{"paper_id":"0160e9da-972c-44ce-bbd5-31cb5c1b0830","body_text":"A Novel Mechanism of 16α-OHE1, One of Estrogen Metabolites, Alleviating Inflammatory Infiltration in Hypoxia-Induced Myocardial Injury via β2-Adrenergic Receptor | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article A Novel Mechanism of 16α-OHE1, One of Estrogen Metabolites, Alleviating Inflammatory Infiltration in Hypoxia-Induced Myocardial Injury via β2-Adrenergic Receptor Yequan Zhou, Zeyuan Yin, Junchao Cui, Zhonghui Cao, Cheng Wang, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3206949/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective The study aimed to investigate the protective effect of 16α-OHE1 on myocardial injury caused by hypoxia. Methods and results Rats were exposed to normoxia or hypoxia conditions simulating an high altitude of 6000 m in a low-pressure chamber for 7 days. Post-exposure, evaluations were made on cardiac function, myocardial enzyme concentrations, histopathological modifications, inflammatory infiltration, and β2-adrenergic receptor (β2AR) expression levels. In parallel, H9C2 cells were cultured under standard oxygen conditions or in a three-gas incubator containing 5% O 2 for 24 h. Cell viability, apoptosis, inflammatory infiltration, and myocardial enzyme levels in H9C2 cells were measured. Hypoxia induced significant myocardial damage, marked by impaired cardiac function, myocardial structural changes, inflammatory infiltration, and increased apoptosis. Pre-treatment with 16α-OHE1 significantly improved heart function and reduced myocardial enzyme release. The increased inflammatory response was also significantly suppressed. In addition to preserving myocardial structures, hypoxia-induced apoptosis in cardiomyocytes was significantly weakened. Notably, these protective effects of 16α-OHE1 were linked with the upregulation of β2AR expression. However, when β 2 AR was inhibited by ICI 118,551, the protective effect of 16α-OHE1 on the myocardium was abrogated. Conclusion 16α-OHE1 could reduce hypoxia-induced myocardial injury in rats through β 2 -adrenoceptors. hypoxia hypoxia-induced myocardial injury 16α-OHE1 estrogen metabolites Inflammatory Infiltration β2-adrenergic receptor Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Highlights The myocardial injury through hypoxia was induced and the preventive and protective effects of 16α-OHE1 on hypoxia-induced myocardial injury was confirmed. A novel mechanism of 16α-OHE1 alleviating inflammatory infiltration in hypoxia-induced myocardial injury was investigated. By instigating cardiomyocyte damage via hypoxia, it was identified that 16α-OHE1 against hypoxia-induced myocardial injury was caused by the activation of the β2-adrenergic receptor. 1. Introduction Myocardial injury refers to cardiomyocyte damage caused by various factors [ 1 , 2 ] . Among these, hypoxia stands out as one of the most prevalent and impactful triggers for this condition [ 3 ] . With rapid industrial development and urban expansion, there has been an increased exposure to environments with reduced oxygen levels, such as densely populated urban areas with high pollution and workplaces with deficient ventilation. Consequently, the incidence of hypoxia-induced myocardial injury has seen a significant surge, underscoring the need for effective myocardial protective strategies. Estrogen is an essential sex steroid hormone that functions primarily in female reproductive system, as well as in a variety of tissues and organs with pleiotropic effects, such as in cardiovascular, nervous, immune, and musculoskeletal systems [ 4 ] . Women with low estrogen, as exemplified by those in postmenopause, are therefore prone to suffer from various disorders including cardiovascular disease and metabolic syndrome [ 5 , 6 ] . In our previous study, estrogen can protect right ventricular function in patients with pulmonary hypertension through BMPR2 and apelin [ 7 ] . Estrogen has been reported to alleviate chronic stress-induced cardiomyopathy by regulating macrophage polarization [ 8 ] . Natural estrogens include estrone (E1), estradiol (E2), estriol (E3), etc. They have many types of metabolites, such as the methylated metabolite 2-methoxyestrone (2-MeOE1), 2-methoxyestradiol (2-MeOE2), etc., hydroxylated metabolites 2-hydroxyestrone (2-OHE1), 2-hydroxyestradiol (2-OHE2), 16α-OHE1 (16α-OHE1), and so on [ 9 ] . An inverse relationship between serum concentrations of 16α-OHE1 and systolic blood pressure (SBP) in postmenopausal women has been found after adjusting for age, BMI, race/ethnicity, and antihypertensive drug use [ 10 ] . Previous studies have shown that 16α-OHE1 is a potent antioxidant [ 11 ] that can increase endothelial cell production of prostacyclin, which is a vasodilator, at twice the rate of E2 [ 12 ] . 16α-OHE1 may also increase endothelial nitric oxide synthase (eNOS) gene expression, nitric oxide (a vasodilator) production, and vascular endothelial cell proliferation [ 13 ] . In addition, 16α-OHE1 can also reduce dysfunction of left ventricular contractility by regulating myocardial ischemia and autophagy after reperfusion [ 14 ] . However, no studies have reported a relationship between 16α-OHE1 and hypoxia-induced myocardial injury. In the physiological state, the positive inotropic and temporal function of the heart is mediated by β adrenergic receptors (βARs) through G-stimulating proteins (G s ), mainly β 1 -adrenergic receptor (β 1 AR) and β 2 -adrenergic receptor (β 2 AR) [ 8 ] . However, overstimulation of receptors during chronic stress leads to the downregulation of β 1 AR expression, which transmits signals via G-suppressor protein (G i ) to prevent heart damage [ 15 ] . The literature has reported that β 2 AR plays a key role in cardiomyocyte apoptosis, which is an important cellular response and a key mechanism leading to cardiomyopathy endpoints [ 16 ] . In addition, there have been studies suggesting that β 2 AR activation may prevent cardiac dysfunction [ 17 ] . It is well documented that β 2 AR activation can inhibit inflammatory infiltration and exert cardioprotective effects [ 18 ] . While the protective effects of 16α-OHE1 on myocardial injury were identified in our previous study [16], the underlying mechanism, primarily focused on ischemia and reperfusion, remained largely unexplored. Consequently, in this current research, we delve deeper into the protective role of 16α-OHE1 on hypoxia-induced myocardial injury in rats. Our objective is to elucidate the protective mechanism of 16α-OHE1 in diminishing the incidence of myocardial injury under hypoxic conditions. The insights gained from this study will form a solid foundation for subsequent translational research aimed at preventing myocardial injury in humans. 2. Materials and methods 2.1 Animals and Experimental Design All procedures were performed in accordance with the guidelines developed by the Institutional Animal Care and Use Committee of Xuzhou Medical University (Xuzhou, China). All the animals were housed in a barrier environment (24 ± 1°C; 12:12-h dark/light cycle) and provided food and water ad libitum before and during the experiment. Based on previous hypoxic animal studies, male Sprague‒Dawley (SD) rats (180–200 g) were purchased from Beijing Vitonglihua (Beijing, China) [ 19 ] . Thirty-six male SD rats were randomly divided into 6 groups (n = 6): normoxia + saline (N), hypoxia + saline (H), hypoxia + estradiol (H + E2), hypoxia + low-dose 16α-OHE1 (H + 16α-OHE1 37.5 µg/kg), hypoxia + medium-dose 16α-OHE1 (H + 16α-OHE1 75 µg/kg), and hypoxia + high-dose 16α-OHE1 (H + 16α-OHE1 150 µg/kg). The equal amount of normal saline was administered as a placebo to Groups N and H. The dose of estrogen administered was based on previous studies [ 7 ] . After one week of adaptive rearing, rats in Group N were intraperitoneally injected with an equal volume of normal saline for 14 days. After seven days of intraperitoneal injection of an equal volume of normal saline under normal oxygen, rats in Group H were placed in a low-pressure chamber to simulate hypoxia at 6000 meters for 24 hours/day for 7 days, and normal saline was injected every day. After seven days of intraperitoneal injection of 75 µg/kg E2 under normal oxygen condition, rats in H + E2 group were placed in a low-pressure chamber to simulate hypoxia at 6000 meters for 24 hours/day for 7 days, and E2 was injected intraperitoneally every day. For group H + 16αOHE1-L, H + 16αOHE1-M, and H + 16αOHE1-H, the rats were placed in a low-pressure chamber to stimulate hypoxia at 6000m for 24 hours/day for 7 days after peritoneal injection of 37.5, 75, and 150 ug/kg 16α-OHE1 respectively. And the 16α-OHE1 was injected intraperitoneally every day. 2.2 Cell Culture and Transfection H9C2 cells, the rat cardiomyocyte line, was cultured in DMEM containing 5.56 mmol/l d-glucose (normal glucose, NG) supplemented with 10% fetal bovine serum (Invitrogen, Grand Island, NY), 100 U/ml penicillin, and 100 µg/ml streptomycin in a humidified incubator at 37°C with 5% CO 2 . Cells were passaged at 80 − 90% confluence. Prior to the experiment, confluent cells were grown in serum-free DMEM for 24 h. To observe the effect of 16α-OHE1 on hypoxic damage in cardiomyocytes, H9C2 cells were divided into 6 groups. In the N group, H9C2 cells were cultured in a 5% CO 2 incubator. In Group H, H9C2 cells were cultured under hypoxic conditions in a three-gas incubator containing 1% O 2 , 5% CO 2 , and 94% N 2 for 24 h. In the H + E2 group, H9C2 cells were cultured under hypoxic conditions in a three-gas incubator containing 1% O 2 , 5% CO 2 , and 94% N 2 for 24 h, and E2 (1 nM) was added to the medium. For group H + low-dose 16α-OHE1, H + medium-dose, and H + high-dose 16α-OHE1, the H9C2 cells were cultured under hypoxic conditions in a three-gas incubator containing 1% O2, 5% CO2, and 94% N2 for 24 h, and 16α-OHE1 (0.5 nM, 1 nM, 2 nM) were added to the medium respectively. The dose selection was based on previous research [ 8 ] . For mechanistic studies, H9C2 cells were divided into 4 groups. In Group N, H9C2 cells were cultured in a 5% CO 2 incubator. In Group H, H9C2 cells were cultured under hypoxic conditions in a three-gas incubator containing 1% O 2 , 5% CO 2 , and 94% N 2 for 24 h. In the H + 16α-OHE1 group, H9C2 cells were cultured under hypoxic conditions in a three-gas incubator containing 1% O 2 , 5% CO 2 , and 94% N 2 for 24 h, and 16α-OHE1 (2 nM) was added to the medium. In the H + 16α-OHE1 + β2AR blocker group, H9C2 cells were cultured under hypoxic conditions for 24 h in a tri-gas incubator containing 1% O 2 , 5% CO 2 , and 94% N 2 , and 16α-OHE1 (2 nM) and ICI 118,551 (55 nM) were added to the medium. The dose selection was based on previous research [ 8 ] . 2.3 Body Weight and Cardiac Function Parameters At the end of the experiment, body weight was recorded. Electrocardiograms (ECGs) were recorded using the PowerLab data acquisition system (ADInstruments, USA). Before the heart was collected, the rats were intraperitoneally injected with heparin to inhibit coagulation and with a sodium pentobarbital (40 mg/kg) for anesthesia. After fixation of rats, the chest cavity was opened, the vena cava, aorta and pericardial tissues were cut, and the hearts were quickly removed and placed in ice-cold Krebs-Henseleit solution (K-H fluid) for cleaning and pruning. A cotton thread was inserted at the root of the aorta for backup, and an aortic cannula inserted into the aorta at the end of the perfusion duct was fixed with the prepared cotton thread. After perfusion with oxygenated K-H fluid, the heart could resume beating within 1 minute. After the heart resumed beating, a small amount of apical tissue was clamped with the frog clamp of the tether, which was connected to the muscle tone sensor. The cardiac contraction force output was recorded by the tension sensor of the biological function experimental system ( Chengdu Taimeng Technology Co.Ltd, BL-420S, China). Before recording the cardiac contraction force, the tightness of the tether connected to the tension sensor was adjusted so that the cardiac preload was approximately 3 g. After the experiment, the force at each time point was measured in the area, and the maximum systolic velocity (+ dp/dt max ), maximum diastolic velocity (-dp/dt max ), maximum tension (Tension max ) and minimum tension (Tension min ) were measured. 2.4 Histological Assessment Excised hearts (n = 6 hearts per group) were washed with prechilled PBS, blotted with filter paper, and fixed in 4% paraformaldehyde for more than 48 h. Next, the heart specimens were embedded in paraffin, sectioned at a thickness of 4 µm, and preserved for histological assessment. The myocardial sections were deparaffinized before Masson’s trichrome (Maxim Biotechnologies, Fuzhou, China), hematoxylin and eosin (H&E), and immunohistochemical (IHC) staining. Trichome staining was performed to determine the collagen volume fraction (CVF), while H&E staining was performed to assess diameters of cardiomyocytes and the extent of myocardial hypertrophy. Additionally, IHC staining of β 2 AR (Affinity Biosciences, DF3512, USA), CD68 (Bioss, bs-1432R, China), CD86 (Bioss, bs-1035R, China), and CD206 (Affinity Biosciences, DF4149, USA) was performed to assess the extent of myocardial infiltration caused by inflammatory cells. Imaging of the stained sections was performed at 400× magnification (BX43F, Olympus, Tokyo, Japan), and linear measurements were obtained using image analysis system (Image-Pro-Plus 4.0, Media Cybernetics, Silver Spring, MD). 2.5 Real-time PCR Total RNA was extracted from mouse heart tissue and GMCs with TRIzol reagent (15596-026; Invitrogen, Carlsbad, CA, USA). Then, mRNA was reverse transcribed, and the RT-Rever TraAce kit (FSQ-101; Toyobo Co, Osaka, Japan) was used to transcribe mRNA to cDNA. Real-time PCR was performed in the LC480 system (Roche Applied Science, Mannheim, Germany). The following gene primers (Sangon Biotech, Shanghai, China) were used to evaluate mRNA expression: (1) tumor necrosis factor alpha (TNF-α), forward GAAAGCATGATCCGAGATGTG, reverse CACGAGCAGGAATGAGAAGAG; (2) transforming growth factor-beta (TGF-β1), forward ATGGTGGACCGCA ACAACGC, reverse CTGGCACTGCTTCCCGAATGTC; (3) inducible nitric oxide synthase (iNOS), forward TCTTGGAGCGAGTTGTGGATTGT, reverse TAGGTGAGG GCTTGCCTGAGTG; and (4) arginase 1 (Arg-1), forward CGTTG. GAPDH was used as the internal reference. 2.6 Western Blotting The relative protein expression in H9C2 cells and rat heart tissue was examined. Briefly, cells and heart tissue were homogenized and lysed with RIPA buffer (P0013B; Beyotime Institute of Biotechnology, Nantong, China) containing 1 mmol/L PMSF (ST506; Beyotime Institute of Biotechnology, Nantong, China). Then, cells were incubated at 4°C for 30 min followed by centrifugation at 12,000 ×g and 4°C for 15 min to obtain the supernatant. The bicinchoninic acid (BCA) protein assay (23228; 1859078; Pierce Thermo-Scientific, Rockford, IL, USA) was performed to determine the protein concentration according to the manufacturer’s instructions. The following antibodies were used: ANP (1:1,000, Affinity Biosciences, DF6497, USA), BNP (1:1,000, Affinity Biosciences, DF6902, USA), β 2 AR (1:1,000, Affinity Biosciences, DF3512, USA), and GAPDH (1:4,000, Proteintech, 10494-1-AP, UK). Band density was quantified by densitometric analysis using ImageJ software, and the expression of β-actin was used as the internal reference. 2.7 ELISA Enzyme-linked immunosorbent assay (ELISA) was used to measure IL-6(Cusabio, EK306, China), IL-1β(Cusabio, EK301B, China), TNF-α(Cusabio, EK382, China), CK-MB(Wuhan Xinqidi Biotech Co.Ltd, EIA05488r, China) and cTnT(Wuhan Xinqidi Biotech Co.Ltd, EIA05536r, China) levels in rat myocardial tissue and H9C2 cells according to the manufacturer's instructions. 