{"paper_id":"013603c4-4ab7-4cc1-a0d9-c237193c8803","body_text":"Aif-1, a highly conserved, 17 kDa EF hand motif-bearing phosphoprotein ( Utans et al., 1995 ; ( Imai  et al ., 1996 ), is expressed primarily by developing spermatids ( Iida  et al ., 2001 ;  Kohler, 2007 ) and cells of monocyte/macrophage lineage. Increased Aif-1 expression has been identified in infiltrating macrophages in damaged or inflamed tissues, including allografted solid organs ( e.g ., heart ( Utans  et al ., 1995 ) and liver ( Nagakawa  et al ., 2004 )), autoimmune conditions ( e.g ., rheumatoid arthritis), and drug-induced disease models ( e.g ., kidney ( Tsubata  et al ., 2006 )). In the nervous system, Aif-1 (often referred to as Iba1 in this literature) has emerged as a histologic marker of microglia and microglial activation ( Ahmed  et al ., 2007 ;  Mittelbronn  et al ., 2001 ) in several pathologic conditions, including the response to facial nerve axotomy ( Graeber  et al ., 1998 ), stroke ( Postler  et al ., 2000 ), uveitis ( Fauser  et al ., 2001 ), and experimental autoimmune encephalomyelitis ( Schluesener  et al ., 1998 ).\nHow Aif-1 affects cellular activities is not well understood. When microglia are stimulated with colony stimulating factor-1, Aif-1 accumulates with F-actin in membrane ruffles, and overexpression studies  in vitro  suggest a role for this protein in cellular motility and phagocytosis ( Imai and Kohsaka, 2002 ). It has also been suggested that Aif-1 expression in the cytoplasm of elongated spermatids contributes to the final stage of spermiogenesis ( i.e ., elimination of residual cytoplasm) ( Iida  et al ., 2001 ), perhaps by reorganizing the actin cytoskeleton to promote residual body extrusion. Relevant intracellular signaling events may include Aif-1-mediated potentiation of a phospholipase C-gamma-dependent pathway that activates the Rac GTPase ( Kanazawa  et al ., 2002 ). Exogenous or overexpressed Aif-1 induces cytokine expression, including that of IL-6 by synovial fibroblasts and mononuclear cells ( Kimura  et al ., 2007 ) and IL-12 by monocyte/macrophages ( Watano  et al ., 2001 ), and promotes proliferation of cells derived from inflammatory lesions ( Kimura  et al ., 2007 ). Knockdown of Aif-1 with an siRNA decreased macrophage proliferation and migration, and limited activities of Akt and extracellular signal-regulated kinase 1/2 pathways, without affecting apoptosis as evaluated by caspase 3 activation ( Tian  et al ., 2006 ). Manipulation of Aif-1 expression  in vivo  affects neointima formation after mechanical vascular injury ( Sommerville  et al ., 2009 ), but the significance of Aif-1 expression in development and auto- and alloimmune inflammatory conditions is not known.\nTo permit such investigations, we have generated a mouse line with targeted inactivation of the  aif-1  gene. Mice homozygous for the targeted allele appear grossly normal, show good viability and fertility, and have nearly normal peripheral blood cell profiles. In a collagen-induced arthritis model, they displayed significantly less paw swelling and disease activity compared to control mice. We anticipate that these mice will be useful for studies of Aif-1 function in a variety of inflammatory disease models.\n\nThe mouse  aif-1  locus lies in in the class III major compatibility complex on chromosome 17. Transcripts described in Genbank entries NM019467.2 and  AK006184.1  indicate that the locus has 8 exons. Two exons encode 5’ untranslated sequences, while the other 6, which encompass the translation start and stop sites, span just 1.4 kb of the genome. To create a null allele with genetic reporter capability, we designed a targeting construct to substitute a modified  lacZ  gene encoding nuclear-localized β-galactosidase ( Kupershmidt  et al ., 1999 ) for all  aif-1  coding sequences ( Figure 1a ). This construct was electroporated into embryonic stem (ES) cells, and homologous recombinant clones were identified by PCR and evaluated by genomic Southern analysis using 5’ and 3’ external probes. Several clones with proper targeting were identified; in the example in  Figure 1b , lane 2 shows the predicted change in Nde I restriction fragment size from 12.7 kb to 9.9 kb (5’ probe) and to 6.6 kb (3’ probe). This clone was injected into C57BL/6 blastocysts, and yielded highly chimeric founders. Germline transmission of the targeted, inactivated  aif-1  allele was confirmed, and these F1 mice were crossed with C57BL/6 mice to establish the colony. Genomic Southern analysis further confirmed expected genotypes ( Figure 1c ). Methods for routine genotyping by PCR were established ( Figure 2a ). Both  aif-1 +/−  and  aif-1 −/−  mice of both sexes appeared grossly normal and bred well; genotyping of 130 offspring showed no significant deviation from predicted Mendelian ratios of inheritance, indicating that loss of Aif-1 has little or no effect on fertility or survival in barrier-protected, C57BL/6 mice ( Table 1 ).