{"paper_id":"01a329a8-8904-42b9-a2ef-abdfdcd0daa9","body_text":"Inhibitory effects of crocin on breast cancer cell proliferation and apoptosis: Mediation via downregulation of ERα and suppression of p38 MAPK/Akt signaling pathways | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Inhibitory effects of crocin on breast cancer cell proliferation and apoptosis: Mediation via downregulation of ERα and suppression of p38 MAPK/Akt signaling pathways Xinyu Jiang, Yumei Jia, Bo Zhang, kai Yang, Lijiang Yang, Yang Li This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6338876/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective: This study investigates the inhibitory effects of Crocin on estrogen receptor-positive (ER+) MCF-7 and estrogen receptor-negative (ER-) MDA-MB-231 breast cancer cells, as well as its potential molecular mechanisms. Methods: The CCK-8 assay was used to assess the effect of Crocin on cell proliferation, and the optimal concentration and treatment time were selected. Cell apoptosis was measured by Annexin V-FITC/PI double staining. Western blot analysis was performed to examine the protein expression of ERα, p38 MAPK, and p-Akt, while qPCR was used to analyze the mRNA levels of ERα, p38 MAPK, and Akt. Results: Crocin inhibited the proliferation of breast cancer cells in a concentration-dependent manner, with a stronger effect on MCF-7 cells compared to MDA-MB-231 cells (P<0.05). Western blot analysis revealed that Crocin significantly downregulated the expression of ERα, p-p38 MAPK, and p-Akt proteins (P<0.05), which was consistent with the qPCR results. Conclusion: Crocin may inhibit breast cancer cell proliferation and induce apoptosis by regulating the ERα-mediated estrogen signaling pathway and the p38 MAPK/Akt signaling axis, with a more pronounced effect on ER-positive cells. This study provides new theoretical insights for the application of Crocin in breast cancer treatment. Crocin breast cancer estrogen signaling pathway MAPK/Akt signaling Traditional Chinese Medicine Figures Figure 1 Figure 2 Figure 3 1. Introduction Breast cancer is the most prevalent cancer among women in China, and its incidence continues to rise globally( 1 ). Global breast cancer statistics show particularly rapid incidence growth in developing countries, with China accounting for ~ 18% of new cases annually( 2 ).Therefore, finding effective treatments for breast cancer has become an urgent issue. In recent years, treatment options for breast cancer have expanded, including surgery, chemotherapy, radiation therapy, and the emerging field of immunotherapy( 3 – 6 ). While immunotherapy (e.g., PD-1/PD-L1 inhibitors) shows promise for triple-negative breast cancer, its efficacy remains limited in ER + subtypes( 7 ). As patients' expectations for breast cancer treatment have risen, and in light of the side effects and complications associated with surgery and chemotherapy, integrative treatments combining traditional Chinese and Western medicine have gained increasing recognition and attention. More and more individuals are turning to Traditional Chinese Medicine as a potential treatment option( 8 ). Clinical studies demonstrate that TCM-Western medicine integration reduces chemotherapy-induced nausea/vomiting by 37% and fatigue by 28% compared to Western therapy alone( 9 ). Furthermore, research indicates that Traditional Chinese Medicine (TCM) not only effectively alleviates the adverse reactions induced by Western treatments but also significantly improves patients' quality of life by regulating the body's overall homeostasis( 10 ). Notably, TCM’s approach to breast diseases can be traced back to ancient medical texts, with detailed descriptions of conditions such as 'lumps' and 'breast masses' found in the Huangdi Neijing from the Han Dynasty. TCM has established a systematic treatment framework that includes the use of classical formulas, acupuncture( 11 ), and physical condition adjustment. This approach has shown significant value, particularly in adjunctive cancer therapy, immune regulation, and symptom management( 12 ). Modern pharmacological research further reveals that classical TCM formulas regulate estrogen metabolism( 13 ), inhibit tumor angiogenesis, and affect multiple molecular pathways, bridging traditional medical wisdom with contemporary translational medicine. Crocin is an active compound extracted from the traditional Chinese medicine( 14 ), Gardenia, known for its beneficial effects in lowering blood lipids, reducing blood glucose( 15 ), and exhibiting anti-tumor properties( 16 ). This study focuses on crocin, an active compound extracted from Gardenia, to explore its inhibitory mechanisms in breast cancer. In our preliminary research, we employed network pharmacology to investigate the potential link between crocin and breast cancer, confirming that crocin is one of the key active components in Gardenia extract. Through Gene Ontology (GO) functional annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis, we hypothesize that Crocin may exert its potential inhibitory effect in breast cancer by modulating estrogen-related signaling pathways( 17 ). This finding provides an important theoretical foundation for further investigation into the application of Gardenia extract in breast cancer treatment and establishes a clear direction for subsequent experimental validation. We hope that this research will offer more scientific evidence and guidance for the clinical use of Traditional Chinese Medicine in breast cancer treatment. 2. Materials and Methods 2.1 Reagents Crocin, paclitaxel, and other reagents were purchased from Aladdin Biochemical Technology Co., Ltd. (China). The MCF-7 specific culture medium (Catalog number: GZ10503) and MDA-MB-231 specific culture medium (Catalog number: GZ10504) were obtained from Wuhan Sevier Biological Co., Ltd. (China). The CCK-8 cell proliferation assay kit was purchased from Vigor Biotech Co., Ltd. (Catalog number: AWC0114). The Annexin V-EGFP/PI apoptosis detection kit was also purchased from Wuhan Sevier Biological Co., Ltd. (Catalog number: G1510). The rapid protein blocking solution was from Wuhan Sevier Biological Co., Ltd. (Catalog number: G2052). Primary antibodies for Western blot (β-actin, Catalog number: GB15001-100; p-Akt, Catalog number: GB150002-100; ERα, Catalog number: GB151845-100; p38 MAPK, Catalog number: GB153380-100) and the secondary antibody (HRP-Goat Anti-Rabbit, Catalog number: ZB15001-HRP-100) were all sourced from Wuhan Sevier Biological Co., Ltd. 2.2 Experimental Equipment Flow cytometer: FACSCalibur (BD Biosciences, USA); Microscope: Nikon (Japan); CO2 incubator: SANTN (China); LightCycler480 real-time PCR system (Roche, Switzerland); Tecan Infinite® 200 Pro multi-functional microplate reader (Tecan, Switzerland); 550 automated microplate reader (BIO-RAD, USA). 2.3 Experimental Cells MCF-7 (ER-positive) and MDA-MB-231 (ER-negative) cells were purchased from Wuhan Sevier Biological Co., Ltd. 2.4 Experimental Methods 2.4.1 Cell Culture MCF-7 (ER-positive) and MDA-MB-231 (ER-negative) cells were cultured in their respective specific media and incubated at 37°C with 5% CO2. The media were changed every 48 hours, and cells were passaged every 2–3 days. 2.4.2 CCK-8 Assay for Cell Proliferation MCF-7 and MDA-MB-231 cells in the logarithmic growth phase were collected and seeded at a density of 1×10⁴ cells per well in a 96-well plate. Six different concentrations (0, 5, 10, 20, 40, 60 µmol/L) of Crocin and a paclitaxel control group were prepared with DMSO as the solvent. After 24, 48, and 72 hours of incubation at 37°C, 100 µL of the drug solution was added per well, followed by gentle shaking. After each incubation period, 200 µL of CCK-8 reagent was added to each well, and the plate was incubated for 2 hours at 37°C. Absorbance at 450 nm was measured using a microplate reader. The inhibition rate was calculated using the following formula: Inhibition rate = [(OD of control group - OD of treated group) / OD of control group] × 100%. The IC50 value was also determined. 2.4.3 Flow Cytometry for Apoptosis Detection The apoptosis rate was measured using the Annexin V-EGFP/PI apoptosis detection kit. Cells in the logarithmic growth phase were collected, washed with cold PBS, and resuspended in buffer. Annexin V-EGFP was added according to the manufacturer's instructions, and cells were incubated in the dark. PI was then added, and flow cytometry was used to analyze the apoptosis rate. 2.4.4 Western Blot Analysis of ERα, p38 MAPK, and p-Akt Expression MCF-7 and MDA-MB-231 cells were treated with different concentrations of Crocin for 48 hours. Cells were lysed on ice for 20 minutes using RIPA lysis buffer, followed by centrifugation at 12,000 rpm for 20 minutes at 4°C to collect the supernatant. Protein concentrations were determined using a BCA assay kit. A total of 40 µg of protein was loaded onto SDS-PAGE gels, transferred to membranes, and blocked for 5 minutes with a rapid protein blocking solution. The membranes were incubated overnight at 4°C with primary antibodies against ERα (1:1000), p38 MAPK (1:1400), p-Akt (1:1000), and β-actin (1:8000). After washing, the membranes were incubated with HRP-conjugated secondary antibodies at room temperature for 2 hours. Protein bands were visualized using ECL detection and analyzed using ImageJ software. 2.4.5 qPCR for ERα, p38 MAPK, and Akt mRNA Expression Total RNA was extracted from cells using the Trizol method. One microgram of RNA was reverse transcribed into cDNA using a reverse transcription kit. The cDNA was then amplified using a quantitative PCR kit. The PCR conditions were as follows: 95°C for 30 seconds, 95°C for 10 seconds, and 60°C for 30 seconds, with 40 cycles. β-actin was used as the internal control, and relative gene expression was calculated using the 2 − ΔΔCt method. The primer sequences are listed in Table 1 . Table 1 Primer Sequences Used for qPCR Primer Name Primer Sequence ERα Forward Primer: 5'- GAGGAGGAAGAGAGGGAAGG − 3' Reverse Primer: 5'- TGAAGTGGATGGCTTTTGGA − 3' p38 MAPK Forward Primer: 5'- GGGGAGGGGGAGATGAGGAG − 3' Reverse Primer: 5'- GGGCGGACAGGAGGGAAGAA − 3' AKT Forward Primer: 5'- CCTGGAAGGCGGAAATGAA − 3' Reverse Primer: 5'- AGGTTGGAGACAGTGGGGA − 3' β-actin Forward Primer:5'- CATGTACGTTGCTATCCAGGC -3' Reverse Primer: 5'- CTCCTTAATGTCACGCACGAT − 3' 2.5 Statistical Analysis Experimental data are expressed as mean ± standard deviation (Mean ± SD). Data were analyzed using SPSS 22.0 software. For comparisons among multiple groups, one-way analysis of variance (ANOVA) was used, while t-tests were applied for comparisons between two groups. A p-value of < 0.05 was considered statistically significant. 2.6 Ethical Compliance This in vitro study did not involve human participants or animal experiments. Therefore, Ethics Approval, Consent to Participate, and Consent to Publish declarations are not applicable. 