2.8 Cardiomyocyte Apoptosis Assay Apoptosis was measured by staining the with a combination of fluoresceinated (FITC) annexin V and propidium iodide (PI). Briefly, for annexin V-PI analysis, the cells were resuspended in 500 µl of binding buffer (containing 140 mM NaCl, 2.5 mM CaCl 2 , 10 mM HEPES; pH 7.4). After that, 5 µl of annexin V-FITC and 10 µl of PI-PBS solution (Keygen Biotech, KGA108, China) were added to 1×10 5 cells and incubated for 15 minutes at room temperature in the dark. Data acquisition was performed within 1 hour by flow cytometry to avoid cell damage and the diffusion of PI through the cell membrane. The results were analyzed using CellQuest software. 2.9 Cell Counting Kit-8 (CCK-8) assay H9C2 cells (2 × 10 3 cells per well) were seeded in a 96-well plate and incubated under normal or hypoxic conditions in complete medium. After the indicated time, 10 µL of CCK-8 solution (TargetMoI, C0005, USA) was added to each well and incubated at 37°C for another 4 h. The spectrophotometric absorbance was measured at 450 nm by microplate reader (Thermo Scientific, USA). The reagents and samples were prepared according to the manufacturer’s instructions as previously described. 2.10 Statistical Analysis All experimental data were analyzed using GraphPad Prism 7 software (GraphPad Software Inc., San Diego, CA, USA). The results were shown as the mean ± SEM. An unpaired t test was used to analyze the data between two groups. One-way ANOVA followed by Tukey’s multiple comparisons test was performed to analyze data from more than two groups. It was considered to be significant when p < 0.05. 3. Results 3.1 Hypoxia Increases Cardiac weight As shown in Fig. 2A, a significant decrease in body weight (BW) was observed in the group exposed to a low-pressure hypoxic environment compared to the normoxic group. Treatment with E2 or 16α-OHE1 slightly suppressed this decline, but the difference was not significant. Compared with those in the normoxic group, the rats in the hypoxic group had different increases in heart weight (HW), the heart weight/body weight ratio (HW/BW), lung weight (LW), and lung wet weight (LW/LW) (Fig. 2B-E). Pretreatment with medium and high doses of 16α-OHE1 (75 µg/kg, 150 µg/kg) reduced these values significantly, while the effects on the low-dose 16α-OHE1 (37.5 µg/kg) group were not statistically significant. However, this treatment reduced HW, HW/BW, LW, and LW/LW to some extent. Figure 1 Graphical presentations of morphometric data. (A) Body weight (BW). (B) Heart weight (HW). (C) HW/BW coefficient. (D) Lung weight (LW). (E) LW/BW coefficient. n = 6. * p < 0.05, ** p < 0.01 vs. N; # p < 0.05, ## p < 0.01 vs. H. The data were presented as the mean ± SEM. (one-way ANOVA) 3.2 16α-OHE1 Improves Heart Function After Hypoxia The ECG showed that rats in the hypoxic group had increased heart rates, which were decreased after treatment with medium and high doses of 16α-OHE1, but there was no significant effect in the low-dose 16α-OHE1 group, compared with those in the normoxic group (Fig. 3A). Compared with the N group, the H group showed a significant reduction in maximal systolic velocity, maximal diastolic velocity, and maximum tension, but there was no significant change in minimum tension (Fig. 3B-E). Compared with the H group, the low-dose 16α-OHE1 group had a slight increase in the maximal systolic velocity, maximal diastolic velocity, and maximum tension, but the difference was not statistically significant. High doses of 16α-OHE1 significantly increased the maximal systolic velocity, maximum diastolic velocity, and maximum tension. After treatment with medium-dose 16α-OHE1, the maximum systolic velocity did not increase significantly, and the difference was not statistically significant, but the maximum diastolic velocity and tension increased significantly. These results indicated that medium to high doses of 16α-OHE1 significantly improved hypoxia-induced cardiac systolic decline in rats. Figure 2 16 α-OHE1 improves cardiac function in rats with hypoxia-induced myocardial injury. (A) Graphical representation of the heart rate (HR). n = 6. (B, C) 16α-OHE1 increased the maximum systolic rate (+ dp/dt max ) and maximum diastolic velocity (-dp/dtmax) in rats with hypoxia-induced myocardial injury. (D, E) Maximum tension value (Tension max ) and minimum tension value (Tension min ) of rat hearts. n = 4. * p < 0.05, ** p < 0.01 vs. N; # p < 0.05, ## p < 0.01 vs. H. The data were presented as the mean ± SEM. (one-way ANOVA) 3.3 16α-OHE1 Alleviates Myocardial Damage in Hypoxic Rats and Promotes β 2 AR Expression Creatine kinase isoenzymes (CK-MB) and troponin T (cTnT) are markers of myocardial injury. As shown in the figure, the CK-MB and cTnT in the hypoxic group were increased significantly compared with those in the normoxic group, which indicates hypoxia-induced myocardial injury (Fig. 4A, B). However, compared with those in the H group, low, medium and high doses of 16α-OHE1 reduced CK-MB and cTnT values to varying degrees, and there were significant differences in the medium-dose and high-dose 16α-OHE1 groups. This finding suggested that 16α-OHE1 could improve myocardial damage caused by hypoxia. Next, we measured β 2 AR protein and gene expression in the rat myocardium. The results of Western blot showed that the expression of β 2 AR in the rat myocardium was significantly reduced by hypoxia (Fig. 4C, D). However, 16α-OHE1 administration increased β 2 AR expression. Immunohistochemistry (IHC) was used to examine β 2 AR expression in the myocardium, and the results were consistent with the Western blot results (Fig. 4E, F). Figure 3 16 α-OHE1 alleviates hypoxia-induced myocardial injury in rats. (A, B) Relative protein levels of β 2 -adrenoceptor (β 2 AR) in the rat myocardium. (C, D) ELISA kit were used to detect creatine kinase isoenzyme (CK-MB) and troponin T (cTnT) in the rat myocardium. (E, F) Relative protein levels of β 2 -adrenoceptor (β 2 AR) in the rat myocardium were determined by IHC. n = 6. * p < 0.05, ** p < 0.01 vs. N; # p < 0.05, ## p < 0.01 vs. H. The data were presented as the mean ± SEM. (one-way ANOVA) 3.4 16α-OHE1 Inhibits Myocardial Hypertrophy and Myocardial Fibrosis in Hypoxic Rats To determine the effect of hypoxia on myocardial structure, H&E and Masson staining were performed to assess the degree of cardiomyocyte hypertrophy and mesenchymal collagen deposition, respectively. Diameter of cardiomyocyte was measured in the H&E-stained myocardium and the results showed that hypoxia induced cardiomyocyte hypertrophy, and different doses of 16α-OHE1 could inhibit cardiomyocyte hypertrophy to varying degrees (Fig. 5A, B). Immunoblot analysis of atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) further confirmed this conclusion (Fig. 5C-F). The CVF evaluation showed an increase in myocardial interstitial fibrosis during hypoxia in SD rats (Fig. 5G, H). These results suggested that pretreatment with 16α-OHE1 significantly ameliorated injury. Figure 4 16 α-OHE1 inhibits myocardial remodeling in rats with hypoxia-induced myocardial injury. (A, B) Representative H&E staining and graphical presentation of the cardiomyocyte diameters. (C-F) Representative Western blotting and graphical presentations of the cardiac hypertrophy markers atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP). (G, H) Representative Masson’s trichrome staining and graphical presentation of the collagen volume fractions, which were evaluated to assess the extent of fibrosis. n = 6. * p < 0.05, ** p < 0.01 vs. N; # p < 0.05, ## p < 0.01 vs. H. The data are presented as the mean ± SEM. (one-way ANOVA) 3.5 16α-OHE1 Alleviates the Maladaptive Myocardial Inflammatory Response Myocardial inflammation during chronic stress exacerbates myocardial remodeling [ 20 ] . Therefore, we evaluated the potential of E2 in adaptive immunomodulation in the myocardium during hypoxia. CD68-positive IHC staining showed a slight increase in infiltrating macrophages in the myocardium during hypoxia, while pretreatment with 16α-OHE1 prevented the infiltration of a large number of CD68-positive cells into the myocardium during stress (Fig. 6A, D). Furthermore, CD86 and CD206 IHC staining showed that most inflammatory cells that infiltrated the myocardium during stress were CD86-positive (proinflammatory) cells, while CD206-positive (anti-inflammatory) cell infiltration was significantly hindered (Fig. 6B, C, E, F). However, the opposite results were observed in the H E2 group and the H 16α-OHE1 group during stress: anti-inflammatory cell infiltration increased significantly, while proinflammatory cell infiltration was inhibited in these groups. To validate the adaptive immunomodulation induced by 16α-OHE1, the mRNA expression of proinflammatory (TNF-α and iNOS) and anti-inflammatory (TGF-β1 and Arg-1) biomarkers in the myocardium was evaluated. Compared with that in the N group, the expression of TNF-α and iNOS in the H group was increased, and the expression of TGF-β1 and Arg-1 was decreased (Fig. 6G-J). However, pretreatment with 16α-OHE1 enhanced the expression of TGF-β1 and Arg-1 and reduced TNF-α and iNOS levels, and the difference was particularly significant in the medium- and high-dose 16α-OHE1 groups. Next, we measured interleukin 6 (IL-6), interleukin 1β (IL-1β), and tumor necrosis factor α (TNF-α) levels using ELISA kits. Hypoxia increased the expression of these three inflammatory factors in the myocardium, and pretreatment with 16α-OHE1 significantly improved this outcome (Fig. 6K-M). Figure 5 16 α-OHE1 alleviates inflammatory infiltration in rats with hypoxia-induced myocardial injury. (A, D) Representative immunohistochemical staining and graphical presentation of CD68-positive cells (whole macrophages) in the myocardium. (B, E) Representative immunohistochemical staining and graphical presentation of CD86-positive cells (proinflammatory phenotype/M1 macrophages) in the myocardium. (C, F) Representative immunohistochemical staining and graphical presentation of CD206-positive cells (anti-inflammatory phenotype/M2 macrophages) in the myocardium. (G, H) The mRNA expression of the M1 macrophage markers tumor necrosis factor-alpha (TNF-α) and inducible nitric oxide synthase (iNOS) was assessed by RT‒PCR. (I, J) The mRNA expression of the M2 macrophage markers transforming growth factor-beta (TGF-β1) and arginase 1 (Arg-1) was assessed by RT‒qPCR. (K-M) ELISA was used to measure interleukin 6 (IL-6), interleukin 1β (IL-1β), and tumor necrosis factor α (TNF-α) levels in the rat myocardium. n = 6. * p < 0.05, ** p < 0.01 vs. N; # p < 0.05, ## p < 0.01 vs. H. The data were presented as the mean ± SEM. (one-way ANOVA) 3.6 16α-OHE1 Attenuates Cardiomyocyte Damage The inhibitory effect of 16α-OHE1 on hypoxia-induced H9C2 cardiomyocyte injury was determined. H9C2 cells were placed in a three-gas incubator containing 1% O 2 , 5% CO 2 , and 94% N 2 for 24 h. After the cells were stimulated by hypoxia, the expression levels of CK-MB, cTnT, and BNP were significantly increased, while 16α-OHE1 inhibited the abnormal increase in these substances (Fig. 7A-D). The Western blot results showed that 16α-OHE1 inhibited the hypoxia-induced decrease in β 2 AR levels in H9C2 cells (Fig. E, F). Altered expression of IL-6, IL-1β and TNF-α showed the anti-inflammatory effect of 16α-OHE1 (Fig. 7G-I). The CCK-8 results showed that cardiomyocyte viability was decreased significantly by hypoxia, and treatment with 16α-OHE1 inhibited this change (Fig. 7J). In addition, we measured apoptosis rates using flow cytometry. Compared with that in the N group, the apoptosis rate of cells in the H group was significantly increased. However, pretreatment with the three doses of 16α-OHE1 reduced apoptosis to varying degrees, and the results were statistically significant (Fig. 7K). Our results suggested that 16α-OHE1 has a favorable protective effect against hypoxia-induced H9C2 cell damage. Figure 6 16 α-OHE1 alleviates cardiomyocyte damage. (A-B) ELISA kits were used to measure creatine kinase isoenzyme (CK-MB) and troponin T (cTnT) levels in H9C2 cells. (C, D) Relative protein levels of brain natriuretic peptide (BNP) in H9C2 cells. (E, F) Relative protein levels of β 2 -adrenoceptor (β 2 AR) in H9C2 cells. (G-I) ELISA kits were used to measure interleukin 6 (IL-6), interleukin 1β (IL-1β), and tumor necrosis factor α (TNF-α) levels in H9C2 cells. (J) The viability of H9C2 cells exposed to hypoxia for 24 was assessed by CCK-8 assays. (K) Apoptosis in H9C2 cells incubated under hypoxic conditions for 24 h was evaluated by flow cytometry. n = 3. * p < 0.05, ** p < 0.01 vs. N; # p < 0.05, ## p < 0.01 vs. H. The data were presented as the mean ± SEM. (one-way ANOVA) 3.7 16α-OHE1 Attenuates Cardiomyocyte Damage via β 2 AR To further explore whether β 2 AR activation is related to the protection of cardiomyocytes injury by 16α-OHE1 administration, we inhibit β 2 AR signaling using the β 2 AR inhibitor ICI 118,551. Compared with the H group, the contents of BNP, CK-MB and cTnT in the cells of the H + 16α-OHE1 (2nM) group were significantly reduced, and compared with the H + 16α-OHE1 (2nM) group, the expression of BNP, CK-MB and cTnT in the cells of the H + 16α-OHE1 + ICI 118,551 group was significantly increased, and the results showed that the depletion of β 2 AR inhibited the protective effect of 16α-OHE1 on cardiomyocyte damage (Fig. 8A-D). In addition, ELISA showed that inhibiting β 2 AR eliminated the inhibitory effect of 16α-OHE1 on IL-6, IL-1β and TNF-α overexpression in hypoxia-induced H9C2 cells, as shown in Fig. 8E-G. In addition, the CCK-8 and flow cytometry results showed that 16α-OHE1-mediated enhancement of cell viability and suppression of apoptosis was inhibited after β 2 AR signaling is blocked (Fig. 8H, I). These results suggested that the protective effect of 16α-OHE1 on cardiomyocyte injury is at least partially mediated by β 2 AR activation. Figure 7 16 α-OHE1 alleviates cardiomyocyte damage by activating β 2 AR. (A, B) Relative protein levels of brain natriuretic peptide (BNP) in H9C2 cells. (C, D) ELISA kits were used to measure creatine kinase isoenzyme (CK-MB) and troponin T (cTnT) levels in H9C2 cells. (E-G) ELISA kits were used to measure interleukin 6 (IL-6), interleukin 1β (IL-1β), and tumor necrosis factor α (TNF-α) levels in H9C2 cells. (H) Apoptosis was evaluated by flow cytometric analysis of H9C2 cells incubated under hypoxic conditions for 24 h. (I) Cell viability was assessed by CCK-8 analysis of H9C2 cells exposed to hypoxia for 24. n = 3. * p < 0.05, ** p < 0.01 vs. N; # p < 0.05, ## p < 0.01 vs. H; & p < 0.05, && p < 0.01 vs. H + 16α-OHE1. The data were presented as the mean ± SEM. (one-way ANOVA) 4. Discussion Long-term studies have revealed higher mortality rates and increased readmission due to heart failure in patients with myocardial injuries [ 21 ] . However, the mechanism of Hypoxia-Induced myocardial injury remains unclear [ 22 ] , which has driven research toward new therapeutic agents and drug targets. Our research focused on Hypoxia-Induced myocardial injury, exploring the preventive and protective effects of 16α-OHE1and its underlying mechanisms. In our study, hypoxia was first observed to significantly reduce rat body weight (BW). It may result from the physiological adaptation to environmental changes, including reduced fatty acid intake and cellular lipid storage [ 23 , 24 ] . We also revealed that hypoxia increased HW and HW/BW coefficients in rats, which probably due to epicardial fat and myocardial hypertrophy [ 25 ] . Notably, treatment with 16α-OHE1 alleviated the hypoxia-induced increase in cardiac weight. Hypoxia resulted in increased heart rates in rats, aligning with previous studies showing enhanced sympathetic activity and reduced parasympathetic activity under hypoxic conditions [ 26 ] . 