividual development, resisting interference from various external factors, and maintaining normal tissue homeostasis. When multicellular organisms are affected by specific internal and external factors, they can lead to morphological changes and cell death 8 . Many insecticidal active substances can exert insecticidal effects by inducing insect cell apoptosis, such as matrine and harmine, both of which can induce apoptosis in Sf9 cells from the Spodoptera frugiperda (fall armyworm) species 9 , 10 , azadirachtin that can induce apoptosis in Sf9 cells from the S. frugiperda and Sl-1 cells from the Spodoptera litura 11 , 12 , camptothecin that can induce apoptosis in Spodoptera exigua (beet armyworm) Spex II cells 13 , etc. Juglone has been shown to induce tumor cell apoptosis and inhibit tumor cell proliferation through different mechanisms. For example, by stimulating the production of reactive oxygen species (ROS) in gastric cancer SGC-7901 cells and activating the caspase cascade reaction to induce apoptosis 14 , by inducing apoptosis in liver cancer HepG2 cells through G2/M phase arrest and the p53 pathway, by inducing apoptosis in melanoma cells through ROS-p38 mediated cellular signaling pathway 15 , etc. As a naphthoquinone compound with insecticidal activity, the toxic effects of juglone on insect cells are still unclear. The Sf9 cell line was initially established from ovarian tissue of the S. frugiperda , and is an excellent model for studying insecticide cytotoxicity and programmed cell death 16 , 17 . In this study the Sf9 cell line is used to investigate the growth inhibitory and apoptosis inducing effects of juglone on in-sect cells. This study elucidated the molecular mechanism of juglone toxicity, providing theoretical basis for studying the toxicology and mode of action of insecticides at the cellular level, and identifying candidate compounds for the eventual development of safe and efficient plant-based insecticides. Materials and Methods Experimental materials Juglone (purity ≥ 98%) was purchased from Shanghai Yuanye Biotechnology Co., Ltd. (Shanghai, China). Sf9 cells, culture medium and supplements were purchased from Wuhan Punosai Life Technology Co., Ltd. (Wuhan, China), and cultured in our laboratory. The Annexin V-PE/7-AAD cell apoptosis kit was purchased from BD Bio-sciences (San Jose, CA, USA); the DAPI (4’,6-diamidino-2-phenylindole) staining solution, cell counting kit-8 (CCK-8), and cell cycle kit were all purchased from Shanghai Biyuntian Biotechnology Co., Ltd. (Shanghai, China); the total RNA extraction and reverse transcription kits were purchased from Shanghai Shenggong Bio-technology Co., Ltd. (Shanghai, China); SYBR Green Master Mix was purchased from Takara Bio Inc. (Shiga, Japan); the genomic DNA extraction kit was purchased from Tiangen Biochemical Technology Co., Ltd. (Beijing, China); the ROS detection kit and Rhodamine 123 (Rho-123) dye solution were both purchased from Nanjing Jiancheng Biotechnology Research Institute (Nanjing, China). Cell Thawing and Culture The liquid nitrogen frozen Sf9 cells were rapidly thawed by incubating the vial with frozen cells in a water bath at 37℃ for 1 ~ 2 min with constant shaking. Then, a certain amount of Grace’s insect culture medium containing 10% fetal bovine serum (FBS) was added dropwise, mixed well, and centrifuged at 1,000 rpm, 5 min. Subsequently, after discarding the supernatant, the cells were resuspended in complete Grace’s medium, cultured in a 27℃ constant temperature incubator, and passaged every 3 days. Cell grouping and processing Logarithmic growth phase Sf9 cells (1×10 5 cells /mL) were seeded in 96-well plates (100 µL/well) and incubated for 24 h. Then, for cell morphology observation and cell viability analysis using the CCK-8 assay, juglone solution was added at final concentrations of 12.5, 25, 50 and 100 µmol/L and incubated for 12, 24, and 48 h. Subsequently, for cell cycle and apoptosis assays, Sf9 cells with good growth state were seeded in 6-well plates (1×10 5 cells/well), incubated for 24 h, and then the cells were treated for 24 h with different concentrations of juglone (final concentration: 25, 50, 100 µmol/L). The above treatments were concurrently set with cell control wells (treated with 0.1% dimethyl sulfoxide (DMSO) only), with 3 replicates for each treatment. Cell viability assay Cell viability was measured using the CCK-8 kit assay, and cells were treated with different concentrations of juglone for 12, 24, and 48 h, and concurrently, drug blank wells and cell control wells (0.1% DMSO) were set up. Subsequently, After washing wells were 3 times with phosphate-buffered saline (PBS), 100 µL of fresh culture medium was replenished in each well, followed by adding 10 µL of CCK-8 solution to each well, and the plates were incubated at 27℃ for 90 min in the dark. Finally, after measuring the absorbance value at 450 nm using a Microplate reader (BioTek, Winooski, VT, USA), the measured absorbance values were used to calculate cell viability. Observation of Cell Morphology After treating Sf9 cells with different concentrations of juglone for 12, 24, and 48 h, the cell growth status was observed and images were captured under an inverted microscope (Olympus Corporation, Tokyo, Japan). DNA ladder analysis Genomic DNA was extracted from Sf9 cells treated with different concentrations of juglone for 24 h, according to the instructions of DNA extraction kit. The integrity of the extracted DNA was assessed by 1% agarose gel electrophoresis. DAPI staining to detect apoptotic morphological changes in Sf9 cells The apoptotic morphological changes in Sf9 cells treated with different concentrations of juglone for 24 h were observed using a DAPI staining kit. Briefly, after as-pirating the culture medium from each well of the 6-well plate, 1 mL of DAPI staining solution was added to each well and stained for 5 min, followed by 3 washes with PBS for 5 min each time. Eventually, cells were observed under a fluorescence microscope and images were captured. Detection of cell apoptosis rate by flow cytometry The Annexin V-PE/7-AAD apoptosis detection kit was used to measure the cell apoptosis rate following the kit manufacturer’s instructions. Briefly, Sf9 cells treated with different concentrations of juglone for 24 h were washed twice with pre cooled PBS buffer, fixed in 500 µL of the binding solution, and stained by adding 5µL of an Annexin V-PE and 7-AAD solution. After incubation at room temperature in the dark for 15 min, cells were subjected to flow cytometry analysis, and the results were analyzed using the Cell Quest software (BD Biosciences). Detection of cell cycle by flow cytometry After treatment with different concentrations of juglone for 24 h, Sf9 cells were collected and washed twice with pre-cooled PBS buffer, fixed overnight at 4℃ with pre-cooled 70% ethanol, washed with PBS, stained with propidium iodide (PI) by adding 0.5 mL of PI staining solution and incubating at 37℃ for 30 min. Finally, cells were subjected to flow cytometry analysis and the results were analyzed using the ModFit LT (for Mac) software (BD Biosciences). Cell reactive oxygen species detection The intracellular ROS levels were detected using a dichlorofluorescin-diacetate (DCFH-DA) fluorescence probe. Briefly, after treating Sf9 cells with different concentrations of juglone for 24 h, 1 mL of DCFH-DA probe diluted with serum-free culture medium (final concentration of 10 µM) was added, and cells were incubated at 27℃ for 25 min, washed twice with PBS, and ROS levels were detected using a fluorescence microscope. Mitochondrial membrane potential (ΔψM) detection The changes of mitochondrial membrane potential (ΔψM) were measured using Rho-123 staining solution. Briefly, after collecting cells treated with different concentrations of juglone for 24 h, and washing twice with PBS, Rho-123 staining solution (0.5 mg/mL) was added to each well, and the plate was incubated at 27℃ in the dark for 20 min. Eventually, the fluorescence intensity of the cells was detected under a fluorescence microscope. Quantitative Real-time Polymerase Chain Reaction (RT-qPCR) After treating Sf9 cells with different concentrations of juglone for 24 h, total RNA was extracted from cells using Trizol reagent. After checking the quality and integrity of the RNA, the PrimescriptTM RT kit (Takara Bio) was used to synthesize cDNA. Then, the obtained cDNA was used to measure the expression of apoptosis related gene transcription levels with the SYBR Green Master Mix qPCR quantitative kit (Takara Bio). All the above procedures were performed according to the instructions provided by the manufacturer of the kit. The primer sequences were designed using Primer 5.0 software (Premier Biosoft International, Palo Alto, CA, USA) and are listed in Table 1 . The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as the internal reference gene. The RT-qPCR reaction conditions were as follows: 95℃ for 3 min, 95℃ for 30 s, 60℃ for 30 s, 40 cycles, each reaction was repeated 3 times, and the relative gene expression level was calculated using the 2— △△Ct method 18 . Table 1 RT-RCR Primer Sequences. Gene name Primer sequence Apaf-1-RT-F CCGCAGTATTTCGGCTCG Apaf-1-RT-R GCATCGGATTATTGTTCTTCAT Caspase-3-RT-F CAGTTCTTCGCAACCCAA Caspase-3-RT-R GTCGCTGTCTACATTCGTG Caspase-9-RT-F ACCAGCACCCGCTACAGA Caspase-9-RT-R CGAACACCTCGCACAAT Cytochrome C-RT-F CTGGAATTTCATCTATTTTAGG Cytochrome C-RT-R GATGTATTTAGATTTCGATCAGT GAPDH-RT-F GGTATGGCTTTCCGTGTT GAPDH-RT-R GACCTGTTCCTCGGTGTAG Data statistical analysis The SPSS 20.0 software (IBM Corporation, Armonk, NY, USA) was used to calculate the mean and standard deviation, and one-way analysis of variance (ANOVA) was used to calculate the differences among the groups. Then, Tukey’s multiple com-parison test was performed, with P < 0.05 indicated statistical significance. Results The effect of juglone on the viability of Sf9 cells The results of the cell viability CCK-8 assay on Sf9 cells treated with different concentrations of juglone for 12, 24, and 48 h, revealed, as shown in Fig. 1 , that when Sf9 cells are exposed to the same concentration of juglone, the cell viability de-creases with treatment time, and with the increase of juglone concentration. The half maximal inhibitory concentration (IC 50 ) values after treatment with different concentrations of juglone, listed in Table 2 . Together, these results indicate that juglone has dose and time dependent toxicity against Sf9 cells. Table 2 Inhibition rates and IC 50 values of juglone on Sf9 cells at different concentrations and action times Concentration(µM) 12h 4h 48h survival rate(%) IC 50 (µM) survival rate(%) IC 50 (µM) survival rate(%) IC 50 (µM) 12.5 1.425 ± 0.081 1.232 ± 0.052 0.821 ± 0.028 25 1.008 ± 0.048 84.86 0.843 ± 0.036 57.12 0.689 ± 0.082 35.97 50 0.794 ± 0.015 0.602 ± 0.062 0.338 ± 0.028 100 0.328 ± 0.043 0.247 ± 0.032 0.175 ± 0.011 Effect of juglone on apoptosis in Sf9 cells The observation of the morphological changes in Sf9 cells treated with different concentrations of juglone for 12, 24, and 48 h, under an inverted microscope, revealed, as shown in Fig. 2 , that the cells in the control group were circular or elliptical in shape, with good adhesion ability, and the morphological changes of cells treated with 12.5 µmol/L were not significant. Cells from other treatment groups showed typical apoptotic features, such as cell membrane blebs and apoptotic bodies with the extension of treatment time and the increase of drug concentration. These results showed the time-dependent and dose-dependent effects of juglone, indicating that juglone has a significant impact on the morphology of Sf9 cells and can induce cell apoptosis. DAPI staining is widely used for cell