3. Results 3.1 Crocin inhibits proliferation of breast cancer cells in a concentration- and time-dependent manner As shown in Tables 2 and 3 , Crocin inhibited the proliferation of both MCF-7 (ER-positive) and MDA-MB-231 (ER-negative) cells at different concentrations. This inhibitory effect increased with prolonged incubation, demonstrating a concentration- and time-dependent effect. In the 24, 48, and 72-hour experiments, the IC₅₀ values of Crocin for MCF-7 (ER-positive) cells were 51.43, 49.09, and 23.64 µmol/L, respectively, while for MDA-MB-231 (ER-negative) cells, the IC₅₀ values were 73.52, 53.36, and 26.08 µmol/L, respectively. Based on these results, the low, medium, and high dose groups for MCF-7 cells were set at 23.64, 49.09, and 51.43 µmol/L, respectively, and cultured for 48 hours. For MDA-MB-231 cells, the low, medium, and high dose groups were set at 26, 53, and 73 µmol/L, respectively, and cultured for 48 hours for subsequent experimental analysis. Table 2 Effect of Different Concentrations of Crocin on MCF-7 Cell Proliferation (Mean ± SD, n = 3) 24/h 48/h 72/h concentration (µmol/L) A450 IR IC50 (µmol/L) A450 IR IC50 (µmol/L) A450 IR IC50 (µmol/L) 0 2.4318 ± 0.145 2.3765 ± 0.048 2.452 ± 0.149 5 2.1921 ± 0.009 89% 51.43 2.0219 ± 0.023 84% 49.09 1.9759 ± 0.047 79% 23.64 10 1.9788 ± 0.056 79% 1.8866 ± 0.007 77% 1.7601 ± 0.028 69% 20 1.7059 ± 0.073 66% 1.5386 ± 0.035 61% 1.3777 ± 0.017 52% 40 1.4624 ± 0.044 55% 1.3796 ± 0.025 54% 1.141 ± 0.400 41% 80 1.1955 ± 0.082 42% 0.7799 ± 0.024 27% 0.481 ± 0.069 12% Table 3 Effect of Different Concentrations of Crocin on MDA-MB-231 Cell Proliferation (Mean ± SD, n = 3) 24/h 48/h 72/h concentration (µmol/L) A450 IR IC50 (µmol/L) A450 IR IC50 (µmol/L) A450 IR IC50 (µmol/L) 0 0.8582 ± 0.021 0.8416 ± 0.036 0.832 ± 0.018 5 0.8058 ± 0.009 92% 73.52 0.7949 ± 0.053 93% 53.36 0.7702 ± 0.037 90% 26.0 10 0.752 ± 0.005 84% 0.7531 ± 0.043 86% 0.627 ± 0.028 67% 20 0.7157 ± 0.003 78% 0.6298 ± 0.018 67% 0.5716 ± 0.022 59% 40 0.6268 ± 0.013 64% 0.5668 ± 0.038 57% 0.3939 ± 0.007 30% 80 0.5182 ± 0.018 47% 0.3796 ± 0.018 27% 0.2856 ± 0.007 13% 3.2 Crocin induces apoptosis in breast cancer cells MCF-7 cells were treated with 23.64 µmol/L (low dose), 49.09 µmol/L (medium dose), and 51.43 µmol/L (high dose), while MDA-MB-231 cells were treated with 26 µmol/L (low dose), 53 µmol/L (medium dose), and 73 µmol/L (high dose). Flow cytometry analysis showed that apoptosis rates significantly increased in both cell types with increasing drug concentrations (P < 0.05). Notably, the apoptosis rate in MCF-7 cells in the high-dose group was 3.2 times higher than that of the control group (P < 0.01), whereas in MDA-MB-231 cells, it increased 1.8 times (P < 0.05). These results suggest that ER-positive MCF-7 cells are more sensitive to the pro-apoptotic effects of Crocin. This finding implies that Crocin may enhance its pro-apoptotic effect through an ERα-dependent pathway. 2.3 Crocin inhibits p-Akt, ERα and p-p38 MAPK protein expression in breast cancer cells Western blot analysis was performed to detect the expression of p-Akt, ERα, and p-p38 MAPK proteins in each group, as shown in Fig. 2 . Compared to the control group, the expression of p-Akt, ERα, and p38 MAPK proteins was significantly reduced in the MCF-7 cell group ( P < 0.05). Similarly, in the MDA-MB-231 cell group, the expression of p-Akt, ERα, and p38 MAPK proteins was also significantly lower than that in the control group ( P < 0.05). Furthermore, the reduction in protein expression of p-Akt, ERα, and p38 MAPK was more pronounced in the MCF-7 cell group compared to the MDA-MB-231 cell group ( P < 0.05). 3.4 Crocin reduces Akt, ERα and p38 MAPK mRNA expression in breast cancer cells qPCR was used to measure the mRNA expression of Akt, ERα, and p38 MAPK in each group, as shown in Fig. 3 . Compared to the control group, the mRNA expression of Akt, ERα, and p38 MAPK was significantly reduced in the MCF-7 cell group ( P < 0.05). Similarly, in the MDA-MB-231 cell group, the mRNA expression of Akt, ERα, and p38 MAPK was also significantly lower than in the control group ( P < 0.05). Furthermore, the reduction in Akt, ERα, and p38 MAPK mRNA expression was more pronounced in the MCF-7 (ER-positive) cell group compared to the MDA-MB-231 cell group ( P < 0.05). 4. Discussion Breast cancer, a prevalent malignancy in women, is closely associated with the aberrant activation of estrogen signaling pathways, particularly in estrogen receptor-positive (ER-positive) breast cancer. Crocin, a major active component extracted from Crocus sativus L. (saffron), is a diterpene glycoside with various biological activities, including antioxidant, anti-inflammatory, and anti-cancer properties. In recent years, it has gained significant attention as a promising natural product in cancer research 13 . The anti-inflammatory effects of crocin are mediated through inhibition of NF-κB and COX-2 pathways, which are critical in breast cancer progression( 18 ).Modern pharmacological studies have shown that Crocin can modulate signaling pathways such as PI3K/Akt, MAPK, and Wnt/β-catenin to alleviate neuroinflammation and oxidative stress 16 . Crocin’s ability to downregulate ERα expression has been linked to its suppression of estrogen-mediated transcriptional activity, making it a potential adjunct to hormonal therapy( 21 ).Experimental evidence suggests that Crocin induces apoptosis, inhibits breast cancer cell proliferation, and regulates the expression of estrogen receptor alpha (ERα), highlighting its potential as a therapeutic agent for estrogen receptor-positive (ER-positive) breast cancer( 22 ). Furthermore, the chemical synthesis and structural modification of Crocin, particularly through cyclodextrin-derived glycosylation reactions( 23 ), enable efficient total synthesis, offering a new pathway for scaled production and laying the foundation for its clinical application. Despite promising preclinical data, the clinical translation of crocin requires further pharmacokinetic optimization due to its low bioavailability( 24 ). This study investigated the effects of crocin on breast cancer cell proliferation and apoptosis in vitro, as well as its association with estrogen signaling pathways. The results demonstrated that crocin significantly inhibited the viability of both MCF-7 (ER-positive) and MDA-MB-231 (ER-negative) cells and induced apoptosis by downregulating ERα, p38 MAPK, and p-Akt expression. Notably, ER-positive cells exhibited greater sensitivity to Crocin. These findings provide new mechanistic insights into the anti-breast cancer effects of crocin. The CCK-8 assay confirmed that Crocin exerted a dose-dependent inhibitory effect on both breast cancer cell lines. However, its inhibitory effect was significantly stronger on ER-positive MCF-7 cells than on ER-negative MDA-MB-231 cells. This difference suggests that the anticancer effect of crocin may be partially dependent on ERα-mediated signaling pathways. Notably, although MDA-MB-231 cells do not express ERα, crocin can still induce apoptosis through the p38 MAPK or Akt pathway. However, its pro-apoptotic effect in these cells is not significant, consistent with previous studies reporting the limited efficacy of plant-derived compounds against ER-negative breast cancer( 25 ). Further analysis using Annexin V/PI double staining revealed that crocin significantly increased apoptosis in both cell lines. However, in the high-dose group, the apoptosis rate of MCF-7 cells reached 3.2 times that of the control group, markedly higher than the 1.8-fold increase observed in MDA-MB-231 cells. This difference in the dose-response relationship may result from the synergistic interaction between the ERα pathway and other apoptotic pathways, such as the mitochondrial pathway( 26 ). Western blot and qPCR results demonstrated that crocin significantly reduced ERα protein and mRNA expression in MCF-7 cells. Traditionally, ERα is considered a key mediator of estrogen signaling, and its overexpression is often associated with breast cancer proliferation( 27 ). The downregulation of ERα induced by crocin may inhibit breast cancer cell growth by antagonizing ERα-dependent proliferative signaling. Additionally, this study observed a significant reduction in the expression of key proteins and genes in the p38 MAPK and Akt pathways( 28 ). This suggests that crocin may exert its effects not only through the ERα-mediated estrogen signaling pathway but also by suppressing p38 MAPK- and Akt-dependent survival signals, further weakening the adaptability of breast cancer cells. As a stress-activated kinase, p38 MAPK is typically involved in the transmission of apoptotic signals( 29 ). However, its role in breast cancer is dual: low-intensity activation may promote cell adaptation to stress, while high-intensity or sustained activation triggers apoptosis( 30 ). This study found that after intervention with saffron glycoside, the expression of p38 MAPK was significantly downregulated, suggesting that in this experimental model, saffron glycoside primarily exerts a pro-survival effect. By inhibiting this pathway, saffron glycoside weakens the cell's adaptive capacity, thus promoting breast cancer cell death. Akt primarily regulates cell survival through the PI3K/Akt/mTOR pathway and inhibits apoptosis( 31 ). After saffron glycoside intervention, p-Akt was significantly downregulated, indicating that the anti-apoptotic effect of this pathway was suppressed, potentially by reducing Bcl-2 expression or inhibiting the mTOR signal, thereby decreasing breast cancer cell survival and promoting apoptosis. Moreover, there is an interaction between ERα and the Akt pathway, where ERα can rapidly activate Akt through a non-genomic mechanism, and Akt can phosphorylate ERα to enhance its transcriptional activity( 32 ). This study demonstrates that after saffron glycoside intervention, both ERα and p-Akt are downregulated simultaneously. This may disrupt the positive feedback loop, thereby weakening estrogen-dependent survival signals, ultimately inhibiting breast cancer cell proliferation and promoting apoptosis. This study also has certain limitations. First, only two breast cancer cell lines were used; future research should include more subtypes and normal breast epithelial cells to verify specificity. Second, it is unclear whether saffron glycoside exerts its effects through direct binding to ERα, and further validation through molecular docking or ligand competition experiments is needed. Additionally, the lack of in vivo experiments means that extrapolating the results to clinical settings should be done with caution. Future studies could combine animal models to explore the pharmacokinetics of saffron glycoside and its potential synergistic effects with existing therapies, while also providing a deeper understanding of the specific molecular nodes involved in the interaction between ERα and the p38 MAPK/Akt pathways. In summary, saffron glycoside II inhibits breast cancer cell proliferation and induces apoptosis by regulating the ERα, p38 MAPK, and Akt signaling pathways, with a stronger inhibitory effect on ER-positive cells. This finding not only provides new evidence for the anti-cancer mechanisms of plant-derived active ingredients but also offers theoretical support for developing targeted therapeutic strategies based on ER signaling regulation for breast cancer. Declarations Conflict of Interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Funding This research was financially supported by the \"Integrative Western and Traditional Chinese Medicine Focus-DCA Mode Intervention for Preventing Postoperative Infections in Elderly Patients with Gastrointestinal Malignancies\" project, with the project number A2023053, funded by the Hunan Provincial Administration of Traditional Chinese Medicine. Author Contribution Xinyu Jiang conducted the main experiments, performed data analysis, and drafted the manuscript. Yumei Jia and Bo Zhang assisted with cell culture, molecular biology experiments, and data collection. Kai Yang contributed to statistical analysis and figure preparation. Lijiang Yang provided technical guidance and assisted in the interpretation of results. Yang Li supervised the study, secured funding, and revised the manuscript for important intellectual content. All authors reviewed and approved the final version of the manuscript. Data Availability The data generated or analyzed during this study are included in this published article and its supplementary files. Additional data are available from the corresponding author upon reasonable request. References Qiu H, Cao S, Xu R. Cancer incidence, mortality, and burden in China: a time-trend analysis and comparison with the United States and United Kingdom based on the global epidemiological data released in 2020. Cancer Commun. 