16α-OHE1 pre-treatment, however, led to decreased heart rates and improved systolic and diastolic function, countering the hypoxia-induced decline in cardiac function. Decreased systolic function has been reported to be a major feature of hypoxia-induced myocardial injury [ 27 ] , and the administration of 16α-OHE1 significantly improved systolic and diastolic function of rat hearts. Thus, 16α-OHE1 could inhibit the hypoxia-induced decline in cardiac function in rats. Further studies are needed to characterize the effect of 16α-OHE1 on myocardial structure. It has been noted that pathological cardiac remodeling is characterized by cardiac hypertrophy and fibrosis, which are pathological features of many heart diseases and can induce severe myocardial damage [ 28 , 29 ] . Cardiac hypertrophy is characterized by enlarged cells and involves both physiological and pathological hypertrophy [ 30 ] . Pathological cardiac hypertrophy is typically accompanied by the release of atrial natriuretic peptide (ANP) and brain-type atriuretic peptide (BNP) [ 31 , 32 ] . We observed that cardiomyocyte diameter was increased during hypoxia, which distorted the typical myocardial structure [ 33 ] . This was further demonstrated by the significant upregulation of ANP and BNP expression in rat hearts in the hypoxic state. However, 16α-OHE1 could abrogate the increases in ANP, BNP, and cell diameter during stress. In addition, we found that hypoxia induced massive interstitial fibrosis, and pretreatment with 16α-OHE1 improved this adverse outcome. In conclusion, 16α-OHE1 can inhibit myocardial remodeling in rats by inhibiting myocardial hypertrophy and fibrosis, thereby reducing myocardial damage in rats. Proinflammatory macrophages are abundant in the myocardium, as evidenced by autopsies of heart-damaged patients, and have been shown to exacerbate the inflammatory response in the myocardium, which may be caused by stress-induced heart damage, and the biased infiltration of CD86 + macrophages (proinflammatory) accelerates pathological cardiac remodeling because autopsy hearts have significant levels of fibrosis [ 34 , 35 ] . IHC showed that CD68-positive cells exhibited increased myocardial infiltration under hypoxic conditions. Pretreatment with 16α-OHE1 minimized CD68-positive cell infiltration. The phenotypic ratio was evaluated by CD86 and CD206 immunostaining, and most CD68-positive cells that infiltrated the myocardium during hypoxia were CD86-positive cells, while CD206-positive cells were less abundant, indicating inflammatory infiltration of the rat myocardium [ 36 , 37 ] . However, 16α-OHE1 reversed these phenomena by increasing the presence of CD206 + macrophages to enhance the anti-inflammatory response of the heart during stress, as the literature suggests [ 38 , 39 ] . This finding was validated by evaluating the mRNA expression of proinflammatory (TNF-α and iNOS) and anti-inflammatory macrophage (TGF-β and Arg-1) markers in the experimental groups [ 40 – 42 ] . Similar to the histological observations, TNF-α and iNOS expression in the myocardium was upregulated during hypoxia, and TGF-β and Arg-1 mRNA expression as downregulated by hypoxia. In contrast, 16α-OHE1 exerted anti-inflammatory effects by enhancing TGF-β and Arg-1 while reducing TNF-α and iNOS mRNA expression. In addition, the decrease of IL-6, IL-1β, and TNF-α in the myocardium of rats in the 16α-OHE1 dosing group further demonstrated the anti-inflammatory effect of 16α-OHE1, as described in the literature [ 43 , 44 ] . In conclusion, 16α-OHE1 can inhibit hypoxia-induced myocardial inflammatory infiltration. Creatine kinase isoenzyme (CK-MB) and cardiac troponin T (cTnT) have been reported to be markers of myocardial injury [ 45 , 46 ] . The rat myocardial enzymes CK-MB and cTnT were examined to directly illustrate the protective effect of 16α-OHE1 on myocardial injury [16]. In summary, we can draw a preliminary conclusion: 16α-OHE1 protects against hypoxia-induced myocardial injury in rats by improving cardiac diastolic and systolic function and inhibits myocardial remodeling and inflammation. A hypoxia-induced cardiomyocyte injury model was established based on rat H9C2 cells and was pretreated with 16α-OHE1. The results showed that 16α-OHE1 could significantly improve the hypoxia-induced decrease in H9C2 cell activity and reduce hypoxia-induced apoptosis in H9C2 cells. In addition, 16α-OHE1 pretreatment could reduce the hypoxia-induced increase in CK-MB and cTnT in H9C2 cells, and similar to CK-MB and cTnT, the decrease in BNP also reflected the cardiomyocyte protective effect of 16α-OHE1 [ 47 ] . In addition, 16α-OHE1 significantly reduced the increase in IL-6, IL-1β, and TNF-α levels in H9C2 cells under hypoxic conditions. In summary, 16α-OHE1 protects H9C2 cells from hypoxia-induced damage. Under hypoxic conditions, β 2 AR expression in the rat myocardium and H9C2 cells decreased significantly, while pretreatment with 16α-OHE1 significantly abrogated the decline in β 2 AR. We hypothesize that the protective effect of 16α-OHE1 against hypoxia-induced myocardial injury may be related to β 2 AR activation. To explore this mechanism, we used the β 2 AR blocker ICI 118,551 to determine whether the myocardial protective effect of 16α-OHE1 was affected by impairing β 2 AR signaling, following previous experience [ 48 – 50 ] . As expected, when β 2 AR signaling is blocked, the antiapoptotic and cell viability-enhancing effects of 16α-OHE1 on hypoxia-induced H9C2 cells disappeared. In addition, 16α-OHE1 could not inhibit the abnormal increases in CK-MB, cTnT, and BNP in hypoxia-induced H9C2 cells after β 2 AR signaling was blocked. In addition, the anti-inflammatory effect of 16α-OHE1 was also abrogated after β 2 AR expression was inhibited. These results show that β 2 AR plays an important role in the protective effect of 16α-OHE1 against hypoxia-induced myocardial injury. In conclusion, 16α-OHE1, which is a hydroxylated metabolite of estrogen, protects against hypoxia-induced myocardial injury in rats. In addition, we demonstrated that 16α-OHE1 could effectively activate the β 2 AR signaling pathway, thereby improving cardiac function and inhibiting myocardial remodeling, inflammatory infiltration, and apoptosis in rats under hypoxic conditions. These effects of 16α-OHE1 make it promising in protecting against hypoxia-induced myocardial injury and provide new ideas for the treatment of hypoxia-induced myocardial injury. Declarations Author Contribution Yequan Zhou: Conceptualization, Methodology, Software, Investigation, Formal Analysis, Writing - Original Draft, Zeyuan Yin: Writing -Review & Editing, Investigation, Junchao Cui: Data Curation, Investigation, Validation, Writing - Original Draft, Zhonghui Cao: Visualization, Investigation, Cheng Wang: Supervision, Writing -Review & Editing, Xiao Gao: Visualization, Writing - Review & Editing, Shimin He: Software, Tong Fu: Writing -Review & Editing, Lu Fu: Conceptualization, Writing -Review & Editing, Xueyan Zhou: Conceptualization, Funding Acquisition, Resources, Supervision, Writing -Review & Editing, All authors read and approved the final manuscript. Funding This work was supported by the Natural Science Foundation of China [No. 82173883]; the Science and Technology Foundation of Xuzhou [No. KC21010]; the Natural Science Foundation of the Jiangsu Higher Education Institutions of China [No. 18KJA350002]; the Natural Science Foundation of Jiangsu Province [No. BK20181470]; the Provincial Commission of Health and Family Planning in Jiangsu Province [No. H2017079]; the Science and Technology Planning Project of Jiangsu Province [No. BE2019636]; the Science and technology project of Xuzhou [No. KC22469]. Data Availability The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions. Code Availability Statistical analysis was performed using GraphPad Prism 7 software. Ethics Approval All procedures were performed in accordance with the guidelines developed by the Institutional Animal Care and Use Committee of Xuzhou Medical University (Xuzhou, China). Consent to Participate Not applicable References Zhang E, Zhao X, Zhang L, et al. Minocycline promotes cardiomyocyte mitochondrial autophagy and cardiomyocyte autophagy to prevent sepsis-induced cardiac dysfunction by Akt/mTOR signaling. Apoptosis. 2019;24(3–4):369–81. Zhang H, Liu M, Zhang Y, et al. Trimetazidine Attenuates Exhaustive Exercise-Induced Myocardial Injury in Rats via Regulation of the Nrf2/NF-κB Signaling Pathway. Front Pharmacol. 2019;10(null):175. Tan J, Pan W, Chen H et al. Circ_0124644 Serves as a ceRNA for miR-590-3p to Promote Hypoxia-Induced Cardiomyocytes Injury via Regulating SOX4. Frontiers in genetics. 2021;12(null):667724. Yoh K, Ikeda K, Horie K, et al. Roles of Estrogen, Estrogen Receptors, and Estrogen-Related Receptors in Skeletal Muscle: Regulation of Mitochondrial Function. Int J Mol Sci. 2023;24(3):null. Zhao L, Fan X, Zuo L, et al. Estrogen receptor 1 gene polymorphisms are associated with metabolic syndrome in postmenopausal women in China. BMC Endocr disorders. 2018;18(1):65. Meng Q, Li Y, Ji T, et al. Estrogen prevent atherosclerosis by attenuating endothelial cell pyroptosis via activation of estrogen receptor α-mediated autophagy. J Adv Res. 2021;28(null):149–64. Frump AL, Albrecht M, Yakubov B, et al. 17β-Estradiol and estrogen receptor α protect right ventricular function in pulmonary hypertension via BMPR2 and apelin. J Clin Invest. 2021;131(6):null. Hou H, Adzika GK, Wu Q, et al. Estrogen Attenuates Chronic Stress-Induced Cardiomyopathy by Adaptively Regulating Macrophage Polarizations via β2-Adrenergic Receptor Modulation. Front cell Dev biology. 2021;9(null):737003. Zhao F, Wang X, Wang Y, et al. The function of uterine UDP-glucuronosyltransferase 1A8 (UGT1A8) and UDP-glucuronosyltransferase 2B7 (UGT2B7) is involved in endometrial cancer based on estrogen metabolism regulation. Hormones-International J Endocrinol Metabolism. 2020;19(3):403–12. Masi CM, Hawkley LC, Xu X, et al. Serum estrogen metabolites and systolic blood pressure among middle-aged and older women and men. Am J Hypertens. 2009;22(11):1148–53. Seeger H, Mueck AO, Lippert TH. Effect of estradiol metabolites on the susceptibility of low density lipoprotein to oxidation. Life Sci. 1997;61(9):865–8. Seeger H, Mueck AO, Lippert TH. Effect of estradiol metabolites on prostacyclin synthesis in human endothelial cell cultures. Life Sci. 1999;65(13):Pl167–70. Swaneck GE, Fishman J. Covalent binding of the endogenous estrogen 16 alpha-hydroxyestrone to estradiol receptor in human breast cancer cells: characterization and intranuclear localization. Proceedings of the national academy of sciences of the united states of america. 1988;85(21):7831-5. Yin ZY, Fu T, He SM et al. 16α-OHE1, a novel oestrogen metabolite, attenuates dysfunction of left ventricle contractility via regulation of autophagy after myocardial ischemia and reperfusion. Int J Cardiol. 2023;null(null):131123. Paur H, Wright PT, Sikkel MB, et al. High levels of circulating epinephrine trigger apical cardiodepression in a β2-adrenergic receptor/Gi-dependent manner: a new model of Takotsubo cardiomyopathy. Circulation. 2012;126(6):697–706. Steiner JL, Lang CH. Etiology of alcoholic cardiomyopathy: Mitochondria, oxidative stress and apoptosis. Int J Biochem Cell Biol. 2017;89(null):125–35. Yang X, Zhao T, Feng L, et al. PM2.5-induced ADRB2 hypermethylation contributed to cardiac dysfunction through cardiomyocytes apoptosis via PI3K/Akt pathway. Environ Int. 2019;127(null):601–14. Tao X, Xu Y, Adu-Amankwaah J et al. β2AR against myocarditis-lipid deposition depends on estrogenic environment in stress. Journal of endocrinology. 2023;null(null):null. Dang Z, Su S, Jin G et al. Tsantan Sumtang attenuated chronic hypoxia-induced right ventricular structure remodeling and fibrosis by equilibrating local ACE-AngII-AT1R/ACE2-Ang1-7-Mas axis in rat. Journal of ethnopharmacology. 2020;250(null):112470. Hulsmans M, Sager HB, Roh JD, et al. Cardiac macrophages promote diastolic dysfunction. J Exp Med. 2018;215(2):423–40. Bardají A, Bonet G, Carrasquer A, et al. Clinical Features and Prognosis of Patients with Acute and Chronic Myocardial Injury Admitted to the Emergency Department. Am J Med. 2019;132(5):614–21. Giustino G, Croft LB, Stefanini GG, et al. Characterization of Myocardial Injury in Patients With COVID-19. J Am Coll Cardiol. 2020;76(18):2043–55. Bensaad K, Favaro E, Lewis CA, et al. Fatty acid uptake and lipid storage induced by HIF-1α contribute to cell growth and survival after hypoxia-reoxygenation. Cell Rep. 2014;9(1):349–65. Ruixia Z, Chuanchuan L, Lu G, et al. Studies on the effects of hypothermia combined with hypoxia on rat skeletal muscle and lipid metabolism based on AMPK/PGC1α pathway. J Orthop Surg Res. 2021;16(1):712. Mori T, Kai H, Kajimoto H, et al. Enhanced cardiac inflammation and fibrosis in ovariectomized hypertensive rats: a possible mechanism of diastolic dysfunction in postmenopausal women. Hypertens Res. 2011;34(4):496–502. Siebenmann C, Rasmussen P, Hug M, et al. Parasympathetic withdrawal increases heart rate after 2 weeks at 3454 m altitude. J Physiol-London. 2017;595(5):1619–26. Smeir E, Leberer S, Blumrich A, et al. Depletion of cardiac cardiolipin synthase alters systolic and diastolic function. iScience. 2021;24(11):103314. Wu MP, Zhang YS, Xu XB, et al. Vinpocetine Attenuates Pathological Cardiac Remodeling by Inhibiting Cardiac Hypertrophy and Fibrosis. Cardiovasc Drug Ther. 2017;31(2):157–66. Liang B, Zhang XX, Li R et al. Guanxin V alleviates acute myocardial infarction by restraining oxidative stress damage, apoptosis, and fibrosis through the TGF-β1 signalling pathway. Phytomedicine. 2022;100(null):154077. D'Ascenzi F, Pelliccia A, Corrado D, et al. Right ventricular remodelling induced by exercise training in competitive athletes. Eur Heart J-Card Img. 2016;17(3):301–7. Tang L, Yu X, Zheng Y, et al. Inhibiting SLC26A4 reverses cardiac hypertrophy in H9C2 cells and in rats. PeerJ. 2020;8(null):e8253. Wen ZQ, Li SH, Shui X, et al. LncRNA PEG10 aggravates cardiac hypertrophy through regulating HOXA9. Eur Rev Med Pharmacol Sci. 2019;23(3 Suppl):281–6. Li XR, Lan YH, Wang Y, et al. Telmisartan suppresses cardiac hypertrophy by inhibiting cardiomyocyte apoptosis via the NFAT/ANP/BNP signaling pathway. Mol Med Rep. 2017;15(5):2574–82. Scally C, Abbas H, Ahearn T, et al. Myocardial and Systemic Inflammation in Acute Stress-Induced (Takotsubo) Cardiomyopathy. Circulation. 2019;139(13):1581–92. Wilson HM, Cheyne L, Brown PAJ et al. Characterization of the Myocardial Inflammatory Response in Acute Stress-Induced (Takotsubo) Cardiomyopathy. JACC Basic to translational science. 2018;3(6):766–78. Al-Darraji A, Haydar D, Chelvarajan L, et al. Azithromycin therapy reduces cardiac inflammation and mitigates adverse cardiac remodeling after myocardial infarction: Potential therapeutic targets in ischemic heart disease. PLoS ONE. 2018;13(7):e0200474. Krasnyi AM, Sadekova AA, Smolnova TY, et al. The Levels of Ghrelin, Glucagon, Visfatin and Glp-1 Are Decreased in the Peritoneal Fluid of Women with Endometriosis along with the Increased Expression of the CD10 Protease by the Macrophages. Int J Mol Sci. 2022;23(18):null. Bai XJ, Hao L, Guo YE, et al. Bone marrow stromal cells reverse the microglia type from pro-inflammatory tumour necrosis factor a microglia to anti-inflammatory CD206 microglia of middle cerebral artery occlusion rats through triggering secretion of CX3CL1. Folia Neuropathol. 2021;59(1):20–31. Machin A, Divamillenia D, Fatimah N, et al. The Effect of Green Tea with EGCG Active Compound in Enhancing the Expression of M2 Microglia Marker (CD206). Neurol India. 2022;70(2):530–4. Chen HL, Jia WJ, Li HE, et al. Scutellarin Exerts Anti-Inflammatory Effects in Activated Microglia/Brain Macrophage in Cerebral Ischemia and in Activated BV-2 Microglia Through Regulation of MAPKs Signaling Pathway. Neuromol Med. 2020;22(2):264–77. Liu M, Wang J, Chen S et al. Exploring the effect of Er miao San-containing serum on macrophage polarization through miR-33/NLRP3 pathway. Journal of ethnopharmacology. 