apoptosis detection and measurement 19 , 20 , and its blue fluorescence intensity is proportional to the degree of nuclear apoptotic morphological changes. As shown in Fig. 3 a, compared to the control group, as the juglone concentration of the treatment group increased, the blue fluorescence intensity gradually increased, indicating an increase in the fragmentation of the nucleus into apoptotic bodies of varying sizes, showing a dose-dependent effect. These findings indicate that juglone can induce apoptosis in Sf9 cells. The formation of a series of characteristic DNA fragments appearing as a DNA ladder-like pattern of bands produced by DNA cleavage at DNA nucleosomes is an important feature of cell apoptosis. Agarose gel electrophoresis analysis of genomic DNA from Sf9 cells exposed to different concentrations of juglone for 24 h, revealed, as shown in Fig. 3 b, that the genomic DNA from cells of the control group and the 25 µmol/L treatment group appeared as a single band at the top of the lane, while the genomic DNA from cells treated with juglone at the concentrations of 50 and 100 µmol/L formed the typical DNA ladder pattern of bands at intervals of about 200 bp. Also, as the treatment concentration increases, the DNA fragmentation be-comes more prominent, indicating that juglone induces cell DNA damage in a con-centration-dependent manner. The cell membrane blebs and DNA ladder like pattern of bands indicate that the inhibition of cell activity by juglone is due to cell apoptosis, therefore, the cell apoptosis rate was measured using flow cytometry. The flow cytometry analysis of Sf9 cells treated with different concentrations of juglone for 24 h revealed, as shown in Fig. 3 c, that, compared with the percentage of late apoptotic cells (5.05%) in the control group, all cells in the in the 25, 50 and 100 µmol/L juglone treatment groups showed higher rate of late apoptotic cells with rates of 7.21, 18.41 and 33.12%, respectively. Also, the proportion of latest stage apoptotic cells in the medium and high juglone con-centration treatment groups increased significantly, and the difference was statistically significant (P < 0.05), while there was no significant difference in percentage of early apoptotic cells between the treatment group and the control group. These results further indicate that juglone can induce apoptosis in Sf9 cells in a dose-dependent manner. Effect of juglone on the cell cycle of Sf9 cells We investigated whether the decrease in Sf9 cell viability was due to cell cycle arrest by determining cell cycle distribution in cells treated with different concentrations of juglone for 24 h. The results (Fig. 3 c) showed that compared with the control group, the proportion of G1 phase cells in the treatment groups changed little or remained essentially unchanged, while the proportion of S phase cells decreased significantly with increasing juglone concentration, decreasing from 38.34% to 33.93, 26.4, and 12.41%, respectively. In addition, the proportion of G2/M phase cells in-creased significantly, increasing from 28.8% to 32.68, 42.57, and 55.74%. These findings indicate that juglone can induce the arrest of Sf9 cell cycle progression in the G2/M phase, thereby inhibiting cell proliferation. Juglone activates the mitochondrial apoptosis pathway Considering that juglone can induce apoptosis of Sf9 cells, the production and accumulation of ROS in cells is one of the indicators of mitochondrial dysfunction, and excessive ROS production is an early event that triggers mitochondrial dysfunction 28 。To determine whether the juglone-induced apoptosis in Sf9 cells is related to ROS production, we measured ROS levels using the fluorescent dye DCFH-DA, which combines with ROS in cells to produce green fluorescence, and its fluorescence intensity is proportional to the amount of ROS generated. The results revealed, as shown in Fig. 4 a, that with the increase of the juglone concentration, the fluorescence intensity in Sf9 cells was significantly enhanced, indicating that juglone can induce the production of ROS in Sf9 cells in a dose-dependent manner. Excessive accumulation of ROS in cells can lead to oxidative stress, thereby dam-aging cell membranes and promoting mitochondrial damage 21 . ΔψM dysfunction is an important feature of early cell apoptosis. We detected the changes in ΔψM using the Rho-123 fluorescent dye, which can rely on the ΔψM of normal cells to enter the mitochondrial matrix and emit yellow-green fluorescence, and its fluorescence intensity is an indicator of ΔψM, After the treatment with juglone, as the con-centration in-creased, the fluorescence intensity gradually weakened, as shown in Fig. 4 b. These results indicate that juglone can induce the loss of ΔψM in Sf9 cells, leading to the re-lease of Rho-23 from mitochondria, resulting in a decrease in fluorescence intensity in a juglone dose-dependent manner. Considering that the mitochondrial apoptosis pathway is regulated by a series of apoptosis-related genes 22 , we performed qRT-PCR analysis to detect changes in the transcription levels of the apoptosis-related genes cytochrome C, Apaf-1, caspase 3, and caspase 9, which are known to be involved in the mitochondrial pathway. The results in Fig. 4 c reveal that as the concentration of juglone increases, the mRNA expression levels of these genes are significantly upregulated in a dose-dependent manner. These results further indicate that juglone activates the caspase-dependent apoptosis pathway at the transcriptional level. Discussion In recent years, natural metabolites of plants have attracted considerable attention to combat pests. Although juglone is a natural naphthoquinone compound whose insecticidal activity has been confirmed by many studies, to date there has been no in-depth research on its insecticidal mechanism. Available research reports reveal that the cytochrome P450 system is involved in the detoxification pathway of insect resistance to juglone. Additionally, juglone can also reduce the activity of phenolic oxidase in the body of Pieris rapae and cotton bollworm larvae 23 . Lv et al. used metabolomics approaches to study the toxicity mechanism of juglone in aphids, and found that through the change of metabolites it affects the growth and development of cot-ton aphid and causes toxicity. These resistance mechanisms are mainly measured in living insects, but the toxicity of juglone on insect cells and the mechanism of action at the molecular level have been poorly studied. In order to conduct an in-depth investigation of the insecticidal mechanism of juglone, this study investigated its effect on cell viability and induction of cell apoptosis in Sf9 cells from a Lepidoptera insect- S. frugiperda , with the aim of elucidating the potential toxicological mechanism of juglone on insect cells. The results of this study, using the CCK-8 assay, showed that juglone inhibited the proliferation of Sf9 cells in a time- and dose-dependent manner, exerting significant cytotoxic effects on insect cells. Our results are consistent with the previously reported toxic effects of juglone on other cells, such as LS-174T cells 24 , Hela cells 25 , MCF-7 cells 26 , etc. Cell proliferation is mediated through cell cycle progression. In order to further examne the molecular mechanism of cell proliferation inhibition, flow cytometry analysis was used to determine cell cycle distribution. The results showed that, com-pared with the control group, after 24 h of treatment the number of G2/M phase cells in the treatment group significantly increased, in a dose-dependent manner, from 28.8% to 32.68, 42.57, and 55.74%, respectively. These findings suggest that the G2/M phase is the point of action of juglone to inhibit Sf9 cell proliferation, indicating that the growth inhibition of Sf9 cells by juglone is mediated through cell cycle arrest leading to blocked division. This can provide reference information for in-depth research on the mechanism of action of juglone and the development of targeted drugs. Many cytotoxic agents or DNA damaging agents can block the cell cycle in G1, S, or G2/M phases and then induce cell apoptosis 27 . This study aimed to investigate whether these effects are related to cell apoptosis. Cell membrane blebs and apoptotic bodies were observed through cell morphology observations, and the detection of dose-dependent morphological changes confirmed that cells were undergoing apoptosis. This was further confirmed by qualitative analysis using DAPI staining and DNA fragmentation assays. In addition, we used flow cytometry with a double staining method to detect the ratio of apoptotic cells treated with different concentrations of juglone. The results showed that the proportion of cell apoptosis increased from 5.05% in the control group to 7.21, 18.41, and 33.12%, respectively. The above results indicate that juglone can induce apoptosis in Sf9 cells, thereby inhibiting the proliferation of insect cells. This finding is consistent with the research results of other studies showing that juglone can induce apoptosis in various human tumor cells, such as prostate cancer LNCaP cells 28 , leukemia HL-60 cells 29 , oral squamous cell carcinoma Tac8113 cells 30 , etc., and inhibit tumor cell proliferation. Numerous studies have shown that mitochondria are closely related to cell apoptosis, and the mitochondrial apoptosis pathway is one of the endogenous path-ways of cell apoptosis. The activation of the mitochondrial apoptosis pathway in Sf9 cells has been confirmed and shown to be highly conserved, and can be activated by plant-derived compounds, such as azadirachtin 31 , camptothecin 32 , and cantharidin 33 . The disruption of the ΔψM is one of the earliest events occurring in the cascade reaction of cell apoptosis, once the ΔψM collapses, cell apoptosis is irreversible 34 . The excessive production of ROS can cause irreversible opening of mitochondrial mem-brane permeability transition pore (MPTP), and the loss of ΔψM and opening of the MPTP result in the release of cytochrome C into the cytoplasm, leading to the recruitment of caspase 9 by Apaf-1 to form a complex 35 . This activates the downstream apoptotic executive factor caspase 3 through the caspase 9 cascade reaction, leading to a series of chain reactions, ultimately inducing cell apoptosis 36 , 37 . In this study, treatment of Sf9 cells with juglone induced the production of ROS, the collapse of the ΔψM and a significant increase in mRNA levels of key apoptotic genes involved in the mitochondrial apoptosis pathway, which combined with the morpho-logical observations and apoptosis data, further demonstrate that juglone induces cell apoptosis by activating the caspase-dependent mitochondrial apoptosis pathway in Sf9 cells through excessive production of ROS. The results of this study also indicate that excessive production of ROS can induce DNA oxidative damage that in turn can cause cell cycle arrest and apoptosis, which is consistent with the results of Wang et al. 38 . As is well established, one of the mechanisms mediating the cytotoxic effects of juglone on cells is through its conversion into semi quinone free radicals in the body, which participate in the redox cycle and increase ROS levels, leading to cytotoxicity 39 . This is also consistent with the results of this study. Conclusion In summary, our study suggests that juglone has significant cytotoxic effects on Sf9 cells and induces cell apoptosis through a caspase-dependent mitochondrial pathway associated with increased ROS levels and cell cycle arrest caused by ΔψM loss. The results of this study provide a theoretical basis for the toxicity mechanism of juglone in insect cells, and lay a theoretical foundation for the further development of juglone as a plant-based insecticide. Declarations Competing interests The author declare no competing interests. Author Contribution L.L. conceived the project and designed the research, performed experiments and analyzed the data, completed the experiments and discussed the results and reviewed the manuscript. Acknowledgements This work was supported by Jilin Province Science and Technology Development Plan Project, grant number YDZJ202201ZYTS686. Data Availability The data that support the findings of this study are available from the corresponding author upon reasonable request. References Hongya, S. U. N., LI, Y. A. & Jipeng Inhibitory effect of juglone on proliferation and invasion of human ovarian cancer SKOV3 and IOSE80 cells and its mechanism[J]. Clin. Pharmacol. Ther. China . 