2021;41:1037–48. 10.1002/cac2.12197 . Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71:209–49. 10.3322/caac.21660 . Fisher B, Anderson S, Bryant J, Margolese RG, Deutsch M, Fisher ER, Jeong J-H, Wolmark N. Twenty-year follow-up of a randomized trial comparing total mastectomy, lumpectomy, and lumpectomy plus irradiation for the treatment of invasive breast cancer. N Engl J Med. 2002;347:1233–41. 10.1056/NEJMoa022152 . Slamon DJ, Leyland-Jones B, Shak S, Fuchs H, Paton V, Bajamonde A, Fleming T, Eiermann W, Wolter J, Pegram M, et al. Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N Engl J Med. 2001;344:783–92. 10.1056/NEJM200103153441101 . Early Breast Cancer Trialists’ Collaborative Group (EBCTCG), Darby S, McGale P, Correa C, Taylor C, Arriagada R, Clarke M, Cutter D, Davies C, Ewertz M, et al. Effect of radiotherapy after breast-conserving surgery on 10-year recurrence and 15-year breast cancer death: meta-analysis of individual patient data for 10,801 women in 17 randomised trials. Lancet. 2011;378:1707–16. 10.1016/S0140-6736(11)61629-2 . Schmid P, Adams S, Rugo HS, Schneeweiss A, Barrios CH, Iwata H, Diéras V, Hegg R, Im S-A, Shaw Wright G, et al. Atezolizumab and Nab-Paclitaxel in Advanced Triple-Negative Breast Cancer. N Engl J Med. 2018;379:2108–21. 10.1056/NEJMoa1809615 . Emens LA. Breast Cancer Immunotherapy: Facts and Hopes. Clin Cancer Res. 2018;24:511–20. 10.1158/1078-0432.CCR-16-3001 . Wu Y, Zhang F, Yang K, Fang S, Bu D, Li H, Sun L, Hu H, Gao K, Wang W, et al. SymMap: an integrative database of traditional Chinese medicine enhanced by symptom mapping. Nucleic Acids Res. 2019;47:D1110–7. 10.1093/nar/gky1021 . Greenlee H, DuPont-Reyes MJ, Balneaves LG, Carlson LE, Cohen MR, Deng G, Johnson JA, Mumber M, Seely D, Zick SM, et al. Clinical practice guidelines on the evidence-based use of integrative therapies during and after breast cancer treatment. CA Cancer J Clin. 2017;67:194–232. 10.3322/caac.21397 . Fang Y-W, Chen S-F, Wang M-L, Wang M-H. Effects of traditional Chinese medicine-assisted intervention on improving postpartum lactation: A systematic review and meta-analysis. Heliyon. 2024;10:e27154. 10.1016/j.heliyon.2024.e27154 . Zhang Z, Yu Q, Zhang X, Wang X, Su Y, He W, Li J, Wan H, Jing X. Electroacupuncture regulates inflammatory cytokines by activating the vagus nerve to enhance antitumor immunity in mice with breast tumors. Life Sci. 2021;272:119259. 10.1016/j.lfs.2021.119259 . Liu L, Zhang CS, Zhang AL, Cai Y, Xue CC. Oral Chinese herbal medicine combined with donepezil for mild cognitive impairment: A systematic review and meta-analysis. J Am Geriatr Soc. 2024;72:3890–902. 10.1111/jgs.19125 . Chen W-F, Xu L, Yu C-H, Ho C-K, Wu K, Leung GC, Wong M-S. The in vivo Therapeutic Effect of Free Wanderer Powder (xiāo yáo sǎn, Xiaoyaosan) on Mice with 4T1 Cell Induced Breast Cancer Model. J Tradit Complement Med. 2012;2:67–75. 10.1016/s2225-4110(16)30073-6 . Cerdá-Bernad D, Valero-Cases E, Pastor J-J, Frutos MJ. Saffron bioactives crocin, crocetin and safranal: effect on oxidative stress and mechanisms of action. Crit Rev Food Sci Nutr. 2022;62:3232–49. 10.1080/10408398.2020.1864279 . Xi L, Qian Z, Xu G, Zhou C, Sun S. Crocetin attenuates palmitate-induced insulin insensitivity and disordered tumor necrosis factor-alpha and adiponectin expression in rat adipocytes. Br J Pharmacol. 2007;151:610–7. 10.1038/sj.bjp.0707276 . Mollaei H, Safaralizadeh R, Babaei E, Abedini MR, Hoshyar R. The anti-proliferative and apoptotic effects of crocin on chemosensitive and chemoresistant cervical cancer cells. Biomed Pharmacother. 2017;94:307–16. 10.1016/j.biopha.2017.07.052 . Jiang X, Li Y, Yang Q. Investigating the Relationship between Crocin from Gardenia and Breast Cancer Based on Network Pharmacology. Practical Med Res, 2(3), 24–33. https://doi.org/10.70711/pmr.v2i3.5464 Lu P, Lin H, Gu Y, Li L, Guo H, Wang F, Qiu X. Antitumor effects of crocin on human breast cancer cells. Int J Clin Exp Med. 2015;8:20316–22. Boozari M, Hosseinzadeh H. Crocin molecular signaling pathways at a glance: A comprehensive review. Phytother Res. 2022;36:3859–84. 10.1002/ptr.7583 . Fernández-Albarral JA, de Hoz R, Ramírez AI, López-Cuenca I, Salobrar-García E, Pinazo-Durán MD, Ramírez JM, Salazar JJ. Beneficial effects of saffron (Crocus sativus L.) in ocular pathologies, particularly neurodegenerative retinal diseases. Neural Regen Res. 2020;15:1408–16. 10.4103/1673-5374.274325 . Bakshi HA, Quinn GA, Nasef MM, Mishra V, Aljabali AAA, El-Tanani M, Serrano-Aroca Á, Webba Da Silva M, McCarron PA, Tambuwala MM. Crocin Inhibits Angiogenesis and Metastasis in Colon Cancer via TNF-α/NF-kB/VEGF Pathways. Cells. 2022;11:1502. 10.3390/cells11091502 . Mir MA, Ganai SA, Mansoor S, Jan S, Mani P, Masoodi KZ, Amin H, Rehman MU, Ahmad P. Isolation, purification and characterization of naturally derived Crocetin beta-d-glucosyl ester from Crocus sativus L. against breast cancer and its binding chemistry with ER-alpha/HDAC2. Saudi J Biol Sci. 2020;27:975–84. 10.1016/j.sjbs.2020.01.018 . Hoshyar R, Mollaei H. A comprehensive review on anticancer mechanisms of the main carotenoid of saffron, crocin. J Pharm Pharmacol. 2017;69:1419–27. 10.1111/jphp.12776 . Shah HM, Jain AS, Joshi SV, Kharkar PS. Crocetin and related oxygen diffusion-enhancing compounds: Review of chemical synthesis, pharmacology, clinical development, and novel therapeutic applications. Drug Dev Res. 2021;82:883–95. 10.1002/ddr.21814 . Hillis AL, Martin TD, Manchester HE, Högström J, Zhang N, Lecky E, Kozlova N, Lee J, Persky NS, Root DE, et al. Targeting Cholesterol Biosynthesis with Statins Synergizes with AKT Inhibitors in Triple-Negative Breast Cancer. Cancer Res. 2024;84:3250–66. 10.1158/0008-5472.CAN-24-0970 . Xing Y, Huang B, Cui Z, Zhang Q, Ma H. Dioscin improves fatty liver hemorrhagic syndrome by promoting ERα-AMPK mediated mitophagy in laying hens. Phytomedicine. 2024;135:156056. 10.1016/j.phymed.2024.156056 . Thomas C, Gustafsson J-Å. The different roles of ER subtypes in cancer biology and therapy. Nat Rev Cancer. 2011;11:597–608. 10.1038/nrc3093 . Shi A, Liu L, Li S, Qi B. Natural products targeting the MAPK-signaling pathway in cancer: overview. J Cancer Res Clin Oncol. 2024;150:6. 10.1007/s00432-023-05572-7 . He D, Wu H, Xiang J, Ruan X, Peng P, Ruan Y, Chen Y-G, Wang Y, Yu Q, Zhang H, et al. Gut stem cell aging is driven by mTORC1 via a p38 MAPK-p53 pathway. Nat Commun. 2020;11:37. 10.1038/s41467-019-13911-x . Thorpe LM, Yuzugullu H, Zhao JJ. PI3K in cancer: divergent roles of isoforms, modes of activation and therapeutic targeting. Nat Rev Cancer. 2015;15:7–24. 10.1038/nrc3860 . Yu L, Wei J, Liu P. Attacking the PI3K/Akt/mTOR signaling pathway for targeted therapeutic treatment in human cancer. Semin Cancer Biol. 2022;85:69–94. 10.1016/j.semcancer.2021.06.019 . Miller TW, Hennessy BT, González-Angulo AM, Fox EM, Mills GB, Chen H, Higham C, García-Echeverría C, Shyr Y, Arteaga CL. Hyperactivation of phosphatidylinositol-3 kinase promotes escape from hormone dependence in estrogen receptor-positive human breast cancer. J Clin Invest. 2010;120:2406–13. 10.1172/JCI41680 . Additional Declarations No competing interests reported. Supplementary Files qpcr.zip cck8.zip FlowCytometryforApoptosisDetection.zip wb.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6338876\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":455541009,\"identity\":\"017a4229-58ac-442e-a651-bf7083aa89f1\",\"order_by\":0,\"name\":\"Xinyu Jiang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xinyu\",\"middleName\":\"\",\"lastName\":\"Jiang\",\"suffix\":\"\"},{\"id\":455541010,\"identity\":\"68b7fd5e-e9d8-47f3-8c4b-c152678f5c00\",\"order_by\":1,\"name\":\"Yumei Jia\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yumei\",\"middleName\":\"\",\"lastName\":\"Jia\",\"suffix\":\"\"},{\"id\":455541011,\"identity\":\"6d267f80-dc2b-4e17-8c46-cfb3a34bd7cc\",\"order_by\":2,\"name\":\"Bo Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Bo\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":455541012,\"identity\":\"33b1b949-9d88-416e-a91f-310beeaeec64\",\"order_by\":3,\"name\":\"kai Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"kai\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":455541013,\"identity\":\"feed943d-c3eb-4f34-b264-28e5e6f9d6cb\",\"order_by\":4,\"name\":\"Lijiang Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Lijiang\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":455541014,\"identity\":\"8597577a-2ff5-4952-a33c-b5ba80a20ac6\",\"order_by\":5,\"name\":\"Yang Li\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0ElEQVRIiWNgGAWjYBACPmYwZZNAvBY2iJY0UrRAqMOkaGHnMfxc8Ot8njn74QcMH/fUMvDPbiDkMB5j6Zl9t4ste9IMGGc8O84gcecAQS0G0rw9txM33GAwYOY5cIzBQIKAI0G2/ObtOQfUwv6BaC1m0jw/DgC18IBsqSFGC1uZNW9DcuKGMzkFB2ccOMAjcYOAFn7+w5tv8/yxS9xw/PjGBx8O1MnxzyCghYGBw4CBsQ3CPACMIB5C6oGA/QEDwx84r44IHaNgFIyCUTDSAAD9UkCkTLp/2gAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"Hunan cancer Hospital, The Affiliated Cancer Hospital of Xiangya School of Medicne Central South University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Yang\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-03-30 14:08:12\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6338876/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6338876/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":82609068,\"identity\":\"223a1d42-dbd8-45a8-8d4f-9121595d6d94\",\"added_by\":\"auto\",\"created_at\":\"2025-05-13 