{"paper_id":"02aed2e4-69f3-4d54-86d4-0e8e59ee3911","body_text":"Phosphorylation of Kibra by RSK regulates binding to Cdk4 to control cell cycle progression and organ growth independently of the Hippo-pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Letter Phosphorylation of Kibra by RSK regulates binding to Cdk4 to control cell cycle progression and organ growth independently of the Hippo-pathway Michael Krahn, Lennart Wellenberg, Jana John, Vanessa Maximowitsch, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3293493/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted You are reading this latest preprint version Abstract The conserved adapter protein KIBRA (Kidney and Brain) has been described as an upstream regulator of the Hippo signaling cascade, which controls cell proliferation, apoptosis, differentiation and organ growth. Components of this pathway, including KIBRA, are often downregulated or mutated in various types of cancer. KIBRA is phosphorylated at a conserved threonine residue by Ribosomal S6 kinase (RSK), but the function of this phosphorylation in vivo is still unclear. In this study we show that overexpression of Kibra in Drosophila eyes and wings decreases organ growth and that this effect is strongly enhanced upon mutation of the RSK-phosphorylation site in Kibra. Notably, the reduced cell proliferation that leads to impaired organ growth does not depend on the activity of Yorkie as the downstream effector of the Hippo signaling cascade. Instead, Kibra phosphorylation by RSK enables binding to 14-3-3 proteins, which displace Cyclin-dependent kinase 4 (Cdk4) from Kibra, resulting in cell cycle progression. Consequently, overexpression or knockin of a non-phosphorylatable Kibra variant blocks release of Cdk4 from Kibra, retaining cells in G1 phase, which leads to a decreased cell proliferation and thus inhibition of organ and organism growth. Our results elucidate a novel, Hippo pathway-independent function of Kibra in cell cycle regulation and control of organ growth. Biological sciences/Cell biology/Cell division/Checkpoints Biological sciences/Developmental biology/Experimental organisms/Model invertebrates/Drosophila Kibra Cdk4 14-3-3 Hippo signaling YAP cell cycle cell proliferation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 INTRODUCTION The highly conserved protein KIBRA (KIdney BRAin, homologues in humans are WW and C2-domain containing 1–3, WWC1-3) was first discovered as a memory performance and cognition-associated protein 1 , 2 . KIBRA is a cytoplasmic adapter protein, containing two WW-domains, which facilitate protein-protein interactions, as well as several coiled-coil domains and a C2 domain (Fig. 1 A). In the past years several studies demonstrated that in Drosophila and mammals, KIBRA plays an important role as an upstream regulator of the Hippo signaling cascade and therefore has a direct impact on cell proliferation and apoptosis 3 – 7 . Mechanistically, KIBRA forms a complex with Merlin/NF2 to activate Salvador/Hippo (Mst in mammals) 8 . Apart from this upstream regulation, KIBRA can also function as a scaffold to activate Large tumor suppressor (Lats), the kinase which directly phosphorylates YAP (Yorkie, Yki in Drosophila ), the downstream effector of the Hippo signaling pathway 6 . Phosphorylated YAP is excluded from the nucleus and either retained in the cytoplasm or degraded. Dephosphorylated YAP enters the nucleus and functions as a co-activator to enhance transcription of pro-proliferative and anti-apoptotic genes such as cyclin E and Drosophila inhibitor of apoptosis 1 (Diap) 9 , 10 . Apart from its role in cell proliferation control, KIBRA regulates apical-basal cell polarity by restricting the apical plasma membrane domain by inhibiting atypical kinase C (aPKC), resulting in decreased exocytosis 11 . Moreover, KIBRA/aPKC control cell migration by regulating Paxillin activation in focal adhesions 12 . Of note, KIBRA itself is phosphorylated by aPKC at two conserved serines (Fig. 1 A) 13 . Albeit not strictly localized to cell-cell contacts, KIBRA has been found to associate with the Tight Junction (TJ)-associated Crumbs complex 14 . Yang et al. recently described a phosphorylation of KIBRA by ERK and Ribosomal S6 kinase (RSK) at several residues 15 . Impaired phosphorylation of threonine 929 (T929) of human KIBRA by RSK inhibits cell proliferation and cell migration in cultured breast cancer cells. However, the underlying mechanism and the function of this RSK-mediated phosphorylation in vivo are not yet fully understood. To address these questions, we used Drosophila melanogaster as model system. Overexpression of Kibra results in decreased organ size in wings or eyes 16 and this study . We used this system as well as CRISPR/Cas9-mediated knockins to analyze the function of KIBRA T971 phosphorylation (the threonine residue corresponding to T929 in human KIBRA, Fig. 1 A) and found that organ growth inhibition upon Kibra overexpression is not due to increased Hippo signaling. Instead, Kibra binds to the adapter protein 14-3-3 and Cyclin dependent kinase 4 (Cdk4), thereby directly regulating cell cycle progression. Phosphorylation of KIBRA leads to increased 14-3-3 binding, displacing Cdk4 from KIBRA. Non-phosphorylatable KIBRA (T971A) retains Cdk4 association, which results in a prolonged G1 phase, reduced cell proliferation and decreased organ size. RESULTS Phosphorylation of Kibra at T971 regulates organ size in Drosophila Overexpression of Kibra in the developing eye of Drosophila (using the UAS/GAL4-system with eyeless::GAL4, ey::GAL4) or in the posterior compartment of the wing (using engrailed::GAL4, en::GAL4) led to a decrease of organ size Fig. 1 B-E and 16 . Notably, mutation of threonine 971 to alanine (T971A), resulting in a non-phosphorylatable version of Kibra, strongly enhanced this phenotype (Fig. 1 B-E), whereas overexpression of Kibra T971D, mimicking a constitutive phosphorylation, resulted in a slightly but not significantly weaker organ size reduction compared to overexpression of wild type Kibra (Fig. 1 B-E). By contrast, mutation of two conserved prolines within the WW-domains of Kibra, disrupting the binding capacity of these domains abolished the ability of Kibra to reduce organ size (Fig. 1 B-E), indicating that a protein-protein interaction mediated by the WW domains might be essential for this phenotype. Phosphorylation of Kibra at T971 is not essential for viability but regulates cell proliferation and Drosophila body size under endogenous conditions As overexpression of Kibra might lead to artificial activation of signaling pathways regulating cell proliferation and organ growth, we next tested whether Kibra T971 phosphorylation is essential under endogenous expression conditions, too. For this, we used CRISPR/Cas9 to establish a knockin of either wild-type T971, T917A or T971D Kibra proteins. Surprisingly, all fly lines expressing the different phosphorylation variants displayed similar survival rates (Fig. 2 A). However, analysis of body size revealed that animals carrying two phosphorylation-deficient kibra alleles are significantly smaller compared to wild type or T971D animals (Fig. 2 B). Next, we tested, whether this effect is cell-autonomous by inducing clones mutant for kibra -variants in an otherwise wild type tissue by using mosaic analysis with a repressible cell marker (MARCM). Indeed, clones of kibra T971A are significantly smaller compared to those cells expressing wild type Kibra or Kibra T971D (Fig. 2 C-F), indicating a decreased cell proliferation in cells lacking Kibra T971 phosphorylation. Organ size regulation by Kibra does not depend on Hippo signaling Kibra is a well described upstream regulator of the Hippo signaling cascade first by forming a scaffolding platform for Salvador/Hippo together with Merlin/Expanded and second (at least in mammals) by increasing the phosphorylation and activation of Lats by binding through its WW-domains 6 , 16 . The observation that overexpression of Kibra results in decreased organ size in wings and eyes would be in line with increased Hippo pathway activation leading to decreased Yki activity and thus downregulation of Yki target genes. Following this line, phosphorylation-deficient Kibra should show a stronger downregulation of Yki/YAP target genes. Therefore, we first tested human KIBRA in a luciferase-based YAP-reporter assay 17 and found that expression of KIBRA induces a downregulation of YAP activity (as reported earlier), but not changes between wild type and phosphorylation-deficient KIBRA (KIBRA T929A) (Fig. 3 A). In order to further test our hypothesis in vivo , we generated flies overexpressing the T971A variant together with point mutations, which inactivate the WW-domains (P85A P132A = ∆WW). As expected, overexpression of Kibra∆WW T971A did not result in decreased organ size in eyes or wings but showed similar organ sizes as control flies or flies expressing Kibra∆WW alone (Fig. 3 B-C). Next, we directly assessed Yki targets in vivo by overexpression of GFP-Kibra in the posterior compartment of imaginal discs, which expressed β-Galactosidase under control of the expanded promoter (ex::lacZ) or the four-jointed promoter (fj::lacZ), which are both activated by Yki 18 – 20 . In addition, we stained for Cyclin E expression, which is also a downstream target of the Hippo pathway 18 . If a decreased Yki activation would be the reason for the decrease in organ size in Kibra overexpressing tissues, expression of ex::lacZ/fj::lacZ as well as Cyclin E should be decreased. Surprisingly, we found a clear upregulation of Cyclin E and if at all a minimal upregulation but no downregulation of ex::lacZ/fj::lacZ expression in the posterior compartment of the wing imaginal discs, where wild type Kibra or Kibra T971A was overexpressed (Fig. 3 D-G). Taken together, our data indicate that increased levels of KIBRA indeed enhance Hippo signaling, resulting in decreased YAP activation in cell culture. However, this effect cannot be observed in vivo , suggesting that the Kibra overexpression phenotype of reduced organ size is not the consequence of enhanced Hippo signaling leading to reduced Yki activation in vivo . Furthermore, phosphorylation of Kibra by RSK does not affect its function in Hippo-pathway regulation, arguing against an involvement of Hippo in the strongly enhanced organ size reduction upon overexpression of phosphorylation-deficient Kibra. Phosphorylation of Kibra regulates cell cycle progression As the known role of Kibra in Hippo pathway regulation did not explain the reduced organ growth observed upon its overexpression, we investigated cell cycle progression in imaginal discs overexpressing wild type KIBRA or phospho-deficient KIBRA. To discriminate distinct cell cycle phases, we used the FlyFUCCI system 21 : In brief, we analyzed imaginal discs constitutively expressing GFP, which was fused to an E2f1 degron and RFP, fused to Cyclin-B degron. Thus, cells in G1 express only GFP, whereas in S-phase, only RFP is expressed and G2-/M-phase cells retain both fluorochromes. Kibra and Kibra T971A were overexpressed in the posterior compartment of the wing imaginal discs (marked by expression of engrailed, Fig. 4 A). Cells in G1 were normalized to the total amount of cells (DAPI staining) and the quotient of posterior cells (engrailed positive and expressing Kibra wt/T971A) to anterior cells (no Kibra overexpression). As quantified in Fig. 4 B, overexpression of wild type Kibra enhances the number of cells in G1 by ca. twofold. Moreover, overexpression of phosphorylation-deficient Kibra resulted in a more than four-fold increase in cells in G1-phase. Kibra phosphorylation regulates binding to 14-3-3 and Cdk4 to control cell cycle progression In silico analysis of the phosphorylation motif revealed a conserved consensus motif for 14-3-3- proteins (R-S-X-T-X-P). 