\nTo confirm loss of Aif-1 expression through this strategy, we euthanized  wt ,  aif-1 +/− , and aif-1 −/−  mice and isolated total RNA from several organs. Samples were subjected to Northern analysis using a cDNA probe encoding the entire Aif-1 open reading frame ( Sibinga  et al ., 2002 ). The filter was washed to high stringency and autoradiographed. As shown in  Figure 2b , robust expression of  aif-1  mRNA was apparent in thymus, testis, and spleen samples from  wt  mice, with a faint signal also observed in liver. In the testis sample, higher molecular weight bands were observed, consistent with a previous report ( Watano  et al ., 2001 ), and these signals were notably more intense than those produced by other organs. All samples from  aif-1 +/−  mice showed decreased signal intensity relative to those from the corresponding  wt  tissue. Samples from  aif-1 −/−  mice were devoid of signal, as expected based on the targeting strategy. Immunoblotting also showed loss of Aif-1 signal, although in this case, faint bands of ~22 and 17 kDa were apparent in the testis and liver samples, respectively ( Figure 2c ). Because our targeting strategy removed all Aif-1 coding sequences, these bands likely result from non-specific cross-reaction of the antibody, but it is possible that the 17 kDa band represents a product of the Aif-1-like gene (ENSMUSG00000001864), which is 81% similar in sequence to Aif-1.\nOn necropsy, spleens from  aif-1 −/−  mice appeared smaller than those of  wt  littermates. On average, Aif-1-deficient spleens weighed less, while splenic cell density (cell number per gram of tissue) was similar to  wt  ( Figure 3 ). We also evaluated peripheral blood components. While erythrocyte numbers, hemoglobin, and hematocrit concentrations from Aif-1-deficient mice were all slightly lower than those in  wt  mice, these individual differences did not reach statistical significance ( Table 2 ). On the other hand, mice lacking Aif-1 had ~10% fewer circulating platelets compared to their  wt  counterparts. The cellular basis for these modest differences in hematopoietic cell populations is not known at present.\nIncreased Aif-1 expression, infiltration of Aif-1-expressing cells, and single nucleotide polymorphisms in the  aif-1  locus have been linked to multiple autoimmune diseases, notably rheumatoid arthritis ( Kimura  et al ., 2007 ); ( Pawlik  et al ., 2012 ), but whether Aif-1 has an essential role in the pathogenesis of such processes is not clear. For initial evaluation of how Aif-1-deficiency affects inflammatory disease progression, we studied 12 week-old male  wt  control and  aif-1 -targeted mice, immunizing them by intradermal injection of chicken collagen type II (CII) emulsified in complete Freund’s adjuvant ( Inglis  et al ., 2008 ). The animals were examined every few days to evaluate disease activity as reflected in measured paw thickness and overall clinical score, as described ( Inglis  et al ., 2008 ). We saw thickening and erythema in the paws, but not in knee or ankle joints, consistent with the milder level of disease seen in C57BL/6 compared with DBA/1 mice ( Inglis  et al ., 2007 ). In both genotypes, these indices increased during the period from 29 to 69 days after immunization, but in mice that lacked Aif-1, both paw thickening and disease scores were significantly attenuated relative to control mice ( Figure 4 ).\nIn summary, these studies demonstrate the successful generation, by homologous recombination, of a null allele for the  aif-1  gene in mice. The effect of global loss of Aif-1 expression on mouse development has not been previously described. Although  aif-1  mRNA is normally expressed strongly in the testis ( Figure 2b ), mice lacking one or both copies of the gene proved to have good fertility and viability. Decreased spleen weight and lower peripheral blood platelet counts in  aif-1-null  animals indicate that loss of Aif-1 has modest effects on hematologic development; the precise cellular basis of these effects remains to be determined. Several prior reports have implicated Aif-1 in the pathogenesis of multiple inflammatory and immunologic conditions, but the functional significance of Aif-1 in these diseases and disease models has not been previously tested in vivo. Our initial studies using a model of autoimmune arthritis support the idea that Aif-1 promotes disease activity, and demonstrate the utility of this new transgenic mouse line. We anticipate that the line will be useful in characterizing how Aif-1 contributes to a variety of other inflammatory diseases.