10:26:34\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":503322,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffect of Crocin on Apoptosis in Cells (Flow Cytometry Analysis, n = 3) *Compared to the control group (0 μmol/L), *\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05, ***\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6338876/v1/fde731d18f5a8abc5b20bd95.png\"},{\"id\":82609942,\"identity\":\"ca64771e-2c0a-4668-88b7-acfafef566dc\",\"added_by\":\"auto\",\"created_at\":\"2025-05-13 10:34:34\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":269912,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffect of Crocin on the Expression of p-Akt, ERα, and p38 MAPK Proteins in Cells (n = 3, x̅ ± s). *Compared to the control group (0 μmol/L), *\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05, ***\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6338876/v1/03f2b565153ad5fc3a33072e.png\"},{\"id\":82609065,\"identity\":\"c94c9676-b9e7-4d8c-9d0b-97983b4249cb\",\"added_by\":\"auto\",\"created_at\":\"2025-05-13 10:26:34\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":104335,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffect of Crocin on the mRNA Expression of p-Akt, ERα, and p38 MAPK in Cells (n = 3, x̅ ± s). **Compared to the control group (0 μmol/L), **\\u003cem\\u003eP \\u003c/em\\u003e\\u0026lt; 0.05, ***\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6338876/v1/3ebd6c5a5b114fe3ab3d8f93.png\"},{\"id\":89276427,\"identity\":\"44832445-d852-4fe6-ab8c-97d409002368\",\"added_by\":\"auto\",\"created_at\":\"2025-08-18 09:32:19\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1657363,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6338876/v1/6777eae9-4048-438a-8fe9-585d581d8a47.pdf\"},{\"id\":82609939,\"identity\":\"dafde7d8-55ee-4255-b08d-b986d32da61c\",\"added_by\":\"auto\",\"created_at\":\"2025-05-13 10:34:34\",\"extension\":\"zip\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":444250,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"qpcr.zip\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6338876/v1/01c35b5ff020dc4732a6cc5d.zip\"},{\"id\":82611141,\"identity\":\"afd933a3-3179-49c7-855e-557524a2bbda\",\"added_by\":\"auto\",\"created_at\":\"2025-05-13 10:50:34\",\"extension\":\"zip\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":23225,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"cck8.zip\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6338876/v1/07c2356b1173e836ace38cd4.zip\"},{\"id\":82609087,\"identity\":\"8f794944-a16d-4641-89ba-2eff8b1831e0\",\"added_by\":\"auto\",\"created_at\":\"2025-05-13 10:26:39\",\"extension\":\"zip\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":65138992,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FlowCytometryforApoptosisDetection.zip\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6338876/v1/4b88b015fec85de9a7a5e4fe.zip\"},{\"id\":82609074,\"identity\":\"a2eb9c3f-f500-46ba-891f-bb4dec333481\",\"added_by\":\"auto\",\"created_at\":\"2025-05-13 10:26:35\",\"extension\":\"docx\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":197690,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"wb.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6338876/v1/2fad6af38e61179a3862098c.docx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Inhibitory effects of crocin on breast cancer cell proliferation and apoptosis: Mediation via downregulation of ERα and suppression of p38 MAPK/Akt signaling pathways\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003eBreast cancer is the most prevalent cancer among women in China, and its incidence continues to rise globally(\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e). Global breast cancer statistics show particularly rapid incidence growth in developing countries, with China accounting for ~\\u0026thinsp;18% of new cases annually(\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e).Therefore, finding effective treatments for breast cancer has become an urgent issue. In recent years, treatment options for breast cancer have expanded, including surgery, chemotherapy, radiation therapy, and the emerging field of immunotherapy(\\u003cspan additionalcitationids=\\\"CR4 CR5\\\" citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e). While immunotherapy (e.g., PD-1/PD-L1 inhibitors) shows promise for triple-negative breast cancer, its efficacy remains limited in ER\\u0026thinsp;+\\u0026thinsp;subtypes(\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e). As patients' expectations for breast cancer treatment have risen, and in light of the side effects and complications associated with surgery and chemotherapy, integrative treatments combining traditional Chinese and Western medicine have gained increasing recognition and attention. More and more individuals are turning to Traditional Chinese Medicine as a potential treatment option(\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e). Clinical studies demonstrate that TCM-Western medicine integration reduces chemotherapy-induced nausea/vomiting by 37% and fatigue by 28% compared to Western therapy alone(\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e). Furthermore, research indicates that Traditional Chinese Medicine (TCM) not only effectively alleviates the adverse reactions induced by Western treatments but also significantly improves patients' quality of life by regulating the body's overall homeostasis(\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e). Notably, TCM\\u0026rsquo;s approach to breast diseases can be traced back to ancient medical texts, with detailed descriptions of conditions such as 'lumps' and 'breast masses' found in the Huangdi Neijing from the Han Dynasty. TCM has established a systematic treatment framework that includes the use of classical formulas, acupuncture(\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e), and physical condition adjustment. This approach has shown significant value, particularly in adjunctive cancer therapy, immune regulation, and symptom management(\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e). Modern pharmacological research further reveals that classical TCM formulas regulate estrogen metabolism(\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e), inhibit tumor angiogenesis, and affect multiple molecular pathways, bridging traditional medical wisdom with contemporary translational medicine. Crocin is an active compound extracted from the traditional Chinese medicine(\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e), Gardenia, known for its beneficial effects in lowering blood lipids, reducing blood glucose(\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e), and exhibiting anti-tumor properties(\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e). This study focuses on crocin, an active compound extracted from Gardenia, to explore its inhibitory mechanisms in breast cancer. In our preliminary research, we employed network pharmacology to investigate the potential link between crocin and breast cancer, confirming that crocin is one of the key active components in Gardenia extract. Through Gene Ontology (GO) functional annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis, we hypothesize that Crocin may exert its potential inhibitory effect in breast cancer by modulating estrogen-related signaling pathways(\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e). This finding provides an important theoretical foundation for further investigation into the application of Gardenia extract in breast cancer treatment and establishes a clear direction for subsequent experimental validation. We hope that this research will offer more scientific evidence and guidance for the clinical use of Traditional Chinese Medicine in breast cancer treatment.\\u003c/p\\u003e\"},{\"header\":\"2. Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1 Reagents\\u003c/h2\\u003e \\u003cp\\u003eCrocin, paclitaxel, and other reagents were purchased from Aladdin Biochemical Technology Co., Ltd. (China). The MCF-7 specific culture medium (Catalog number: GZ10503) and MDA-MB-231 specific culture medium (Catalog number: GZ10504) were obtained from Wuhan Sevier Biological Co., Ltd. (China). The CCK-8 cell proliferation assay kit was purchased from Vigor Biotech Co., Ltd. (Catalog number: AWC0114). The Annexin V-EGFP/PI apoptosis detection kit was also purchased from Wuhan Sevier Biological Co., Ltd. (Catalog number: G1510). The rapid protein blocking solution was from Wuhan Sevier Biological Co., Ltd. (Catalog number: G2052). Primary antibodies for Western blot (β-actin, Catalog number: GB15001-100; p-Akt, Catalog number: GB150002-100; ERα, Catalog number: GB151845-100; p38 MAPK, Catalog number: GB153380-100) and the secondary antibody (HRP-Goat Anti-Rabbit, Catalog number: ZB15001-HRP-100) were all sourced from Wuhan Sevier Biological Co., Ltd.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2 Experimental Equipment\\u003c/h2\\u003e \\u003cp\\u003eFlow cytometer: FACSCalibur (BD Biosciences, USA); Microscope: Nikon (Japan); CO2 incubator: SANTN (China); LightCycler480 real-time PCR system (Roche, Switzerland); Tecan Infinite\\u0026reg; 200 Pro multi-functional microplate reader (Tecan, Switzerland); 550 automated microplate reader (BIO-RAD, USA).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3 Experimental Cells\\u003c/h2\\u003e \\u003cp\\u003eMCF-7 (ER-positive) and MDA-MB-231 (ER-negative) cells were purchased from Wuhan Sevier Biological Co., Ltd.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4 Experimental Methods\\u003c/h2\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.4.1 Cell Culture\\u003c/h2\\u003e \\u003cp\\u003eMCF-7 (ER-positive) and MDA-MB-231 (ER-negative) cells were cultured in their respective specific media and incubated at 37\\u0026deg;C with 5% CO2. The media were changed every 48 hours, and cells were passaged every 2\\u0026ndash;3 days.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.4.2 CCK-8 Assay for Cell Proliferation\\u003c/h2\\u003e \\u003cp\\u003eMCF-7 and MDA-MB-231 cells in the logarithmic growth phase were collected and seeded at a density of 1\\u0026times;10⁴ cells per well in a 96-well plate. Six different concentrations (0, 5, 10, 20, 40, 60 \\u0026micro;mol/L) of Crocin and a paclitaxel control group were prepared with DMSO as the solvent. After 24, 48, and 72 hours of incubation at 37\\u0026deg;C, 100 \\u0026micro;L of the drug solution was added per well, followed by gentle shaking. After each incubation period, 200 \\u0026micro;L of CCK-8 reagent was added to each well, and the plate was incubated for 2 hours at 37\\u0026deg;C. Absorbance at 450 nm was measured using a microplate reader. The inhibition rate was calculated using the following formula:\\u003c/p\\u003e \\u003cp\\u003eInhibition rate = [(OD of control group - OD of treated group) / OD of control group] \\u0026times; 100%. The IC50 value was also determined.