14-3-3 proteins are adapter proteins which bind to phosphorylated motifs, thereby facilitating e.g. protein degradation, displacement from the plasma membrane or blocking of protein-protein interactions 22 . Furthermore, in an earlier proteomic screen for KIBRA interaction partners, we identified 14-3-3 proteins as well as the Cyclin-dependent kinase 4 (Cdk4) to co-immunoprecipitate with KIBRA (data not shown). We verified that 14-3-3 and Cdk4 associate with KIBRA using co-immunoprecipitation from WWC1/2 deficient HEK293 cells expressing GFP-KIBRA variants (Fig. 4 A and Supplementary Fig. 1). Notably, KIBRA T929A displayed a strongly increased binding of Cdk4 compared to wild type KIBRA, whereas binding of 14-3-3 is decreased, suggesting that phosphorylation of KIBRA T929 affects the association with both proteins contrarily. As Cdk4 is a critical regulator of G1 phase length 23 , we hypothesized that binding of KIBRA to Cdk4 controls cell cycle progression and thus cell proliferation and organ size. Phosphorylation of KIBRA at T929 (T971 in Drosophila ) by RSK, induced by mitogen stimuli releases Cdk4 from KIBRA, resulting in cell cycle progression and increased proliferation. Impaired phosphorylation of KIBRA by expression of T929A/T971A decreases or delays the release of Cdk4, thus inhibiting cell cycle progression and proliferation. Indeed, in Drosophila , inhibition of RSK in KIBRA overexpressing wings, which results in impaired phosphorylation of KIBRA T971, led to a decreased organ size in comparison to downregulation of RSK alone or overexpression of wild type KIBRA alone (Supplementary Fig. 2). Finally, the overexpression phenotype of Drosophila KIBRA T971A can be diminished by simultaneous overexpression of Cdk4, while overexpression of Cdk4 alone had no effect on eye or wing size (Fig. 5 B-E). Moreover, overexpression of Cdk4 during embryogenesis could rescue the increased lethality of KIBRA T971A overexpression to large extent (Fig. 5 F). These data confirm that KIBRA regulates cell cycle progression and thus organ growth by binding Cdk4 and that phosphorylation of KIBRA at T971 by RSK regulates this interaction. DISCUSSION In this study, we describe that phosphorylation of KIBRA at a conserved threonine by RSK regulates the binding of KIBRA to Cdk4, thereby regulating G1 phase length and thus cell proliferation and organism/organ growth. Contrarily, phosphorylation of KIBRA increases binding to 14-3-3, suggesting that upon phosphorylation, 14-3-3 displaces Cdk4 from KIBRA (Fig. 6 ). Although KIBRA has been well described as an upstream regulator of the Hippo signaling cascade and its overexpression phenotype of reduced organ growth would fit with increased Hippo activity, the expression of Hippo target genes such as four jointed, expanded and cyclin E is not downregulated upon KIBRA overexpression. Instead, cyclin E accumulates in KIBRA-overexpressing cells, indicating a prolonged G1 phase. Thus, we demonstrated a new regulatory mechanism of KIBRA directly regulated the cell cycle, which is controlled by mitogen stimuli. Albeit this mechanism seems to be independent of the function of KIBRA in Hippo signaling, several key components of the Hippo cascade have been described to be regulated by mitogen-stimulated pathways, too: Ajuba proteins, which bind to and control the activation of Lats, are phosphorylated by MAPK 24 and MAP4K’s function in redundancy to Hippo/Mst kinases in activating Warts/Lats 25–27 . Moreover, the activity of Yki/YAP is regulated by PI3Kinase signaling 28 . Despite mitogen (extracellular) stimuli, cellular metabolism and energy supply has been emerged as a critical modulator of the Hippo-signaling cascade 29 . The Hippo pathway independent regulation of Kibra by RSK described in this study is a parallel pathway ensuring cell cycle control downstream of mitogen signals. Notably, knockin of phosphorylation-deficient KIBRA in flies results in reduced cell proliferation and a reduction in animal size, which resembles the phenotype of homozygous cdk4 knockout mice 30 and flies 31 . Cell cycle progression must be strictly regulated to ensure correct proliferation and growth arrest. The activation of Cyclin D by Cdk4/6 during G1 phase is a key checkpoint for cells designated for proliferation. Lack of mitogenic stimuli results in insufficient expression of Cyclin D, whereas anti-proliferative stimuli, e.g. by contact inhibition result in inactivation of Cdk4 by its binding to INK4 and p21/p27 proteins, thus blocking the Cdk4-Cyclin D interaction 32 . In addition to its direct role in cell cycle progression by phosphorylating and thereby inactivating pocket proteins, Cdk4 also phosphorylates the TGFβ-pathway effectors SMAD2/3, inhibiting their transcriptional activity, which results in a decreased expression of the Cdk inhibitor p15 33 . Beside Cyclin Ds, the known Cdk inhibitors and SMAD2/3 transcription factors, KIBRA is the first protein interacting with Cdk4, for which no direct implication in G1-phase regulation and cell cycle progression has been showed yet. Links between KIBRA and M-phase control have been established by the observation that KIBRA can be phosphorylated by the mitotic kinases Aurora-A/B ensuring correct progression through mitosis 34 . However, this phosphorylation seems to regulate binding of KIBRA to NF2/Merlin as well, thus mediating Hippo signaling-dependent and -independent functions of KIBRA. By contrast, phosphorylation of KIBRA by Cdk1 does not affect the function of KIBRA in regulating Hippo signaling Cdk1 but ensures cell cycle arrest in M-phase upon Taxol-induced spindle damage stress 35 . Vice versa, KIBRA regulates Aurora A activity resulting in correct alignment of chromosomes during M-phase 36 . Upon induction of DNA damage, KIBRA gets phosphorylated by ataxia telangiectasia mutated (ATM) kinase and regulates efficient double strand break repair, presumably by scaffolding Ku70/80 complex proteins to facilitate non-homologues-end-joining of double strand breaks 37 . Of note, deletion of WWC1 and WWC2 in hepatocytes in mice induces tissue overgrowth and tumorigenesis as well as increased activation of YAP target genes 38 . Moreover, WWC1/KIBRA is downregulated in breast cancer and B-cell acute lymphocytic leukemia and associated with poor prognosis, suggesting a critical role as tumor suppressor 39 , 40 . However, is still remains to clarify, whether the function of KIBRA as tumor suppressor is due to its implication in Hippo-signaling cascade or a direct consequence of its inhibitory role on Cdk4 regulating cell cycle progression – or both. Taken together, KIBRA functions in different molecular pathways regulating cell cycle progression and cell proliferation, which are partly independent of its known role in the Hippo signaling cascade. The regulation of KIBRA binding to Cdk4 by RSK and 14-3-3 described in this study seems to be another key mechanism of in these processes. MATERIALS AND METHODS Drosophila stocks and genetics Fly stocks were cultured on standard cornmeal agar food and maintained at 25°C. Knockins of kibra variants were established using CRISPR/Cas9 technique as described recently 41 . In short, a plasmid (pU6-Bbs-chiRNA) encoding the guide-RNAi (GTCAGTCACAAGTAAGTACT) targeting Cas9 to the sixth exon of kibra was injected into vasa::Cas9 transgenic flies (#51323 obtained from Bloomington stock center) together with a donor plasmid containing ca. 1kbp 5’ and 3’ homology arms and an eye-driven (3xP3 promoter) dsRed (pHD-dsRed) (Gratz et al., 2013). Point mutations (T971A and T971D) were introduced by site-directed mutagenesis. MARCM (mosaic analysis with a repressible cell marker) clones were produced by crossing kibra (wt, T971A or T971D) FRT82B flies with hsFlp, tub::GAL4, UAS::nGFP;;FRT82B, tubP::GAL80 (obtained from Bloomington stock center). GFP-marked kibra -variant-mutant clones in imaginal discs were induced by heat shock in first instar larvae. UASt::GFP-Kibra and UASt::Kibra trangenic flies were generated using Phi-C31-Integrase system 42 with attP40 and crossed with en::GAL4, ey::GAL4, fj::lacZ (fj 9 – 11 ), ex::lacZ, UAS::Cdk4 or Ubi::GFP-E2f1, Ubi::RFP-CycB.1 (FlyFUCCI) (all obtained from Bloomington stock center except of ex::lacZ (ex 697 , which was kindly provided by Georg Halder). Immunohistochemistry Imaginal discs of third instar lavae were dissected in PBS and fixed for 20 minutes in 4% PFA/PBS. Subsequently, discs were washed three times in PBS + 0.2% Triton X-100 and blocked with 1% BSA for 1h, incubated over night with primary antibodies in PBS + 0.2% Triton X-100 + 1% BSA, washed three times and incubated for 2h with secondary antibodies. After three washing steps and DAPI-staining, nephrocytes were mounted with Mowiol. Primary antibodies used were as follows: Rabbit anti Cyclin-E (1:500, Santa Cruz #sc-33748), goat anti GFP (1:500, #600-101-215, Rockland), mouse anti engrailed (1:10, 4D9, Developmental Studies Hybridoma Bank (DSHB)), mouse anti beta-Galactosidase (1:100, JIE7, DSHB). Secondary antibodies conjugated with Alexa 488, Alexa 568 and Alexa 647 (Life technologies) were used at 1:400. Images were taken on a Leica SP8 confocal microscope using lightning program and processed using ImageJ. Luciferase assays Luciferase assays for YAP activity were performed in HEK293 cells in 96-well plates, with six replicates per condition. Cells were grown in DMEM (4.5 g/L) and 7.5% FCS, but without antibiotics. 