{"paper_id":"011b835c-558b-4754-b096-73568748fd56","body_text":"Development of a MET-targeted single-chain antibody fragment as an anti-oncogene targeted therapy for breast cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Development of a MET-targeted single-chain antibody fragment as an anti-oncogene targeted therapy for breast cancer Rana Vafaei, Zohreh Khaki, Malihe Salehi, Neda Jalili, Mohammad Reza Esmailinejad, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2216162/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 01 Apr, 2023 Read the published version in Investigational New Drugs → Version 1 posted 8 You are reading this latest preprint version Abstract The usage of monoclonal antibodies (mAbs), as a matter associated with the biopharmaceutical industry, is increasingly growing. Harmonious with this concept, we designed the exquisitely modeled anti-MET scFv against breast cancer by gene cloning, and expression using a bacterial host. Herein, we developed a recombinant scFv against MET and examined its preclinical efficacy for the reduction of tumor growth, invasiveness and angiogenesis in vitro and in vivo. Expressed anti-MET scFv demonstrated high binding capacity (48.8%) toward MET-overexpressing cancer cells. The IC50 value of anti-MET scFv against MET-positive human breast cancer cell line (MDA-MB-435) was 11.4 nM whereas this value was measured as 47.01 nM in MET-negative cell line BT-483. Similar concentrations could also effectively induce apoptosis in MDA-MB-435 cancer cells. Moreover, this antibody fragment could reduce migration and invasion in MDA-MB-435 cells. Grafted breast tumors in Balb/c mice showed significant tumor growth suppression as well as reduction of blood-supply in response to recombinant anti-MET treatment. Histopathology and immunohistochemical assessments revealed higher rate of response to therapy. In our study, we designed and synthetized a novel anti-MET scFv which could effectively suppress MET-overexpressing breast cancer tumors. MET Receptor Tyrosine Kinase Breast Cancer Antibody Fragment scFv Recombinant Figures Figure 1 Figure 2 Figure 3 Figure 4 Background The use of monoclonal antibodies (mAbs), as a matter branch of the biopharmaceutical industry, is increasingly developing. This includes a wide range of applications such as protein purification, protein-based in vitro diagnostic tests, and treatment of a large variety of human diseases in particular as a therapeutic approach against cancer cells ( 1 , 2 ). More recently, smaller antibody binding fragments have become the topic of interest, since they offer significant advantages over the full-length mAbs, such as higher affinity and specificity, less immunogenicity, better solubility, and stability as well as less expensive production ( 1 , 3 ). Three types of fragments, including the single V-type domain, antigen-binding fragment (Fab), and single-chain variable fragment (scFv) are representing consecutive waves of antibody fragment technologies ( 4 , 5 ). The scFv consists of variable regions of heavy and light chains of antibodies, which are assembled by a flexible linker ( 6 ). Although this unit of antibody is the smallest format of immunoglobulin, it still retains antigen-binding activity and specificity ( 6 , 7 ). Small size of scFv (∼30 kDa), is a desirable trait for tissue infiltration, especially in cancer therapy ( 8 , 9 ). The monovalency of this antibody fragment made it desirable for targeting receptor tyrosine kinases to overcome antibody-mediated receptor dimerization ( 10 ). Receptor tyrosine kinases (RTKs) as transmembrane proteins are expressed on different normal cell types as well as tumor cells ( 11 ). Their substantial role in tumorigenesis made them targets for the development of promising anticancer drugs ( 12 ). Multifarious antibodies inhibiting RTKs are being used in clinical practice ( 13 ). A subfamily of RTKs known as hepatocyte growth factor receptor (HGFR) or mesenchymal-epithelial transition (MET or c-Me) is expressed on the epithelial cell surface. Upon binding of HGF to this receptor, MET homodimerization and phosphorylation occur, triggering a signaling cascade that is responsible for early embryonic development, which