2023;307(null):116178. Salim T, Sershen CL, May EE. Investigating the Role of TNF-α and IFN-γ Activation on the Dynamics of iNOS Gene Expression in LPS Stimulated Macrophages. PLoS ONE. 2016;11(6):e0153289. Dong W, Li X, Wang X, et al. Influence of Dexmedetomidine on Cognitive Function and Inflammatory Factors in Rats and Analysis of Its Molecular Mechanism after Cardiac Surgery under Cardiopulmonary Bypass. Cell Mol Biol. 2022;68(2):119–25. Wang JL, Cai F, Liu XH, et al. Lipopolysaccharide Promotes Inflammatory Response via Enhancing IFIT1 Expression in Human Umbilical Vein Endothelial Cells. DNA Cell Biol. 2020;39(7):1274–81. Chen JY, Jiang ZZ, Zhou X, et al. Dexmedetomidine Preconditioning Protects Cardiomyocytes Against Hypoxia/Reoxygenation-Induced Necroptosis by Inhibiting HMGB1-Mediated Inflammation. Cardiovasc Drug Ther. 2019;33(1):45–54. Ren Z, Xiao WJ, Zeng Y, et al. Fibroblast growth factor-21 alleviates hypoxia/reoxygenation injury in H9c2 cardiomyocytes by promoting autophagic flux. Int J Mol Med. 2019;43(3):1321–30. Yue L, Sheng S, Yuan M et al. HypERlnc attenuates angiotensin II-induced cardiomyocyte hypertrophy via promoting SIRT1 SUMOylation-mediated activation of PGC-1α/PPARα pathway in AC16 cells. Cell Biol Int. 2023;null(null):null. O'Neill E, Yssel JD, McNamara C, et al. Pharmacological targeting of β2 -adrenoceptors is neuroprotective in the LPS inflammatory rat model of Parkinson's disease. Br J Pharmacol. 2020;177(2):282–97. Liu S, Xiu J, Zhu C, et al. Fat mass and obesity-associated protein regulates RNA methylation associated with depression-like behavior in mice. Nat Commun. 2021;12(1):6937. Chen X, Zhang W, Liu R, et al. NNK from tobacco smoking enhances pancreatic cancer cell stemness and chemoresistance by creating a β2AR-Akt feedback loop that activates autophagy. Mol Oncol. 2022;16(15):2881–95. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3206949\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":223796630,\"identity\":\"800843e2-acbd-495b-a7a8-20dde6f83a7e\",\"order_by\":0,\"name\":\"Yequan Zhou\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+klEQVRIiWNgGAWjYDACCSBOMLCRk+fvf/757x8bHn7+BiK0PChIMzaccYaNgbchTUZyxgHCWhgffDic2HAgB6TlsI1BQwJ+HfKzm49JJBgcNmZsOHvsgeSO8zwGDAcYP3zMwa2Fcc6xNKCWdDl25r50A8Mzt3nMmRuYJWduw62FWSLHDKjFGmjLAQOJBLbbPJYNB9iYefFoYYNoYQb6JcFA4gDbOR6DAwn4tfBAtDiDvG8m2dh2gLAWCYm0ZIsEA1AgH0s2ZjiTzCM542AzXr/Iz0g+ePPHH1BUNh98zFBhZ88PZHz4iEcLNsDYQJr6UTAKRsEoGAUYAABL8FPUYy3JwQAAAABJRU5ErkJggg==\",\"orcid\":\"https://orcid.org/0009-0003-9032-9415\",\"institution\":\"Xuzhou Medical University\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yequan\",\"middleName\":\"\",\"lastName\":\"Zhou\",\"suffix\":\"\"},{\"id\":223796631,\"identity\":\"bb8fbd4b-81ef-462d-9278-f98e84d10485\",\"order_by\":1,\"name\":\"Zeyuan Yin\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Manchester University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zeyuan\",\"middleName\":\"\",\"lastName\":\"Yin\",\"suffix\":\"\"},{\"id\":223796632,\"identity\":\"68ddd68d-f982-4e69-83aa-431998b5daca\",\"order_by\":2,\"name\":\"Junchao Cui\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Xuzhou Medical University School of Pharmacy\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Junchao\",\"middleName\":\"\",\"lastName\":\"Cui\",\"suffix\":\"\"},{\"id\":223796633,\"identity\":\"2f403ef7-4cc8-41b8-9087-dc24c4f8afe4\",\"order_by\":3,\"name\":\"Zhonghui Cao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Xuzhou Medical College Affiliated Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zhonghui\",\"middleName\":\"\",\"lastName\":\"Cao\",\"suffix\":\"\"},{\"id\":223796634,\"identity\":\"baea9737-14b9-497b-9f01-8f4b680b6679\",\"order_by\":4,\"name\":\"Cheng Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Xuzhou Medical College Affiliated Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Cheng\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":223796635,\"identity\":\"bf37e969-f579-432c-9fd1-e543b4590df9\",\"order_by\":5,\"name\":\"Xiao Gao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Xuzhou Medical University School of Pharmacy\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiao\",\"middleName\":\"\",\"lastName\":\"Gao\",\"suffix\":\"\"},{\"id\":223796636,\"identity\":\"dbdd2167-37c5-4ddf-ac57-e1511d242979\",\"order_by\":6,\"name\":\"Shimin He\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Xuzhou Central Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shimin\",\"middleName\":\"\",\"lastName\":\"He\",\"suffix\":\"\"},{\"id\":223796637,\"identity\":\"d7f23aee-ba53-4934-8b31-fa278900ce8a\",\"order_by\":7,\"name\":\"Tong Fu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Xuzhou Central Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tong\",\"middleName\":\"\",\"lastName\":\"Fu\",\"suffix\":\"\"},{\"id\":223796638,\"identity\":\"2a8b8abe-aad5-4b8f-bd5a-bde4daa9360a\",\"order_by\":8,\"name\":\"Lu Fu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Xuzhou Medical University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Lu\",\"middleName\":\"\",\"lastName\":\"Fu\",\"suffix\":\"\"},{\"id\":223796639,\"identity\":\"d51965ea-c842-49e6-b81e-2de287aaf2c9\",\"order_by\":9,\"name\":\"Xueyan Zhou\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0003-2821-1013\",\"institution\":\"Xuzhou Medical University School of Pharmacy\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xueyan\",\"middleName\":\"\",\"lastName\":\"Zhou\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2023-07-26 15:22:28\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3206949/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3206949/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":41315861,\"identity\":\"fe2fb47d-e8bf-4a5f-a09c-49f91c662cad\",\"added_by\":\"auto\",\"created_at\":\"2023-08-09 15:27:25\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":40241,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eGraphical presentations of morphometric data. (A) Body weight (BW). (B) Heart weight (HW). (C) HW/BW coefficient. (D) Lung weight (LW). (E) LW/BW coefficient. n = 6. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01 vs. N; \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01 vs. H. The data were presented as the mean ± SEM. (one-way ANOVA)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"OnlineFig1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3206949/v1/a7d6652390d7a6e46d202422.png\"},{\"id\":41315866,\"identity\":\"30c7c508-99f5-4e71-b0f9-89e69ee0f05f\",\"added_by\":\"auto\",\"created_at\":\"2023-08-09 15:27:26\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":39716,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e16α-OHE1 improves cardiac function in rats with hypoxia-induced myocardial injury. (A) Graphical representation of the heart rate (HR). n = 6. (B, C) 16α-OHE1 increased the maximum systolic rate (+dp/dt\\u003csub\\u003emax\\u003c/sub\\u003e) and maximum diastolic velocity (-dp/dtmax) in rats with hypoxia-induced myocardial injury. (D, E) Maximum tension value (Tension\\u003csub\\u003emax\\u003c/sub\\u003e) and minimum tension value (Tension\\u003csub\\u003emin\\u003c/sub\\u003e) of rat hearts. n = 4. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01 vs. N; \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01 vs. H. The data were presented as the mean ± SEM. (one-way ANOVA)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"OnlineFig2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3206949/v1/8fb7537d59aa9ef2b756b5f2.png\"},{\"id\":41315868,\"identity\":\"42da5421-32d2-4bb1-835b-4430f8cf3fb9\",\"added_by\":\"auto\",\"created_at\":\"2023-08-09 15:27:26\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":111914,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e16α-OHE1 alleviates hypoxia-induced myocardial injury in rats. (A, B) Relative protein levels of β\\u003csub\\u003e2\\u003c/sub\\u003e-adrenoceptor (β\\u003csub\\u003e2\\u003c/sub\\u003eAR) in the rat myocardium. (C, D) ELISA kit were used to detect creatine kinase isoenzyme (CK-MB) and troponin T (cTnT) in the rat myocardium. (E, F) Relative protein levels of β\\u003csub\\u003e2\\u003c/sub\\u003e-adrenoceptor (β\\u003csub\\u003e2\\u003c/sub\\u003eAR) in the rat myocardium were determined by IHC. n = 6. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01 vs. N; \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01 vs. H. The data were presented as the mean ± SEM. (one-way ANOVA)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"OnlineFig3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3206949/v1/79b46d81b667a423e5013955.png\"},{\"id\":41315865,\"identity\":\"1cc7a8a3-7825-4840-a41f-1917f8693321\",\"added_by\":\"auto\",\"created_at\":\"2023-08-09 15:27:26\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":320302,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e16α-OHE1 inhibits myocardial remodeling in rats with hypoxia-induced myocardial injury. (A, B) Representative H\\u0026amp;E staining and graphical presentation of the cardiomyocyte diameters. (C-F) Representative Western blotting and graphical presentations of the cardiac hypertrophy markers atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP). (G, H) Representative Masson’s trichrome staining and graphical presentation of the collagen volume fractions, which were evaluated to assess the extent of fibrosis. n = 6. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01 vs. N; \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01 vs. H. The data are presented as the mean ± SEM. (one-way ANOVA)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"OnlineFig4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3206949/v1/3da94dbcce3f274a4138c64a.png\"},{\"id\":41315862,\"identity\":\"31fa0ddc-6f58-4b72-8789-b51a83cf5c2f\",\"added_by\":\"auto\",\"created_at\":\"2023-08-09 15:27:25\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":308652,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e16α-OHE1 alleviates inflammatory infiltration in rats with hypoxia-induced myocardial injury. (A, D) Representative immunohistochemical staining and graphical presentation of CD68-positive cells (whole macrophages) in the myocardium. (B, E) Representative immunohistochemical staining and graphical presentation of CD86-positive cells (proinflammatory phenotype/M1 macrophages) in the myocardium. (C, F) Representative immunohistochemical staining and graphical presentation of CD206-positive cells (anti-inflammatory phenotype/M2 macrophages) in the myocardium. (G, H) The mRNA expression of the M1 macrophage markers tumor necrosis factor-alpha (TNF-α) and inducible nitric oxide synthase (iNOS) was assessed by RT‒PCR. (I, J) The mRNA expression of the M2 macrophage markers transforming growth factor-beta (TGF-β1) and arginase 1 (Arg-1) was assessed by RT‒qPCR. (K-M) ELISA was used to measure interleukin 6 (IL-6), interleukin 1β (IL-1β), and tumor necrosis factor α (TNF-α) levels in the rat myocardium. n = 6. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01 vs. N; \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01 vs. H. The data were presented as the mean ± SEM. (one-way ANOVA)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"OnlineFig5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3206949/v1/29a6f7a829ccda510afc4afb.png\"},{\"id\":41315864,\"identity\":\"a8da15c5-ad88-4448-9a2e-a5a95e3a9de2\",\"added_by\":\"auto\",\"created_at\":\"2023-08-09 15:27:25\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":71692,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e16α-OHE1 alleviates cardiomyocyte damage. (A-B) ELISA kits were used to measure creatine kinase isoenzyme (CK-MB) and troponin T (cTnT) levels in H9C2 cells. (C, D) Relative protein levels of brain natriuretic peptide (BNP) in H9C2 cells. (E, F) Relative protein levels of β\\u003csub\\u003e2\\u003c/sub\\u003e-adrenoceptor (β\\u003csub\\u003e2\\u003c/sub\\u003eAR) in H9C2 cells. (G-I) ELISA kits were used to measure interleukin 6 (IL-6), interleukin 1β (IL-1β), and tumor necrosis factor α (TNF-α) levels in H9C2 cells. (J) The viability of H9C2 cells exposed to hypoxia for 24 was assessed by CCK-8 assays. (K) Apoptosis in H9C2 cells incubated under hypoxic conditions for 24 h was evaluated by flow cytometry. n = 3. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01 vs. N; \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01 vs. H. The data were presented as the mean ± SEM. (one-way ANOVA)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"OnlineFig6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3206949/v1/2ca5036390cff3c6fb334c9f.png\"},{\"id\":41317330,\"identity\":\"8fcf0b7a-6122-49aa-873b-73735a3b1f69\",\"added_by\":\"auto\",\"created_at\":\"2023-08-09 15:35:26\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":52490,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e16α-OHE1 alleviates cardiomyocyte damage by activating β\\u003csub\\u003e2\\u003c/sub\\u003eAR. (A, B) Relative protein levels of brain natriuretic peptide (BNP) in H9C2 cells. (C, D) ELISA kits were used to measure creatine kinase isoenzyme (CK-MB) and troponin T (cTnT) levels in H9C2 cells. (E-G) ELISA kits were used to measure interleukin 6 (IL-6), interleukin 1β (IL-1β), and tumor necrosis factor α (TNF-α) levels in H9C2 cells. (H) Apoptosis was evaluated by flow cytometric analysis of H9C2 cells incubated under hypoxic conditions for 24 h. (I) Cell viability was assessed by CCK-8 analysis of H9C2 cells exposed to hypoxia for 24. n = 3. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01 vs. N; \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01 vs. H; \\u003csup\\u003e\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e\\u0026amp;\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01 vs. H+16α-OHE1. The data were presented as the mean ± SEM. (one-way ANOVA)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"OnlineFig7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3206949/v1/c7eb42aac827fdf260d1f79b.png\"},{\"id\":42298170,\"identity\":\"2a64d1cf-8489-4170-959e-03c835573fa8\",\"added_by\":\"auto\",\"created_at\":\"2023-08-29 11:52:23\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":3200870,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3206949/v1/73924127-5bc6-4dda-b62c-658a7e7872f3.pdf\"}],\"financialInterests\":\"\",\"formattedTitle\":\"A Novel Mechanism of 16α-OHE1, One of Estrogen Metabolites, Alleviating Inflammatory Infiltration in Hypoxia-Induced Myocardial Injury via β2-Adrenergic Receptor\",\"fulltext\":[{\"header\":\"Highlights\",\"content\":\"\\u003cp\\u003e\\u003cul\\u003e \\u003cli\\u003e \\u003cp\\u003eThe myocardial injury through hypoxia was induced and the preventive and protective effects of 16α-OHE1 on hypoxia-induced myocardial injury was confirmed.\\u003c/p\\u003e \\u003c/li\\u003e \\u003cli\\u003e \\u003cp\\u003eA novel mechanism of 16α-OHE1 alleviating inflammatory infiltration in hypoxia-induced myocardial injury was investigated.\\u003c/p\\u003e \\u003c/li\\u003e \\u003cli\\u003e \\u003cp\\u003eBy instigating cardiomyocyte damage via hypoxia, it was identified that 16α-OHE1 against hypoxia-induced myocardial injury was caused by the activation of the β2-adrenergic receptor.\\u003c/p\\u003e \\u003c/li\\u003e \\u003c/ul\\u003e\\u003c/p\\u003e\"},{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003eMyocardial injury refers to cardiomyocyte damage caused by various factors\\u003csup\\u003e[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]\\u003c/sup\\u003e. Among these, hypoxia stands out as one of the most prevalent and impactful triggers for this condition \\u003csup\\u003e[\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]\\u003c/sup\\u003e. With rapid industrial development and urban expansion, there has been an increased exposure to environments with reduced oxygen levels, such as densely populated urban areas with high pollution and workplaces with deficient ventilation. Consequently, the incidence of hypoxia-induced myocardial injury has seen a significant surge, underscoring the need for effective myocardial protective strategies.