20,000 cells per well were seeded onto poly-l-lysine (PLL)-coated plates and transfected with 20 ng of the TEAD reporter 8xGTIIC-luciferase gift from Stefano Piccolo, Addgene plasmid # 34615, 17 , 20 ng of TK-Renilla (Promega) and 20 ng of pcDNA3.1 FLAG-YAP1 and GFP-hKIBRA, GFP-hKIBRA T929A or GFP-KIBRA ∆WW. 20 h after transfection, the medium was removed, and cells were lysed in 30 µl of Passive Lysis Buffer (Promega) and firefly and renilla luciferase activity was analyzed using a dual luciferase assay (Promega) in a Mithras LB 940 Multimode Microplate Reader (Berthold Technologies). Coimmunoprecipitation and Western blot analysis For coimmunoprecipitation, KIBRA/WWC1 + WWC2-deficient HEK293 cells stably expressing GFP-KIBRA variants were lysed in lysis buffer (150mM NaCl, 50mM TRIS-HCl pH 7.5, 1% Triton-X100), GFP-KIBRA was immunoprecipitated using GFP-trap (Chromotek) and beads were subjected to Western blot analysis. The following primary antibodies were used in Western blots: rabbit anti Cdk4 (1:1000, Cell Signaling #12790), mouse anti PKCζ (1:500, Santa Cruz #sc-393218), rabbit anti 14-3-3β/α (1:1000, Cell Signaling #9636), rabbit anti 14-3-3τ (1:1000, Cell Signaling #9638), rabbit anti 14-3-3η (1:1000, Cell Signaling #9640), rabbit anti 14-3-3ε (1:1000, Cell Signaling #9635), rabbit anti 14-3-3ᵧ (1:1000, Cell Signaling #5522), rabbit anti 14-3-3ζ/δ (1:1000, Cell Signaling #7413), mouse anti GFP (1:500, Santa Cruz #9996). Declarations Acknowledgements We thank the Bloomington Drosophila stock center at the University of Indiana (USA), Georg Halder and the Developmental Studies Hybridoma Bank at the University of Iowa (USA) for providing reagents. This work was supported by grants of the German research foundation (DFG, CRC1348-A05, KR3901/9-2), the IZKF Münster (Kr-A-031.21) and MedK PhD school to M. P. K. Author contributions LW, JJ, VM, MS and IF performed the Drosophila in vivo experiments except of FUCCI-analysis, which was done by KD and MK and analyzed by TZ. LW, FW and DOW conducted co-immunoprecipitation with HEK cells. MW contributes YAP-based luciferase reporter assays. HP, JK and MPK supervised the project. Conflict of interests The authors declare no conflicts of interests. Data availability All data are available in main and supplemental figures. References Papassotiropoulos A, Stephan DA, Huentelman MJ et al. Common Kibra alleles are associated with human memory performance. Science 2006; 314 :475-478. Kremerskothen J, Plaas C, Buther K et al. Characterization of KIBRA, a novel WW domain-containing protein. Biochemical and biophysical research communications 2003; 300 :862-867. Baumgartner R, Poernbacher I, Buser N, Hafen E, Stocker H. The WW domain protein Kibra acts upstream of Hippo in Drosophila. Developmental cell 2010; 18 :309-316. Genevet A, Wehr MC, Brain R, Thompson BJ, Tapon N. Kibra is a regulator of the Salvador/Warts/Hippo signaling network. Developmental cell 2010; 18 :300-308. Yu J, Zheng Y, Dong J, Klusza S, Deng WM, Pan D. Kibra functions as a tumor suppressor protein that regulates Hippo signaling in conjunction with Merlin and Expanded. Developmental cell 2010; 18 :288-299. Xiao L, Chen Y, Ji M, Dong J. KIBRA regulates Hippo signaling activity via interactions with large tumor suppressor kinases. The Journal of biological chemistry 2011; 286 :7788-7796. Moleirinho S, Chang N, Sims AH et al. KIBRA exhibits MST-independent functional regulation of the Hippo signaling pathway in mammals. Oncogene 2013; 32 :1821-1830. Su T, Ludwig MZ, Xu J, Fehon RG. Kibra and Merlin Activate the Hippo Pathway Spatially Distinct from and Independent of Expanded. Developmental cell 2017; 40 :478-490 e473. Yu FX, Zhao B, Guan KL. Hippo Pathway in Organ Size Control, Tissue Homeostasis, and Cancer. Cell 2015; 163 :811-828. Moya IM, Halder G. Hippo-YAP/TAZ signalling in organ regeneration and regenerative medicine. Nature reviews Molecular cell biology 2019; 20 :211-226. Yoshihama Y, Sasaki K, Horikoshi Y et al. KIBRA suppresses apical exocytosis through inhibition of aPKC kinase activity in epithelial cells. Current biology : CB 2011; 21 :705-711. Rosse C, Formstecher E, Boeckeler K et al. An aPKC-exocyst complex controls paxillin phosphorylation and migration through localised JNK1 activation. PLoS biology 2009; 7 :e1000235. Buther K, Plaas C, Barnekow A, Kremerskothen J. KIBRA is a novel substrate for protein kinase Czeta. Biochemical and biophysical research communications 2004; 317 :703-707. Duning K, Schurek EM, Schluter M et al. KIBRA modulates directional migration of podocytes. Journal of the American Society of Nephrology : JASN 2008; 19 :1891-1903. Yang S, Ji M, Zhang L et al. Phosphorylation of KIBRA by the extracellular signal-regulated kinase (ERK)-ribosomal S6 kinase (RSK) cascade modulates cell proliferation and migration. Cellular signalling 2014; 26 :343-351. Wennmann DO, Schmitz J, Wehr MC et al. Evolutionary and molecular facts link the WWC protein family to Hippo signaling. Molecular biology and evolution 2014; 31 :1710-1723. Dupont S, Morsut L, Aragona M et al. Role of YAP/TAZ in mechanotransduction. Nature 2011; 474 :179-183. Hamaratoglu F, Willecke M, Kango-Singh M et al. The tumour-suppressor genes NF2/Merlin and Expanded act through Hippo signalling to regulate cell proliferation and apoptosis. Nature cell biology 2006; 8 :27-36. Reddy BV, Rauskolb C, Irvine KD. Influence of fat-hippo and notch signaling on the proliferation and differentiation of Drosophila optic neuroepithelia. Development 2010; 137 :2397-2408. Cho E, Feng Y, Rauskolb C, Maitra S, Fehon R, Irvine KD. Delineation of a Fat tumor suppressor pathway. Nature genetics 2006; 38 :1142-1150. Zielke N, Korzelius J, van Straaten M et al. Fly-FUCCI: A versatile tool for studying cell proliferation in complex tissues. Cell reports 2014; 7 :588-598. Obsilova V, Obsil T. Structural insights into the functional roles of 14-3-3 proteins. Frontiers in molecular biosciences 2022; 9 :1016071. Dong P, Zhang C, Parker BT, You L, Mathey-Prevot B. Cyclin D/CDK4/6 activity controls G1 length in mammalian cells. PloS one 2018; 13 :e0185637. Reddy BV, Irvine KD. Regulation of Hippo signaling by EGFR-MAPK signaling through Ajuba family proteins. Developmental cell 2013; 24 :459-471. Li Q, Li S, Mana-Capelli S et al. The conserved misshapen-warts-Yorkie pathway acts in enteroblasts to regulate intestinal stem cells in Drosophila. Developmental cell 2014; 31 :291-304. Meng Z, Moroishi T, Mottier-Pavie V et al. MAP4K family kinases act in parallel to MST1/2 to activate LATS1/2 in the Hippo pathway. Nature communications 2015; 6 :8357. Zheng Y, Wang W, Liu B, Deng H, Uster E, Pan D. Identification of Happyhour/MAP4K as Alternative Hpo/Mst-like Kinases in the Hippo Kinase Cascade. Developmental cell 2015; 34 :642-655. Strassburger K, Tiebe M, Pinna F, Breuhahn K, Teleman AA. Insulin/IGF signaling drives cell proliferation in part via Yorkie/YAP. Developmental biology 2012; 367 :187-196. Ibar C, Irvine KD. Integration of Hippo-YAP Signaling with Metabolism. Developmental cell 2020; 54 :256-267. Rane SG, Dubus P, Mettus RV et al. Loss of Cdk4 expression causes insulin-deficient diabetes and Cdk4 activation results in beta-islet cell hyperplasia. Nature genetics 1999; 22 :44-52. Meyer CA, Jacobs HW, Datar SA, Du W, Edgar BA, Lehner CF. Drosophila Cdk4 is required for normal growth and is dispensable for cell cycle progression. The EMBO journal 2000; 19 :4533-4542. Malumbres M, Barbacid M. Cell cycle, CDKs and cancer: a changing paradigm. Nature reviews Cancer 2009; 9 :153-166. Matsuura I, Denissova NG, Wang G, He D, Long J, Liu F. Cyclin-dependent kinases regulate the antiproliferative function of Smads. Nature 2004; 430 :226-231. Xiao L, Chen Y, Ji M et al. KIBRA protein phosphorylation is regulated by mitotic kinase aurora and protein phosphatase 1. The Journal of biological chemistry 2011; 286 :36304-36315. Ji M, Yang S, Chen Y, Xiao L, Zhang L, Dong J. Phospho-regulation of KIBRA by CDK1 and CDC14 phosphatase controls cell-cycle progression. The Biochemical journal 2012; 447 :93-102. Zhang L, Iyer J, Chowdhury A et al. KIBRA regulates aurora kinase activity and is required for precise chromosome alignment during mitosis. The Journal of biological chemistry 2012; 287 :34069-34077. Mavuluri J, Beesetti S, Surabhi R, Kremerskothen J, Venkatraman G, Rayala SK. Phosphorylation-Dependent Regulation of the DNA Damage Response of Adaptor Protein KIBRA in Cancer Cells. Molecular and cellular biology 2016; 36 :1354-1365. Hermann A, Wennmann DO, Gromnitza S et al. WW and C2 domain-containing proteins regulate hepatic cell differentiation and tumorigenesis through the hippo signaling pathway. Hepatology 2018; 67 :1546-1559. Wang Z, Katsaros D, Biglia N et al. Low expression of WWC1, a tumor suppressor gene, is associated with aggressive breast cancer and poor survival outcome. FEBS open bio 2019; 9 :1270-1280. Hill VK, Dunwell TL, Catchpoole D et al. Frequent epigenetic inactivation of KIBRA, an upstream member of the Salvador/Warts/Hippo (SWH) tumor suppressor network, is associated with specific genetic event in B-cell acute lymphocytic leukemia. Epigenetics 2011; 6 :326-332. Borkowsky S, Gass M, Alavizargar A et al. Phosphorylation of LKB1 by PDK1 Inhibits Cell Proliferation and Organ Growth by Decreased Activation of AMPK. Cells 2023; 12 . Groth AC, Fish M, Nusse R, Calos MP. Construction of transgenic Drosophila by using the site-specific integrase from phage phiC31. Genetics 2004; 166 :1775-1782. Additional Declarations There is NO Competing Interest. Supplementary Files 20230821PAPERboxplot7.pdf Supplementary Figure 1. Kibra interacts with various 14-3-3 proteins Co-Immunoprecipitation of Flag-Kibra in transduced HEK293 cells. Co-immunoprecipitated 14-3-3 proteins were detected using immunoblotting. 20230821PAPERboxplot8.pdf Supplementary Figure 2. Kibra and RSK genetically interact A, B Comparison of wings expressing wild type Kibra and/or downregulating RSK using RNAi in the posterior compartment. The posterior wing compartment is surrounded with a red dashed line. Measurements were normalized against control. n ≥ 22. Scale bars are 0,4 mm. Error bars represent standard error of the means. For statistical analysis a one-way ANOVA with TUKEYS post-test was chosen. * Significant, p-value < 0.1; **** Extremely significant, p-value <0.0001. FigureS3.pdf Supplementary Figure 3. Uncropped and unedited Western blots Cite Share Download PDF Status: Under Review Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3293493\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Letter\",\"associatedPublications\":[],\"authors\":[{\"id\":234656041,\"identity\":\"563b0950-078e-43fe-942d-cfd8e80d671c\",\"order_by\":0,\"name\":\"Michael Krahn\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABLklEQVRIie3PMUvDQBTA8RcC18G7Zn3hRL/ChUJqsNCvYpe6CSJIhxICwk3RuQXRzyBCcIwc1CXgmlEQMlXQRSpY8aJBQa/ODvdf7gL34+UB2Gz/MKGA6GMLRF5fRvDx+RUaSPRJEIKkvhTfBFeRft6QTv3YkT8GmEh441Z3ixFCyFV1v3+m9tqwNsSnqzj2eO6UjwaiSDdIC4Ree9jtTDN1QIBl/rRQ6J/suNHERChBJjWhehDL1EBuPmScyRxFAYTT30Ro4i/f9I/R1jNnp5roKXwpY+zX5NVMOEv0+pTqKUlDHOmioJoY1heKhHx9hjRI6SGns92aXEbHUvmTwjmKUgO5VZU/H/c2RNHKOB1vD84TdlG+yNjzUve6XBjGNBnWBHCS1cBms9lsf/UOTLJZeaa2jDAAAAAASUVORK5CYII=\",\"orcid\":\"https://orcid.org/0000-0001-7718-9890\",\"institution\":\"University Hospital M\\u0026#x00FC\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Michael\",\"middleName\":\"\",\"lastName\":\"Krahn\",\"suffix\":\"\"},{\"id\":234656042,\"identity\":\"17a48f5c-03a8-4377-bc25-4a52904a2266\",\"order_by\":1,\"name\":\"Lennart Wellenberg\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University Hospital of Münster\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Lennart\",\"middleName\":\"\",\"lastName\":\"Wellenberg\",\"suffix\":\"\"},{\"id\":234656043,\"identity\":\"37c751af-554a-4ca3-99e7-36fbf1105377\",\"order_by\":2,\"name\":\"Jana John\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University Hospital Mü\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jana\",\"middleName\":\"\",\"lastName\":\"John\",\"suffix\":\"\"},{\"id\":234656044,\"identity\":\"bb8bb2f0-211e-4931-847e-6b7aa9e22fc4\",\"order_by\":3,\"name\":\"Vanessa Maximowitsch\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University Hospital Mü\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Vanessa\",\"middleName\":\"\",\"lastName\":\"Maximowitsch\",\"suffix\":\"\"},{\"id\":234656045,\"identity\":\"49c104f4-7825-4d95-b8ad-672e858a8e84\",\"order_by\":4,\"name\":\"Marion Stiewe\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University Hospital Mü\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Marion\",\"middleName\":\"\",\"lastName\":\"Stiewe\",\"suffix\":\"\"},{\"id\":234656046,\"identity\":\"84a5a9ba-51ca-4dc7-875e-a0a586113d4a\",\"order_by\":5,\"name\":\"Kira Dickmann\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University Hospital Mü\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Kira\",\"middleName\":\"\",\"lastName\":\"Dickmann\",\"suffix\":\"\"},{\"id\":234656047,\"identity\":\"2a255894-05f0-4aa9-88e2-5ad3e99fe9d0\",\"order_by\":6,\"name\":\"Marie-Viktoria