24 (1), 32–37 (2019). Wenjun, L. I. LIU Chengjing. Extraction and Antimicrobial Activity of Juglone from Pericarpium Juglandis[J]. Chem. Indus. For. Prod. 39 (05), 95–100 (2019). LIU, J. et al. Research Progress of Walnut Green Husk asa Botanical Pesticide[J]. J. Agricultural Catastrophology . 8 (6), 12–14 (2018). Wenyi Hu, W. D. Shumin Bai; Sitong Lv; Guang Chen. Phenoloxidase, an effective bioactivity target for botanical insecticide screening from green walnut husks[J]. Nat. Prod. Res. 32 (23), 2848–2851 (2018). Cha, D. J. Dong Soo Kim. Nematicidal Activities of Three Naphthoquinones against the Pine Wood Nematode, Bursaphelenchus xylophilus[J]. Molecules 24 (20), 3634 (2019). Si-Tong Lv, W. X. D. & Shu-Min, B. Guang Chen. Insecticidal effect of juglone and its disturbance analysis in metabolic profiles of Aphis gossypii glover using 1 HNMR-based metabonomics approach[J]. Phytoparasitica 46 , 521–531 (2018). He Zhang, L. Z. & Diao, X. Na Li; Chenglan Liu. Toxicity of the mycotoxin fumonisin B1 on the insect Sf9 cell line[J]. Toxicon 129 , 20–27 (2017). Wei, Z. H. A. N. G. et al. Pin1 inhibitor juglone induces apoptosis in human cervical cancer SiHa cells[J]. Chin. J. Pathophysiology . 31 (3), 543–546 (2015). Huiqing He, X. Q., Fangyun, D. & JingminYe Chunbao Xu; Hanhui Zhang; Zhanmei Liu; Xiaojing Lv; YuehuaWu; Xuhong Jiang; Xingan Cheng. Synthesis, characterization of two matrine derivatives and their cytotoxic effect on Sf9 cell of Spodoptera frugiperda Journa [J]. Sci. Rep. 10 (1). (2020). Benshui Shu, J. Z., Zhiyan & Jiang Gaofeng Cui; Sethuraman Veeran; Guohua Zhong. Harmine induced apoptosis in Spodoptera frugiperda Sf9 cells by activatingthe endogenous apoptotic pathways and inhibiting DNA topoisomerase Iactivity[J] (Pesticide Biochemistry and Physiology, 2019). Benshui Shu, W. W., Qingbo, H. & Jingfei, H. Meiying Hu; Guohua Zhong. A comprehensive study on apoptosis induction by azadirachtin in Spodoptera frugiperda cultured cell line Sf9[J]. Archiues Insect Biochem. Physiol. 89 (3), 153–168 (2015). JingFei Huang, K. S., HaiYi, L. & MeiYing, H. GuoHua Zhong. Antiproliferative effect of azadirachtin A on Spodoptera litura Sl-1 cell line through cell cycle arrest and apoptosis induced by up-regulation of p53[J]. Pestic. Biochem. Physiol. 99 (1), 16–24 (2011). Zhang Lan, Z. Y. & He, W. Ma Dejun; Jiang Hongyun. Effects of camptothecin and hydroxycamptothecin on insect cell lines Sf21 and IOZCAS-Spex-II[J]. Pest Manag. Sci. 68 (4), 652–657 (2012). YuBin Ji, Z. Q., Xiang & Zou Juglone-induced apoptosis in human gastric cancer SGC-7901cells via the mitochondrial pathway[J]. Exp. Toxicol. Pathol. 63 (1), 69–78 (2011). Wu Jinfeng, Z. H., Xu, Y. & Zhang, J. Zhu Wei; Zhang Yi; Chen Liang; Hua Wei; Mao Ying. Juglone induces apoptosis of tumor stem-like cells through ROS-P38 pathway in glioblastoma[J]. BMC Neurol. 17 (1), 70 (2017). Guohua Zhong, G. C. & Xin, Y. Ranran Sun;Jingjing Zhang. Insecticide cytotoxicology in China: Current status and challenges[J]. Pestic. Biochem. Physiol. 132 (1), 3–12 (2016). Ruttanaphan Torranis, S. G. Pengsook Anchulee,Pluempanupat Wanchai,Huditz HannahIsadora,Bullangpoti Vasakorn,Le Goff Gaëlle, A Novel Insecticidal Molecule Extracted from Alpinia galanga with Potential to Control the Pest Insect Spodoptera frugiperda[J]. Insects 11 (10), 686 (2020). Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆CT method[J]. Methods 25 , 402–408 (2001). Chetverikov, P. E. A study of emb ryonic devel-opment in eriophyoid mites Acariformes,Eriophyoidea with the use of the fluorochrome DAPI and confocal micros-copy[J]. Exp. Appl. Acarol . 68 (1), 97–111 (2016). Yagi, K. & Osipowski, P. M. Molecular cyto-genetic analysis of cucumis wild species distributed in south-ern africa:physical mapping of 5Sand 45SrDNA with DAPI[J]. Cytogenet. Genome Res. 146 (1), 80–87 (2015). Seong, S. & Choi, G. R. E. A pesticide, fludioxonil, induced mitochondrial toxicity by increasing reactive oxygen species production and decreasing mitochondrial membrane potential in cardiomyocytes[J]. Toxicol. Lett. 384 (1), 221 (2023). Tianfeng Yang, R. X. & Qi, S. Hongying Wang; Feng Liu; Bingling Dai; Bo Wang; Yanmin Zhang. Chelerythrine hydrochloride inhibits proliferation and induces mitochondrial apoptosis in cervical cancer cells via PI3K/BAD signaling pathway[J]. Toxicol. In Vitro . 68 (1), 104965 (2020). Yiou Pan, C. Z., Hongfei & Xu Yongqiang Wu; Xiwu Gao; Jinghui Xi; Qingli Shang. Contribution of cytochrome P450 monooxygenase CYP380C6 to spirotetramat resistance in Aphis gossypii glover[J] (Pesticide Biochemistry and Physiology, 2018). Li, Q. & Juan, X. L. Z. Anti-proliferative and apoptosis-inducing activities of juglone in LS-174T cells[J]. Bangladesh J. Pharmacol. 8 (1), 65–72 (2013). Sun; Shou-Gang Jiang; Xian-Feng Gong. Zhai Lu, H. C. Xiao-Mei Zheng; Man-Ling Chen. Experimental study on the apoptosis of cervical cancer Hela cells induced by juglone through c-JunN-terminal kinase/c-Jun pathway[J]. Asian Pac. J. Trop. Med. 10 (6), 641–644 (2017). Ji, Y. B., Qu, G. S. X. Z. Y. & Zou, X. M. Yu. Mechanism of juglone-induced apoptosis of MCF-7 cells by the mitochondrial pathway[J]. Genet. Mol. Res. 15 (3), 1–4 (2016). Zhi-Jun Zhang, J. J. Z. & Zhi-Yan, J. Guo-Hua Zhong. Design, Synthesis and Bioactivity Evaluation of Novel β-carboline 1,3,4-oxadiazole Derivatives[J]. Molecules 22 (11), 1811 (2017). Huali Xu, X. Y. & Shaochun, Q. Dayun Sui. Juglone, isolated from Juglans mandshurica Maxim, induces apoptosis via down-regulation of AR expression in human prostate cancer LNCaP cells[J]. Bioorg. Med. Chem. Lett. 23 (1), 3631–3634 (2013). Shao-Chun, H. L. X. X. F. Y. Anti-proliferative effect of Juglone from Juglans mandshurica Maxim on human leukemia cell HL-60 by inducing apoptosis through the mitochondria-dependent pathway[J]. Eur. J. Pharmacol. 645 (1), 14–22 (2010). Qu; Rui Zhang; Xiang-Ru Qu; Yan-Ping Chen; Xing-Yuan Ma; Da-Yuan Sui. Kun, L. I. Z. H.; DONG Suge; et al. Effect and Mechanism of Walnut Quinone on Proliferation and Apoptosis of Oral Squamous Cell Carcinoma Tac8113 Cells[J]. Chinese archives of traditional Chinese medicine 2022, 4 (40), 107–110 . Jingfei Huang, C. L. & Meiying, H. Guohua Zhong. The Mitochondria-Mediate Apoptosis of Lepidopteran cells induced by Azadirachtin[J]. PLoS One . 8 (3), 58499 (2013). Benshui Shu, J. Z. & Veeran, S. Gaofeng Cui; Xin Yi; Guohua Zhong. Transcriptome analysis of Spodoptera frugiperda Sf9 cells reveals putative apoptosis-related genes and a preliminary apoptosis mechanism induced by azadirachtin[J]. Sci. Rep. 7 (1), 13231 (2017). Gaofeng Cui, Y. L. & Kai, D. Shaodong Hao; Jinzhong Wang; Zhiyong Zhang. Attribution of Bax and mitochondrial permeability transition pore on cantharidin-induced apoptosis of Sf9 cells[J]. Pestic. Biochem. Physiol. 142 (1), 91–101 (2017). Ly, J. D. & Lawen, G. D. R. The mitochondrial membrane potential (deltapsi(m)) in apoptosis: an update[J]. Apoptosis 8 (1), 115–128 (2003). Ouyang, L. et al. Programmed cell death pathways in cancer: a review of apoptosis, autophagy and programmed necrosis[J]. Cell Prolif. 45 (6), 487–498 (2012). Chen, M. G. A. D. et al. Caspase-9-induced mitochondrial disruption through cleavage of anti-apoptotic BCL-2 family members[J]. Joumal Biol. Chem. 282 (46), 33888–33895 (2007). Yu, F. W. & Kiejda, C. C. J. Apoptosis Induction in Human Melanoma Cells by Inhibition of MEK Is Caspase-Independent and Mediated by the Bcl-2 Family Members PUMA, Bim, and Mcl-1[J]. Clin. Cancer Res. 13 (16), 4934–4942 (2007). Xin-quan, Y. L., Shi & Zhong Hu Zhang; Xiang-yun Wang; Pei-pei Qi; Hao Xu. Oxidative injury is involved in fipronil-induced G2/M phase arrest and apoptosis in Spodoptera frugiperda (Sf9) cell line [J]. Pesticide Biochemistry and Physiology 105(2), 122–130. (2013). Piskorski, R. & D., S. How the oligophage codling moth Cydia pomonella survives on walnut despite its secondary metabolite juglone[J]. J. Insect. Physiol. 57 (6), 744–750 (2011). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-7414469\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":523758663,\"identity\":\"de2e5992-b355-45e5-a2fe-eee25c51ee7a\",\"order_by\":0,\"name\":\"Lihua Liu\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0UlEQVRIiWNgGAWjYBACPmYGxgOJDQwM/MzMBx8kVNQQ1sLGzMAA1iLZ3pZs8ODMMSK0APEBRqAWgzNnzCQftjAToYWdx+DAwx2H5Rlu5JhVJDawMfC3dycQcBhQS+KZw4aNM9LKbiTukGGQOHN2AxFa2g4zNkskb7uReIaNwUAilzgt9m0SCWYFiW3MxGtJ7OE5YsZApBa2AqCW9OQZ7G3JEglnjvEQ9As//+GND3+2WdvuP8x88OOPiho5/vZe/FowAA9pykfBKBgFo2AUYAUALEpK3z5tFcEAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Tonghua Normal University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Lihua\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-08-20 07:23:17\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-7414469/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-7414469/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":92708141,\"identity\":\"e874ae3e-0ac6-4d18-9cf1-01d79871f8a4\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:22:00\",\"extension\":\"docx\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":1613055,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"revisedJugloneinducesapoptosisinSf9cellsthroughreactiveoxygenspeciesmediatedcaspasedependentmitochondrialpathway.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/f9780efe98519adcf9124bb2.docx\"},{\"id\":92708134,\"identity\":\"b2d8970f-93b1-4719-9e90-2f50433ae925\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:22:00\",\"extension\":\"json\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":3589,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"c5290048a54846a790d8d22aabfee62d.json\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/3fa32a56f6c6e87c78814eb7.json\"},{\"id\":92708136,\"identity\":\"082e9d2a-848a-4b8e-8a2a-7b2f61601326\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:22:00\",\"extension\":\"xml\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":93322,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"c5290048a54846a790d8d22aabfee62d1enriched.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/de91a7265aae91a5dca41810.xml\"},{\"id\":92708843,\"identity\":\"7d4a162b-286f-4bc7-858b-7e11edbd5b36\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:30:00\",\"extension\":\"png\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":31944,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/d889d47fa0e5631ce1baa740.png\"},{\"id\":92709087,\"identity\":\"39babf34-173c-4f0e-a36e-1976cdbfa4c7\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:38:00\",\"extension\":\"png\",\"order_by\":4,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":777291,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/f3aebe3a40d29a330e0f9135.png\"},{\"id\":92708144,\"identity\":\"e56e5b53-8bd8-4b0e-861b-87a4e967480a\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:22:00\",\"extension\":\"jpeg\",\"order_by\":5,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":414280,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage3.