\\u003c/p\\u003e \\u003cp\\u003eEstrogen is an essential sex steroid hormone that functions primarily in female reproductive system, as well as in a variety of tissues and organs with pleiotropic effects, such as in cardiovascular, nervous, immune, and musculoskeletal systems\\u003csup\\u003e[\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]\\u003c/sup\\u003e. Women with low estrogen, as exemplified by those in postmenopause, are therefore prone to suffer from various disorders including cardiovascular disease and metabolic syndrome \\u003csup\\u003e[\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]\\u003c/sup\\u003e. In our previous study, estrogen can protect right ventricular function in patients with pulmonary hypertension through BMPR2 and apelin\\u003csup\\u003e[\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]\\u003c/sup\\u003e. Estrogen has been reported to alleviate chronic stress-induced cardiomyopathy by regulating macrophage polarization\\u003csup\\u003e[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eNatural estrogens include estrone (E1), estradiol (E2), estriol (E3), etc. They have many types of metabolites, such as the methylated metabolite 2-methoxyestrone (2-MeOE1), 2-methoxyestradiol (2-MeOE2), etc., hydroxylated metabolites 2-hydroxyestrone (2-OHE1), 2-hydroxyestradiol (2-OHE2), 16α-OHE1 (16α-OHE1), and so on\\u003csup\\u003e[\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]\\u003c/sup\\u003e. An inverse relationship between serum concentrations of 16α-OHE1 and systolic blood pressure (SBP) in postmenopausal women has been found after adjusting for age, BMI, race/ethnicity, and antihypertensive drug use \\u003csup\\u003e[\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]\\u003c/sup\\u003e. Previous studies have shown that 16α-OHE1 is a potent antioxidant \\u003csup\\u003e[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]\\u003c/sup\\u003e that can increase endothelial cell production of prostacyclin, which is a vasodilator, at twice the rate of E2 \\u003csup\\u003e[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]\\u003c/sup\\u003e. 16α-OHE1 may also increase endothelial nitric oxide synthase (eNOS) gene expression, nitric oxide (a vasodilator) production, and vascular endothelial cell proliferation \\u003csup\\u003e[\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]\\u003c/sup\\u003e. In addition, 16α-OHE1 can also reduce dysfunction of left ventricular contractility by regulating myocardial ischemia and autophagy after reperfusion\\u003csup\\u003e[\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]\\u003c/sup\\u003e. However, no studies have reported a relationship between 16α-OHE1 and hypoxia-induced myocardial injury.\\u003c/p\\u003e \\u003cp\\u003eIn the physiological state, the positive inotropic and temporal function of the heart is mediated by β adrenergic receptors (βARs) through G-stimulating proteins (G\\u003csub\\u003es\\u003c/sub\\u003e), mainly β\\u003csub\\u003e1\\u003c/sub\\u003e-adrenergic receptor (β\\u003csub\\u003e1\\u003c/sub\\u003eAR) and β\\u003csub\\u003e2\\u003c/sub\\u003e-adrenergic receptor (β\\u003csub\\u003e2\\u003c/sub\\u003eAR) \\u003csup\\u003e[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]\\u003c/sup\\u003e. However, overstimulation of receptors during chronic stress leads to the downregulation of β\\u003csub\\u003e1\\u003c/sub\\u003eAR expression, which transmits signals via G-suppressor protein (G\\u003csub\\u003ei\\u003c/sub\\u003e) to prevent heart damage \\u003csup\\u003e[\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]\\u003c/sup\\u003e. The literature has reported that β\\u003csub\\u003e2\\u003c/sub\\u003eAR plays a key role in cardiomyocyte apoptosis, which is an important cellular response and a key mechanism leading to cardiomyopathy endpoints \\u003csup\\u003e[\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]\\u003c/sup\\u003e. In addition, there have been studies suggesting that β\\u003csub\\u003e2\\u003c/sub\\u003eAR activation may prevent cardiac dysfunction \\u003csup\\u003e[\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]\\u003c/sup\\u003e. It is well documented that β\\u003csub\\u003e2\\u003c/sub\\u003eAR activation can inhibit inflammatory infiltration and exert cardioprotective effects \\u003csup\\u003e[\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eWhile the protective effects of 16α-OHE1 on myocardial injury were identified in our previous study [16], the underlying mechanism, primarily focused on ischemia and reperfusion, remained largely unexplored. Consequently, in this current research, we delve deeper into the protective role of 16α-OHE1 on hypoxia-induced myocardial injury in rats. Our objective is to elucidate the protective mechanism of 16α-OHE1 in diminishing the incidence of myocardial injury under hypoxic conditions. The insights gained from this study will form a solid foundation for subsequent translational research aimed at preventing myocardial injury in humans.\\u003c/p\\u003e\"},{\"header\":\"2. Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1 Animals and Experimental Design\\u003c/h2\\u003e \\u003cp\\u003e All procedures were performed in accordance with the guidelines developed by the Institutional Animal Care and Use Committee of Xuzhou Medical University (Xuzhou, China). All the animals were housed in a barrier environment (24\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1\\u0026deg;C; 12:12-h dark/light cycle) and provided food and water ad libitum before and during the experiment.\\u003c/p\\u003e \\u003cp\\u003eBased on previous hypoxic animal studies, male Sprague‒Dawley (SD) rats (180\\u0026ndash;200 g) were purchased from Beijing Vitonglihua (Beijing, China) \\u003csup\\u003e[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]\\u003c/sup\\u003e. Thirty-six male SD rats were randomly divided into 6 groups (n\\u0026thinsp;=\\u0026thinsp;6): normoxia\\u0026thinsp;+\\u0026thinsp;saline (N), hypoxia\\u0026thinsp;+\\u0026thinsp;saline (H), hypoxia\\u0026thinsp;+\\u0026thinsp;estradiol (H\\u0026thinsp;+\\u0026thinsp;E2), hypoxia\\u0026thinsp;+\\u0026thinsp;low-dose 16α-OHE1 (H\\u0026thinsp;+\\u0026thinsp;16α-OHE1 37.5 \\u0026micro;g/kg), hypoxia\\u0026thinsp;+\\u0026thinsp;medium-dose 16α-OHE1 (H\\u0026thinsp;+\\u0026thinsp;16α-OHE1 75 \\u0026micro;g/kg), and hypoxia\\u0026thinsp;+\\u0026thinsp;high-dose 16α-OHE1 (H\\u0026thinsp;+\\u0026thinsp;16α-OHE1 150 \\u0026micro;g/kg). The equal amount of normal saline was administered as a placebo to Groups N and H. The dose of estrogen administered was based on previous studies\\u003csup\\u003e[\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]\\u003c/sup\\u003e. After one week of adaptive rearing, rats in Group N were intraperitoneally injected with an equal volume of normal saline for 14 days. After seven days of intraperitoneal injection of an equal volume of normal saline under normal oxygen, rats in Group H were placed in a low-pressure chamber to simulate hypoxia at 6000 meters for 24 hours/day for 7 days, and normal saline was injected every day. After seven days of intraperitoneal injection of 75 \\u0026micro;g/kg E2 under normal oxygen condition, rats in H\\u0026thinsp;+\\u0026thinsp;E2 group were placed in a low-pressure chamber to simulate hypoxia at 6000 meters for 24 hours/day for 7 days, and E2 was injected intraperitoneally every day. For group H\\u0026thinsp;+\\u0026thinsp;16αOHE1-L, H\\u0026thinsp;+\\u0026thinsp;16αOHE1-M, and H\\u0026thinsp;+\\u0026thinsp;16αOHE1-H, the rats were placed in a low-pressure chamber to stimulate hypoxia at 6000m for 24 hours/day for 7 days after peritoneal injection of 37.5, 75, and 150 ug/kg 16α-OHE1 respectively. And the 16α-OHE1 was injected intraperitoneally every day.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2 Cell Culture and Transfection\\u003c/h2\\u003e \\u003cp\\u003eH9C2 cells, the rat cardiomyocyte line, was cultured in DMEM containing 5.56 mmol/l d-glucose (normal glucose, NG) supplemented with 10% fetal bovine serum (Invitrogen, Grand Island, NY), 100 U/ml penicillin, and 100 \\u0026micro;g/ml streptomycin in a humidified incubator at 37\\u0026deg;C with 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e. Cells were passaged at 80\\u0026thinsp;\\u0026minus;\\u0026thinsp;90% confluence. Prior to the experiment, confluent cells were grown in serum-free DMEM for 24 h.\\u003c/p\\u003e \\u003cp\\u003eTo observe the effect of 16α-OHE1 on hypoxic damage in cardiomyocytes, H9C2 cells were divided into 6 groups. In the N group, H9C2 cells were cultured in a 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e incubator. In Group H, H9C2 cells were cultured under hypoxic conditions in a three-gas incubator containing 1% O\\u003csub\\u003e2\\u003c/sub\\u003e, 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e, and 94% N\\u003csub\\u003e2\\u003c/sub\\u003e for 24 h. In the H\\u0026thinsp;+\\u0026thinsp;E2 group, H9C2 cells were cultured under hypoxic conditions in a three-gas incubator containing 1% O\\u003csub\\u003e2\\u003c/sub\\u003e, 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e, and 94% N\\u003csub\\u003e2\\u003c/sub\\u003e for 24 h, and E2 (1 nM) was added to the medium. For group H\\u0026thinsp;+\\u0026thinsp;low-dose 16α-OHE1, H\\u0026thinsp;+\\u0026thinsp;medium-dose, and H\\u0026thinsp;+\\u0026thinsp;high-dose 16α-OHE1, the H9C2 cells were cultured under hypoxic conditions in a three-gas incubator containing 1% O2, 5% CO2, and 94% N2 for 24 h, and 16α-OHE1 (0.5 nM, 1 nM, 2 nM) were added to the medium respectively. The dose selection was based on previous research \\u003csup\\u003e[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eFor mechanistic studies, H9C2 cells were divided into 4 groups. In Group N, H9C2 cells were cultured in a 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e incubator. In Group H, H9C2 cells were cultured under hypoxic conditions in a three-gas incubator containing 1% O\\u003csub\\u003e2\\u003c/sub\\u003e, 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e, and 94% N\\u003csub\\u003e2\\u003c/sub\\u003e for 24 h. In the H\\u0026thinsp;+\\u0026thinsp;16α-OHE1 group, H9C2 cells were cultured under hypoxic conditions in a three-gas incubator containing 1% O\\u003csub\\u003e2\\u003c/sub\\u003e, 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e, and 94% N\\u003csub\\u003e2\\u003c/sub\\u003e for 24 h, and 16α-OHE1 (2 nM) was added to the medium. In the H\\u0026thinsp;+\\u0026thinsp;16α-OHE1\\u0026thinsp;+\\u0026thinsp;β2AR blocker group, H9C2 cells were cultured under hypoxic conditions for 24 h in a tri-gas incubator containing 1% O\\u003csub\\u003e2\\u003c/sub\\u003e, 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e, and 94% N\\u003csub\\u003e2\\u003c/sub\\u003e, and 16α-OHE1 (2 nM) and ICI 118,551 (55 nM) were added to the medium. The dose selection was based on previous research \\u003csup\\u003e[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3 Body Weight and Cardiac Function Parameters\\u003c/h2\\u003e \\u003cp\\u003eAt the end of the experiment, body weight was recorded. Electrocardiograms (ECGs) were recorded using the PowerLab data acquisition system (ADInstruments, USA). Before the heart was collected, the rats were intraperitoneally injected with heparin to inhibit coagulation and with a sodium pentobarbital (40 mg/kg) for anesthesia. After fixation of rats, the chest cavity was opened, the vena cava, aorta and pericardial tissues were cut, and the hearts were quickly removed and placed in ice-cold Krebs-Henseleit solution (K-H fluid) for cleaning and pruning. A cotton thread was inserted at the root of the aorta for backup, and an aortic cannula inserted into the aorta at the end of the perfusion duct was fixed with the prepared cotton thread. After perfusion with oxygenated K-H fluid, the heart could resume beating within 1 minute. After the heart resumed beating, a small amount of apical tissue was clamped with the frog clamp of the tether, which was connected to the muscle tone sensor. The cardiac contraction force output was recorded by the tension sensor of the biological function experimental system ( Chengdu Taimeng Technology Co.Ltd, BL-420S, China). Before recording the cardiac contraction force, the tightness of the tether connected to the tension sensor was adjusted so that the cardiac preload was approximately 3 g. After the experiment, the force at each time point was measured in the area, and the maximum systolic velocity (+\\u0026thinsp;dp/dt\\u003csub\\u003emax\\u003c/sub\\u003e), maximum diastolic velocity (-dp/dt\\u003csub\\u003emax\\u003c/sub\\u003e), maximum tension (Tension\\u003csub\\u003emax\\u003c/sub\\u003e) and minimum tension (Tension\\u003csub\\u003emin\\u003c/sub\\u003e) were measured.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4 Histological Assessment\\u003c/h2\\u003e \\u003cp\\u003eExcised hearts (n\\u0026thinsp;=\\u0026thinsp;6 hearts per group) were washed with prechilled PBS, blotted with filter paper, and fixed in 4% paraformaldehyde for more than 48 h. Next, the heart specimens were embedded in paraffin, sectioned at a thickness of 4 \\u0026micro;m, and preserved for histological assessment.\\u003c/p\\u003e \\u003cp\\u003eThe myocardial sections were deparaffinized before Masson\\u0026rsquo;s trichrome (Maxim Biotechnologies, Fuzhou, China), hematoxylin and eosin (H\\u0026amp;E), and immunohistochemical (IHC) staining. Trichome staining was performed to determine the collagen volume fraction (CVF), while H\\u0026amp;E staining was performed to assess diameters of cardiomyocytes and the extent of myocardial hypertrophy. Additionally, IHC staining of β\\u003csub\\u003e2\\u003c/sub\\u003eAR (Affinity Biosciences, DF3512, USA), CD68 (Bioss, bs-1432R, China), CD86 (Bioss, bs-1035R, China), and CD206 (Affinity Biosciences, DF4149, USA) was performed to assess the extent of myocardial infiltration caused by inflammatory cells. Imaging of the stained sections was performed at 400\\u0026times; magnification (BX43F, Olympus, Tokyo, Japan), and linear measurements were obtained using image analysis system (Image-Pro-Plus 4.0, Media Cybernetics, Silver Spring, MD).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5 Real-time PCR\\u003c/h2\\u003e \\u003cp\\u003eTotal RNA was extracted from mouse heart tissue and GMCs with TRIzol reagent (15596-026; Invitrogen, Carlsbad, CA, USA). Then, mRNA was reverse transcribed, and the RT-Rever TraAce kit (FSQ-101; Toyobo Co, Osaka, Japan) was used to transcribe mRNA to cDNA. Real-time PCR was performed in the LC480 system (Roche Applied Science, Mannheim, Germany). The following gene primers (Sangon Biotech, Shanghai, China) were used to evaluate mRNA expression: (1) tumor necrosis factor alpha (TNF-α), forward GAAAGCATGATCCGAGATGTG, reverse CACGAGCAGGAATGAGAAGAG; (2) transforming growth factor-beta (TGF-β1), forward ATGGTGGACCGCA ACAACGC, reverse CTGGCACTGCTTCCCGAATGTC; (3) inducible nitric oxide synthase (iNOS), forward TCTTGGAGCGAGTTGTGGATTGT, reverse TAGGTGAGG GCTTGCCTGAGTG; and (4) arginase 1 (Arg-1), forward CGTTG. GAPDH was used as the internal reference.