Kalka\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University Hospital Mü\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Marie-Viktoria\",\"middleName\":\"\",\"lastName\":\"Kalka\",\"suffix\":\"\"},{\"id\":234656048,\"identity\":\"2823899c-18c5-4220-bb56-fd3f9b956a74\",\"order_by\":7,\"name\":\"Ina Fredrich\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University Hospital Mü\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ina\",\"middleName\":\"\",\"lastName\":\"Fredrich\",\"suffix\":\"\"},{\"id\":234656049,\"identity\":\"b99fa3c9-8991-4b19-b8e1-d96fa8ff8e6f\",\"order_by\":8,\"name\":\"Thomas Zobel\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Münster\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Thomas\",\"middleName\":\"\",\"lastName\":\"Zobel\",\"suffix\":\"\"},{\"id\":234656050,\"identity\":\"174ec1a3-d8cd-4e52-9c12-7c4eebe2a5d0\",\"order_by\":9,\"name\":\"Florian Westphal\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University Hospital Münster\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Florian\",\"middleName\":\"\",\"lastName\":\"Westphal\",\"suffix\":\"\"},{\"id\":234656051,\"identity\":\"0239b4e5-4126-44ff-a96f-573236f44e50\",\"order_by\":10,\"name\":\"Dirk Wennmann\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University Hospital Münster\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dirk\",\"middleName\":\"\",\"lastName\":\"Wennmann\",\"suffix\":\"\"},{\"id\":234656052,\"identity\":\"245053bd-c883-480c-91f7-939ea3680fa3\",\"order_by\":11,\"name\":\"Michael Wehr\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"LMU University Hospital München\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Michael\",\"middleName\":\"\",\"lastName\":\"Wehr\",\"suffix\":\"\"},{\"id\":234656053,\"identity\":\"664aad21-87fa-4668-899d-336df25a42f9\",\"order_by\":12,\"name\":\"Hermann Pavenstädt\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University Hospital Münster\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hermann\",\"middleName\":\"\",\"lastName\":\"Pavenstädt\",\"suffix\":\"\"},{\"id\":234656054,\"identity\":\"7626a5f5-1b71-4990-b10c-d331acb8ddb1\",\"order_by\":13,\"name\":\"Joachim Kremerskothen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University Hospital Münster\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Joachim\",\"middleName\":\"\",\"lastName\":\"Kremerskothen\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2023-08-24 17:45:37\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3293493/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3293493/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":44019073,\"identity\":\"e79b4db9-849d-4e2d-9fcc-22998044929a\",\"added_by\":\"auto\",\"created_at\":\"2023-10-03 12:47:20\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":463006,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eImpaired KIBRA T971 phosphorylation enhances organ size reduction phenotype.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA\\u003c/strong\\u003e Scheme of \\u003cem\\u003eDrosophila \\u003c/em\\u003eKIBRA and human WWC1 with key phosphorylation sites annotated. \\u003cstrong\\u003eB-E \\u003c/strong\\u003eOverexpression of KIBRA variants in the eye using ey::GAL4 or in the posterior compartment of the wing using en::GAL4. The posterior wing compartment is surrounded with a red dashed line. n ≥ 9 in \\u003cstrong\\u003eD\\u003c/strong\\u003e and n ≥ 17 in \\u003cstrong\\u003eE \\u003c/strong\\u003eScale bars are 0,2 mm in \\u003cstrong\\u003eB\\u003c/strong\\u003e and 0,4 mm in \\u003cstrong\\u003eC\\u003c/strong\\u003e. Error bars represent standard error of the means. For statistical analysis a one-way ANOVA with TUKEYS post-test was applied. n.s. not significant; *** Extremely significant, p-value \\u0026lt; 0.001; **** Extremely significant, p-value \\u0026lt;0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3293493/v1/19a488c8cf55881cb8e90ecb.jpg\"},{\"id\":44020539,\"identity\":\"c6d242f8-dfc8-4f62-b3ca-ac5a0b09fe7c\",\"added_by\":\"auto\",\"created_at\":\"2023-10-03 13:11:20\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":330523,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eKIBRA T971 phosphorylation regulates cell proliferation and organism size but not viability.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA\\u003c/strong\\u003e Survival rates of KIBRA wild type, T971A and T971D knockin flies reveal no significant changes in overall survival. N = 3, n = 100. \\u003cstrong\\u003eB\\u003c/strong\\u003e Body size of indicated KIBRA knockins. n = 20. \\u003cstrong\\u003eC-E\\u003c/strong\\u003e Immunostainings of imaginal disc cells using GFP-marked MARCM (mosaic analysis with a repressible cell marker) – clones. Mutant cells are labelled by the expression of GFP. \\u003cstrong\\u003eF\\u003c/strong\\u003e Quantification of clone size (cell number) of C-E. n ≥ 13. Scale bars are 50 µm. For statistical analysis a one-way ANOVA with TUKEYS post-test was applied. n.s. not significant; ** Very significant, p-value \\u0026lt;0.01; *** Extremely significant, p-value \\u0026lt; 0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3293493/v1/65444b3da8e490616378a3df.jpg\"},{\"id\":44019485,\"identity\":\"b871523a-82b0-4116-a442-2893b2c796f4\",\"added_by\":\"auto\",\"created_at\":\"2023-10-03 12:55:20\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":421870,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eOrgan size reduction upon KIBRA overexpression is not a result of decreased Yki activation.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA \\u003c/strong\\u003eLuciferase-based YAP activation reporter assays with expression of human KIBRA variants. N=6. \\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eB-C\\u003c/strong\\u003e Quantification of KIBRA\\u003csub\\u003e \\u003c/sub\\u003evariants overexpression in eyes (A, n ≥ 9) and the posterior compartment of the wing (B, n ≥ 17).\\u0026nbsp; Error bars represent standard error of the means. For statistical analysis a one-way ANOVA with TUKEYS post-test was applied. n.s. not significant; *** Extremely significant, p-value \\u0026lt; 0.001; **** Extremely significant, p-value \\u0026lt; 0.0001. \\u003cstrong\\u003eD-G\\u003c/strong\\u003e Immunostainings of wing imaginal discs expressing lacZ under control of the expanded promoter (ex::lacZ, C-D) or four jointed promoter (fj::lacZ, E-F) and UAS::GFP-KIBRA variants driven by engrailed::GAL4 (en::GAL4) . Discs were stained against GFP, lacZ and Cyclin E. Scale bars are 50 µm.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3293493/v1/f9fa493a9b2d1faabb751251.jpg\"},{\"id\":44019066,\"identity\":\"47bf4396-338d-4077-bdb6-5d9c3f93b08d\",\"added_by\":\"auto\",\"created_at\":\"2023-10-03 12:47:20\",\"extension\":\"jpg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":244784,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eOverexpression of phosphorylation-deficient Kibra results in prolonged G1-phase\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA\\u003c/strong\\u003e Wild type Kibra or Kibra T971A were overexpressed in the posterior compartment of imaginal discs expressing FlyFUCCI (GFP-E2f1-degron and RFP-Cyclin-B1-degron). Engrailed labels posterior compartment cells. Scale bars = 50µm. \\u003cstrong\\u003eB \\u003c/strong\\u003eQuantification of cells in G1 (expressing only GFP) as quotient posterior/anterior (normalized against cell number (calculated with DAPI). n=3.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3293493/v1/ebe1423dde342082581cea60.jpg\"},{\"id\":44019072,\"identity\":\"19da386a-21e6-403e-8bc0-b509a10e91ee\",\"added_by\":\"auto\",\"created_at\":\"2023-10-03 12:47:20\",\"extension\":\"jpg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":433538,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003ePhosphorylation of Kibra T971 regulates the interaction with Cdk4 to control organ size.\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA\\u003c/strong\\u003e Co-Immunoprecipitation of GFP-Kibra in transduced HEK293 ΔWWC1/2 knockout cells expressing the indicated transgenes. Co-immunoprecipitated proteins were detected using immunoblotting. n=3. \\u003cstrong\\u003eB-E \\u003c/strong\\u003eOverexpression of Kibra\\u003csub\\u003e \\u003c/sub\\u003evariants overexpression in eyes (C and E, n ≥ 14) and the posterior compartment of the wing (D and F, n ≥ 18). The posterior wing compartment is surrounded with a red dashed line.\\u003cstrong\\u003e F\\u003c/strong\\u003e Quantification of embryonic lethality of flies expressing the indicated transgenes ubiquitously using daughterless::GAL4 (dag::GAL4). N = 3. Scale bars are 0,2 mm in \\u003cstrong\\u003eB\\u003c/strong\\u003e and 0,4 mm in \\u003cstrong\\u003eC\\u003c/strong\\u003e. Error bars represent standard error of the means. For statistical analysis a one-way ANOVA with TUKEYS post-test was applied. n.s. not significant; * Significant, p-value \\u0026lt; 0.1; ** Very significant, p-value \\u0026lt; 0.01. *** Extremely significant, p-value \\u0026lt; 0.001; **** Extremely significant, p-value \\u0026lt;0,0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3293493/v1/b238171408325b10769cb5d5.jpg\"},{\"id\":44020318,\"identity\":\"ad8f385e-eb9f-4618-9041-13baf9e45ac5\",\"added_by\":\"auto\",\"created_at\":\"2023-10-03 13:03:20\",\"extension\":\"jpg\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":169469,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSchematic summary of the proposed mechanism of Kibra phosphorylation\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003ePhosphorylation of Kibra at T971 (Drosophila Kibra, T929 in human Kibra) results in enhanced binding of 14-3-3, which displaces Cdk4 from Kibra, resulting in cell cycle progression from G1 to S-phase. Expression of phosphorylation-deficient Kibra therefore leads to reduced organ (eye, wing) and organism growth as well as reduced cell proliferation in imaginal disc clones. Scheme was drawn using Biorender.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"6.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3293493/v1/b7162cde3f55225b42271560.jpg\"},{\"id\":44021008,\"identity\":\"92905095-375c-40ce-be2d-ed14aa7024d3\",\"added_by\":\"auto\",\"created_at\":\"2023-10-03 13:19:21\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1087116,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3293493/v1/41855f9c-8c31-4769-86ba-3a4c67a34cb7.pdf\"},{\"id\":44019065,\"identity\":\"04b63526-139d-44e0-b7eb-4aa1b823fb88\",\"added_by\":\"auto\",\"created_at\":\"2023-10-03 12:47:20\",\"extension\":\"pdf\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":65070,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Figure 1. Kibra interacts with various 14-3-3 proteins\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eCo-Immunoprecipitation of Flag-Kibra in transduced HEK293 cells. Co-immunoprecipitated 14-3-3 proteins were detected using immunoblotting.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"20230821PAPERboxplot7.