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/a1aab0a09a19499e8bc4d272.jpeg\"},{\"id\":92708139,\"identity\":\"028aa411-6e3e-4d82-a12d-698068eba790\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:22:00\",\"extension\":\"png\",\"order_by\":6,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":349147,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/e84b084844b9d835ca096309.png\"},{\"id\":92708846,\"identity\":\"9d9b0078-11bc-4d58-bec5-999b095ed56e\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:30:00\",\"extension\":\"png\",\"order_by\":7,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":6273,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/131949b494421c8a2f155bc9.png\"},{\"id\":92708148,\"identity\":\"400bcc09-129f-490e-bd2b-918272674e36\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:22:00\",\"extension\":\"png\",\"order_by\":8,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":142729,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/77219be33d48e0a2aa768f74.png\"},{\"id\":92708845,\"identity\":\"e368f820-1390-42ba-be94-95eeb18600ff\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:30:00\",\"extension\":\"png\",\"order_by\":9,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":57523,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/81083914d7b6ce9914500220.png\"},{\"id\":92708143,\"identity\":\"d21583eb-6e76-4adc-a9a3-e099e7ce7bb7\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:22:00\",\"extension\":\"png\",\"order_by\":10,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":46402,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/aef87be028991662b017eacc.png\"},{\"id\":92708145,\"identity\":\"5bf6738f-1c99-4877-8bf7-a3b076226cf3\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:22:00\",\"extension\":\"xml\",\"order_by\":11,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":92359,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"c5290048a54846a790d8d22aabfee62d1structuring.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/de99f83dbe968568dcb28240.xml\"},{\"id\":92708847,\"identity\":\"583a55be-8376-4670-82fa-3db0a5cf3e2b\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:30:00\",\"extension\":\"html\",\"order_by\":12,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":99923,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"earlyproof.html\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/2db1828d03a4fd48bad32d00.html\"},{\"id\":92708131,\"identity\":\"52362263-02bf-49ec-90b7-8da6b20d8fae\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:21:59\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":39282,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffects of juglone, at different concentrations and action times, on the activity of Sf9 cells. Different letters indicate significant differences between treatments (P \\u0026lt; 0.05)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/77dd2244f6c8717eda1df758.png\"},{\"id\":92708132,\"identity\":\"dda91d7c-cfe6-4c8d-90d5-2bdfaa1e688a\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:21:59\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":777291,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eDynamic changes of Sf9 cells under different concentrations of juglone.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/d9815bbe7eaa2ebcc7145d3d.png\"},{\"id\":92708842,\"identity\":\"462f0fc2-318f-4371-a4d4-2af6ea9fce9d\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:29:59\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":311734,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eMorphological apoptosis of Sf9 cells treated with juglone at different concentrations.\\u003c/p\\u003e\\n\\u003cp\\u003e(a) DAPI staining to detect morphological apoptosis of Sf9 cells treated with different concentrations of juglone. (b) Effects of different concentrations of juglone on the apoptosis rate of SF9 cells. (c) Effect of different concentrations of juglone on Sf9 cell cycle distribution.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/4d0636c598e3dbf58294f5cb.png\"},{\"id\":92708137,\"identity\":\"adaf0ef5-bd63-41c6-897d-bd955d63820f\",\"added_by\":\"auto\",\"created_at\":\"2025-10-03 10:22:00\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":349147,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePhysiological and molecular responses of Sf9 cells to different concentrations of juglone. (a) Different concentrations of juglone induce ROS production in Sf9 cells. (b) Effects of different concentrations of juglone on Sf9 cell membrane potential. (c) Effects of different concentrations of juglone on the expression of apoptosis-related genes in Sf9 cells.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/b1f15cbc717ec9c51cb4e591.png\"},{\"id\":105564490,\"identity\":\"9238997e-5956-4685-9739-5ceb5efccdd1\",\"added_by\":\"auto\",\"created_at\":\"2026-03-27 12:49:45\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2345586,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7414469/v1/0ee8736f-0938-4cec-b249-ce7fd0ee9c86.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Juglone induces apoptosis in Sf9 cells through reactive oxygen species-mediated caspase-dependent mitochondrial pathway\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eJuglone is a naphthoquinone compound that has been shown to have insecticidal activity, but its mechanism of action remains to be fully elucidated. The results of this study indicate that juglone inhibits Sf9 cell proliferation in a time- and concentration-dependent manner. Typical apoptotic features, such as cell membrane blebs and apoptotic bodies were observed by microscopy and DAPI staining. Additionally, a series of DNA fragments appearing as a ladder-like pattern of bands at intervals of about 200 bp, a hallmark of apoptosis, were detected by the DNA fragmentation assay. Flow cytometry analysis revealed that juglone induced G2/M phase arrest of Sf9 cells, as indicated by significant increase in the proportion of G2/M phase cells from 28.8 to 55.74%, and the proportion of apoptotic cells from 5.05 to 33.12% compared to control cells, implying that juglone can induce apoptosis in Sf9 cells. In addition, intracellular biochemical assays confirmed that in Sf9 cells juglone also significantly induced the loss of mitochondrial membrane potential, the production of reactive oxygen species (ROS) and the mRNA expression levels of key apoptotic genes (Apaf-1, Caspase-3, Caspase-9, Cytochrome C) in the mitochondrial apoptosis pathway. Thus, it was confirmed that, in Sf9 cells, juglone induces cell apoptosis by activating the caspase-dependent mitochondrial apoptosis pathway through excessive production of ROS. The findings of this study provide a new perspective for studying the toxicology and mode of action of juglone at the cellular level.\\u003c/p\\u003e\\u003cp\\u003eResistance to pesticides, residual pesticides, and environmental pollution of chemical pesticides have always been and continue to be pressing problems to be solved in agricultural production. One of the key means of solving these problems is to develop and environmentally friendly plant-derived pesticides with characteristics of non-target biosafety, low toxicity and low residue. The development and application of plant-based pesticides such as azadirachtin camptothecin, and matrine have well established that plant-based pesticides have broad application prospects in the pesticide industry. China is rich in plant resources, including nearly a thousand species of plants with insecticidal or bactericidal activity. They can produce alkaloids, terpenoids, naphthoquinones, flavonoids, essential oils and other secondary metabolites with different properties, including insecticidal or bactericidal activity, which can be used as natural products to find a lead compound with insecticidal activity, which is a prerequisite for the development of green pesticides.\\u003c/p\\u003e\\u003cp\\u003eJuglone (5-hydroxy-1,4-naphthalenedione) is a kind of hydroxy-naphthoquinone compound isolated from the fresh root bark, branch bark and green fruit peel of Juglans mandshurica (monkey nuts or tigernut), which besides having various biological activities, such as antitumor\\u003csup\\u003e\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e\\u003c/sup\\u003e, antibacterial\\u003csup\\u003e\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u003c/sup\\u003e, antiviral\\u003csup\\u003e\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e\\u003c/sup\\u003e and antioxidant, it also has insecticidal activity. Previous studies have shown that juglone has strong contact and gastric toxic effects on the larvae of gypsy moth and cabbage armyworm. In addition, juglone has also been found to have toxic effects on various agricultural pests, such as brown planthopper, cauliflower butterfly\\u003csup\\u003e\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e\\u003c/sup\\u003e, nematode\\u003csup\\u003e\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e\\u003c/sup\\u003e, cotton aphid\\u003csup\\u003e\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u003c/sup\\u003e, etc. Although the insecticidal activity of juglone has been studied, its mechanism of action remains unknown.\\u003c/p\\u003e\\u003cp\\u003eIn recent years, induction of cell apoptosis has been considered as one of the effective mechanisms for controlling pests\\u003csup\\u003e\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e\\u003c/sup\\u003e. Apoptosis is a programmed cell death process regulated by a series of related genes. Apoptosis plays an important role in in-dividual development, resisting interference from various external factors, and maintaining normal tissue homeostasis. When multicellular organisms are affected by specific internal and external factors, they can lead to morphological changes and cell death\\u003csup\\u003e\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e\\u003c/sup\\u003e. Many insecticidal active substances can exert insecticidal effects by inducing insect cell apoptosis, such as matrine and harmine, both of which can induce apoptosis in Sf9 cells from the \\u003cem\\u003eSpodoptera frugiperda\\u003c/em\\u003e (fall armyworm) species\\u003csup\\u003e\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e\\u003c/sup\\u003e, azadirachtin that can induce apoptosis in Sf9 cells from the \\u003cem\\u003eS. frugiperda\\u003c/em\\u003e and Sl-1 cells from the \\u003cem\\u003eSpodoptera litura\\u003c/em\\u003e\\u003csup\\u003e\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e\\u003c/sup\\u003e, camptothecin that can induce apoptosis in \\u003cem\\u003eSpodoptera exigua\\u003c/em\\u003e (beet armyworm) Spex II cells\\u003csup\\u003e\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u003c/sup\\u003e, etc. Juglone has been shown to induce tumor cell apoptosis and inhibit tumor cell proliferation through different mechanisms. For example, by stimulating the production of reactive oxygen species (ROS) in gastric cancer SGC-7901 cells and activating the caspase cascade reaction to induce apoptosis\\u003csup\\u003e\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u003c/sup\\u003e, by inducing apoptosis in liver cancer HepG2 cells through G2/M phase arrest and the p53 pathway, by inducing apoptosis in melanoma cells through ROS-p38 mediated cellular signaling pathway\\u003csup\\u003e\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e\\u003c/sup\\u003e, etc.