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.6 Western Blotting\\u003c/h2\\u003e \\u003cp\\u003eThe relative protein expression in H9C2 cells and rat heart tissue was examined. Briefly, cells and heart tissue were homogenized and lysed with RIPA buffer (P0013B; Beyotime Institute of Biotechnology, Nantong, China) containing 1 mmol/L PMSF (ST506; Beyotime Institute of Biotechnology, Nantong, China). Then, cells were incubated at 4\\u0026deg;C for 30 min followed by centrifugation at 12,000 \\u0026times;g and 4\\u0026deg;C for 15 min to obtain the supernatant. The bicinchoninic acid (BCA) protein assay (23228; 1859078; Pierce Thermo-Scientific, Rockford, IL, USA) was performed to determine the protein concentration according to the manufacturer\\u0026rsquo;s instructions. The following antibodies were used: ANP (1:1,000, Affinity Biosciences, DF6497, USA), BNP (1:1,000, Affinity Biosciences, DF6902, USA), β\\u003csub\\u003e2\\u003c/sub\\u003eAR (1:1,000, Affinity Biosciences, DF3512, USA), and GAPDH (1:4,000, Proteintech, 10494-1-AP, UK). Band density was quantified by densitometric analysis using ImageJ software, and the expression of β-actin was used as the internal reference.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.7 ELISA\\u003c/h2\\u003e \\u003cp\\u003eEnzyme-linked immunosorbent assay (ELISA) was used to measure IL-6(Cusabio, EK306, China), IL-1β(Cusabio, EK301B, China), TNF-α(Cusabio, EK382, China), CK-MB(Wuhan Xinqidi Biotech Co.Ltd, EIA05488r, China) and cTnT(Wuhan Xinqidi Biotech Co.Ltd, EIA05536r, China) levels in rat myocardial tissue and H9C2 cells according to the manufacturer's instructions.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.8 Cardiomyocyte Apoptosis Assay\\u003c/h2\\u003e \\u003cp\\u003eApoptosis was measured by staining the with a combination of fluoresceinated (FITC) annexin V and propidium iodide (PI). Briefly, for annexin V-PI analysis, the cells were resuspended in 500 \\u0026micro;l of binding buffer (containing 140 mM NaCl, 2.5 mM CaCl\\u003csub\\u003e2\\u003c/sub\\u003e, 10 mM HEPES; pH 7.4). After that, 5 \\u0026micro;l of annexin V-FITC and 10 \\u0026micro;l of PI-PBS solution (Keygen Biotech, KGA108, China) were added to 1\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e cells and incubated for 15 minutes at room temperature in the dark. Data acquisition was performed within 1 hour by flow cytometry to avoid cell damage and the diffusion of PI through the cell membrane. The results were analyzed using CellQuest software.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.9 Cell Counting Kit-8 (CCK-8) assay\\u003c/h2\\u003e \\u003cp\\u003eH9C2 cells (2 \\u0026times; 10\\u003csup\\u003e3\\u003c/sup\\u003e cells per well) were seeded in a 96-well plate and incubated under normal or hypoxic conditions in complete medium. After the indicated time, 10 \\u0026micro;L of CCK-8 solution (TargetMoI, C0005, USA) was added to each well and incubated at 37\\u0026deg;C for another 4 h. The spectrophotometric absorbance was measured at 450 nm by microplate reader (Thermo Scientific, USA). The reagents and samples were prepared according to the manufacturer\\u0026rsquo;s instructions as previously described.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.10 Statistical Analysis\\u003c/h2\\u003e \\u003cp\\u003eAll experimental data were analyzed using GraphPad Prism 7 software (GraphPad Software Inc., San Diego, CA, USA). The results were shown as the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM. An unpaired t test was used to analyze the data between two groups. One-way ANOVA followed by Tukey\\u0026rsquo;s multiple comparisons test was performed to analyze data from more than two groups. It was considered to be significant when \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.1 Hypoxia Increases Cardiac weight\\u003c/h2\\u003e \\u003cp\\u003eAs shown in Fig.\\u0026nbsp;2A, a significant decrease in body weight (BW) was observed in the group exposed to a low-pressure hypoxic environment compared to the normoxic group. Treatment with E2 or 16α-OHE1 slightly suppressed this decline, but the difference was not significant. Compared with those in the normoxic group, the rats in the hypoxic group had different increases in heart weight (HW), the heart weight/body weight ratio (HW/BW), lung weight (LW), and lung wet weight (LW/LW) (Fig.\\u0026nbsp;2B-E). Pretreatment with medium and high doses of 16α-OHE1 (75 \\u0026micro;g/kg, 150 \\u0026micro;g/kg) reduced these values significantly, while the effects on the low-dose 16α-OHE1 (37.5 \\u0026micro;g/kg) group were not statistically significant. However, this treatment reduced HW, HW/BW, LW, and LW/LW to some extent.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eFigure\\u0026nbsp;1\\u003c/b\\u003e Graphical presentations of morphometric data. (A) Body weight (BW). (B) Heart weight (HW). (C) HW/BW coefficient. (D) Lung weight (LW). (E) LW/BW coefficient. n\\u0026thinsp;=\\u0026thinsp;6. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01 vs. N; \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01 vs. H. The data were presented as the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM. (one-way ANOVA)\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.2 16α-OHE1 Improves Heart Function After Hypoxia\\u003c/h2\\u003e \\u003cp\\u003eThe ECG showed that rats in the hypoxic group had increased heart rates, which were decreased after treatment with medium and high doses of 16α-OHE1, but there was no significant effect in the low-dose 16α-OHE1 group, compared with those in the normoxic group (Fig.\\u0026nbsp;3A). Compared with the N group, the H group showed a significant reduction in maximal systolic velocity, maximal diastolic velocity, and maximum tension, but there was no significant change in minimum tension (Fig.\\u0026nbsp;3B-E). Compared with the H group, the low-dose 16α-OHE1 group had a slight increase in the maximal systolic velocity, maximal diastolic velocity, and maximum tension, but the difference was not statistically significant. High doses of 16α-OHE1 significantly increased the maximal systolic velocity, maximum diastolic velocity, and maximum tension. After treatment with medium-dose 16α-OHE1, the maximum systolic velocity did not increase significantly, and the difference was not statistically significant, but the maximum diastolic velocity and tension increased significantly. These results indicated that medium to high doses of 16α-OHE1 significantly improved hypoxia-induced cardiac systolic decline in rats.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eFigure\\u0026nbsp;2 16\\u003c/b\\u003eα-OHE1 improves cardiac function in rats with hypoxia-induced myocardial injury. (A) Graphical representation of the heart rate (HR). n\\u0026thinsp;=\\u0026thinsp;6. (B, C) 16α-OHE1 increased the maximum systolic rate (+\\u0026thinsp;dp/dt\\u003csub\\u003emax\\u003c/sub\\u003e) and maximum diastolic velocity (-dp/dtmax) in rats with hypoxia-induced myocardial injury. (D, E) Maximum tension value (Tension\\u003csub\\u003emax\\u003c/sub\\u003e) and minimum tension value (Tension\\u003csub\\u003emin\\u003c/sub\\u003e) of rat hearts. n\\u0026thinsp;=\\u0026thinsp;4. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01 vs. N; \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01 vs. H. The data were presented as the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM. (one-way ANOVA)\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.3 16α-OHE1 Alleviates Myocardial Damage in Hypoxic Rats and Promotes β\\u003csub\\u003e2\\u003c/sub\\u003eAR Expression\\u003c/h2\\u003e \\u003cp\\u003eCreatine kinase isoenzymes (CK-MB) and troponin T (cTnT) are markers of myocardial injury. As shown in the figure, the CK-MB and cTnT in the hypoxic group were increased significantly compared with those in the normoxic group, which indicates hypoxia-induced myocardial injury (Fig.\\u0026nbsp;4A, B). However, compared with those in the H group, low, medium and high doses of 16α-OHE1 reduced CK-MB and cTnT values to varying degrees, and there were significant differences in the medium-dose and high-dose 16α-OHE1 groups. This finding suggested that 16α-OHE1 could improve myocardial damage caused by hypoxia. Next, we measured β\\u003csub\\u003e2\\u003c/sub\\u003eAR protein and gene expression in the rat myocardium. The results of Western blot showed that the expression of β\\u003csub\\u003e2\\u003c/sub\\u003eAR in the rat myocardium was significantly reduced by hypoxia (Fig.\\u0026nbsp;4C, D). However, 16α-OHE1 administration increased β\\u003csub\\u003e2\\u003c/sub\\u003eAR expression. Immunohistochemistry (IHC) was used to examine β\\u003csub\\u003e2\\u003c/sub\\u003eAR expression in the myocardium, and the results were consistent with the Western blot results (Fig.\\u0026nbsp;4E, F).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eFigure\\u0026nbsp;3 16\\u003c/b\\u003eα-OHE1 alleviates hypoxia-induced myocardial injury in rats. (A, B) Relative protein levels of β\\u003csub\\u003e2\\u003c/sub\\u003e-adrenoceptor (β\\u003csub\\u003e2\\u003c/sub\\u003eAR) in the rat myocardium. (C, D) ELISA kit were used to detect creatine kinase isoenzyme (CK-MB) and troponin T (cTnT) in the rat myocardium. (E, F) Relative protein levels of β\\u003csub\\u003e2\\u003c/sub\\u003e-adrenoceptor (β\\u003csub\\u003e2\\u003c/sub\\u003eAR) in the rat myocardium were determined by IHC. n\\u0026thinsp;=\\u0026thinsp;6. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01 vs. N; \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01 vs. H. The data were presented as the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM. (one-way ANOVA)\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.4 16α-OHE1 Inhibits Myocardial Hypertrophy and Myocardial Fibrosis in Hypoxic Rats\\u003c/h2\\u003e \\u003cp\\u003eTo determine the effect of hypoxia on myocardial structure, H\\u0026amp;E and Masson staining were performed to assess the degree of cardiomyocyte hypertrophy and mesenchymal collagen deposition, respectively. Diameter of cardiomyocyte was measured in the H\\u0026amp;E-stained myocardium and the results showed that hypoxia induced cardiomyocyte hypertrophy, and different doses of 16α-OHE1 could inhibit cardiomyocyte hypertrophy to varying degrees (Fig.\\u0026nbsp;5A, B). Immunoblot analysis of atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) further confirmed this conclusion (Fig.\\u0026nbsp;5C-F). The CVF evaluation showed an increase in myocardial interstitial fibrosis during hypoxia in SD rats (Fig.\\u0026nbsp;5G, H). These results suggested that pretreatment with 16α-OHE1 significantly ameliorated injury.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eFigure\\u0026nbsp;4 16\\u003c/b\\u003eα-OHE1 inhibits myocardial remodeling in rats with hypoxia-induced myocardial injury. (A, B) Representative H\\u0026amp;E staining and graphical presentation of the cardiomyocyte diameters. (C-F) Representative Western blotting and graphical presentations of the cardiac hypertrophy markers atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP). (G, H) Representative Masson\\u0026rsquo;s trichrome staining and graphical presentation of the collagen volume fractions, which were evaluated to assess the extent of fibrosis. n\\u0026thinsp;=\\u0026thinsp;6. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01 vs. N; \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01 vs. H. The data are presented as the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM. (one-way ANOVA)\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.5 16α-OHE1 Alleviates the Maladaptive Myocardial Inflammatory Response\\u003c/h2\\u003e \\u003cp\\u003eMyocardial inflammation during chronic stress exacerbates myocardial remodeling \\u003csup\\u003e[\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]\\u003c/sup\\u003e. Therefore, we evaluated the potential of E2 in adaptive immunomodulation in the myocardium during hypoxia. CD68-positive IHC staining showed a slight increase in infiltrating macrophages in the myocardium during hypoxia, while pretreatment with 16α-OHE1 prevented the infiltration of a large number of CD68-positive cells into the myocardium during stress (Fig.\\u0026nbsp;6A, D). Furthermore, CD86 and CD206 IHC staining showed that most inflammatory cells that infiltrated the myocardium during stress were CD86-positive (proinflammatory) cells, while CD206-positive (anti-inflammatory) cell infiltration was significantly hindered (Fig.\\u0026nbsp;6B, C, E, F). However, the opposite results were observed in the H E2 group and the H 16α-OHE1 group during stress: anti-inflammatory cell infiltration increased significantly, while proinflammatory cell infiltration was inhibited in these groups. To validate the adaptive immunomodulation induced by 16α-OHE1, the mRNA expression of proinflammatory (TNF-α and iNOS) and anti-inflammatory (TGF-β1 and Arg-1) biomarkers in the myocardium was evaluated. Compared with that in the N group, the expression of TNF-α and iNOS in the H group was increased, and the expression of TGF-β1 and Arg-1 was decreased (Fig.\\u0026nbsp;6G-J). However, pretreatment with 16α-OHE1 enhanced the expression of TGF-β1 and Arg-1 and reduced TNF-α and iNOS levels, and the difference was particularly significant in the medium- and high-dose 16α-OHE1 groups. Next, we measured interleukin 6 (IL-6), interleukin 1β (IL-1β), and tumor necrosis factor α (TNF-α) levels using ELISA kits. Hypoxia increased the expression of these three inflammatory factors in the myocardium, and pretreatment with 16α-OHE1 significantly improved this outcome (Fig.\\u0026nbsp;6K-M).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eFigure\\u0026nbsp;5 16\\u003c/b\\u003eα-OHE1 alleviates inflammatory infiltration in rats with hypoxia-induced myocardial injury. (A, D) Representative immunohistochemical staining and graphical presentation of CD68-positive cells (whole macrophages) in the myocardium. (B, E) Representative immunohistochemical staining and graphical presentation of CD86-positive cells (proinflammatory phenotype/M1 macrophages) in the myocardium. (C, F) Representative immunohistochemical staining and graphical presentation of CD206-positive cells (anti-inflammatory phenotype/M2 macrophages) in the myocardium. (G, H) The mRNA expression of the M1 macrophage markers tumor necrosis factor-alpha (TNF-α) and inducible nitric oxide synthase (iNOS) was assessed by RT‒PCR. (I, J) The mRNA expression of the M2 macrophage markers transforming growth factor-beta (TGF-β1) and arginase 1 (Arg-1) was assessed by RT‒qPCR. (K-M) ELISA was used to measure interleukin 6 (IL-6), interleukin 1β (IL-1β), and tumor necrosis factor α (TNF-α) levels in the rat myocardium. n\\u0026thinsp;=\\u0026thinsp;6. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01 vs. N; \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01 vs. H. The data were presented as the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM. (one-way ANOVA)\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.6 16α-OHE1 Attenuates Cardiomyocyte Damage\\u003c/h2\\u003e \\u003cp\\u003eThe inhibitory effect of 16α-OHE1 on hypoxia-induced H9C2 cardiomyocyte injury was determined. H9C2 cells were placed in a three-gas incubator containing 1% O\\u003csub\\u003e2\\u003c/sub\\u003e, 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e, and 94% N\\u003csub\\u003e2\\u003c/sub\\u003e for 24 h. After the cells were stimulated by hypoxia, the expression levels of CK-MB, cTnT, and BNP were significantly increased, while 16α-OHE1 inhibited the abnormal increase in these substances (Fig.\\u0026nbsp;7A-D). The Western blot results showed that 16α-OHE1 inhibited the hypoxia-induced decrease in β\\u003csub\\u003e2\\u003c/sub\\u003eAR levels in H9C2 cells (Fig. E, F). Altered expression of IL-6, IL-1β and TNF-α showed the anti-inflammatory effect of 16α-OHE1 (Fig.\\u0026nbsp;7G-I). The CCK-8 results showed that cardiomyocyte viability was decreased significantly by hypoxia, and treatment with 16α-OHE1 inhibited this change (Fig.\\u0026nbsp;7J). In addition, we measured apoptosis rates using flow cytometry. Compared with that in the N group, the apoptosis rate of cells in the H group was significantly increased. However, pretreatment with the three doses of 16α-OHE1 reduced apoptosis to varying degrees, and the results were statistically significant (Fig.\\u0026nbsp;7K). Our results suggested that 16α-OHE1 has a favorable protective effect against hypoxia-induced H9C2 cell damage.