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3293493/v1/dfce635918711056f75a2a66.pdf\"},{\"id\":44019071,\"identity\":\"d6ae6cb0-5e3f-419a-87f9-b728e94dc978\",\"added_by\":\"auto\",\"created_at\":\"2023-10-03 12:47:20\",\"extension\":\"pdf\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":325836,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Figure 2. Kibra and RSK genetically interact\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA, B \\u003c/strong\\u003eComparison of wings expressing wild type Kibra and/or downregulating RSK using RNAi in the posterior compartment. The posterior wing compartment is surrounded with a red dashed line. Measurements were normalized against control. n ≥ 22. Scale bars are 0,4 mm. Error bars represent standard error of the means. For statistical analysis a one-way ANOVA with TUKEYS post-test was chosen. * Significant, p-value \\u0026lt; 0.1; **** Extremely significant, p-value \\u0026lt;0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"20230821PAPERboxplot8.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3293493/v1/7583991c27d90e4558522b4a.pdf\"},{\"id\":44019074,\"identity\":\"1e51a8bd-6165-40bb-90cc-4cd2a4a451a0\",\"added_by\":\"auto\",\"created_at\":\"2023-10-03 12:47:21\",\"extension\":\"pdf\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":8411830,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Figure 3. Uncropped and unedited Western blots\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FigureS3.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3293493/v1/8519df7e6392d3f4fc7cc292.pdf\"}],\"financialInterests\":\"There is \\u003cb\\u003eNO\\u003c/b\\u003e Competing Interest.\",\"formattedTitle\":\"Phosphorylation of Kibra by RSK regulates binding to Cdk4 to control cell cycle progression and organ growth independently of the Hippo-pathway\",\"fulltext\":[{\"header\":\"INTRODUCTION\",\"content\":\"\\u003cp\\u003eThe highly conserved protein KIBRA (KIdney BRAin, homologues in humans are WW and C2-domain containing 1\\u0026ndash;3, WWC1-3) was first discovered as a memory performance and cognition-associated protein\\u003csup\\u003e\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u003c/sup\\u003e. KIBRA is a cytoplasmic adapter protein, containing two WW-domains, which facilitate protein-protein interactions, as well as several coiled-coil domains and a C2 domain (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). In the past years several studies demonstrated that in \\u003cem\\u003eDrosophila\\u003c/em\\u003e and mammals, KIBRA plays an important role as an upstream regulator of the Hippo signaling cascade and therefore has a direct impact on cell proliferation and apoptosis\\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR4 CR5 CR6\\\" citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e\\u003c/sup\\u003e. Mechanistically, KIBRA forms a complex with Merlin/NF2 to activate Salvador/Hippo (Mst in mammals)\\u003csup\\u003e\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e\\u003c/sup\\u003e. Apart from this upstream regulation, KIBRA can also function as a scaffold to activate Large tumor suppressor (Lats), the kinase which directly phosphorylates YAP (Yorkie, Yki in \\u003cem\\u003eDrosophila\\u003c/em\\u003e), the downstream effector of the Hippo signaling pathway\\u003csup\\u003e\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u003c/sup\\u003e. Phosphorylated YAP is excluded from the nucleus and either retained in the cytoplasm or degraded. Dephosphorylated YAP enters the nucleus and functions as a co-activator to enhance transcription of pro-proliferative and anti-apoptotic genes such as cyclin E and \\u003cem\\u003eDrosophila\\u003c/em\\u003e inhibitor of apoptosis 1 (Diap)\\u003csup\\u003e\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eApart from its role in cell proliferation control, KIBRA regulates apical-basal cell polarity by restricting the apical plasma membrane domain by inhibiting atypical kinase C (aPKC), resulting in decreased exocytosis\\u003csup\\u003e\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e\\u003c/sup\\u003e. Moreover, KIBRA/aPKC control cell migration by regulating Paxillin activation in focal adhesions\\u003csup\\u003e\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e\\u003c/sup\\u003e. Of note, KIBRA itself is phosphorylated by aPKC at two conserved serines (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA)\\u003csup\\u003e\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u003c/sup\\u003e. Albeit not strictly localized to cell-cell contacts, KIBRA has been found to associate with the Tight Junction (TJ)-associated Crumbs complex\\u003csup\\u003e\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eYang et al. recently described a phosphorylation of KIBRA by ERK and Ribosomal S6 kinase (RSK) at several residues\\u003csup\\u003e\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e\\u003c/sup\\u003e. Impaired phosphorylation of threonine 929 (T929) of human KIBRA by RSK inhibits cell proliferation and cell migration in cultured breast cancer cells. However, the underlying mechanism and the function of this RSK-mediated phosphorylation \\u003cem\\u003ein vivo\\u003c/em\\u003e are not yet fully understood.\\u003c/p\\u003e \\u003cp\\u003eTo address these questions, we used \\u003cem\\u003eDrosophila melanogaster\\u003c/em\\u003e as model system. Overexpression of Kibra results in decreased organ size in wings or eyes\\u003csup\\u003e\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e and this study\\u003c/sup\\u003e. We used this system as well as CRISPR/Cas9-mediated knockins to analyze the function of KIBRA T971 phosphorylation (the threonine residue corresponding to T929 in human KIBRA, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA) and found that organ growth inhibition upon Kibra overexpression is not due to increased Hippo signaling. Instead, Kibra binds to the adapter protein 14-3-3 and Cyclin dependent kinase 4 (Cdk4), thereby directly regulating cell cycle progression. Phosphorylation of KIBRA leads to increased 14-3-3 binding, displacing Cdk4 from KIBRA. Non-phosphorylatable KIBRA (T971A) retains Cdk4 association, which results in a prolonged G1 phase, reduced cell proliferation and decreased organ size.\\u003c/p\\u003e\"},{\"header\":\"RESULTS\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003ePhosphorylation of Kibra at T971 regulates organ size in\\u003c/strong\\u003e \\u003cstrong\\u003eDrosophila\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eOverexpression of Kibra in the developing eye of \\u003cem\\u003eDrosophila\\u003c/em\\u003e (using the UAS/GAL4-system with eyeless::GAL4, ey::GAL4) or in the posterior compartment of the wing (using engrailed::GAL4, en::GAL4) led to a decrease of organ size Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB-E and \\u003csup\\u003e\\u003cspan class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e\\u003c/sup\\u003e. Notably, mutation of threonine 971 to alanine (T971A), resulting in a non-phosphorylatable version of Kibra, strongly enhanced this phenotype (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB-E), whereas overexpression of Kibra T971D, mimicking a constitutive phosphorylation, resulted in a slightly but not significantly weaker organ size reduction compared to overexpression of wild type Kibra (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB-E). By contrast, mutation of two conserved prolines within the WW-domains of Kibra, disrupting the binding capacity of these domains abolished the ability of Kibra to reduce organ size (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB-E), indicating that a protein-protein interaction mediated by the WW domains might be essential for this phenotype.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ePhosphorylation of Kibra at T971 is not essential for viability but regulates cell proliferation and Drosophila body size under endogenous conditions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAs overexpression of Kibra might lead to artificial activation of signaling pathways regulating cell proliferation and organ growth, we next tested whether Kibra T971 phosphorylation is essential under endogenous expression conditions, too. For this, we used CRISPR/Cas9 to establish a knockin of either wild-type T971, T917A or T971D Kibra proteins. Surprisingly, all fly lines expressing the different phosphorylation variants displayed similar survival rates (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA). However, analysis of body size revealed that animals carrying two phosphorylation-deficient \\u003cem\\u003ekibra\\u003c/em\\u003e alleles are significantly smaller compared to wild type or T971D animals (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). Next, we tested, whether this effect is cell-autonomous by inducing clones mutant for \\u003cem\\u003ekibra\\u003c/em\\u003e-variants in an otherwise wild type tissue by using mosaic analysis with a repressible cell marker (MARCM). Indeed, clones of \\u003cem\\u003ekibra\\u003c/em\\u003e T971A are significantly smaller compared to those cells expressing wild type Kibra \\u003cem\\u003eor\\u003c/em\\u003e Kibra T971D (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC-F), indicating a decreased cell proliferation in cells lacking Kibra T971 phosphorylation.\\u003c/p\\u003e\\n\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eOrgan size regulation by Kibra does not depend on Hippo signaling\\u003c/h2\\u003e\\n\\u003cp\\u003eKibra is a well described upstream regulator of the Hippo signaling cascade first by forming a scaffolding platform for Salvador/Hippo together with Merlin/Expanded and second (at least in mammals) by increasing the phosphorylation and activation of Lats by binding through its WW-domains\\u003csup\\u003e\\u003cspan class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e, \\u003cspan class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e\\u003c/sup\\u003e. The observation that overexpression of Kibra results in decreased organ size in wings and eyes would be in line with increased Hippo pathway activation leading to decreased Yki activity and thus downregulation of Yki target genes. Following this line, phosphorylation-deficient Kibra should show a stronger downregulation of Yki/YAP target genes. Therefore, we first tested human KIBRA in a luciferase-based YAP-reporter assay\\u003csup\\u003e\\u003cspan class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e\\u003c/sup\\u003e and found that expression of KIBRA induces a downregulation of YAP activity (as reported earlier), but not changes between wild type and phosphorylation-deficient KIBRA (KIBRA T929A) (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA).\\u003c/p\\u003e\\n\\u003cp\\u003eIn order to further test our hypothesis \\u003cem\\u003ein vivo\\u003c/em\\u003e, we generated flies overexpressing the T971A variant together with point mutations, which inactivate the WW-domains (P85A P132A = ∆WW). As expected, overexpression of Kibra∆WW T971A did not result in decreased organ size in eyes or wings but showed similar organ sizes as control flies or flies expressing Kibra∆WW alone (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB-C).