\\u003c/p\\u003e\\u003cp\\u003eAs a naphthoquinone compound with insecticidal activity, the toxic effects of juglone on insect cells are still unclear. The Sf9 cell line was initially established from ovarian tissue of the \\u003cem\\u003eS. frugiperda\\u003c/em\\u003e, and is an excellent model for studying insecticide cytotoxicity and programmed cell death\\u003csup\\u003e\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e\\u003c/sup\\u003e. In this study the Sf9 cell line is used to investigate the growth inhibitory and apoptosis inducing effects of juglone on in-sect cells. This study elucidated the molecular mechanism of juglone toxicity, providing theoretical basis for studying the toxicology and mode of action of insecticides at the cellular level, and identifying candidate compounds for the eventual development of safe and efficient plant-based insecticides.\\u003c/p\\u003e\"},{\"header\":\"Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec2\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eExperimental materials\\u003c/h2\\u003e\\u003cp\\u003eJuglone (purity\\u0026thinsp;\\u0026ge;\\u0026thinsp;98%) was purchased from Shanghai Yuanye Biotechnology Co., Ltd. (Shanghai, China). Sf9 cells, culture medium and supplements were purchased from Wuhan Punosai Life Technology Co., Ltd. (Wuhan, China), and cultured in our laboratory. The Annexin V-PE/7-AAD cell apoptosis kit was purchased from BD Bio-sciences (San Jose, CA, USA); the DAPI (4\\u0026rsquo;,6-diamidino-2-phenylindole) staining solution, cell counting kit-8 (CCK-8), and cell cycle kit were all purchased from Shanghai Biyuntian Biotechnology Co., Ltd. (Shanghai, China); the total RNA extraction and reverse transcription kits were purchased from Shanghai Shenggong Bio-technology Co., Ltd. (Shanghai, China); SYBR Green Master Mix was purchased from Takara Bio Inc. (Shiga, Japan); the genomic DNA extraction kit was purchased from Tiangen Biochemical Technology Co., Ltd. (Beijing, China); the ROS detection kit and Rhodamine 123 (Rho-123) dye solution were both purchased from Nanjing Jiancheng Biotechnology Research Institute (Nanjing, China).\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eCell Thawing and Culture\\u003c/h2\\u003e\\u003cp\\u003eThe liquid nitrogen frozen Sf9 cells were rapidly thawed by incubating the vial with frozen cells in a water bath at 37℃ for 1\\u0026thinsp;~\\u0026thinsp;2 min with constant shaking. Then, a certain amount of Grace\\u0026rsquo;s insect culture medium containing 10% fetal bovine serum (FBS) was added dropwise, mixed well, and centrifuged at 1,000 rpm, 5 min. Subsequently, after discarding the supernatant, the cells were resuspended in complete Grace\\u0026rsquo;s medium, cultured in a 27℃ constant temperature incubator, and passaged every 3 days.\\u003c/p\\u003e\\u003c/div\\u003e\\n\\u003ch3\\u003eCell grouping and processing\\u003c/h3\\u003e\\n\\u003cp\\u003eLogarithmic growth phase Sf9 cells (1\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e cells /mL) were seeded in 96-well plates (100 \\u0026micro;L/well) and incubated for 24 h. Then, for cell morphology observation and cell viability analysis using the CCK-8 assay, juglone solution was added at final concentrations of 12.5, 25, 50 and 100 \\u0026micro;mol/L and incubated for 12, 24, and 48 h. Subsequently, for cell cycle and apoptosis assays, Sf9 cells with good growth state were seeded in 6-well plates (1\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e cells/well), incubated for 24 h, and then the cells were treated for 24 h with different concentrations of juglone (final concentration: 25, 50, 100 \\u0026micro;mol/L). The above treatments were concurrently set with cell control wells (treated with 0.1% dimethyl sulfoxide (DMSO) only), with 3 replicates for each treatment.\\u003c/p\\u003e\\n\\u003ch3\\u003eCell viability assay\\u003c/h3\\u003e\\n\\u003cp\\u003eCell viability was measured using the CCK-8 kit assay, and cells were treated with different concentrations of juglone for 12, 24, and 48 h, and concurrently, drug blank wells and cell control wells (0.1% DMSO) were set up. Subsequently, After washing wells were 3 times with phosphate-buffered saline (PBS), 100 \\u0026micro;L of fresh culture medium was replenished in each well, followed by adding 10 \\u0026micro;L of CCK-8 solution to each well, and the plates were incubated at 27℃ for 90 min in the dark. Finally, after measuring the absorbance value at 450 nm using a Microplate reader (BioTek, Winooski, VT, USA), the measured absorbance values were used to calculate cell viability.\\u003c/p\\u003e\\n\\u003ch3\\u003eObservation of Cell Morphology\\u003c/h3\\u003e\\n\\u003cp\\u003eAfter treating Sf9 cells with different concentrations of juglone for 12, 24, and 48 h, the cell growth status was observed and images were captured under an inverted microscope (Olympus Corporation, Tokyo, Japan).\\u003c/p\\u003e\\n\\u003ch3\\u003eDNA ladder analysis\\u003c/h3\\u003e\\n\\u003cp\\u003eGenomic DNA was extracted from Sf9 cells treated with different concentrations of juglone for 24 h, according to the instructions of DNA extraction kit. The integrity of the extracted DNA was assessed by 1% agarose gel electrophoresis.\\u003c/p\\u003e\\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eDAPI staining to detect apoptotic morphological changes in Sf9 cells\\u003c/h2\\u003e\\u003cp\\u003eThe apoptotic morphological changes in Sf9 cells treated with different concentrations of juglone for 24 h were observed using a DAPI staining kit. Briefly, after as-pirating the culture medium from each well of the 6-well plate, 1 mL of DAPI staining solution was added to each well and stained for 5 min, followed by 3 washes with PBS for 5 min each time. Eventually, cells were observed under a fluorescence microscope and images were captured.\\u003c/p\\u003e\\u003c/div\\u003e\\n\\u003ch3\\u003eDetection of cell apoptosis rate by flow cytometry\\u003c/h3\\u003e\\n\\u003cp\\u003eThe Annexin V-PE/7-AAD apoptosis detection kit was used to measure the cell apoptosis rate following the kit manufacturer\\u0026rsquo;s instructions. Briefly, Sf9 cells treated with different concentrations of juglone for 24 h were washed twice with pre cooled PBS buffer, fixed in 500 \\u0026micro;L of the binding solution, and stained by adding 5\\u0026micro;L of an Annexin V-PE and 7-AAD solution. After incubation at room temperature in the dark for 15 min, cells were subjected to flow cytometry analysis, and the results were analyzed using the Cell Quest software (BD Biosciences).\\u003c/p\\u003e\\n\\u003ch3\\u003eDetection of cell cycle by flow cytometry\\u003c/h3\\u003e\\n\\u003cp\\u003eAfter treatment with different concentrations of juglone for 24 h, Sf9 cells were collected and washed twice with pre-cooled PBS buffer, fixed overnight at 4℃ with pre-cooled 70% ethanol, washed with PBS, stained with propidium iodide (PI) by adding 0.5 mL of PI staining solution and incubating at 37℃ for 30 min. Finally, cells were subjected to flow cytometry analysis and the results were analyzed using the ModFit LT (for Mac) software (BD Biosciences).\\u003c/p\\u003e\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eCell reactive oxygen species detection\\u003c/h2\\u003e\\u003cp\\u003eThe intracellular ROS levels were detected using a dichlorofluorescin-diacetate (DCFH-DA) fluorescence probe. Briefly, after treating Sf9 cells with different concentrations of juglone for 24 h, 1 mL of DCFH-DA probe diluted with serum-free culture medium (final concentration of 10 \\u0026micro;M) was added, and cells were incubated at 27℃ for 25 min, washed twice with PBS, and ROS levels were detected using a fluorescence microscope.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eMitochondrial membrane potential (ΔψM) detection\\u003c/h2\\u003e\\u003cp\\u003eThe changes of mitochondrial membrane potential (ΔψM) were measured using Rho-123 staining solution. Briefly, after collecting cells treated with different concentrations of juglone for 24 h, and washing twice with PBS, Rho-123 staining solution (0.5 mg/mL) was added to each well, and the plate was incubated at 27℃ in the dark for 20 min. Eventually, the fluorescence intensity of the cells was detected under a fluorescence microscope.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eQuantitative Real-time Polymerase Chain Reaction (RT-qPCR)\\u003c/h2\\u003e\\u003cp\\u003eAfter treating Sf9 cells with different concentrations of juglone for 24 h, total RNA was extracted from cells using \\u003cem\\u003eTrizol\\u003c/em\\u003e reagent. After checking the quality and integrity of the RNA, the PrimescriptTM RT kit (Takara Bio) was used to synthesize cDNA. Then, the obtained cDNA was used to measure the expression of apoptosis related gene transcription levels with the SYBR Green Master Mix qPCR quantitative kit (Takara Bio). All the above procedures were performed according to the instructions provided by the manufacturer of the kit. The primer sequences were designed using Primer 5.0 software (Premier Biosoft International, Palo Alto, CA, USA) and are listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as the internal reference gene. The RT-qPCR reaction conditions were as follows: 95℃ for 3 min, 95℃ for 30 s, 60℃ for 30 s, 40 cycles, each reaction was repeated 3 times, and the relative gene expression level was calculated using the 2\\u0026mdash;\\u003csup\\u003e△△Ct\\u003c/sup\\u003e method\\u003csup\\u003e\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eRT-RCR Primer Sequences.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"2\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eGene name\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003ePrimer sequence\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eApaf-1-RT-F\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCCGCAGTATTTCGGCTCG\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eApaf-1-RT-R\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eGCATCGGATTATTGTTCTTCAT\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCaspase-3-RT-F\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCAGTTCTTCGCAACCCAA\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCaspase-3-RT-R\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eGTCGCTGTCTACATTCGTG\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCaspase-9-RT-F\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eACCAGCACCCGCTACAGA\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCaspase-9-RT-R\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCGAACACCTCGCACAAT\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCytochrome C-RT-F\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eCTGGAATTTCATCTATTTTAGG\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCytochrome C-RT-R\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eGATGTATTTAGATTTCGATCAGT\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eGAPDH-RT-F\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eGGTATGGCTTTCCGTGTT\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eGAPDH-RT-R\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eGACCTGTTCCTCGGTGTAG\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eData statistical analysis\\u003c/h2\\u003e\\u003cp\\u003eThe SPSS 20.0 software (IBM Corporation, Armonk, NY, USA) was used to calculate the mean and standard deviation, and one-way analysis of variance (ANOVA) was used to calculate the differences among the groups. Then, Tukey\\u0026rsquo;s multiple com-parison test was performed, with P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 indicated statistical significance.