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eFigure\\u0026nbsp;6 16\\u003c/b\\u003eα-OHE1 alleviates cardiomyocyte damage. (A-B) ELISA kits were used to measure creatine kinase isoenzyme (CK-MB) and troponin T (cTnT) levels in H9C2 cells. (C, D) Relative protein levels of brain natriuretic peptide (BNP) in H9C2 cells. (E, F) Relative protein levels of β\\u003csub\\u003e2\\u003c/sub\\u003e-adrenoceptor (β\\u003csub\\u003e2\\u003c/sub\\u003eAR) in H9C2 cells. (G-I) ELISA kits were used to measure interleukin 6 (IL-6), interleukin 1β (IL-1β), and tumor necrosis factor α (TNF-α) levels in H9C2 cells. (J) The viability of H9C2 cells exposed to hypoxia for 24 was assessed by CCK-8 assays. (K) Apoptosis in H9C2 cells incubated under hypoxic conditions for 24 h was evaluated by flow cytometry. n\\u0026thinsp;=\\u0026thinsp;3. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01 vs. N; \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01 vs. H. The data were presented as the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM. (one-way ANOVA)\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.7 16α-OHE1 Attenuates Cardiomyocyte Damage via β\\u003csub\\u003e2\\u003c/sub\\u003eAR\\u003c/h2\\u003e \\u003cp\\u003eTo further explore whether β\\u003csub\\u003e2\\u003c/sub\\u003eAR activation is related to the protection of cardiomyocytes injury by 16α-OHE1 administration, we inhibit β\\u003csub\\u003e2\\u003c/sub\\u003eAR signaling using the β\\u003csub\\u003e2\\u003c/sub\\u003eAR inhibitor ICI 118,551. Compared with the H group, the contents of BNP, CK-MB and cTnT in the cells of the H\\u0026thinsp;+\\u0026thinsp;16α-OHE1 (2nM) group were significantly reduced, and compared with the H\\u0026thinsp;+\\u0026thinsp;16α-OHE1 (2nM) group, the expression of BNP, CK-MB and cTnT in the cells of the H\\u0026thinsp;+\\u0026thinsp;16α-OHE1\\u0026thinsp;+\\u0026thinsp;ICI 118,551 group was significantly increased, and the results showed that the depletion of β\\u003csub\\u003e2\\u003c/sub\\u003eAR inhibited the protective effect of 16α-OHE1 on cardiomyocyte damage (Fig.\\u0026nbsp;8A-D). In addition, ELISA showed that inhibiting β\\u003csub\\u003e2\\u003c/sub\\u003eAR eliminated the inhibitory effect of 16α-OHE1 on IL-6, IL-1β and TNF-α overexpression in hypoxia-induced H9C2 cells, as shown in Fig.\\u0026nbsp;8E-G. In addition, the CCK-8 and flow cytometry results showed that 16α-OHE1-mediated enhancement of cell viability and suppression of apoptosis was inhibited after β\\u003csub\\u003e2\\u003c/sub\\u003eAR signaling is blocked (Fig.\\u0026nbsp;8H, I). These results suggested that the protective effect of 16α-OHE1 on cardiomyocyte injury is at least partially mediated by β\\u003csub\\u003e2\\u003c/sub\\u003eAR activation.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eFigure\\u0026nbsp;7 16\\u003c/b\\u003eα-OHE1 alleviates cardiomyocyte damage by activating β\\u003csub\\u003e2\\u003c/sub\\u003eAR. (A, B) Relative protein levels of brain natriuretic peptide (BNP) in H9C2 cells. (C, D) ELISA kits were used to measure creatine kinase isoenzyme (CK-MB) and troponin T (cTnT) levels in H9C2 cells. (E-G) ELISA kits were used to measure interleukin 6 (IL-6), interleukin 1β (IL-1β), and tumor necrosis factor α (TNF-α) levels in H9C2 cells. (H) Apoptosis was evaluated by flow cytometric analysis of H9C2 cells incubated under hypoxic conditions for 24 h. (I) Cell viability was assessed by CCK-8 analysis of H9C2 cells exposed to hypoxia for 24. n\\u0026thinsp;=\\u0026thinsp;3. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01 vs. N; \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u003csup\\u003e##\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01 vs. H; \\u003csup\\u003e\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u003csup\\u003e\\u0026amp;\\u0026amp;\\u003c/sup\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01 vs. H\\u0026thinsp;+\\u0026thinsp;16α-OHE1. The data were presented as the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM. (one-way ANOVA)\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"4. Discussion\",\"content\":\"\\u003cp\\u003eLong-term studies have revealed higher mortality rates and increased readmission due to heart failure in patients with myocardial injuries \\u003csup\\u003e[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]\\u003c/sup\\u003e. However, the mechanism of Hypoxia-Induced myocardial injury remains unclear \\u003csup\\u003e[\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]\\u003c/sup\\u003e, which has driven research toward new therapeutic agents and drug targets. Our research focused on Hypoxia-Induced myocardial injury, exploring the preventive and protective effects of 16α-OHE1and its underlying mechanisms.\\u003c/p\\u003e \\u003cp\\u003eIn our study, hypoxia was first observed to significantly reduce rat body weight (BW). It may result from the physiological adaptation to environmental changes, including reduced fatty acid intake and cellular lipid storage \\u003csup\\u003e[\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]\\u003c/sup\\u003e. We also revealed that hypoxia increased HW and HW/BW coefficients in rats, which probably due to epicardial fat and myocardial hypertrophy \\u003csup\\u003e[\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]\\u003c/sup\\u003e. Notably, treatment with 16α-OHE1 alleviated the hypoxia-induced increase in cardiac weight.\\u003c/p\\u003e \\u003cp\\u003eHypoxia resulted in increased heart rates in rats, aligning with previous studies showing enhanced sympathetic activity and reduced parasympathetic activity under hypoxic conditions \\u003csup\\u003e[\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]\\u003c/sup\\u003e. 16α-OHE1 pre-treatment, however, led to decreased heart rates and improved systolic and diastolic function, countering the hypoxia-induced decline in cardiac function. Decreased systolic function has been reported to be a major feature of hypoxia-induced myocardial injury \\u003csup\\u003e[\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]\\u003c/sup\\u003e, and the administration of 16α-OHE1 significantly improved systolic and diastolic function of rat hearts. Thus, 16α-OHE1 could inhibit the hypoxia-induced decline in cardiac function in rats.\\u003c/p\\u003e \\u003cp\\u003eFurther studies are needed to characterize the effect of 16α-OHE1 on myocardial structure. It has been noted that pathological cardiac remodeling is characterized by cardiac hypertrophy and fibrosis, which are pathological features of many heart diseases and can induce severe myocardial damage \\u003csup\\u003e[\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]\\u003c/sup\\u003e. Cardiac hypertrophy is characterized by enlarged cells and involves both physiological and pathological hypertrophy \\u003csup\\u003e[\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]\\u003c/sup\\u003e. Pathological cardiac hypertrophy is typically accompanied by the release of atrial natriuretic peptide (ANP) and brain-type atriuretic peptide (BNP)\\u003csup\\u003e[\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]\\u003c/sup\\u003e. We observed that cardiomyocyte diameter was increased during hypoxia, which distorted the typical myocardial structure\\u003csup\\u003e[\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]\\u003c/sup\\u003e. This was further demonstrated by the significant upregulation of ANP and BNP expression in rat hearts in the hypoxic state. However, 16α-OHE1 could abrogate the increases in ANP, BNP, and cell diameter during stress. In addition, we found that hypoxia induced massive interstitial fibrosis, and pretreatment with 16α-OHE1 improved this adverse outcome. In conclusion, 16α-OHE1 can inhibit myocardial remodeling in rats by inhibiting myocardial hypertrophy and fibrosis, thereby reducing myocardial damage in rats.\\u003c/p\\u003e \\u003cp\\u003eProinflammatory macrophages are abundant in the myocardium, as evidenced by autopsies of heart-damaged patients, and have been shown to exacerbate the inflammatory response in the myocardium, which may be caused by stress-induced heart damage, and the biased infiltration of CD86\\u0026thinsp;+\\u0026thinsp;macrophages (proinflammatory) accelerates pathological cardiac remodeling because autopsy hearts have significant levels of fibrosis \\u003csup\\u003e[\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]\\u003c/sup\\u003e. IHC showed that CD68-positive cells exhibited increased myocardial infiltration under hypoxic conditions. Pretreatment with 16α-OHE1 minimized CD68-positive cell infiltration. The phenotypic ratio was evaluated by CD86 and CD206 immunostaining, and most CD68-positive cells that infiltrated the myocardium during hypoxia were CD86-positive cells, while CD206-positive cells were less abundant, indicating inflammatory infiltration of the rat myocardium\\u003csup\\u003e[\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]\\u003c/sup\\u003e. However, 16α-OHE1 reversed these phenomena by increasing the presence of CD206\\u0026thinsp;+\\u0026thinsp;macrophages to enhance the anti-inflammatory response of the heart during stress, as the literature suggests\\u003csup\\u003e[\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e]\\u003c/sup\\u003e. This finding was validated by evaluating the mRNA expression of proinflammatory (TNF-α and iNOS) and anti-inflammatory macrophage (TGF-β and Arg-1) markers in the experimental groups\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR41\\\" citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e]\\u003c/sup\\u003e. Similar to the histological observations, TNF-α and iNOS expression in the myocardium was upregulated during hypoxia, and TGF-β and Arg-1 mRNA expression as downregulated by hypoxia. In contrast, 16α-OHE1 exerted anti-inflammatory effects by enhancing TGF-β and Arg-1 while reducing TNF-α and iNOS mRNA expression. In addition, the decrease of IL-6, IL-1β, and TNF-α in the myocardium of rats in the 16α-OHE1 dosing group further demonstrated the anti-inflammatory effect of 16α-OHE1, as described in the literature\\u003csup\\u003e[\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e]\\u003c/sup\\u003e. In conclusion, 16α-OHE1 can inhibit hypoxia-induced myocardial inflammatory infiltration.\\u003c/p\\u003e \\u003cp\\u003eCreatine kinase isoenzyme (CK-MB) and cardiac troponin T (cTnT) have been reported to be markers of myocardial injury \\u003csup\\u003e[\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e]\\u003c/sup\\u003e. The rat myocardial enzymes CK-MB and cTnT were examined to directly illustrate the protective effect of 16α-OHE1 on myocardial injury [16]. In summary, we can draw a preliminary conclusion: 16α-OHE1 protects against hypoxia-induced myocardial injury in rats by improving cardiac diastolic and systolic function and inhibits myocardial remodeling and inflammation.\\u003c/p\\u003e \\u003cp\\u003eA hypoxia-induced cardiomyocyte injury model was established based on rat H9C2 cells and was pretreated with 16α-OHE1. The results showed that 16α-OHE1 could significantly improve the hypoxia-induced decrease in H9C2 cell activity and reduce hypoxia-induced apoptosis in H9C2 cells. In addition, 16α-OHE1 pretreatment could reduce the hypoxia-induced increase in CK-MB and cTnT in H9C2 cells, and similar to CK-MB and cTnT, the decrease in BNP also reflected the cardiomyocyte protective effect of 16α-OHE1\\u003csup\\u003e[\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e]\\u003c/sup\\u003e. In addition, 16α-OHE1 significantly reduced the increase in IL-6, IL-1β, and TNF-α levels in H9C2 cells under hypoxic conditions. In summary, 16α-OHE1 protects H9C2 cells from hypoxia-induced damage.\\u003c/p\\u003e \\u003cp\\u003eUnder hypoxic conditions, β\\u003csub\\u003e2\\u003c/sub\\u003eAR expression in the rat myocardium and H9C2 cells decreased significantly, while pretreatment with 16α-OHE1 significantly abrogated the decline in β\\u003csub\\u003e2\\u003c/sub\\u003eAR. We hypothesize that the protective effect of 16α-OHE1 against hypoxia-induced myocardial injury may be related to β\\u003csub\\u003e2\\u003c/sub\\u003eAR activation. To explore this mechanism, we used the β\\u003csub\\u003e2\\u003c/sub\\u003eAR blocker ICI 118,551 to determine whether the myocardial protective effect of 16α-OHE1 was affected by impairing β\\u003csub\\u003e2\\u003c/sub\\u003eAR signaling, following previous experience\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR49\\\" citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e]\\u003c/sup\\u003e. As expected, when β\\u003csub\\u003e2\\u003c/sub\\u003eAR signaling is blocked, the antiapoptotic and cell viability-enhancing effects of 16α-OHE1 on hypoxia-induced H9C2 cells disappeared. In addition, 16α-OHE1 could not inhibit the abnormal increases in CK-MB, cTnT, and BNP in hypoxia-induced H9C2 cells after β\\u003csub\\u003e2\\u003c/sub\\u003eAR signaling was blocked. In addition, the anti-inflammatory effect of 16α-OHE1 was also abrogated after β\\u003csub\\u003e2\\u003c/sub\\u003eAR expression was inhibited. These results show that β\\u003csub\\u003e2\\u003c/sub\\u003eAR plays an important role in the protective effect of 16α-OHE1 against hypoxia-induced myocardial injury.\\u003c/p\\u003e \\u003cp\\u003eIn conclusion, 16α-OHE1, which is a hydroxylated metabolite of estrogen, protects against hypoxia-induced myocardial injury in rats. In addition, we demonstrated that 16α-OHE1 could effectively activate the β\\u003csub\\u003e2\\u003c/sub\\u003eAR signaling pathway, thereby improving cardiac function and inhibiting myocardial remodeling, inflammatory infiltration, and apoptosis in rats under hypoxic conditions. These effects of 16α-OHE1 make it promising in protecting against hypoxia-induced myocardial injury and provide new ideas for the treatment of hypoxia-induced myocardial injury.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAuthor Contribution\\u003c/strong\\u003e Yequan Zhou: Conceptualization, Methodology, Software, Investigation, Formal Analysis, Writing - Original Draft, Zeyuan Yin: Writing -Review \\u0026amp; Editing, Investigation, Junchao Cui: Data Curation, Investigation, Validation, Writing - Original Draft, Zhonghui Cao: Visualization, Investigation, Cheng Wang: Supervision, Writing -Review \\u0026amp; Editing, Xiao Gao: Visualization, Writing - Review \\u0026amp; Editing, Shimin He: Software, Tong Fu: Writing -Review \\u0026amp; Editing, Lu Fu: Conceptualization, Writing -Review \\u0026amp; Editing, Xueyan Zhou: Conceptualization, Funding Acquisition, Resources, Supervision, Writing -Review \\u0026amp; Editing, All authors read and approved the final manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding \\u003c/strong\\u003eThis work was supported by the Natural Science Foundation of China [No. 82173883]; the Science and Technology Foundation of Xuzhou [No. KC21010]; the Natural Science Foundation of the Jiangsu Higher Education Institutions of China [No. 18KJA350002]; the Natural Science Foundation of Jiangsu Province [No. BK20181470]; the Provincial Commission of Health and Family Planning in Jiangsu Province [No. H2017079]; the Science and Technology Planning Project of Jiangsu Province [No. BE2019636]; the Science and technology project of Xuzhou [No. KC22469].\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData Availability\\u003c/strong\\u003e The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCode Availability\\u003c/strong\\u003e Statistical analysis was performed using GraphPad Prism 7 software.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics Approval\\u003c/strong\\u003e All procedures were performed in accordance with the guidelines developed by the Institutional Animal Care and Use Committee of Xuzhou Medical University (Xuzhou, China).