\\u003c/p\\u003e\\n\\u003cp\\u003eNext, we directly assessed Yki targets \\u003cem\\u003ein vivo\\u003c/em\\u003e by overexpression of GFP-Kibra in the posterior compartment of imaginal discs, which expressed \\u0026beta;-Galactosidase under control of the expanded promoter (ex::lacZ) or the four-jointed promoter (fj::lacZ), which are both activated by Yki\\u003csup\\u003e\\u003cspan class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e\\u0026ndash;\\u003cspan class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e\\u003c/sup\\u003e. In addition, we stained for Cyclin E expression, which is also a downstream target of the Hippo pathway\\u003csup\\u003e\\u003cspan class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e\\u003c/sup\\u003e. If a decreased Yki activation would be the reason for the decrease in organ size in Kibra overexpressing tissues, expression of ex::lacZ/fj::lacZ as well as Cyclin E should be decreased. Surprisingly, we found a clear upregulation of Cyclin E and if at all a minimal upregulation but no downregulation of ex::lacZ/fj::lacZ expression in the posterior compartment of the wing imaginal discs, where wild type Kibra or Kibra T971A was overexpressed (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD-G).\\u003c/p\\u003e\\n\\u003cp\\u003eTaken together, our data indicate that increased levels of KIBRA indeed enhance Hippo signaling, resulting in decreased YAP activation in cell culture. However, this effect cannot be observed \\u003cem\\u003ein vivo\\u003c/em\\u003e, suggesting that the Kibra overexpression phenotype of reduced organ size is not the consequence of enhanced Hippo signaling leading to reduced Yki activation \\u003cem\\u003ein vivo\\u003c/em\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003eFurthermore, phosphorylation of Kibra by RSK does not affect its function in Hippo-pathway regulation, arguing against an involvement of Hippo in the strongly enhanced organ size reduction upon overexpression of phosphorylation-deficient Kibra.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003ePhosphorylation of Kibra regulates cell cycle progression\\u003c/h2\\u003e\\n\\u003cp\\u003eAs the known role of Kibra in Hippo pathway regulation did not explain the reduced organ growth observed upon its overexpression, we investigated cell cycle progression in imaginal discs overexpressing wild type KIBRA or phospho-deficient KIBRA. To discriminate distinct cell cycle phases, we used the FlyFUCCI system\\u003csup\\u003e\\u003cspan class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e\\u003c/sup\\u003e: In brief, we analyzed imaginal discs constitutively expressing GFP, which was fused to an E2f1 degron and RFP, fused to Cyclin-B degron. Thus, cells in G1 express only GFP, whereas in S-phase, only RFP is expressed and G2-/M-phase cells retain both fluorochromes. Kibra and Kibra T971A were overexpressed in the posterior compartment of the wing imaginal discs (marked by expression of engrailed, Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA). Cells in G1 were normalized to the total amount of cells (DAPI staining) and the quotient of posterior cells (engrailed positive and expressing Kibra wt/T971A) to anterior cells (no Kibra overexpression). As quantified in Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB, overexpression of wild type Kibra enhances the number of cells in G1 by ca. twofold. Moreover, overexpression of phosphorylation-deficient Kibra resulted in a more than four-fold increase in cells in G1-phase.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eKibra phosphorylation regulates binding to 14-3-3 and Cdk4 to control cell cycle progression\\u003c/h2\\u003e\\n\\u003cp\\u003eIn silico analysis of the phosphorylation motif revealed a conserved consensus motif for 14-3-3- proteins (R-S-X-T-X-P). 14-3-3 proteins are adapter proteins which bind to phosphorylated motifs, thereby facilitating e.g. protein degradation, displacement from the plasma membrane or blocking of protein-protein interactions\\u003csup\\u003e\\u003cspan class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e\\u003c/sup\\u003e. Furthermore, in an earlier proteomic screen for KIBRA interaction partners, we identified 14-3-3 proteins as well as the Cyclin-dependent kinase 4 (Cdk4) to co-immunoprecipitate with KIBRA (data not shown). We verified that 14-3-3 and Cdk4 associate with KIBRA using co-immunoprecipitation from WWC1/2 deficient HEK293 cells expressing GFP-KIBRA variants (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA and Supplementary Fig.\\u0026nbsp;1). Notably, KIBRA T929A displayed a strongly increased binding of Cdk4 compared to wild type KIBRA, whereas binding of 14-3-3 is decreased, suggesting that phosphorylation of KIBRA T929 affects the association with both proteins contrarily. As Cdk4 is a critical regulator of G1 phase length\\u003csup\\u003e\\u003cspan class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u003c/sup\\u003e, we hypothesized that binding of KIBRA to Cdk4 controls cell cycle progression and thus cell proliferation and organ size. Phosphorylation of KIBRA at T929 (T971 in \\u003cem\\u003eDrosophila\\u003c/em\\u003e) by RSK, induced by mitogen stimuli releases Cdk4 from KIBRA, resulting in cell cycle progression and increased proliferation. Impaired phosphorylation of KIBRA by expression of T929A/T971A decreases or delays the release of Cdk4, thus inhibiting cell cycle progression and proliferation. Indeed, in \\u003cem\\u003eDrosophila\\u003c/em\\u003e, inhibition of RSK in KIBRA overexpressing wings, which results in impaired phosphorylation of KIBRA T971, led to a decreased organ size in comparison to downregulation of RSK alone or overexpression of wild type KIBRA alone (Supplementary Fig.\\u0026nbsp;2).\\u003c/p\\u003e\\n\\u003cp\\u003eFinally, the overexpression phenotype of \\u003cem\\u003eDrosophila\\u003c/em\\u003e KIBRA T971A can be diminished by simultaneous overexpression of Cdk4, while overexpression of Cdk4 alone had no effect on eye or wing size (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB-E). Moreover, overexpression of Cdk4 during embryogenesis could rescue the increased lethality of KIBRA T971A overexpression to large extent (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eF). These data confirm that KIBRA regulates cell cycle progression and thus organ growth by binding Cdk4 and that phosphorylation of KIBRA at T971 by RSK regulates this interaction.\\u003c/p\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"DISCUSSION\",\"content\":\"\\u003cp\\u003eIn this study, we describe that phosphorylation of KIBRA at a conserved threonine by RSK regulates the binding of KIBRA to Cdk4, thereby regulating G1 phase length and thus cell proliferation and organism/organ growth. Contrarily, phosphorylation of KIBRA increases binding to 14-3-3, suggesting that upon phosphorylation, 14-3-3 displaces Cdk4 from KIBRA (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e). Although KIBRA has been well described as an upstream regulator of the Hippo signaling cascade and its overexpression phenotype of reduced organ growth would fit with increased Hippo activity, the expression of Hippo target genes such as four jointed, expanded and cyclin E is not downregulated upon KIBRA overexpression. Instead, cyclin E accumulates in KIBRA-overexpressing cells, indicating a prolonged G1 phase. Thus, we demonstrated a new regulatory mechanism of KIBRA directly regulated the cell cycle, which is controlled by mitogen stimuli. Albeit this mechanism seems to be independent of the function of KIBRA in Hippo signaling, several key components of the Hippo cascade have been described to be regulated by mitogen-stimulated pathways, too: Ajuba proteins, which bind to and control the activation of Lats, are phosphorylated by MAPK\\u003csup\\u003e\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e and MAP4K\\u0026rsquo;s function in redundancy to Hippo/Mst kinases in activating Warts/Lats\\u003csup\\u003e25\\u0026ndash;27\\u003c/sup\\u003e. Moreover, the activity of Yki/YAP is regulated by PI3Kinase signaling\\u003csup\\u003e\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e\\u003c/sup\\u003e. Despite mitogen (extracellular) stimuli, cellular metabolism and energy supply has been emerged as a critical modulator of the Hippo-signaling cascade \\u003csup\\u003e\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e\\u003c/sup\\u003e. The Hippo pathway independent regulation of Kibra by RSK described in this study is a parallel pathway ensuring cell cycle control downstream of mitogen signals.\\u003c/p\\u003e \\u003cp\\u003eNotably, knockin of phosphorylation-deficient KIBRA in flies results in reduced cell proliferation and a reduction in animal size, which resembles the phenotype of homozygous \\u003cem\\u003ecdk4\\u003c/em\\u003e knockout mice\\u003csup\\u003e\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e\\u003c/sup\\u003e and flies\\u003csup\\u003e\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eCell cycle progression must be strictly regulated to ensure correct proliferation and growth arrest. The activation of Cyclin D by Cdk4/6 during G1 phase is a key checkpoint for cells designated for proliferation. Lack of mitogenic stimuli results in insufficient expression of Cyclin D, whereas anti-proliferative stimuli, e.g. by contact inhibition result in inactivation of Cdk4 by its binding to INK4 and p21/p27 proteins, thus blocking the Cdk4-Cyclin D interaction\\u003csup\\u003e\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e\\u003c/sup\\u003e. In addition to its direct role in cell cycle progression by phosphorylating and thereby inactivating pocket proteins, Cdk4 also phosphorylates the TGFβ-pathway effectors SMAD2/3, inhibiting their transcriptional activity, which results in a decreased expression of the Cdk inhibitor p15\\u003csup\\u003e33\\u003c/sup\\u003e. Beside Cyclin Ds, the known Cdk inhibitors and SMAD2/3 transcription factors, KIBRA is the first protein interacting with Cdk4, for which no direct implication in G1-phase regulation and cell cycle progression has been showed yet.\\u003c/p\\u003e \\u003cp\\u003eLinks between KIBRA and M-phase control have been established by the observation that KIBRA can be phosphorylated by the mitotic kinases Aurora-A/B ensuring correct progression through mitosis \\u003csup\\u003e\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e\\u003c/sup\\u003e. However, this phosphorylation seems to regulate binding of KIBRA to NF2/Merlin as well, thus mediating Hippo signaling-dependent and -independent functions of KIBRA. By contrast, phosphorylation of KIBRA by Cdk1 does not affect the function of KIBRA in regulating Hippo signaling Cdk1 but ensures cell cycle arrest in M-phase upon Taxol-induced spindle damage stress\\u003csup\\u003e\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e\\u003c/sup\\u003e. Vice versa, KIBRA regulates Aurora A activity resulting in correct alignment of chromosomes during M-phase\\u003csup\\u003e\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e\\u003c/sup\\u003e. Upon induction of DNA damage, KIBRA gets phosphorylated by ataxia telangiectasia mutated (ATM) kinase and regulates efficient double strand break repair, presumably by scaffolding Ku70/80 complex proteins to facilitate non-homologues-end-joining of double strand breaks\\u003csup\\u003e\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eOf note, deletion of WWC1 and WWC2 in hepatocytes in mice induces tissue overgrowth and tumorigenesis as well as increased activation of YAP target genes\\u003csup\\u003e\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e\\u003c/sup\\u003e. Moreover, WWC1/KIBRA is downregulated in breast cancer and B-cell acute lymphocytic leukemia and associated with poor prognosis, suggesting a critical role as tumor suppressor\\u003csup\\u003e\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e\\u003c/sup\\u003e. However, is still remains to clarify, whether the function of KIBRA as tumor suppressor is due to its implication in Hippo-signaling cascade or a direct consequence of its inhibitory role on Cdk4 regulating cell cycle progression \\u0026ndash; or both.