\\u003c/p\\u003e\\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eThe effect of juglone on the viability of Sf9 cells\\u003c/h2\\u003e\\u003cp\\u003eThe results of the cell viability CCK-8 assay on Sf9 cells treated with different concentrations of juglone for 12, 24, and 48 h, revealed, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e, that when Sf9 cells are exposed to the same concentration of juglone, the cell viability de-creases with treatment time, and with the increase of juglone concentration. The half maximal inhibitory concentration (IC\\u003csub\\u003e50\\u003c/sub\\u003e) values after treatment with different concentrations of juglone, listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e. Together, these results indicate that juglone has dose and time dependent toxicity against Sf9 cells.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eInhibition rates and IC\\u003csub\\u003e50\\u003c/sub\\u003e values of juglone on Sf9 cells at different concentrations and action times\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"7\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eConcentration(\\u0026micro;M)\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e12h\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e4h\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e48h\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003esurvival rate(%)\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eIC\\u003csub\\u003e50\\u003c/sub\\u003e(\\u0026micro;M)\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003esurvival rate(%)\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003eIC\\u003csub\\u003e50\\u003c/sub\\u003e(\\u0026micro;M)\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003esurvival rate(%)\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003eIC\\u003csub\\u003e50\\u003c/sub\\u003e(\\u0026micro;M)\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e12.5\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e1.425\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.081\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e1.232\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.052\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e0.821\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.028\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e25\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e1.008\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.048\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e84.86\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0.843\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.036\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e57.12\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e0.689\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.082\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e35.97\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e50\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e0.794\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.015\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0.602\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.062\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e0.338\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.028\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e100\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e0.328\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.043\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0.247\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.032\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e0.175\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.011\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eEffect of juglone on apoptosis in Sf9 cells\\u003c/h2\\u003e\\u003cp\\u003eThe observation of the morphological changes in Sf9 cells treated with different concentrations of juglone for 12, 24, and 48 h, under an inverted microscope, revealed, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, that the cells in the control group were circular or elliptical in shape, with good adhesion ability, and the morphological changes of cells treated with 12.5 \\u0026micro;mol/L were not significant. Cells from other treatment groups showed typical apoptotic features, such as cell membrane blebs and apoptotic bodies with the extension of treatment time and the increase of drug concentration. These results showed the time-dependent and dose-dependent effects of juglone, indicating that juglone has a significant impact on the morphology of Sf9 cells and can induce cell apoptosis.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eDAPI staining is widely used for cell apoptosis detection and measurement\\u003csup\\u003e\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e\\u003c/sup\\u003e, and its blue fluorescence intensity is proportional to the degree of nuclear apoptotic morphological changes. As shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea, compared to the control group, as the juglone concentration of the treatment group increased, the blue fluorescence intensity gradually increased, indicating an increase in the fragmentation of the nucleus into apoptotic bodies of varying sizes, showing a dose-dependent effect. These findings indicate that juglone can induce apoptosis in Sf9 cells.\\u003c/p\\u003e\\u003cp\\u003eThe formation of a series of characteristic DNA fragments appearing as a DNA ladder-like pattern of bands produced by DNA cleavage at DNA nucleosomes is an important feature of cell apoptosis. Agarose gel electrophoresis analysis of genomic DNA from Sf9 cells exposed to different concentrations of juglone for 24 h, revealed, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eb, that the genomic DNA from cells of the control group and the 25 \\u0026micro;mol/L treatment group appeared as a single band at the top of the lane, while the genomic DNA from cells treated with juglone at the concentrations of 50 and 100 \\u0026micro;mol/L formed the typical DNA ladder pattern of bands at intervals of about 200 bp. Also, as the treatment concentration increases, the DNA fragmentation be-comes more prominent, indicating that juglone induces cell DNA damage in a con-centration-dependent manner.\\u003c/p\\u003e\\u003cp\\u003eThe cell membrane blebs and DNA ladder like pattern of bands indicate that the inhibition of cell activity by juglone is due to cell apoptosis, therefore, the cell apoptosis rate was measured using flow cytometry. The flow cytometry analysis of Sf9 cells treated with different concentrations of juglone for 24 h revealed, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ec, that, compared with the percentage of late apoptotic cells (5.05%) in the control group, all cells in the in the 25, 50 and 100 \\u0026micro;mol/L juglone treatment groups showed higher rate of late apoptotic cells with rates of 7.21, 18.41 and 33.12%, respectively. Also, the proportion of latest stage apoptotic cells in the medium and high juglone con-centration treatment groups increased significantly, and the difference was statistically significant (P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05), while there was no significant difference in percentage of early apoptotic cells between the treatment group and the control group. These results further indicate that juglone can induce apoptosis in Sf9 cells in a dose-dependent manner.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eEffect of juglone on the cell cycle of Sf9 cells\\u003c/h2\\u003e\\u003cp\\u003eWe investigated whether the decrease in Sf9 cell viability was due to cell cycle arrest by determining cell cycle distribution in cells treated with different concentrations of juglone for 24 h. The results (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ec) showed that compared with the control group, the proportion of G1 phase cells in the treatment groups changed little or remained essentially unchanged, while the proportion of S phase cells decreased significantly with increasing juglone concentration, decreasing from 38.34% to 33.93, 26.4, and 12.41%, respectively. In addition, the proportion of G2/M phase cells in-creased significantly, increasing from 28.8% to 32.68, 42.57, and 55.74%. These findings indicate that juglone can induce the arrest of Sf9 cell cycle progression in the G2/M phase, thereby inhibiting cell proliferation.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eJuglone activates the mitochondrial apoptosis pathway\\u003c/h2\\u003e\\u003cp\\u003eConsidering that juglone can induce apoptosis of Sf9 cells, the production and accumulation of ROS in cells is one of the indicators of mitochondrial dysfunction, and excessive ROS production is an early event that triggers mitochondrial dysfunction\\u003csup\\u003e\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e\\u003c/sup\\u003e。To determine whether the juglone-induced apoptosis in Sf9 cells is related to ROS production, we measured ROS levels using the fluorescent dye DCFH-DA, which combines with ROS in cells to produce green fluorescence, and its fluorescence intensity is proportional to the amount of ROS generated. The results revealed, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ea, that with the increase of the juglone concentration, the fluorescence intensity in Sf9 cells was significantly enhanced, indicating that juglone can induce the production of ROS in Sf9 cells in a dose-dependent manner.\\u003c/p\\u003e\\u003cp\\u003eExcessive accumulation of ROS in cells can lead to oxidative stress, thereby dam-aging cell membranes and promoting mitochondrial damage\\u003csup\\u003e\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e\\u003c/sup\\u003e. ΔψM dysfunction is an important feature of early cell apoptosis. We detected the changes in ΔψM using the Rho-123 fluorescent dye, which can rely on the ΔψM of normal cells to enter the mitochondrial matrix and emit yellow-green fluorescence, and its fluorescence intensity is an indicator of ΔψM, After the treatment with juglone, as the con-centration in-creased, the fluorescence intensity gradually weakened, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eb. These results indicate that juglone can induce the loss of ΔψM in Sf9 cells, leading to the re-lease of Rho-23 from mitochondria, resulting in a decrease in fluorescence intensity in a juglone dose-dependent manner.\\u003c/p\\u003e\\u003cp\\u003eConsidering that the mitochondrial apoptosis pathway is regulated by a series of apoptosis-related genes\\u003csup\\u003e\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e\\u003c/sup\\u003e, we performed qRT-PCR analysis to detect changes in the transcription levels of the apoptosis-related genes cytochrome C, Apaf-1, caspase 3, and caspase 9, which are known to be involved in the mitochondrial pathway. The results in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ec reveal that as the concentration of juglone increases, the mRNA expression levels of these genes are significantly upregulated in a dose-dependent manner. These results further indicate that juglone activates the caspase-dependent apoptosis pathway at the transcriptional level.