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent to Participate\\u003c/strong\\u003e Not applicable\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eZhang E, Zhao X, Zhang L, et al. Minocycline promotes cardiomyocyte mitochondrial autophagy and cardiomyocyte autophagy to prevent sepsis-induced cardiac dysfunction by Akt/mTOR signaling. Apoptosis. 2019;24(3\\u0026ndash;4):369\\u0026ndash;81.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang H, Liu M, Zhang Y, et al. Trimetazidine Attenuates Exhaustive Exercise-Induced Myocardial Injury in Rats via Regulation of the Nrf2/NF-κB Signaling Pathway. Front Pharmacol. 2019;10(null):175.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTan J, Pan W, Chen H et al. Circ_0124644 Serves as a ceRNA for miR-590-3p to Promote Hypoxia-Induced Cardiomyocytes Injury via Regulating SOX4. Frontiers in genetics. 2021;12(null):667724.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYoh K, Ikeda K, Horie K, et al. Roles of Estrogen, Estrogen Receptors, and Estrogen-Related Receptors in Skeletal Muscle: Regulation of Mitochondrial Function. Int J Mol Sci. 2023;24(3):null.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhao L, Fan X, Zuo L, et al. Estrogen receptor 1 gene polymorphisms are associated with metabolic syndrome in postmenopausal women in China. BMC Endocr disorders. 2018;18(1):65.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMeng Q, Li Y, Ji T, et al. Estrogen prevent atherosclerosis by attenuating endothelial cell pyroptosis via activation of estrogen receptor α-mediated autophagy. J Adv Res. 2021;28(null):149\\u0026ndash;64.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFrump AL, Albrecht M, Yakubov B, et al. 17β-Estradiol and estrogen receptor α protect right ventricular function in pulmonary hypertension via BMPR2 and apelin. J Clin Invest. 2021;131(6):null.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHou H, Adzika GK, Wu Q, et al. Estrogen Attenuates Chronic Stress-Induced Cardiomyopathy by Adaptively Regulating Macrophage Polarizations via β2-Adrenergic Receptor Modulation. Front cell Dev biology. 2021;9(null):737003.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhao F, Wang X, Wang Y, et al. The function of uterine UDP-glucuronosyltransferase 1A8 (UGT1A8) and UDP-glucuronosyltransferase 2B7 (UGT2B7) is involved in endometrial cancer based on estrogen metabolism regulation. Hormones-International J Endocrinol Metabolism. 2020;19(3):403\\u0026ndash;12.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMasi CM, Hawkley LC, Xu X, et al. Serum estrogen metabolites and systolic blood pressure among middle-aged and older women and men. Am J Hypertens. 2009;22(11):1148\\u0026ndash;53.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSeeger H, Mueck AO, Lippert TH. Effect of estradiol metabolites on the susceptibility of low density lipoprotein to oxidation. Life Sci. 1997;61(9):865\\u0026ndash;8.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSeeger H, Mueck AO, Lippert TH. Effect of estradiol metabolites on prostacyclin synthesis in human endothelial cell cultures. Life Sci. 1999;65(13):Pl167\\u0026ndash;70.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSwaneck GE, Fishman J. Covalent binding of the endogenous estrogen 16 alpha-hydroxyestrone to estradiol receptor in human breast cancer cells: characterization and intranuclear localization. Proceedings of the national academy of sciences of the united states of america. 1988;85(21):7831-5.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYin ZY, Fu T, He SM et al. 16α-OHE1, a novel oestrogen metabolite, attenuates dysfunction of left ventricle contractility via regulation of autophagy after myocardial ischemia and reperfusion. Int J Cardiol. 2023;null(null):131123.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePaur H, Wright PT, Sikkel MB, et al. High levels of circulating epinephrine trigger apical cardiodepression in a β2-adrenergic receptor/Gi-dependent manner: a new model of Takotsubo cardiomyopathy. Circulation. 2012;126(6):697\\u0026ndash;706.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSteiner JL, Lang CH. Etiology of alcoholic cardiomyopathy: Mitochondria, oxidative stress and apoptosis. Int J Biochem Cell Biol. 2017;89(null):125\\u0026ndash;35.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYang X, Zhao T, Feng L, et al. PM2.5-induced ADRB2 hypermethylation contributed to cardiac dysfunction through cardiomyocytes apoptosis via PI3K/Akt pathway. Environ Int. 2019;127(null):601\\u0026ndash;14.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTao X, Xu Y, Adu-Amankwaah J et al. β2AR against myocarditis-lipid deposition depends on estrogenic environment in stress. Journal of endocrinology. 2023;null(null):null.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDang Z, Su S, Jin G et al. Tsantan Sumtang attenuated chronic hypoxia-induced right ventricular structure remodeling and fibrosis by equilibrating local ACE-AngII-AT1R/ACE2-Ang1-7-Mas axis in rat. Journal of ethnopharmacology. 2020;250(null):112470.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHulsmans M, Sager HB, Roh JD, et al. Cardiac macrophages promote diastolic dysfunction. J Exp Med. 2018;215(2):423\\u0026ndash;40.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBardaj\\u0026iacute; A, Bonet G, Carrasquer A, et al. Clinical Features and Prognosis of Patients with Acute and Chronic Myocardial Injury Admitted to the Emergency Department. Am J Med. 2019;132(5):614\\u0026ndash;21.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGiustino G, Croft LB, Stefanini GG, et al. Characterization of Myocardial Injury in Patients With COVID-19. J Am Coll Cardiol. 2020;76(18):2043\\u0026ndash;55.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBensaad K, Favaro E, Lewis CA, et al. Fatty acid uptake and lipid storage induced by HIF-1α contribute to cell growth and survival after hypoxia-reoxygenation. Cell Rep. 2014;9(1):349\\u0026ndash;65.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRuixia Z, Chuanchuan L, Lu G, et al. Studies on the effects of hypothermia combined with hypoxia on rat skeletal muscle and lipid metabolism based on AMPK/PGC1α pathway. J Orthop Surg Res. 2021;16(1):712.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMori T, Kai H, Kajimoto H, et al. Enhanced cardiac inflammation and fibrosis in ovariectomized hypertensive rats: a possible mechanism of diastolic dysfunction in postmenopausal women. Hypertens Res. 2011;34(4):496\\u0026ndash;502.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSiebenmann C, Rasmussen P, Hug M, et al. Parasympathetic withdrawal increases heart rate after 2 weeks at 3454 m altitude. J Physiol-London. 2017;595(5):1619\\u0026ndash;26.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSmeir E, Leberer S, Blumrich A, et al. Depletion of cardiac cardiolipin synthase alters systolic and diastolic function. iScience. 2021;24(11):103314.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu MP, Zhang YS, Xu XB, et al. Vinpocetine Attenuates Pathological Cardiac Remodeling by Inhibiting Cardiac Hypertrophy and Fibrosis. Cardiovasc Drug Ther. 2017;31(2):157\\u0026ndash;66.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiang B, Zhang XX, Li R et al. Guanxin V alleviates acute myocardial infarction by restraining oxidative stress damage, apoptosis, and fibrosis through the TGF-β1 signalling pathway. Phytomedicine. 2022;100(null):154077.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eD'Ascenzi F, Pelliccia A, Corrado D, et al. Right ventricular remodelling induced by exercise training in competitive athletes. Eur Heart J-Card Img. 2016;17(3):301\\u0026ndash;7.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTang L, Yu X, Zheng Y, et al. Inhibiting SLC26A4 reverses cardiac hypertrophy in H9C2 cells and in rats. PeerJ. 2020;8(null):e8253.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWen ZQ, Li SH, Shui X, et al. LncRNA PEG10 aggravates cardiac hypertrophy through regulating HOXA9. Eur Rev Med Pharmacol Sci. 2019;23(3 Suppl):281\\u0026ndash;6.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi XR, Lan YH, Wang Y, et al. Telmisartan suppresses cardiac hypertrophy by inhibiting cardiomyocyte apoptosis via the NFAT/ANP/BNP signaling pathway. Mol Med Rep. 2017;15(5):2574\\u0026ndash;82.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eScally C, Abbas H, Ahearn T, et al. Myocardial and Systemic Inflammation in Acute Stress-Induced (Takotsubo) Cardiomyopathy. Circulation. 2019;139(13):1581\\u0026ndash;92.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWilson HM, Cheyne L, Brown PAJ et al. Characterization of the Myocardial Inflammatory Response in Acute Stress-Induced (Takotsubo) Cardiomyopathy. JACC Basic to translational science. 2018;3(6):766\\u0026ndash;78.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAl-Darraji A, Haydar D, Chelvarajan L, et al. Azithromycin therapy reduces cardiac inflammation and mitigates adverse cardiac remodeling after myocardial infarction: Potential therapeutic targets in ischemic heart disease. PLoS ONE. 2018;13(7):e0200474.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKrasnyi AM, Sadekova AA, Smolnova TY, et al. The Levels of Ghrelin, Glucagon, Visfatin and Glp-1 Are Decreased in the Peritoneal Fluid of Women with Endometriosis along with the Increased Expression of the CD10 Protease by the Macrophages. Int J Mol Sci. 2022;23(18):null.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBai XJ, Hao L, Guo YE, et al. Bone marrow stromal cells reverse the microglia type from pro-inflammatory tumour necrosis factor a microglia to anti-inflammatory CD206 microglia of middle cerebral artery occlusion rats through triggering secretion of CX3CL1. Folia Neuropathol. 2021;59(1):20\\u0026ndash;31.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMachin A, Divamillenia D, Fatimah N, et al. The Effect of Green Tea with EGCG Active Compound in Enhancing the Expression of M2 Microglia Marker (CD206). Neurol India. 2022;70(2):530\\u0026ndash;4.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen HL, Jia WJ, Li HE, et al. Scutellarin Exerts Anti-Inflammatory Effects in Activated Microglia/Brain Macrophage in Cerebral Ischemia and in Activated BV-2 Microglia Through Regulation of MAPKs Signaling Pathway. Neuromol Med. 2020;22(2):264\\u0026ndash;77.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu M, Wang J, Chen S et al. Exploring the effect of Er miao San-containing serum on macrophage polarization through miR-33/NLRP3 pathway. Journal of ethnopharmacology. 2023;307(null):116178.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSalim T, Sershen CL, May EE. Investigating the Role of TNF-α and IFN-γ Activation on the Dynamics of iNOS Gene Expression in LPS Stimulated Macrophages. PLoS ONE. 2016;11(6):e0153289.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDong W, Li X, Wang X, et al. Influence of Dexmedetomidine on Cognitive Function and Inflammatory Factors in Rats and Analysis of Its Molecular Mechanism after Cardiac Surgery under Cardiopulmonary Bypass. Cell Mol Biol. 2022;68(2):119\\u0026ndash;25.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang JL, Cai F, Liu XH, et al. Lipopolysaccharide Promotes Inflammatory Response via Enhancing IFIT1 Expression in Human Umbilical Vein Endothelial Cells. DNA Cell Biol. 2020;39(7):1274\\u0026ndash;81.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen JY, Jiang ZZ, Zhou X, et al. Dexmedetomidine Preconditioning Protects Cardiomyocytes Against Hypoxia/Reoxygenation-Induced Necroptosis by Inhibiting HMGB1-Mediated Inflammation. Cardiovasc Drug Ther. 2019;33(1):45\\u0026ndash;54.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRen Z, Xiao WJ, Zeng Y, et al. Fibroblast growth factor-21 alleviates hypoxia/reoxygenation injury in H9c2 cardiomyocytes by promoting autophagic flux. Int J Mol Med. 2019;43(3):1321\\u0026ndash;30.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYue L, Sheng S, Yuan M et al. HypERlnc attenuates angiotensin II-induced cardiomyocyte hypertrophy via promoting SIRT1 SUMOylation-mediated activation of PGC-1α/PPARα pathway in AC16 cells. Cell Biol Int. 2023;null(null):null.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eO'Neill E, Yssel JD, McNamara C, et al. Pharmacological targeting of β2 -adrenoceptors is neuroprotective in the LPS inflammatory rat model of Parkinson's disease. Br J Pharmacol. 2020;177(2):282\\u0026ndash;97.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu S, Xiu J, Zhu C, et al. Fat mass and obesity-associated protein regulates RNA methylation associated with depression-like behavior in mice. Nat Commun. 2021;12(1):6937.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen X, Zhang W, Liu R, et al. NNK from tobacco smoking enhances pancreatic cancer cell stemness and chemoresistance by creating a β2AR-Akt feedback loop that activates autophagy. Mol Oncol. 2022;16(15):2881\\u0026ndash;95.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"hypoxia, hypoxia-induced myocardial injury, 16α-OHE1, estrogen metabolites, Inflammatory Infiltration, β2-adrenergic receptor\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3206949/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3206949/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cb\\u003eObjective\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eThe study aimed to investigate the protective effect of 16α-OHE1 on myocardial injury caused by hypoxia.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eMethods and results\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eRats were exposed to normoxia or hypoxia conditions simulating an high altitude of 6000 m in a low-pressure chamber for 7 days. Post-exposure, evaluations were made on cardiac function, myocardial enzyme concentrations, histopathological modifications, inflammatory infiltration, and β2-adrenergic receptor (β2AR) expression levels. In parallel, H9C2 cells were cultured under standard oxygen conditions or in a three-gas incubator containing 5% O\\u003csub\\u003e2\\u003c/sub\\u003e for 24 h. Cell viability, apoptosis, inflammatory infiltration, and myocardial enzyme levels in H9C2 cells were measured. Hypoxia induced significant myocardial damage, marked by impaired cardiac function, myocardial structural changes, inflammatory infiltration, and increased apoptosis. Pre-treatment with 16α-OHE1 significantly improved heart function and reduced myocardial enzyme release. The increased inflammatory response was also significantly suppressed. In addition to preserving myocardial structures, hypoxia-induced apoptosis in cardiomyocytes was significantly weakened. Notably, these protective effects of 16α-OHE1 were linked with the upregulation of β2AR expression. However, when β\\u003csub\\u003e2\\u003c/sub\\u003eAR was inhibited by ICI 118,551, the protective effect of 16α-OHE1 on the myocardium was abrogated.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eConclusion\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003e16α-OHE1 could reduce hypoxia-induced myocardial injury in rats through β\\u003csub\\u003e2\\u003c/sub\\u003e-adrenoceptors.\\u003c/p\\u003e\",\"manuscriptTitle\":\"A Novel Mechanism of 16α-OHE1, One of Estrogen Metabolites, Alleviating Inflammatory Infiltration in Hypoxia-Induced Myocardial Injury via β2-Adrenergic Receptor\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2023-08-09 15:27:21\",\"doi\":\"10.21203/rs.3.rs-3206949/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"050557ac-427c-4d56-b5f1-a739344776c2\",\"owner\":[],\"postedDate\":\"August 9th, 2023\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2023-08-29T11:44:15+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2023-08-09 15:27:21\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3206949\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3206949\",\"identity\":\"rs-3206949\",\"version\":[\"v1\"]},\"buildId\":\"zQwnuV7TCBrMSSSToR1PI\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}