\\u003c/p\\u003e \\u003cp\\u003eTaken together, KIBRA functions in different molecular pathways regulating cell cycle progression and cell proliferation, which are partly independent of its known role in the Hippo signaling cascade. The regulation of KIBRA binding to Cdk4 by RSK and 14-3-3 described in this study seems to be another key mechanism of in these processes.\\u003c/p\\u003e\"},{\"header\":\"MATERIALS AND METHODS\",\"content\":\"\\u003cp\\u003e \\u003cb\\u003eDrosophila\\u003c/b\\u003e \\u003cb\\u003estocks and genetics\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eFly stocks were cultured on standard cornmeal agar food and maintained at 25\\u0026deg;C. Knockins of \\u003cem\\u003ekibra\\u003c/em\\u003e variants were established using CRISPR/Cas9 technique as described recently \\u003csup\\u003e\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e\\u003c/sup\\u003e. In short, a plasmid (pU6-Bbs-chiRNA) encoding the guide-RNAi (GTCAGTCACAAGTAAGTACT) targeting Cas9 to the sixth exon of \\u003cem\\u003ekibra\\u003c/em\\u003e was injected into vasa::Cas9 transgenic flies (#51323 obtained from Bloomington stock center) together with a donor plasmid containing ca. 1kbp 5\\u0026rsquo; and 3\\u0026rsquo; homology arms and an eye-driven (3xP3 promoter) dsRed (pHD-dsRed) (Gratz et al., 2013). Point mutations (T971A and T971D) were introduced by site-directed mutagenesis. MARCM (mosaic analysis with a repressible cell marker) clones were produced by crossing \\u003cem\\u003ekibra\\u003c/em\\u003e (wt, T971A or T971D) FRT82B flies with hsFlp, tub::GAL4, UAS::nGFP;;FRT82B, tubP::GAL80 (obtained from Bloomington stock center). GFP-marked \\u003cem\\u003ekibra\\u003c/em\\u003e-variant-mutant clones in imaginal discs were induced by heat shock in first instar larvae. UASt::GFP-Kibra and UASt::Kibra trangenic flies were generated using Phi-C31-Integrase system \\u003csup\\u003e\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e\\u003c/sup\\u003e with attP40 and crossed with en::GAL4, ey::GAL4, fj::lacZ (fj\\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR10\\\" citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e\\u003c/sup\\u003e), ex::lacZ, UAS::Cdk4 or Ubi::GFP-E2f1, Ubi::RFP-CycB.1 (FlyFUCCI) (all obtained from Bloomington stock center except of ex::lacZ (ex\\u003csup\\u003e697\\u003c/sup\\u003e, which was kindly provided by Georg Halder).\\u003c/p\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eImmunohistochemistry\\u003c/h2\\u003e \\u003cp\\u003eImaginal discs of third instar lavae were dissected in PBS and fixed for 20 minutes in 4% PFA/PBS. Subsequently, discs were washed three times in PBS\\u0026thinsp;+\\u0026thinsp;0.2% Triton X-100 and blocked with 1% BSA for 1h, incubated over night with primary antibodies in PBS\\u0026thinsp;+\\u0026thinsp;0.2% Triton X-100\\u0026thinsp;+\\u0026thinsp;1% BSA, washed three times and incubated for 2h with secondary antibodies. After three washing steps and DAPI-staining, nephrocytes were mounted with Mowiol. Primary antibodies used were as follows: Rabbit anti Cyclin-E (1:500, Santa Cruz #sc-33748), goat anti GFP (1:500, #600-101-215, Rockland), mouse anti engrailed (1:10, 4D9, Developmental Studies Hybridoma Bank (DSHB)), mouse anti beta-Galactosidase (1:100, JIE7, DSHB). Secondary antibodies conjugated with Alexa 488, Alexa 568 and Alexa 647 (Life technologies) were used at 1:400. Images were taken on a Leica SP8 confocal microscope using lightning program and processed using ImageJ.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eLuciferase assays\\u003c/h2\\u003e \\u003cp\\u003eLuciferase assays for YAP activity were performed in HEK293 cells in 96-well plates, with six replicates per condition. Cells were grown in DMEM (4.5 g/L) and 7.5% FCS, but without antibiotics. 20,000 cells per well were seeded onto poly-l-lysine (PLL)-coated plates and transfected with 20 ng of the TEAD reporter 8xGTIIC-luciferase gift from Stefano Piccolo, Addgene plasmid # 34615, \\u003csup\\u003e\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e\\u003c/sup\\u003e, 20 ng of TK-Renilla (Promega) and 20 ng of pcDNA3.1 FLAG-YAP1 and GFP-hKIBRA, GFP-hKIBRA T929A or GFP-KIBRA ∆WW. 20 h after transfection, the medium was removed, and cells were lysed in 30 \\u0026micro;l of Passive Lysis Buffer (Promega) and firefly and renilla luciferase activity was analyzed using a dual luciferase assay (Promega) in a Mithras LB 940 Multimode Microplate Reader (Berthold Technologies).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCoimmunoprecipitation and Western blot analysis\\u003c/h2\\u003e \\u003cp\\u003eFor coimmunoprecipitation, KIBRA/WWC1\\u0026thinsp;+\\u0026thinsp;WWC2-deficient HEK293 cells stably expressing GFP-KIBRA variants were lysed in lysis buffer (150mM NaCl, 50mM TRIS-HCl pH 7.5, 1% Triton-X100), GFP-KIBRA was immunoprecipitated using GFP-trap (Chromotek) and beads were subjected to Western blot analysis. The following primary antibodies were used in Western blots: rabbit anti Cdk4 (1:1000, Cell Signaling #12790), mouse anti PKCζ (1:500, Santa Cruz #sc-393218), rabbit anti 14-3-3β/α (1:1000, Cell Signaling #9636), rabbit anti 14-3-3τ (1:1000, Cell Signaling #9638), rabbit anti 14-3-3η (1:1000, Cell Signaling #9640), rabbit anti 14-3-3ε (1:1000, Cell Signaling #9635), rabbit anti 14-3-3ᵧ (1:1000, Cell Signaling #5522), rabbit anti 14-3-3ζ/δ (1:1000, Cell Signaling #7413), mouse anti GFP (1:500, Santa Cruz #9996).\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe thank the Bloomington \\u003cem\\u003eDrosophila\\u003c/em\\u003e stock center at the University of Indiana (USA), Georg Halder and the Developmental Studies Hybridoma Bank at the University of Iowa (USA) for providing reagents. This work was supported by grants of the German research foundation (DFG, CRC1348-A05, KR3901/9-2), the IZKF M\\u0026uuml;nster (Kr-A-031.21) and MedK PhD school to M. P. K.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eLW, JJ, VM, MS and IF performed the Drosophila \\u003cem\\u003ein vivo\\u003c/em\\u003e experiments except of FUCCI-analysis, which was done by KD and MK and analyzed by TZ. LW, FW and DOW conducted co-immunoprecipitation with HEK cells. MW contributes YAP-based luciferase reporter assays. HP, JK and MPK supervised the project.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare no conflicts of interests.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll data are available in main and supplemental figures.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003ePapassotiropoulos A, Stephan DA, Huentelman MJ\\u003cem\\u003e et al.\\u003c/em\\u003e Common Kibra alleles are associated with human memory performance. \\u003cem\\u003eScience\\u003c/em\\u003e 2006; \\u003cstrong\\u003e314\\u003c/strong\\u003e:475-478.\\u003c/li\\u003e\\n\\u003cli\\u003eKremerskothen J, Plaas C, Buther K\\u003cem\\u003e et al.\\u003c/em\\u003e Characterization of KIBRA, a novel WW domain-containing protein. \\u003cem\\u003eBiochemical and biophysical research communications\\u003c/em\\u003e 2003; \\u003cstrong\\u003e300\\u003c/strong\\u003e:862-867.\\u003c/li\\u003e\\n\\u003cli\\u003eBaumgartner R, Poernbacher I, Buser N, Hafen E, Stocker H. The WW domain protein Kibra acts upstream of Hippo in Drosophila. \\u003cem\\u003eDevelopmental cell\\u003c/em\\u003e 2010; \\u003cstrong\\u003e18\\u003c/strong\\u003e:309-316.\\u003c/li\\u003e\\n\\u003cli\\u003eGenevet A, Wehr MC, Brain R, Thompson BJ, Tapon N. Kibra is a regulator of the Salvador/Warts/Hippo signaling network. \\u003cem\\u003eDevelopmental cell\\u003c/em\\u003e 2010; \\u003cstrong\\u003e18\\u003c/strong\\u003e:300-308.\\u003c/li\\u003e\\n\\u003cli\\u003eYu J, Zheng Y, Dong J, Klusza S, Deng WM, Pan D. Kibra functions as a tumor suppressor protein that regulates Hippo signaling in conjunction with Merlin and Expanded. \\u003cem\\u003eDevelopmental cell\\u003c/em\\u003e 2010; \\u003cstrong\\u003e18\\u003c/strong\\u003e:288-299.\\u003c/li\\u003e\\n\\u003cli\\u003eXiao L, Chen Y, Ji M, Dong J. KIBRA regulates Hippo signaling activity via interactions with large tumor suppressor kinases. \\u003cem\\u003eThe Journal of biological chemistry\\u003c/em\\u003e 2011; \\u003cstrong\\u003e286\\u003c/strong\\u003e:7788-7796.\\u003c/li\\u003e\\n\\u003cli\\u003eMoleirinho S, Chang N, Sims AH\\u003cem\\u003e et al.\\u003c/em\\u003e KIBRA exhibits MST-independent functional regulation of the Hippo signaling pathway in mammals. \\u003cem\\u003eOncogene\\u003c/em\\u003e 2013; \\u003cstrong\\u003e32\\u003c/strong\\u003e:1821-1830.\\u003c/li\\u003e\\n\\u003cli\\u003eSu T, Ludwig MZ, Xu J, Fehon RG. Kibra and Merlin Activate the Hippo Pathway Spatially Distinct from and Independent of Expanded. \\u003cem\\u003eDevelopmental cell\\u003c/em\\u003e 2017; \\u003cstrong\\u003e40\\u003c/strong\\u003e:478-490 e473.\\u003c/li\\u003e\\n\\u003cli\\u003eYu FX, Zhao B, Guan KL. Hippo Pathway in Organ Size Control, Tissue Homeostasis, and Cancer. \\u003cem\\u003eCell\\u003c/em\\u003e 2015; \\u003cstrong\\u003e163\\u003c/strong\\u003e:811-828.\\u003c/li\\u003e\\n\\u003cli\\u003eMoya IM, Halder G. Hippo-YAP/TAZ signalling in organ regeneration and regenerative medicine. \\u003cem\\u003eNature reviews Molecular cell biology\\u003c/em\\u003e 2019; \\u003cstrong\\u003e20\\u003c/strong\\u003e:211-226.\\u003c/li\\u003e\\n\\u003cli\\u003eYoshihama Y, Sasaki K, Horikoshi Y\\u003cem\\u003e et al.\\u003c/em\\u003e KIBRA suppresses apical exocytosis through inhibition of aPKC kinase activity in epithelial cells. \\u003cem\\u003eCurrent biology : CB\\u003c/em\\u003e 2011; \\u003cstrong\\u003e21\\u003c/strong\\u003e:705-711.\\u003c/li\\u003e\\n\\u003cli\\u003eRosse C, Formstecher E, Boeckeler K\\u003cem\\u003e et al.\\u003c/em\\u003e An aPKC-exocyst complex controls paxillin phosphorylation and migration through localised JNK1 activation. \\u003cem\\u003ePLoS biology\\u003c/em\\u003e 2009; \\u003cstrong\\u003e7\\u003c/strong\\u003e:e1000235.\\u003c/li\\u003e\\n\\u003cli\\u003eButher K, Plaas C, Barnekow A, Kremerskothen J. KIBRA is a novel substrate for protein kinase Czeta. \\u003cem\\u003eBiochemical and biophysical research communications\\u003c/em\\u003e 2004; \\u003cstrong\\u003e317\\u003c/strong\\u003e:703-707.\\u003c/li\\u003e\\n\\u003cli\\u003eDuning K, Schurek EM, Schluter M\\u003cem\\u003e et al.\\u003c/em\\u003e KIBRA modulates directional migration of podocytes. \\u003cem\\u003eJournal of the American Society of Nephrology : JASN\\u003c/em\\u003e 2008; \\u003cstrong\\u003e19\\u003c/strong\\u003e:1891-1903.\\u003c/li\\u003e\\n\\u003cli\\u003eYang S, Ji M, Zhang L\\u003cem\\u003e et al.\\u003c/em\\u003e Phosphorylation of KIBRA by the extracellular signal-regulated kinase (ERK)-ribosomal S6 kinase (RSK) cascade modulates cell proliferation and migration. \\u003cem\\u003eCellular signalling\\u003c/em\\u003e 2014; \\u003cstrong\\u003e26\\u003c/strong\\u003e:343-351.\\u003c/li\\u003e\\n\\u003cli\\u003eWennmann DO, Schmitz J, Wehr MC\\u003cem\\u003e et al.\\u003c/em\\u003e Evolutionary and molecular facts link the WWC protein family to Hippo signaling. \\u003cem\\u003eMolecular biology and evolution\\u003c/em\\u003e 2014; \\u003cstrong\\u003e31\\u003c/strong\\u003e:1710-1723.