\\u003c/p\\u003e\\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eIn recent years, natural metabolites of plants have attracted considerable attention to combat pests. Although juglone is a natural naphthoquinone compound whose insecticidal activity has been confirmed by many studies, to date there has been no in-depth research on its insecticidal mechanism. Available research reports reveal that the cytochrome P450 system is involved in the detoxification pathway of insect resistance to juglone. Additionally, juglone can also reduce the activity of phenolic oxidase in the body of Pieris rapae and cotton bollworm larvae\\u003csup\\u003e\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u003c/sup\\u003e. Lv et al. used metabolomics approaches to study the toxicity mechanism of juglone in aphids, and found that through the change of metabolites it affects the growth and development of cot-ton aphid and causes toxicity. These resistance mechanisms are mainly measured in living insects, but the toxicity of juglone on insect cells and the mechanism of action at the molecular level have been poorly studied. In order to conduct an in-depth investigation of the insecticidal mechanism of juglone, this study investigated its effect on cell viability and induction of cell apoptosis in Sf9 cells from a Lepidoptera insect-\\u003cem\\u003eS. frugiperda\\u003c/em\\u003e, with the aim of elucidating the potential toxicological mechanism of juglone on insect cells. The results of this study, using the CCK-8 assay, showed that juglone inhibited the proliferation of Sf9 cells in a time- and dose-dependent manner, exerting significant cytotoxic effects on insect cells. Our results are consistent with the previously reported toxic effects of juglone on other cells, such as LS-174T cells\\u003csup\\u003e\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e, Hela cells\\u003csup\\u003e\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e\\u003c/sup\\u003e, MCF-7 cells\\u003csup\\u003e\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e\\u003c/sup\\u003e, etc.\\u003c/p\\u003e\\u003cp\\u003eCell proliferation is mediated through cell cycle progression. In order to further examne the molecular mechanism of cell proliferation inhibition, flow cytometry analysis was used to determine cell cycle distribution. The results showed that, com-pared with the control group, after 24 h of treatment the number of G2/M phase cells in the treatment group significantly increased, in a dose-dependent manner, from 28.8% to 32.68, 42.57, and 55.74%, respectively. These findings suggest that the G2/M phase is the point of action of juglone to inhibit Sf9 cell proliferation, indicating that the growth inhibition of Sf9 cells by juglone is mediated through cell cycle arrest leading to blocked division. This can provide reference information for in-depth research on the mechanism of action of juglone and the development of targeted drugs. Many cytotoxic agents or DNA damaging agents can block the cell cycle in G1, S, or G2/M phases and then induce cell apoptosis\\u003csup\\u003e\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e\\u003cp\\u003eThis study aimed to investigate whether these effects are related to cell apoptosis. Cell membrane blebs and apoptotic bodies were observed through cell morphology observations, and the detection of dose-dependent morphological changes confirmed that cells were undergoing apoptosis. This was further confirmed by qualitative analysis using DAPI staining and DNA fragmentation assays. In addition, we used flow cytometry with a double staining method to detect the ratio of apoptotic cells treated with different concentrations of juglone. The results showed that the proportion of cell apoptosis increased from 5.05% in the control group to 7.21, 18.41, and 33.12%, respectively. The above results indicate that juglone can induce apoptosis in Sf9 cells, thereby inhibiting the proliferation of insect cells. This finding is consistent with the research results of other studies showing that juglone can induce apoptosis in various human tumor cells, such as prostate cancer LNCaP cells\\u003csup\\u003e\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e\\u003c/sup\\u003e, leukemia HL-60 cells\\u003csup\\u003e\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e\\u003c/sup\\u003e, oral squamous cell carcinoma Tac8113 cells\\u003csup\\u003e\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e\\u003c/sup\\u003e, etc., and inhibit tumor cell proliferation.\\u003c/p\\u003e\\u003cp\\u003eNumerous studies have shown that mitochondria are closely related to cell apoptosis, and the mitochondrial apoptosis pathway is one of the endogenous path-ways of cell apoptosis. The activation of the mitochondrial apoptosis pathway in Sf9 cells has been confirmed and shown to be highly conserved, and can be activated by plant-derived compounds, such as azadirachtin\\u003csup\\u003e\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e\\u003c/sup\\u003e, camptothecin\\u003csup\\u003e\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e\\u003c/sup\\u003e, and cantharidin\\u003csup\\u003e\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e\\u003c/sup\\u003e. The disruption of the ΔψM is one of the earliest events occurring in the cascade reaction of cell apoptosis, once the ΔψM collapses, cell apoptosis is irreversible\\u003csup\\u003e\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e\\u003c/sup\\u003e. The excessive production of ROS can cause irreversible opening of mitochondrial mem-brane permeability transition pore (MPTP), and the loss of ΔψM and opening of the MPTP result in the release of cytochrome C into the cytoplasm, leading to the recruitment of caspase 9 by Apaf-1 to form a complex\\u003csup\\u003e\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e\\u003c/sup\\u003e. This activates the downstream apoptotic executive factor caspase 3 through the caspase 9 cascade reaction, leading to a series of chain reactions, ultimately inducing cell apoptosis\\u003csup\\u003e\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e\\u003c/sup\\u003e. In this study, treatment of Sf9 cells with juglone induced the production of ROS, the collapse of the ΔψM and a significant increase in mRNA levels of key apoptotic genes involved in the mitochondrial apoptosis pathway, which combined with the morpho-logical observations and apoptosis data, further demonstrate that juglone induces cell apoptosis by activating the caspase-dependent mitochondrial apoptosis pathway in Sf9 cells through excessive production of ROS. The results of this study also indicate that excessive production of ROS can induce DNA oxidative damage that in turn can cause cell cycle arrest and apoptosis, which is consistent with the results of Wang et al.\\u003csup\\u003e\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e\\u003c/sup\\u003e. As is well established, one of the mechanisms mediating the cytotoxic effects of juglone on cells is through its conversion into semi quinone free radicals in the body, which participate in the redox cycle and increase ROS levels, leading to cytotoxicity\\u003csup\\u003e\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e\\u003c/sup\\u003e. This is also consistent with the results of this study.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eIn summary, our study suggests that juglone has significant cytotoxic effects on Sf9 cells and induces cell apoptosis through a caspase-dependent mitochondrial pathway associated with increased ROS levels and cell cycle arrest caused by ΔψM loss. The results of this study provide a theoretical basis for the toxicity mechanism of juglone in insect cells, and lay a theoretical foundation for the further development of juglone as a plant-based insecticide.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003ch2\\u003eCompeting interests\\u003c/h2\\u003e\\u003cp\\u003eThe author declare no competing interests.\\u003c/p\\u003e\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\u003cp\\u003eL.L. conceived the project and designed the research, performed experiments and analyzed the data, completed the experiments and discussed the results and reviewed the manuscript.\\u003c/p\\u003e\\u003ch2\\u003eAcknowledgements\\u003c/h2\\u003e\\u003cp\\u003eThis work was supported by Jilin Province Science and Technology Development Plan Project, grant number YDZJ202201ZYTS686.\\u003c/p\\u003e\\u003ch2\\u003eData Availability\\u003c/h2\\u003e\\u003cp\\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eHongya, S. U. N., LI, Y. A. \\u0026amp; Jipeng Inhibitory effect of juglone on proliferation and invasion of human ovarian cancer SKOV3 and IOSE80 cells and its mechanism[J]. \\u003cem\\u003eClin. Pharmacol. Ther. China\\u003c/em\\u003e. \\u003cb\\u003e24\\u003c/b\\u003e (1), 32\\u0026ndash;37 (2019).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eWenjun, L. I. LIU Chengjing. Extraction and Antimicrobial Activity of Juglone from Pericarpium Juglandis[J]. \\u003cem\\u003eChem. Indus. For. Prod.\\u003c/em\\u003e \\u003cb\\u003e39\\u003c/b\\u003e (05), 95\\u0026ndash;100 (2019).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLIU, J. et al. Research Progress of Walnut Green Husk asa Botanical Pesticide[J]. \\u003cem\\u003eJ. Agricultural Catastrophology\\u003c/em\\u003e. \\u003cb\\u003e8\\u003c/b\\u003e (6), 12\\u0026ndash;14 (2018).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eWenyi Hu, W. D. Shumin Bai; Sitong Lv; Guang Chen. Phenoloxidase, an effective bioactivity target for botanical insecticide screening from green walnut husks[J]. \\u003cem\\u003eNat. Prod. Res.\\u003c/em\\u003e \\u003cb\\u003e32\\u003c/b\\u003e (23), 2848\\u0026ndash;2851 (2018).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eCha, D. J. Dong Soo Kim. Nematicidal Activities of Three Naphthoquinones against the Pine Wood Nematode, Bursaphelenchus xylophilus[J]. \\u003cem\\u003eMolecules\\u003c/em\\u003e \\u003cb\\u003e24\\u003c/b\\u003e (20), 3634 (2019).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSi-Tong Lv, W. X. D. \\u0026amp; Shu-Min, B. Guang Chen. Insecticidal effect of juglone and its disturbance analysis in metabolic profiles of Aphis gossypii glover using 1 HNMR-based metabonomics approach[J]. \\u003cem\\u003ePhytoparasitica\\u003c/em\\u003e \\u003cb\\u003e46\\u003c/b\\u003e, 521\\u0026ndash;531 (2018).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eHe Zhang, L. Z. \\u0026amp; Diao, X. Na Li; Chenglan Liu. Toxicity of the mycotoxin fumonisin B1 on the insect Sf9 cell line[J]. \\u003cem\\u003eToxicon\\u003c/em\\u003e \\u003cb\\u003e129\\u003c/b\\u003e, 20\\u0026ndash;27 (2017).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eWei, Z. H. A. N. G. et al. Pin1 inhibitor juglone induces apoptosis in human cervical cancer SiHa cells[J]. \\u003cem\\u003eChin. J. Pathophysiology\\u003c/em\\u003e. \\u003cb\\u003e31\\u003c/b\\u003e (3), 543\\u0026ndash;546 (2015).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eHuiqing He, X. Q., Fangyun, D. \\u0026amp; JingminYe Chunbao Xu; Hanhui Zhang; Zhanmei Liu; Xiaojing Lv; YuehuaWu; Xuhong Jiang; Xingan Cheng. Synthesis, characterization of two matrine derivatives and their cytotoxic effect on Sf9 cell of Spodoptera frugiperda Journa [J]. \\u003cem\\u003eSci. Rep.\\u003c/em\\u003e \\u003cb\\u003e10\\u003c/b\\u003e(1). (2020).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBenshui Shu, J. Z., Zhiyan \\u0026amp; Jiang \\u003cem\\u003eGaofeng Cui; Sethuraman Veeran; Guohua Zhong. Harmine induced apoptosis in Spodoptera frugiperda Sf9 cells by activatingthe endogenous apoptotic pathways and inhibiting DNA topoisomerase Iactivity[J]\\u003c/em\\u003e (Pesticide Biochemistry and Physiology, 2019).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBenshui Shu, W. W., Qingbo, H. \\u0026amp; Jingfei, H. Meiying Hu; Guohua Zhong. A comprehensive study on apoptosis induction by azadirachtin in Spodoptera frugiperda cultured cell line Sf9[J]. \\u003cem\\u003eArchiues Insect Biochem. Physiol.\\u003c/em\\u003e \\u003cb\\u003e89\\u003c/b\\u003e (3), 153\\u0026ndash;168 (2015).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eJingFei Huang, K. S., HaiYi, L. \\u0026amp; MeiYing, H. GuoHua Zhong. Antiproliferative effect of azadirachtin A on Spodoptera litura Sl-1 cell line through cell cycle arrest and apoptosis induced by up-regulation of p53[J]. \\u003cem\\u003ePestic. Biochem. Physiol.\\u003c/em\\u003e \\u003cb\\u003e99\\u003c/b\\u003e (1), 16\\u0026ndash;24 (2011).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZhang Lan, Z. Y. \\u0026amp; He, W. Ma Dejun; Jiang Hongyun. Effects of camptothecin and hydroxycamptothecin on insect cell lines Sf21 and IOZCAS-Spex-II[J]. \\u003cem\\u003ePest Manag. Sci.