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.4.3 Flow Cytometry for Apoptosis Detection\\u003c/h2\\u003e \\u003cp\\u003eThe apoptosis rate was measured using the Annexin V-EGFP/PI apoptosis detection kit. Cells in the logarithmic growth phase were collected, washed with cold PBS, and resuspended in buffer. Annexin V-EGFP was added according to the manufacturer's instructions, and cells were incubated in the dark. PI was then added, and flow cytometry was used to analyze the apoptosis rate.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.4.4 Western Blot Analysis of ERα, p38 MAPK, and p-Akt Expression\\u003c/h2\\u003e \\u003cp\\u003eMCF-7 and MDA-MB-231 cells were treated with different concentrations of Crocin for 48 hours. Cells were lysed on ice for 20 minutes using RIPA lysis buffer, followed by centrifugation at 12,000 rpm for 20 minutes at 4\\u0026deg;C to collect the supernatant. Protein concentrations were determined using a BCA assay kit. A total of 40 \\u0026micro;g of protein was loaded onto SDS-PAGE gels, transferred to membranes, and blocked for 5 minutes with a rapid protein blocking solution. The membranes were incubated overnight at 4\\u0026deg;C with primary antibodies against ERα (1:1000), p38 MAPK (1:1400), p-Akt (1:1000), and β-actin (1:8000). After washing, the membranes were incubated with HRP-conjugated secondary antibodies at room temperature for 2 hours. Protein bands were visualized using ECL detection and analyzed using ImageJ software.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.4.5 qPCR for ERα, p38 MAPK, and Akt mRNA Expression\\u003c/h2\\u003e \\u003cp\\u003eTotal RNA was extracted from cells using the Trizol method. One microgram of RNA was reverse transcribed into cDNA using a reverse transcription kit. The cDNA was then amplified using a quantitative PCR kit. The PCR conditions were as follows: 95\\u0026deg;C for 30 seconds, 95\\u0026deg;C for 10 seconds, and 60\\u0026deg;C for 30 seconds, with 40 cycles. β-actin was used as the internal control, and relative gene expression was calculated using the 2\\u0026thinsp;\\u0026minus;\\u0026thinsp;ΔΔCt method. The primer sequences are listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePrimer Sequences Used for qPCR\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer Name\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ePrimer Sequence\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eERα\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward Primer: 5'- GAGGAGGAAGAGAGGGAAGG \\u0026minus;\\u0026thinsp;3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eReverse Primer: 5'- TGAAGTGGATGGCTTTTGGA \\u0026minus;\\u0026thinsp;3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ep38 MAPK\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward Primer: 5'- GGGGAGGGGGAGATGAGGAG \\u0026minus;\\u0026thinsp;3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eReverse Primer: 5'- GGGCGGACAGGAGGGAAGAA \\u0026minus;\\u0026thinsp;3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eAKT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward Primer: 5'- CCTGGAAGGCGGAAATGAA \\u0026minus;\\u0026thinsp;3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eReverse Primer: 5'- AGGTTGGAGACAGTGGGGA \\u0026minus;\\u0026thinsp;3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eβ-actin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward Primer:5'- CATGTACGTTGCTATCCAGGC -3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eReverse Primer: 5'- CTCCTTAATGTCACGCACGAT \\u0026minus;\\u0026thinsp;3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5 Statistical Analysis\\u003c/h2\\u003e \\u003cp\\u003eExperimental data are expressed as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation (Mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD). Data were analyzed using SPSS 22.0 software. For comparisons among multiple groups, one-way analysis of variance (ANOVA) was used, while t-tests were applied for comparisons between two groups. A p-value of \\u0026lt;\\u0026thinsp;0.05 was considered statistically significant.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.6 Ethical Compliance\\u003c/h2\\u003e \\u003cp\\u003eThis in vitro study did not involve human participants or animal experiments. Therefore, Ethics Approval, Consent to Participate, and Consent to Publish declarations are not applicable.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.1 Crocin inhibits proliferation of breast cancer cells in a concentration- and time-dependent manner\\u003c/h2\\u003e \\u003cp\\u003eAs shown in Tables\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e and \\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e, Crocin inhibited the proliferation of both MCF-7 (ER-positive) and MDA-MB-231 (ER-negative) cells at different concentrations. This inhibitory effect increased with prolonged incubation, demonstrating a concentration- and time-dependent effect. In the 24, 48, and 72-hour experiments, the IC₅₀ values of Crocin for MCF-7 (ER-positive) cells were 51.43, 49.09, and 23.64 \\u0026micro;mol/L, respectively, while for MDA-MB-231 (ER-negative) cells, the IC₅₀ values were 73.52, 53.36, and 26.08 \\u0026micro;mol/L, respectively. Based on these results, the low, medium, and high dose groups for MCF-7 cells were set at 23.64, 49.09, and 51.43 \\u0026micro;mol/L, respectively, and cultured for 48 hours. For MDA-MB-231 cells, the low, medium, and high dose groups were set at 26, 53, and 73 \\u0026micro;mol/L, respectively, and cultured for 48 hours for subsequent experimental analysis.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eEffect of Different Concentrations of Crocin on MCF-7 Cell Proliferation (Mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD, n\\u0026thinsp;=\\u0026thinsp;3)\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"10\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c8\\\" colnum=\\\"8\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c9\\\" colnum=\\\"9\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c10\\\" colnum=\\\"10\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"4\\\" nameend=\\\"c4\\\" namest=\\\"c1\\\"\\u003e \\u003cp\\u003e24/h\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"3\\\" nameend=\\\"c7\\\" namest=\\\"c5\\\"\\u003e \\u003cp\\u003e48/h\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"3\\\" nameend=\\\"c10\\\" namest=\\\"c8\\\"\\u003e \\u003cp\\u003e72/h\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003econcentration (\\u0026micro;mol/L)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eA450\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eIR\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eIC50\\u003c/p\\u003e \\u003cp\\u003e(\\u0026micro;mol/L)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eA450\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eIR\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eIC50\\u003c/p\\u003e \\u003cp\\u003e(\\u0026micro;mol/L)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003eA450\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003eIR\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c10\\\"\\u003e \\u003cp\\u003eIC50\\u003c/p\\u003e \\u003cp\\u003e(\\u0026micro;mol/L)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e0\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e2.4318\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.145\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e2.3765\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.048\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e2.452\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.149\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c10\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e2.1921\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.009\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e89%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\" morerows=\\\"4\\\" rowspan=\\\"5\\\"\\u003e \\u003cp\\u003e51.43\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e2.0219\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.023\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e84%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\" morerows=\\\"4\\\" rowspan=\\\"5\\\"\\u003e \\u003cp\\u003e49.09\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e1.9759\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.047\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e79%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c10\\\" morerows=\\\"4\\\" rowspan=\\\"5\\\"\\u003e \\u003cp\\u003e23.64\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1.9788\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.056\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e79%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e1.8866\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.007\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e77%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e1.7601\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.028\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e69%\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e20\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1.7059\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.073\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e66%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e1.5386\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.035\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e61%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e1.3777\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.017\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e52%\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e40\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1.4624\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.044\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e55%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e1.3796\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.025\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e54%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e1.141\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.400\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e41%\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e80\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1.1955\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.082\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e42%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.7799\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.024\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e27%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.481\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.069\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e12%\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab3\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 3\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eEffect of Different Concentrations of Crocin on MDA-MB-231 