\\u003c/li\\u003e\\n\\u003cli\\u003eDupont S, Morsut L, Aragona M\\u003cem\\u003e et al.\\u003c/em\\u003e Role of YAP/TAZ in mechanotransduction. \\u003cem\\u003eNature\\u003c/em\\u003e 2011; \\u003cstrong\\u003e474\\u003c/strong\\u003e:179-183.\\u003c/li\\u003e\\n\\u003cli\\u003eHamaratoglu F, Willecke M, Kango-Singh M\\u003cem\\u003e et al.\\u003c/em\\u003e The tumour-suppressor genes NF2/Merlin and Expanded act through Hippo signalling to regulate cell proliferation and apoptosis. \\u003cem\\u003eNature cell biology\\u003c/em\\u003e 2006; \\u003cstrong\\u003e8\\u003c/strong\\u003e:27-36.\\u003c/li\\u003e\\n\\u003cli\\u003eReddy BV, Rauskolb C, Irvine KD. Influence of fat-hippo and notch signaling on the proliferation and differentiation of Drosophila optic neuroepithelia. \\u003cem\\u003eDevelopment\\u003c/em\\u003e 2010; \\u003cstrong\\u003e137\\u003c/strong\\u003e:2397-2408.\\u003c/li\\u003e\\n\\u003cli\\u003eCho E, Feng Y, Rauskolb C, Maitra S, Fehon R, Irvine KD. Delineation of a Fat tumor suppressor pathway. \\u003cem\\u003eNature genetics\\u003c/em\\u003e 2006; \\u003cstrong\\u003e38\\u003c/strong\\u003e:1142-1150.\\u003c/li\\u003e\\n\\u003cli\\u003eZielke N, Korzelius J, van Straaten M\\u003cem\\u003e et al.\\u003c/em\\u003e Fly-FUCCI: A versatile tool for studying cell proliferation in complex tissues. \\u003cem\\u003eCell reports\\u003c/em\\u003e 2014; \\u003cstrong\\u003e7\\u003c/strong\\u003e:588-598.\\u003c/li\\u003e\\n\\u003cli\\u003eObsilova V, Obsil T. Structural insights into the functional roles of 14-3-3 proteins. \\u003cem\\u003eFrontiers in molecular biosciences\\u003c/em\\u003e 2022; \\u003cstrong\\u003e9\\u003c/strong\\u003e:1016071.\\u003c/li\\u003e\\n\\u003cli\\u003eDong P, Zhang C, Parker BT, You L, Mathey-Prevot B. Cyclin D/CDK4/6 activity controls G1 length in mammalian cells. \\u003cem\\u003ePloS one\\u003c/em\\u003e 2018; \\u003cstrong\\u003e13\\u003c/strong\\u003e:e0185637.\\u003c/li\\u003e\\n\\u003cli\\u003eReddy BV, Irvine KD. Regulation of Hippo signaling by EGFR-MAPK signaling through Ajuba family proteins. \\u003cem\\u003eDevelopmental cell\\u003c/em\\u003e 2013; \\u003cstrong\\u003e24\\u003c/strong\\u003e:459-471.\\u003c/li\\u003e\\n\\u003cli\\u003eLi Q, Li S, Mana-Capelli S\\u003cem\\u003e et al.\\u003c/em\\u003e The conserved misshapen-warts-Yorkie pathway acts in enteroblasts to regulate intestinal stem cells in Drosophila. \\u003cem\\u003eDevelopmental cell\\u003c/em\\u003e 2014; \\u003cstrong\\u003e31\\u003c/strong\\u003e:291-304.\\u003c/li\\u003e\\n\\u003cli\\u003eMeng Z, Moroishi T, Mottier-Pavie V\\u003cem\\u003e et al.\\u003c/em\\u003e MAP4K family kinases act in parallel to MST1/2 to activate LATS1/2 in the Hippo pathway. \\u003cem\\u003eNature communications\\u003c/em\\u003e 2015; \\u003cstrong\\u003e6\\u003c/strong\\u003e:8357.\\u003c/li\\u003e\\n\\u003cli\\u003eZheng Y, Wang W, Liu B, Deng H, Uster E, Pan D. Identification of Happyhour/MAP4K as Alternative Hpo/Mst-like Kinases in the Hippo Kinase Cascade. \\u003cem\\u003eDevelopmental cell\\u003c/em\\u003e 2015; \\u003cstrong\\u003e34\\u003c/strong\\u003e:642-655.\\u003c/li\\u003e\\n\\u003cli\\u003eStrassburger K, Tiebe M, Pinna F, Breuhahn K, Teleman AA. Insulin/IGF signaling drives cell proliferation in part via Yorkie/YAP. \\u003cem\\u003eDevelopmental biology\\u003c/em\\u003e 2012; \\u003cstrong\\u003e367\\u003c/strong\\u003e:187-196.\\u003c/li\\u003e\\n\\u003cli\\u003eIbar C, Irvine KD. Integration of Hippo-YAP Signaling with Metabolism. \\u003cem\\u003eDevelopmental cell\\u003c/em\\u003e 2020; \\u003cstrong\\u003e54\\u003c/strong\\u003e:256-267.\\u003c/li\\u003e\\n\\u003cli\\u003eRane SG, Dubus P, Mettus RV\\u003cem\\u003e et al.\\u003c/em\\u003e Loss of Cdk4 expression causes insulin-deficient diabetes and Cdk4 activation results in beta-islet cell hyperplasia. \\u003cem\\u003eNature genetics\\u003c/em\\u003e 1999; \\u003cstrong\\u003e22\\u003c/strong\\u003e:44-52.\\u003c/li\\u003e\\n\\u003cli\\u003eMeyer CA, Jacobs HW, Datar SA, Du W, Edgar BA, Lehner CF. Drosophila Cdk4 is required for normal growth and is dispensable for cell cycle progression. \\u003cem\\u003eThe EMBO journal\\u003c/em\\u003e 2000; \\u003cstrong\\u003e19\\u003c/strong\\u003e:4533-4542.\\u003c/li\\u003e\\n\\u003cli\\u003eMalumbres M, Barbacid M. Cell cycle, CDKs and cancer: a changing paradigm. \\u003cem\\u003eNature reviews Cancer\\u003c/em\\u003e 2009; \\u003cstrong\\u003e9\\u003c/strong\\u003e:153-166.\\u003c/li\\u003e\\n\\u003cli\\u003eMatsuura I, Denissova NG, Wang G, He D, Long J, Liu F. Cyclin-dependent kinases regulate the antiproliferative function of Smads. \\u003cem\\u003eNature\\u003c/em\\u003e 2004; \\u003cstrong\\u003e430\\u003c/strong\\u003e:226-231.\\u003c/li\\u003e\\n\\u003cli\\u003eXiao L, Chen Y, Ji M\\u003cem\\u003e et al.\\u003c/em\\u003e KIBRA protein phosphorylation is regulated by mitotic kinase aurora and protein phosphatase 1. \\u003cem\\u003eThe Journal of biological chemistry\\u003c/em\\u003e 2011; \\u003cstrong\\u003e286\\u003c/strong\\u003e:36304-36315.\\u003c/li\\u003e\\n\\u003cli\\u003eJi M, Yang S, Chen Y, Xiao L, Zhang L, Dong J. Phospho-regulation of KIBRA by CDK1 and CDC14 phosphatase controls cell-cycle progression. \\u003cem\\u003eThe Biochemical journal\\u003c/em\\u003e 2012; \\u003cstrong\\u003e447\\u003c/strong\\u003e:93-102.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang L, Iyer J, Chowdhury A\\u003cem\\u003e et al.\\u003c/em\\u003e KIBRA regulates aurora kinase activity and is required for precise chromosome alignment during mitosis. \\u003cem\\u003eThe Journal of biological chemistry\\u003c/em\\u003e 2012; \\u003cstrong\\u003e287\\u003c/strong\\u003e:34069-34077.\\u003c/li\\u003e\\n\\u003cli\\u003eMavuluri J, Beesetti S, Surabhi R, Kremerskothen J, Venkatraman G, Rayala SK. Phosphorylation-Dependent Regulation of the DNA Damage Response of Adaptor Protein KIBRA in Cancer Cells. \\u003cem\\u003eMolecular and cellular biology\\u003c/em\\u003e 2016; \\u003cstrong\\u003e36\\u003c/strong\\u003e:1354-1365.\\u003c/li\\u003e\\n\\u003cli\\u003eHermann A, Wennmann DO, Gromnitza S\\u003cem\\u003e et al.\\u003c/em\\u003e WW and C2 domain-containing proteins regulate hepatic cell differentiation and tumorigenesis through the hippo signaling pathway. \\u003cem\\u003eHepatology\\u003c/em\\u003e 2018; \\u003cstrong\\u003e67\\u003c/strong\\u003e:1546-1559.\\u003c/li\\u003e\\n\\u003cli\\u003eWang Z, Katsaros D, Biglia N\\u003cem\\u003e et al.\\u003c/em\\u003e Low expression of WWC1, a tumor suppressor gene, is associated with aggressive breast cancer and poor survival outcome. \\u003cem\\u003eFEBS open bio\\u003c/em\\u003e 2019; \\u003cstrong\\u003e9\\u003c/strong\\u003e:1270-1280.\\u003c/li\\u003e\\n\\u003cli\\u003eHill VK, Dunwell TL, Catchpoole D\\u003cem\\u003e et al.\\u003c/em\\u003e Frequent epigenetic inactivation of KIBRA, an upstream member of the Salvador/Warts/Hippo (SWH) tumor suppressor network, is associated with specific genetic event in B-cell acute lymphocytic leukemia. \\u003cem\\u003eEpigenetics\\u003c/em\\u003e 2011; \\u003cstrong\\u003e6\\u003c/strong\\u003e:326-332.\\u003c/li\\u003e\\n\\u003cli\\u003eBorkowsky S, Gass M, Alavizargar A\\u003cem\\u003e et al.\\u003c/em\\u003e Phosphorylation of LKB1 by PDK1 Inhibits Cell Proliferation and Organ Growth by Decreased Activation of AMPK. \\u003cem\\u003eCells\\u003c/em\\u003e 2023; \\u003cstrong\\u003e12\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eGroth AC, Fish M, Nusse R, Calos MP. Construction of transgenic Drosophila by using the site-specific integrase from phage phiC31. \\u003cem\\u003eGenetics\\u003c/em\\u003e 2004; \\u003cstrong\\u003e166\\u003c/strong\\u003e:1775-1782.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"cell-death-and-differentiation\",\"isNatureJournal\":false,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"cdd\",\"sideBox\":\"Learn more about [Cell Death \\u0026 Differentiation](http://www.nature.com/cdd/)\",\"snPcode\":\"41418\",\"submissionUrl\":\"https://mts-cdd.nature.com/cgi-bin/main.plex\",\"title\":\"Cell Death \\u0026 Differentiation\",\"twitterHandle\":\"@cddpress\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"Kibra, Cdk4, 14-3-3, Hippo signaling, YAP, cell cycle, cell proliferation\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3293493/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3293493/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eThe conserved adapter protein KIBRA (Kidney and Brain) has been described as an upstream regulator of the Hippo signaling cascade, which controls cell proliferation, apoptosis, differentiation and organ growth. Components of this pathway, including KIBRA, are often downregulated or mutated in various types of cancer. KIBRA is phosphorylated at a conserved threonine residue by Ribosomal S6 kinase (RSK), but the function of this phosphorylation \\u003cem\\u003ein vivo\\u003c/em\\u003e is still unclear. In this study we show that overexpression of Kibra in \\u003cem\\u003eDrosophila\\u003c/em\\u003e eyes and wings decreases organ growth and that this effect is strongly enhanced upon mutation of the RSK-phosphorylation site in Kibra. Notably, the reduced cell proliferation that leads to impaired organ growth does not depend on the activity of Yorkie as the downstream effector of the Hippo signaling cascade. Instead, Kibra phosphorylation by RSK enables binding to 14-3-3 proteins, which displace Cyclin-dependent kinase 4 (Cdk4) from Kibra, resulting in cell cycle progression. Consequently, overexpression or knockin of a non-phosphorylatable Kibra variant blocks release of Cdk4 from Kibra, retaining cells in G1 phase, which leads to a decreased cell proliferation and thus inhibition of organ and organism growth. Our results elucidate a novel, Hippo pathway-independent function of Kibra in cell cycle regulation and control of organ growth.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Phosphorylation of Kibra by RSK regulates binding to Cdk4 to control cell cycle progression and organ growth independently of the Hippo-pathway\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2023-10-03 12:47:15\",\"doi\":\"10.21203/rs.3.rs-3293493/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"cell-death-and-differentiation\",\"isNatureJournal\":false,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"cdd\",\"sideBox\":\"Learn more about [Cell Death \\u0026 Differentiation](http://www.nature.com/cdd/)\",\"snPcode\":\"41418\",\"submissionUrl\":\"https://mts-cdd.nature.com/cgi-bin/main.plex\",\"title\":\"Cell Death \\u0026 Differentiation\",\"twitterHandle\":\"@cddpress\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"62639377-c9b8-4313-9bcf-ff4ba924294e\",\"owner\":[],\"postedDate\":\"October 3rd, 2023\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"under-review\",\"subjectAreas\":[{\"id\":24855074,\"name\":\"Biological sciences/Cell biology/Cell division/Checkpoints\"},{\"id\":24855075,\"name\":\"Biological sciences/Developmental biology/Experimental organisms/Model invertebrates/Drosophila\"}],\"tags\":[],\"updatedAt\":\"2026-02-06T19:47:02+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2023-10-03 12:47:15\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3293493\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3293493\",\"identity\":\"rs-3293493\",\"version\":[\"v1\"]},\"buildId\":\"_2-kVJe1T_tPrBINL-cwx\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}