\n\nThe standing committee of the Albert Einstein Institute for Animal Studies approved these studies, and the mouse model will be shared with the research community after manuscript publication. A 4.2 kb EcoRI-EcoRI fragment containing the known coding sequences of the  aif-1  locus was obtained from a clone isolated from a 129SvJ mouse genomic library in the Lambda Fix II phage (Stratagene); this fragment was recloned into a PGK-tk/pBluescript targeting vector backbone. The Aif-1 coding sequences were excised and replaced by a modified  lacZ  gene encoding nuclear-localized β-galactosidase and a neomycin cassette ( Kupershmidt  et al ., 1999 ). The 5’ arm of the construct was extended by ligating a 4.8 kb NsiI-NsiI  aif-1  genomic fragment into the Nsi I site 1.67 kb 5’ to the Aif-1 translation start site. The final construct was confirmed by restriction digestion and nucleotide sequencing across all junctions. The construct was linearized and electroporated into 129SvEv mouse ES cells, which were cultured in the presence of neomycin for positive selection and ganciclovir for negative selection. Genomic DNA was prepared from ES cells using 100 mM Tris pH 8.5, 0.2 M NaCl, 5 mM EDTA, 0.2% SDS, and 0.1 mg/ml Proteinase K. Individual clones were screened for targeting of the  aif-1  locus by PCR with Redtaq polymerase (Sigma), forward primer PGK polyA (AACCAAATTAAGGGCCAGCT), and reverse primer  aif-1  3’ flanking (ATCCCTCGGAGAGAGAAAGG); cycling conditions were 94°C×30 s, 64°×30 s, and 72°×90 s for a total of 36 cycles.\nGenomic DNA isolated from mouse tails was extracted with phenol-chloroform prior to overnight restriction enzyme digestion, electrophoresed through 0.8% agarose gels, and transferred to GeneScreen Plus (PerkinElmer) nylon filters. DNA probes were labeled with  32 P-dCTP using the Prime-It RmT Random Primer Labeling Kit (Stratagene), hybridized to filters, and processed as described ( Sibinga  et al ., 2002 ).\nRoutine genotyping to identify the intact  aif-1  gene was performed by PCR of genomic DNA obtained from tail biopsies using primers (forward, TGGGCAAGAGATCTGCCATCTTGA, and reverse, AAGAGACACAGGCATCAGGGACAA) to amplify a 243 bp fragment spanning the 3’ most exon-intron junction. Touchdown cycling conditions were used, decreasing the annealing temperature by 0.5° per cycle from 64–58°C over 12 cycles, followed by 25 cycles with an annealing temperature of 58°C. The targeted allele was identified by multiplex PCR using  lacZ -specific (Jackson Labs IMR39 and IMR40) and PCR control (Jackson Labs IMR 15 and IMR16) primers; this reaction used standard PCR cycling with a 60°C annealing temperature.\nTotal RNA was extracted from mouse organs using Trizol (Invitrogen). Samples (10 µg) were fractionated on 1.2% formaldehyde-agarose gels and transferred to BrightStar Plus (Ambion) nylon filters, which were then hybridized at 68°C for 2 h to the random-primed,  32 P-labeled mouse  aif-1  cDNA probe (10 6  cpm/ml) in QuikHyb solution (Stratagene) ( Sibinga  et al ., 2002 ). The filters were washed in 30 mM sodium chloride, 3 mM sodium citrate, and 0.1% SDS at 55°C and autoradiographed with Kodak Biomax MS film for 8 h at −80°C.\nTotal proteins were extracted from  wt  and  aif-1 −/−  mice, separated by SDS-polyacrylamide gel electrophoresis, transferred to Immobilon-P membrane (Millipore), probed with a polyclonal antibody against Aif-1 (1:250, Wako), and evaluated by chemiluminescent detection (Pierce).\nThe targeted  aif-1  allele was backcrossed at least 8 generations onto a C57BL/6 mouse genetic background. To induce arthritis,  wt  and  aif-1 −/−  mice (age 12–14 weeks, 3–6 per genotype) were immunized with CII using a standard protocol ( Inglis  et al ., 2008 ). Briefly, CII (4 mg/ml, MD Bioproducts) was dissolved overnight in 0.1 M acetic acid and mixed with equal parts of Complete Freund’s Adjuvant containing 5 mg/ml of Mycobacterium Tuberculosis H37Ra (Difco). All mice were immunized with a total of 200 µg of this emulsion injected intradermally at the base of the tail and at a second site slightly anterior to the first. Mice were boosted with 100 µg CII in Incomplete Freund’s Adjuvant 14 days after the primary immunization. Starting 20 days after initial immunization, paw diameters of the hind and fore limbs were measured using microcalipers (Kroeplin), and these measures were averaged. Scores for the two genotypes across 8 time points were evaluated using a two-way analysis of variance, with a Bonferroni correction and significance set at 0.05 (Prism 6 software, Graphpad). Disease activity was scored by evaluating each limb on a 0–3 scale, with 0 being normal and 3 referring to swelling of the entire paw with erythema and ankylosis, as described ( Inglis  et al ., 2008 ).\nPaw measurements and disease scores are shown as mean ± standard error (SE). Statistical significance was determined by Student’s t test (two-tailed), multiple analysis of variance (ANOVA) with Bonferroni correction, or Chi-square test, as appropriate, with significance accepted for  P  <.05. The analyses were conducted with GraphPad Prism.","source_license":"public-domain-us","license_restricted":false}