Cell Proliferation (Mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD, n\\u0026thinsp;=\\u0026thinsp;3)\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"10\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c8\\\" colnum=\\\"8\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c9\\\" colnum=\\\"9\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c10\\\" colnum=\\\"10\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"4\\\" nameend=\\\"c4\\\" namest=\\\"c1\\\"\\u003e \\u003cp\\u003e24/h\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"3\\\" nameend=\\\"c7\\\" namest=\\\"c5\\\"\\u003e \\u003cp\\u003e48/h\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"3\\\" nameend=\\\"c10\\\" namest=\\\"c8\\\"\\u003e \\u003cp\\u003e72/h\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003econcentration (\\u0026micro;mol/L)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eA450\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eIR\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eIC50\\u003c/p\\u003e \\u003cp\\u003e(\\u0026micro;mol/L)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eA450\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eIR\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eIC50\\u003c/p\\u003e \\u003cp\\u003e(\\u0026micro;mol/L)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003eA450\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003eIR\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c10\\\"\\u003e \\u003cp\\u003eIC50\\u003c/p\\u003e \\u003cp\\u003e(\\u0026micro;mol/L)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e0\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.8582\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.021\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.8416\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.036\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.832\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.018\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c10\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.8058\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.009\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e92%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\" morerows=\\\"4\\\" rowspan=\\\"5\\\"\\u003e \\u003cp\\u003e73.52\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.7949\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.053\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e93%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\" morerows=\\\"4\\\" rowspan=\\\"5\\\"\\u003e \\u003cp\\u003e53.36\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.7702\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.037\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e90%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c10\\\" morerows=\\\"4\\\" rowspan=\\\"5\\\"\\u003e \\u003cp\\u003e26.0\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.752\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.005\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e84%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.7531\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.043\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e86%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.627\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.028\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e67%\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e20\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.7157\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.003\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e78%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.6298\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.018\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e67%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.5716\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.022\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e59%\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e40\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.6268\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.013\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e64%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.5668\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.038\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e57%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.3939\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.007\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e30%\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e80\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.5182\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.018\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e47%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.3796\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.018\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e27%\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.2856\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.007\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e13%\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.2 Crocin induces apoptosis in breast cancer cells\\u003c/h2\\u003e \\u003cp\\u003eMCF-7 cells were treated with 23.64 \\u0026micro;mol/L (low dose), 49.09 \\u0026micro;mol/L (medium dose), and 51.43 \\u0026micro;mol/L (high dose), while MDA-MB-231 cells were treated with 26 \\u0026micro;mol/L (low dose), 53 \\u0026micro;mol/L (medium dose), and 73 \\u0026micro;mol/L (high dose). Flow cytometry analysis showed that apoptosis rates significantly increased in both cell types with increasing drug concentrations (P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05). Notably, the apoptosis rate in MCF-7 cells in the high-dose group was 3.2 times higher than that of the control group (P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01), whereas in MDA-MB-231 cells, it increased 1.8 times (P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05). These results suggest that ER-positive MCF-7 cells are more sensitive to the pro-apoptotic effects of Crocin. This finding implies that Crocin may enhance its pro-apoptotic effect through an ERα-dependent pathway.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3 Crocin inhibits p-Akt, ERα and p-p38 MAPK protein expression in breast cancer cells\\u003c/h2\\u003e \\u003cp\\u003eWestern blot analysis was performed to detect the expression of p-Akt, ERα, and p-p38 MAPK proteins in each group, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e. Compared to the control group, the expression of p-Akt, ERα, and p38 MAPK proteins was significantly reduced in the MCF-7 cell group (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05). Similarly, in the MDA-MB-231 cell group, the expression of p-Akt, ERα, and p38 MAPK proteins was also significantly lower than that in the control group (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05). Furthermore, the reduction in protein expression of p-Akt, ERα, and p38 MAPK was more pronounced in the MCF-7 cell group compared to the MDA-MB-231 cell group (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.4 Crocin reduces Akt, ERα and p38 MAPK mRNA expression in breast cancer cells\\u003c/h2\\u003e \\u003cp\\u003eqPCR was used to measure the mRNA expression of Akt, ERα, and p38 MAPK in each group, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e. Compared to the control group, the mRNA expression of Akt, ERα, and p38 MAPK was significantly reduced in the MCF-7 cell group (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05). Similarly, in the MDA-MB-231 cell group, the mRNA expression of Akt, ERα, and p38 MAPK was also significantly lower than in the control group (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05). Furthermore, the reduction in Akt, ERα, and p38 MAPK mRNA expression was more pronounced in the MCF-7 (ER-positive) cell group compared to the MDA-MB-231 cell group (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"4. Discussion\",\"content\":\"\\u003cp\\u003eBreast cancer, a prevalent malignancy in women, is closely associated with the aberrant activation of estrogen signaling pathways, particularly in estrogen receptor-positive (ER-positive) breast cancer. Crocin, a major active component extracted from Crocus sativus L. (saffron), is a diterpene glycoside with various biological activities, including antioxidant, anti-inflammatory, and anti-cancer properties. In recent years, it has gained significant attention as a promising natural product in cancer research\\u003csup\\u003e13\\u003c/sup\\u003e. The anti-inflammatory effects of crocin are mediated through inhibition of NF-κB and COX-2 pathways, which are critical in breast cancer progression(\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e).Modern pharmacological studies have shown that Crocin can modulate signaling pathways such as PI3K/Akt, MAPK, and Wnt/β-catenin to alleviate neuroinflammation and oxidative stress\\u003csup\\u003e16\\u003c/sup\\u003e. Crocin\\u0026rsquo;s ability to downregulate ERα expression has been linked to its suppression of estrogen-mediated transcriptional activity, making it a potential adjunct to hormonal therapy(\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e).Experimental evidence suggests that Crocin induces apoptosis, inhibits breast cancer cell proliferation, and regulates the expression of estrogen receptor alpha (ERα), highlighting its potential as a therapeutic agent for estrogen receptor-positive (ER-positive) breast cancer(\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e). Furthermore, the chemical synthesis and structural modification of Crocin, particularly through cyclodextrin-derived glycosylation reactions(\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e), enable efficient total synthesis, offering a new pathway for scaled production and laying the foundation for its clinical application. Despite promising preclinical data, the clinical translation of crocin requires further pharmacokinetic optimization due to its low bioavailability(\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eThis study investigated the effects of crocin on breast cancer cell proliferation and apoptosis in vitro, as well as its association with estrogen signaling pathways. The results demonstrated that crocin significantly inhibited the viability of both MCF-7 (ER-positive) and MDA-MB-231 (ER-negative) cells and induced apoptosis by downregulating ERα, p38 MAPK, and p-Akt expression. Notably, ER-positive cells exhibited greater sensitivity to Crocin. These findings provide new mechanistic insights into the anti-breast cancer effects of crocin. The CCK-8 assay confirmed that Crocin exerted a dose-dependent inhibitory effect on both breast cancer cell lines. However, its inhibitory effect was significantly stronger on ER-positive MCF-7 cells than on ER-negative MDA-MB-231 cells. This difference suggests that the anticancer effect of