\\u003c/em\\u003e \\u003cb\\u003e68\\u003c/b\\u003e (4), 652\\u0026ndash;657 (2012).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eYuBin Ji, Z. Q., Xiang \\u0026amp; Zou Juglone-induced apoptosis in human gastric cancer SGC-7901cells via the mitochondrial pathway[J]. \\u003cem\\u003eExp. Toxicol. Pathol.\\u003c/em\\u003e \\u003cb\\u003e63\\u003c/b\\u003e (1), 69\\u0026ndash;78 (2011).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eWu Jinfeng, Z. H., Xu, Y. \\u0026amp; Zhang, J. Zhu Wei; Zhang Yi; Chen Liang; Hua Wei; Mao Ying. Juglone induces apoptosis of tumor stem-like cells through ROS-P38 pathway in glioblastoma[J]. \\u003cem\\u003eBMC Neurol.\\u003c/em\\u003e \\u003cb\\u003e17\\u003c/b\\u003e (1), 70 (2017).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eGuohua Zhong, G. C. \\u0026amp; Xin, Y. Ranran Sun;Jingjing Zhang. Insecticide cytotoxicology in China: Current status and challenges[J]. \\u003cem\\u003ePestic. Biochem. Physiol.\\u003c/em\\u003e \\u003cb\\u003e132\\u003c/b\\u003e (1), 3\\u0026ndash;12 (2016).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eRuttanaphan Torranis, S. G. Pengsook Anchulee,Pluempanupat Wanchai,Huditz HannahIsadora,Bullangpoti Vasakorn,Le Goff Ga\\u0026euml;lle, A Novel Insecticidal Molecule Extracted from Alpinia galanga with Potential to Control the Pest Insect Spodoptera frugiperda[J]. \\u003cem\\u003eInsects\\u003c/em\\u003e \\u003cb\\u003e11\\u003c/b\\u003e (10), 686 (2020).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLivak, K. J. \\u0026amp; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆CT method[J]. \\u003cem\\u003eMethods\\u003c/em\\u003e \\u003cb\\u003e25\\u003c/b\\u003e, 402\\u0026ndash;408 (2001).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eChetverikov, P. E. A study of emb ryonic devel-opment in eriophyoid mites Acariformes,Eriophyoidea with the use of the fluorochrome DAPI and confocal micros-copy[J]. \\u003cem\\u003eExp. Appl. Acarol\\u003c/em\\u003e. \\u003cb\\u003e68\\u003c/b\\u003e (1), 97\\u0026ndash;111 (2016).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eYagi, K. \\u0026amp; Osipowski, P. M. Molecular cyto-genetic analysis of cucumis wild species distributed in south-ern africa:physical mapping of 5Sand 45SrDNA with DAPI[J]. \\u003cem\\u003eCytogenet. Genome Res.\\u003c/em\\u003e \\u003cb\\u003e146\\u003c/b\\u003e (1), 80\\u0026ndash;87 (2015).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSeong, S. \\u0026amp; Choi, G. R. E. A pesticide, fludioxonil, induced mitochondrial toxicity by increasing reactive oxygen species production and decreasing mitochondrial membrane potential in cardiomyocytes[J]. \\u003cem\\u003eToxicol. Lett.\\u003c/em\\u003e \\u003cb\\u003e384\\u003c/b\\u003e (1), 221 (2023).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eTianfeng Yang, R. X. \\u0026amp; Qi, S. Hongying Wang; Feng Liu; Bingling Dai; Bo Wang; Yanmin Zhang. Chelerythrine hydrochloride inhibits proliferation and induces mitochondrial apoptosis in cervical cancer cells via PI3K/BAD signaling pathway[J]. \\u003cem\\u003eToxicol. In Vitro\\u003c/em\\u003e. \\u003cb\\u003e68\\u003c/b\\u003e (1), 104965 (2020).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eYiou Pan, C. Z., Hongfei \\u0026amp; Xu \\u003cem\\u003eYongqiang Wu; Xiwu Gao; Jinghui Xi; Qingli Shang. Contribution of cytochrome P450 monooxygenase CYP380C6 to spirotetramat resistance in Aphis gossypii glover[J]\\u003c/em\\u003e (Pesticide Biochemistry and Physiology, 2018).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLi, Q. \\u0026amp; Juan, X. L. Z. Anti-proliferative and apoptosis-inducing activities of juglone in LS-174T cells[J]. \\u003cem\\u003eBangladesh J. Pharmacol.\\u003c/em\\u003e \\u003cb\\u003e8\\u003c/b\\u003e (1), 65\\u0026ndash;72 (2013). Sun; Shou-Gang Jiang; Xian-Feng Gong.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZhai Lu, H. C. Xiao-Mei Zheng; Man-Ling Chen. Experimental study on the apoptosis of cervical cancer Hela cells induced by juglone through c-JunN-terminal kinase/c-Jun pathway[J]. \\u003cem\\u003eAsian Pac. J. Trop. Med.\\u003c/em\\u003e \\u003cb\\u003e10\\u003c/b\\u003e (6), 641\\u0026ndash;644 (2017).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eJi, Y. B., Qu, G. S. X. Z. Y. \\u0026amp; Zou, X. M. Yu. Mechanism of juglone-induced apoptosis of MCF-7 cells by the mitochondrial pathway[J]. \\u003cem\\u003eGenet. Mol. Res.\\u003c/em\\u003e \\u003cb\\u003e15\\u003c/b\\u003e (3), 1\\u0026ndash;4 (2016).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZhi-Jun Zhang, J. J. Z. \\u0026amp; Zhi-Yan, J. Guo-Hua Zhong. Design, Synthesis and Bioactivity Evaluation of Novel β-carboline 1,3,4-oxadiazole Derivatives[J]. \\u003cem\\u003eMolecules\\u003c/em\\u003e \\u003cb\\u003e22\\u003c/b\\u003e (11), 1811 (2017).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eHuali Xu, X. Y. \\u0026amp; Shaochun, Q. Dayun Sui. Juglone, isolated from Juglans mandshurica Maxim, induces apoptosis via down-regulation of AR expression in human prostate cancer LNCaP cells[J]. \\u003cem\\u003eBioorg. Med. Chem. Lett.\\u003c/em\\u003e \\u003cb\\u003e23\\u003c/b\\u003e (1), 3631\\u0026ndash;3634 (2013).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eShao-Chun, H. L. X. X. F. Y. Anti-proliferative effect of Juglone from Juglans mandshurica Maxim on human leukemia cell HL-60 by inducing apoptosis through the mitochondria-dependent pathway[J]. \\u003cem\\u003eEur. J. Pharmacol.\\u003c/em\\u003e \\u003cb\\u003e645\\u003c/b\\u003e (1), 14\\u0026ndash;22 (2010). Qu; Rui Zhang; Xiang-Ru Qu; Yan-Ping Chen; Xing-Yuan Ma; Da-Yuan Sui.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKun, L. I. Z. H.; DONG Suge; et al. Effect and Mechanism of Walnut Quinone on Proliferation and Apoptosis of Oral Squamous Cell Carcinoma Tac8113 Cells[J]. Chinese archives of traditional Chinese medicine 2022, \\u003cb\\u003e4\\u003c/b\\u003e(40), 107\\u0026ndash;110 .\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eJingfei Huang, C. L. \\u0026amp; Meiying, H. Guohua Zhong. The Mitochondria-Mediate Apoptosis of Lepidopteran cells induced by Azadirachtin[J]. \\u003cem\\u003ePLoS One\\u003c/em\\u003e. \\u003cb\\u003e8\\u003c/b\\u003e (3), 58499 (2013).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBenshui Shu, J. Z. \\u0026amp; Veeran, S. Gaofeng Cui; Xin Yi; Guohua Zhong. Transcriptome analysis of Spodoptera frugiperda Sf9 cells reveals putative apoptosis-related genes and a preliminary apoptosis mechanism induced by azadirachtin[J]. \\u003cem\\u003eSci. Rep.\\u003c/em\\u003e \\u003cb\\u003e7\\u003c/b\\u003e (1), 13231 (2017).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eGaofeng Cui, Y. L. \\u0026amp; Kai, D. Shaodong Hao; Jinzhong Wang; Zhiyong Zhang. Attribution of Bax and mitochondrial permeability transition pore on cantharidin-induced apoptosis of Sf9 cells[J]. \\u003cem\\u003ePestic. Biochem. Physiol.\\u003c/em\\u003e \\u003cb\\u003e142\\u003c/b\\u003e (1), 91\\u0026ndash;101 (2017).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLy, J. D. \\u0026amp; Lawen, G. D. R. The mitochondrial membrane potential (deltapsi(m)) in apoptosis: an update[J]. \\u003cem\\u003eApoptosis\\u003c/em\\u003e \\u003cb\\u003e8\\u003c/b\\u003e (1), 115\\u0026ndash;128 (2003).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eOuyang, L. et al. Programmed cell death pathways in cancer: a review of apoptosis, autophagy and programmed necrosis[J]. \\u003cem\\u003eCell Prolif.\\u003c/em\\u003e \\u003cb\\u003e45\\u003c/b\\u003e (6), 487\\u0026ndash;498 (2012).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eChen, M. G. A. D. et al. Caspase-9-induced mitochondrial disruption through cleavage of anti-apoptotic BCL-2 family members[J]. \\u003cem\\u003eJoumal Biol. Chem.\\u003c/em\\u003e \\u003cb\\u003e282\\u003c/b\\u003e (46), 33888\\u0026ndash;33895 (2007).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eYu, F. W. \\u0026amp; Kiejda, C. C. J. Apoptosis Induction in Human Melanoma Cells by Inhibition of MEK Is Caspase-Independent and Mediated by the Bcl-2 Family Members PUMA, Bim, and Mcl-1[J]. \\u003cem\\u003eClin. Cancer Res.\\u003c/em\\u003e \\u003cb\\u003e13\\u003c/b\\u003e (16), 4934\\u0026ndash;4942 (2007).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eXin-quan, Y. L., Shi \\u0026amp; Zhong Hu Zhang; Xiang-yun Wang; Pei-pei Qi; Hao Xu. Oxidative injury is involved in fipronil-induced G2/M phase arrest and apoptosis in Spodoptera frugiperda (Sf9) cell line [J]. Pesticide Biochemistry and Physiology 105(2), 122\\u0026ndash;130. (2013).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003ePiskorski, R. \\u0026amp; D., S. How the oligophage codling moth Cydia pomonella survives on walnut despite its secondary metabolite juglone[J]. \\u003cem\\u003eJ. Insect. Physiol.\\u003c/em\\u003e \\u003cb\\u003e57\\u003c/b\\u003e (6), 744\\u0026ndash;750 (2011).\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Juglone, Sf9 cells, Reactive oxygen species, Apoptosis\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-7414469/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-7414469/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"Juglone is a naphthoquinone compound that has been shown to have insecticidal activity, but its mechanism of action remains to be fully elucidated. The results of this study indicate that juglone inhibits Sf9 cell proliferation in a time- and concentration-dependent manner. Typical apoptotic features, such as cell membrane blebs and apoptotic bodies were observed by microscopy and DAPI staining. Additionally, a series of DNA fragments appearing as a ladder-like pattern of bands at intervals of about 200 bp, a hallmark of apoptosis, were detected by the DNA fragmentation assay. Flow cytometry analysis revealed that juglone induced G2/M phase arrest of Sf9 cells, as indicated by significant increase in the proportion of G2/M phase cells from 28.8 to 55.74%, and the proportion of apoptotic cells from 5.05 to 33.12% compared to control cells, implying that juglone can induce apoptosis in Sf9 cells. In addition, intracellular biochemical assays confirmed that in Sf9 cells juglone also significantly induced the loss of mitochondrial membrane potential, the production of reactive oxygen species (ROS) and the mRNA expression levels of key apoptotic genes (Apaf-1, Caspase-3, Caspase-9, Cytochrome C) in the mitochondrial apoptosis pathway. Thus, it was confirmed that, in Sf9 cells, juglone induces cell apoptosis by activating the caspase-dependent mitochondrial apoptosis pathway through excessive production of ROS. The findings of this study provide a new perspective for studying the toxicology and mode of action of juglone at the cellular level.\",\"manuscriptTitle\":\"Juglone induces apoptosis in Sf9 cells through reactive oxygen species-mediated caspase-dependent mitochondrial pathway\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-10-03 10:21:55\",\"doi\":\"10.21203/rs.3.rs-7414469/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"b60a6449-351d-460f-bdfc-1a8819ec49f2\",\"owner\":[],\"postedDate\":\"October 3rd, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":55669082,\"name\":\"Biological sciences/Biochemistry\"},{\"id\":55669083,\"name\":\"Biological sciences/Cell biology\"},{\"id\":55669084,\"name\":\"Biological sciences/Molecular biology\"}],\"tags\":[],\"updatedAt\":\"2026-03-24T04:10:19+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-10-03 10:21:55\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-7414469\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-7414469\",\"identity\":\"rs-7414469\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}