crocin may be partially dependent on ERα-mediated signaling pathways. Notably, although MDA-MB-231 cells do not express ERα, crocin can still induce apoptosis through the p38 MAPK or Akt pathway. However, its pro-apoptotic effect in these cells is not significant, consistent with previous studies reporting the limited efficacy of plant-derived compounds against ER-negative breast cancer(\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e). Further analysis using Annexin V/PI double staining revealed that crocin significantly increased apoptosis in both cell lines. However, in the high-dose group, the apoptosis rate of MCF-7 cells reached 3.2 times that of the control group, markedly higher than the 1.8-fold increase observed in MDA-MB-231 cells. This difference in the dose-response relationship may result from the synergistic interaction between the ERα pathway and other apoptotic pathways, such as the mitochondrial pathway(\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eWestern blot and qPCR results demonstrated that crocin significantly reduced ERα protein and mRNA expression in MCF-7 cells. Traditionally, ERα is considered a key mediator of estrogen signaling, and its overexpression is often associated with breast cancer proliferation(\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e). The downregulation of ERα induced by crocin may inhibit breast cancer cell growth by antagonizing ERα-dependent proliferative signaling. Additionally, this study observed a significant reduction in the expression of key proteins and genes in the p38 MAPK and Akt pathways(\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e). This suggests that crocin may exert its effects not only through the ERα-mediated estrogen signaling pathway but also by suppressing p38 MAPK- and Akt-dependent survival signals, further weakening the adaptability of breast cancer cells. As a stress-activated kinase, p38 MAPK is typically involved in the transmission of apoptotic signals(\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e). However, its role in breast cancer is dual: low-intensity activation may promote cell adaptation to stress, while high-intensity or sustained activation triggers apoptosis(\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e). This study found that after intervention with saffron glycoside, the expression of p38 MAPK was significantly downregulated, suggesting that in this experimental model, saffron glycoside primarily exerts a pro-survival effect. By inhibiting this pathway, saffron glycoside weakens the cell's adaptive capacity, thus promoting breast cancer cell death. Akt primarily regulates cell survival through the PI3K/Akt/mTOR pathway and inhibits apoptosis(\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e). After saffron glycoside intervention, p-Akt was significantly downregulated, indicating that the anti-apoptotic effect of this pathway was suppressed, potentially by reducing Bcl-2 expression or inhibiting the mTOR signal, thereby decreasing breast cancer cell survival and promoting apoptosis. Moreover, there is an interaction between ERα and the Akt pathway, where ERα can rapidly activate Akt through a non-genomic mechanism, and Akt can phosphorylate ERα to enhance its transcriptional activity(\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e). This study demonstrates that after saffron glycoside intervention, both ERα and p-Akt are downregulated simultaneously. This may disrupt the positive feedback loop, thereby weakening estrogen-dependent survival signals, ultimately inhibiting breast cancer cell proliferation and promoting apoptosis.\\u003c/p\\u003e \\u003cp\\u003eThis study also has certain limitations. First, only two breast cancer cell lines were used; future research should include more subtypes and normal breast epithelial cells to verify specificity. Second, it is unclear whether saffron glycoside exerts its effects through direct binding to ERα, and further validation through molecular docking or ligand competition experiments is needed. Additionally, the lack of in vivo experiments means that extrapolating the results to clinical settings should be done with caution. Future studies could combine animal models to explore the pharmacokinetics of saffron glycoside and its potential synergistic effects with existing therapies, while also providing a deeper understanding of the specific molecular nodes involved in the interaction between ERα and the p38 MAPK/Akt pathways.\\u003c/p\\u003e \\u003cp\\u003eIn summary, saffron glycoside II inhibits breast cancer cell proliferation and induces apoptosis by regulating the ERα, p38 MAPK, and Akt signaling pathways, with a stronger inhibitory effect on ER-positive cells. This finding not only provides new evidence for the anti-cancer mechanisms of plant-derived active ingredients but also offers theoretical support for developing targeted therapeutic strategies based on ER signaling regulation for breast cancer.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e \\u003ch2\\u003eConflict of Interest\\u003c/h2\\u003e \\u003cp\\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\\u003c/p\\u003e \\u003c/p\\u003e\\u003ch2\\u003eFunding\\u003c/h2\\u003e \\u003cp\\u003eThis research was financially supported by the \\\"Integrative Western and Traditional Chinese Medicine Focus-DCA Mode Intervention for Preventing Postoperative Infections in Elderly Patients with Gastrointestinal Malignancies\\\" project, with the project number A2023053, funded by the Hunan Provincial Administration of Traditional Chinese Medicine.\\u003c/p\\u003e\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\u003cp\\u003eXinyu Jiang conducted the main experiments, performed data analysis, and drafted the manuscript. Yumei Jia and Bo Zhang assisted with cell culture, molecular biology experiments, and data collection. Kai Yang contributed to statistical analysis and figure preparation. Lijiang Yang provided technical guidance and assisted in the interpretation of results. Yang Li supervised the study, secured funding, and revised the manuscript for important intellectual content. All authors reviewed and approved the final version of the manuscript.\\u003c/p\\u003e\\u003ch2\\u003eData Availability\\u003c/h2\\u003e\\u003cp\\u003eThe data generated or analyzed during this study are included in this published article and its supplementary files. Additional data are available from the corresponding author upon reasonable request.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eQiu H, Cao S, Xu R. Cancer incidence, mortality, and burden in China: a time-trend analysis and comparison with the United States and United Kingdom based on the global epidemiological data released in 2020. Cancer Commun. 2021;41:1037\\u0026ndash;48. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/cac2.12197\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/cac2.12197\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71:209\\u0026ndash;49. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3322/caac.21660\\u003c/span\\u003e\\u003cspan address=\\\"10.3322/caac.21660\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFisher B, Anderson S, Bryant J, Margolese RG, Deutsch M, Fisher ER, Jeong J-H, Wolmark N. Twenty-year follow-up of a randomized trial comparing total mastectomy, lumpectomy, and lumpectomy plus irradiation for the treatment of invasive breast cancer. N Engl J Med. 2002;347:1233\\u0026ndash;41. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1056/NEJMoa022152\\u003c/span\\u003e\\u003cspan address=\\\"10.1056/NEJMoa022152\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSlamon DJ, Leyland-Jones B, Shak S, Fuchs H, Paton V, Bajamonde A, Fleming T, Eiermann W, Wolter J, Pegram M, et al. Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N Engl J Med. 2001;344:783\\u0026ndash;92. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1056/NEJM200103153441101\\u003c/span\\u003e\\u003cspan address=\\\"10.1056/NEJM200103153441101\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEarly Breast Cancer Trialists\\u0026rsquo; Collaborative Group (EBCTCG), Darby S, McGale P, Correa C, Taylor C, Arriagada R, Clarke M, Cutter D, Davies C, Ewertz M, et al. Effect of radiotherapy after breast-conserving surgery on 10-year recurrence and 15-year breast cancer death: meta-analysis of individual patient data for 10,801 women in 17 randomised trials. Lancet. 2011;378:1707\\u0026ndash;16. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/S0140-6736(11)61629-2\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/S0140-6736(11)61629-2\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSchmid P, Adams S, Rugo HS, Schneeweiss A, Barrios CH, Iwata H, Di\\u0026eacute;ras V, Hegg R, Im S-A, Shaw Wright G, et al. Atezolizumab and Nab-Paclitaxel in Advanced Triple-Negative Breast Cancer. N Engl J Med. 2018;379:2108\\u0026ndash;21. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1056/NEJMoa1809615\\u003c/span\\u003e\\u003cspan address=\\\"10.1056/NEJMoa1809615\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEmens LA. Breast Cancer Immunotherapy: Facts and Hopes. Clin Cancer Res. 2018;24:511\\u0026ndash;20. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1158/1078-0432.CCR-16-3001\\u003c/span\\u003e\\u003cspan address=\\\"10.1158/1078-0432.CCR-16-3001\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu Y, Zhang F, Yang K, Fang S, Bu D, Li H, Sun L, Hu H, Gao K, Wang W, et al. SymMap: an integrative database of traditional Chinese medicine enhanced by symptom mapping. Nucleic Acids Res. 2019;47:D1110\\u0026ndash;7. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/nar/gky1021\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/nar/gky1021\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGreenlee H, DuPont-Reyes MJ, Balneaves LG, Carlson LE, Cohen MR, Deng G, Johnson JA, Mumber M, Seely D, Zick SM, et al. Clinical practice guidelines on the evidence-based use of integrative therapies during and after breast cancer treatment. CA Cancer J Clin. 2017;67:194\\u0026ndash;232. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3322/caac.21397\\u003c/span\\u003e\\u003cspan address=\\\"10.3322/caac.21397\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFang Y-W, Chen S-F, Wang M-L, Wang M-H. Effects of traditional Chinese medicine-assisted intervention on improving postpartum lactation: A systematic review and meta-analysis. Heliyon. 2024;10:e27154. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.heliyon.2024.e27154\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.heliyon.2024.e27154\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang Z, Yu Q, Zhang X, Wang X, Su Y, He W, Li J, Wan H, Jing X. Electroacupuncture regulates inflammatory cytokines by activating the vagus nerve to enhance antitumor immunity in mice with breast tumors. Life Sci. 2021;272:119259. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.lfs.2021.119259\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.lfs.2021.119259\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu L, Zhang CS, Zhang AL, Cai Y, Xue CC. Oral Chinese herbal medicine combined with donepezil for mild cognitive impairment: A systematic review and meta-analysis. J Am Geriatr Soc. 2024;72:3890\\u0026ndash;902. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/jgs.19125\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/jgs.19125\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen W-F, Xu L, Yu C-H, Ho C-K, Wu K, Leung GC, Wong M-S. The in vivo Therapeutic Effect of Free Wanderer Powder (xiāo y\\u0026aacute;o sǎn, Xiaoyaosan) on Mice with 4T1 Cell Induced Breast Cancer Model. J Tradit Complement Med. 2012;2:67\\u0026ndash;75. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/s2225-4110(16)30073-6\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/s2225-4110(16)30073-6\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCerd\\u0026aacute;-Bernad D, Valero-Cases E, Pastor J-J, Frutos MJ. Saffron bioactives crocin, crocetin and safranal: effect on oxidative stress and mechanisms of action. Crit Rev Food Sci Nutr. 2022;62:3232\\u0026ndash;49. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1080/10408398.2020.1864279\\u003c/span\\u003e\\u003cspan address=\\\"10.1080/10408398.2020.1864279\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXi L, Qian Z, Xu G, Zhou C, Sun S. Crocetin attenuates palmitate-induced insulin insensitivity and disordered tumor necrosis factor-alpha and adiponectin expression in rat adipocytes. Br J Pharmacol. 2007;151:610\\u0026ndash;7. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/sj.bjp.0707276\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/sj.bjp.0707276\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMollaei H, Safaralizadeh R, Babaei E, Abedini MR, Hoshyar R. The anti-proliferative and apoptotic effects of crocin on chemosensitive and chemoresistant cervical cancer cells. Biomed Pharmacother. 2017;94:307\\u0026ndash;16. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.biopha.2017.07.052\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.biopha.2017.07.052\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJiang X, Li Y, Yang Q. Investigating the Relationship between Crocin from Gardenia and Breast Cancer Based on Network Pharmacology. Practical Med Res, 2(3), 24\\u0026ndash;33. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.70711/pmr.v2i3.5464\\u003c/span\\u003e\\u003cspan address=\\\"10.70711/pmr.v2i3.5464\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLu P, Lin H, Gu Y, Li L, Guo H, Wang F, Qiu X. Antitumor effects of crocin on human breast cancer cells. Int J Clin Exp Med. 2015;8:20316\\u0026ndash;22.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBoozari M, Hosseinzadeh H. Crocin molecular signaling pathways at a glance: A comprehensive review. Phytother Res. 2022;36:3859\\u0026ndash;84. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/ptr.7583\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/ptr.7583\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFern\\u0026aacute;ndez-Albarral JA, de Hoz R, Ram\\u0026iacute;rez AI, L\\u0026oacute;pez-Cuenca I, Salobrar-Garc\\u0026iacute;a E, Pinazo-Dur\\u0026aacute;n MD, Ram\\u0026iacute;rez JM, Salazar JJ. Beneficial effects of saffron (Crocus sativus L.) in ocular pathologies, particularly neurodegenerative retinal diseases. Neural Regen Res. 2020;15:1408\\u0026ndash;16. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.4103/1673-5374.274325\\u003c/span\\u003e\\u003cspan address=\\\"10.4103/1673-5374.274325\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBakshi HA, Quinn GA, Nasef MM, Mishra V, Aljabali AAA, El-Tanani M, Serrano-Aroca \\u0026Aacute;, Webba Da Silva M, McCarron PA, Tambuwala MM. Crocin Inhibits Angiogenesis and Metastasis in Colon Cancer via TNF-α/NF-kB/VEGF Pathways. Cells. 2022;11:1502. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3390/cells11091502\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/cells11091502\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMir MA, Ganai SA, Mansoor S, Jan S, Mani P, Masoodi KZ, Amin H, Rehman MU, Ahmad P. Isolation, purification and characterization of naturally derived Crocetin beta-d-glucosyl ester from Crocus sativus L. against breast cancer and its binding chemistry with ER-alpha/HDAC2. Saudi J Biol Sci. 2020;27:975\\u0026ndash;84. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.sjbs.2020.01.018\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.sjbs.2020.01.018\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHoshyar R, Mollaei H. A comprehensive review on anticancer mechanisms of the main carotenoid of saffron, crocin. J Pharm Pharmacol. 2017;69:1419\\u0026ndash;27. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/jphp.12776\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/jphp.12776\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShah HM, Jain AS, Joshi SV, Kharkar PS. Crocetin and related oxygen diffusion-enhancing compounds: Review of chemical synthesis, pharmacology, clinical development, and novel therapeutic applications. Drug Dev Res. 2021;82:883\\u0026ndash;95. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/ddr.21814\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/ddr.21814\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHillis AL, Martin TD, Manchester HE, H\\u0026ouml;gstr\\u0026ouml;m J, Zhang N, Lecky E, Kozlova N, Lee J, Persky NS, Root DE, et al. Targeting Cholesterol Biosynthesis with Statins Synergizes with AKT Inhibitors in Triple-Negative Breast Cancer. Cancer Res. 2024;84:3250\\u0026ndash;66. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1158/0008-5472.CAN-24-0970\\u003c/span\\u003e\\u003cspan address=\\\"10.1158/0008-5472.CAN-24-0970\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXing Y, Huang B, Cui Z, Zhang Q, Ma H. Dioscin improves fatty liver hemorrhagic syndrome by promoting ERα-AMPK mediated mitophagy in laying hens. Phytomedicine. 2024;135:156056. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.phymed.2024.156056\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.phymed.2024.156056\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eThomas C, Gustafsson J-\\u0026Aring;. The different roles of ER subtypes in cancer biology and therapy. Nat Rev Cancer. 2011;11:597\\u0026ndash;608. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/nrc3093\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/nrc3093\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShi A, Liu L, Li S, Qi B. Natural products targeting the MAPK-signaling pathway in cancer: overview. J Cancer Res Clin Oncol. 2024;150:6. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s00432-023-05572-7\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00432-023-05572-7\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHe D, Wu H, Xiang J, Ruan X, Peng P, Ruan Y, Chen Y-G, Wang Y, Yu Q, Zhang H, et al. Gut stem cell aging is driven by mTORC1 via a p38 MAPK-p53 pathway. Nat Commun. 2020;11:37. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41467-019-13911-x\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41467-019-13911-x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eThorpe LM, Yuzugullu H, Zhao JJ. PI3K in cancer: divergent roles of isoforms, modes of activation and therapeutic targeting. Nat Rev Cancer. 2015;15:7\\u0026ndash;24. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/nrc3860\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/nrc3860\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYu L, Wei J, Liu P. Attacking the PI3K/Akt/mTOR signaling pathway for targeted therapeutic treatment in human cancer. Semin Cancer Biol. 2022;85:69\\u0026ndash;94. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.semcancer.2021.06.019\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.semcancer.2021.06.019\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMiller TW, Hennessy BT, Gonz\\u0026aacute;lez-Angulo AM, Fox EM, Mills GB, Chen H, Higham C, Garc\\u0026iacute;a-Echeverr\\u0026iacute;a C, Shyr Y, Arteaga CL. Hyperactivation of phosphatidylinositol-3 kinase promotes escape from hormone dependence in estrogen receptor-positive human breast cancer. J Clin Invest. 2010;120:2406\\u0026ndash;13. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1172/JCI41680\\u003c/span\\u003e\\u003cspan address=\\\"10.1172/JCI41680\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Crocin, breast cancer, estrogen signaling pathway, MAPK/Akt signaling, Traditional Chinese Medicine\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6338876/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6338876/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cstrong\\u003eObjective: \\u003c/strong\\u003eThis study investigates the inhibitory effects of Crocin on estrogen receptor-positive (ER+) MCF-7 and estrogen receptor-negative (ER-) MDA-MB-231 breast cancer cells, as well as its potential molecular mechanisms.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMethods: \\u003c/strong\\u003eThe CCK-8 assay was used to assess the effect of Crocin on cell proliferation, and the optimal concentration and treatment time were selected. Cell apoptosis was measured by Annexin V-FITC/PI double staining. Western blot analysis was performed to examine the protein expression of ERα, p38 MAPK, and p-Akt, while qPCR was used to analyze the mRNA levels of ERα, p38 MAPK, and Akt.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eResults:\\u003c/strong\\u003e Crocin inhibited the proliferation of breast cancer cells in a concentration-dependent manner, with a stronger effect on MCF-7 cells compared to MDA-MB-231 cells (P\\u0026lt;0.05). Western blot analysis revealed that Crocin significantly downregulated the expression of ERα, p-p38 MAPK, and p-Akt proteins (P\\u0026lt;0.05), which was consistent with the qPCR results.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConclusion: \\u003c/strong\\u003eCrocin may inhibit breast cancer cell proliferation and induce apoptosis by regulating the ERα-mediated estrogen signaling pathway and the p38 MAPK/Akt signaling axis, with a more pronounced effect on ER-positive cells. This study provides new theoretical insights for the application of Crocin in breast cancer treatment.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Inhibitory effects of crocin on breast cancer cell proliferation and apoptosis: Mediation via downregulation of ERα and suppression of p38 MAPK/Akt signaling pathways\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-05-13 10:26:30\",\"doi\":\"10.21203/rs.3.rs-6338876/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"5b3298fd-0ef4-463b-8734-3c88a5aea599\",\"owner\":[],\"postedDate\":\"May 13th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-08-18T09:24:11+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-05-13 10:26:30\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6338876\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6338876\",\"identity\":\"rs-6338876\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}