is generally quiescent in adult tissues, except for tissue repair ( 14 ). Aberrant activation of the MET/HGF signaling pathway in cancer cells, as a result of overexpression, mutation, or amplification of the MET gene, plays a pivotal role in growth factor-mediated proliferation, epithelial to mesenchymal transition, metastasis, and survival, leading to neoplastic transformation in a variety of cancers, including breast cancer ( 10 , 15 – 17 ). This signaling axis, as one of the hallmarks of malignancy in initiating invasion and metastasis, has become a favorite target for developing monoclonal antibodies for immunotherapeutic purposes ( 14 ). Besides the ability of the oncogenic driver, MET also contributes to targeted therapy resistance during using approved VEGFR, EGFR, and Her2 inhibitors ( 18 , 19 ). Although several MET-targeted drug candidates have been designed and developed, none of the HGF/MET-targeted antibodies or antibody fragments reached phase 4 clinical trials ( 10 , 20 – 23 ). The challenging complication of ordinary monoclonal antibodies is the undesirable MET activation rather than antagonization, which happens as a result of RTK dimerization, leading to kinase auto-activation ( 24 ). For example, DN30 which is a monoclonal antibody against an epitope on the extracellular domain behaves as a partial agonist ( 13 ). But this antibody induced MET down-regulation by the mechanism of shedding the ectodomain of the receptor ( 13 ). To overcome this problem, monovalent antibodies were replaced by traditional bivalent antibodies to target MET without dimerization-induced activation ( 10 ). The widely known anti-MET one-armed antibody, Onartuzumab (Genetech), was successful in avoiding MET dimerization but, the phase III study did not confirm the efficacy results observed in the phase II study for non-small cell lung cancer ( 25 ). Furthermore, this drug was not successful in phase 2 of the clinical trial in triple-negative breast cancer ( 26 ). Hence, future efforts are to be made to overcome the current difficulties of MET targeted therapy, which is considered an important immunotherapeutic program in epithelial neoplasms. Congruent with this notion, here we developed a novel modeled anti-MET scFv, which was synthesized by gene cloning and expression in a bacterial host. Designing, construction, and purification of this antibody fraction were then followed by functional assessment as well as in vivo assays. Materials And Methods Cell culture & Bacteria strains Cloning and gene expression were accomplish using E. coli strains NovaBlue GigaSingles™ (Novagen- USA) as the primary cloning host and BL21-DE3 (Novagen-USA) as the expressing host. For gene cloning, plasmid pET-32 LIC vector (Novagen- USA) was utilized. The cell surface expression of MET is abundant in the MDA-MB-435 cell line whereas this protein has no expression in the BT-483 cell line ( 27 ). Thus, authenticated human ductal carcinoma cell lines (MDA-MB-435 and BT-483), as well as mouse breast cancer lines (4T1), were purchased from Pasteur Institute of Iran (IPI, Iran). All cell lines were cultured as adherent cells in high glucose Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Gibco, USA), 1% non-essential amino acid (Gibco-USA), 2 mM L-glutamine (Gibco, USA), 1 mM sodium pyruvate (Gibco, USA), and 1% penicillin-streptomycin (Gibco, USA) in gamma radiated sterile polystyrene plates and flasks then stayed at 37°C in a 5% CO2 humidified atmosphere incubator. Construction Of Recombinant Anti-met Scfv Expression Cassette The DNA sequences of the variable heavy chain (VH), as well as variable light chain (VL) domains of anti-MET Onartuzumab Fab, were obtained from GenBank (Accession number: 4K3J-H and 4K3J-L respectively). The detailed process of construction of Onartuzumab antibody has been described elsewhere ( 24 ). A glycine-rich 15 amino acid peptide was inserted between variable chains as a flexible linker. After the synthesis of this codon (Cinnagen, Inc. Tehran, Iran), it was amplified by PCR, followed by 3 sequential PCR runs to add the following sequences to the reading frame by use of specific primers listed in Table 1 : a stII signal peptide coding sequence at the 3' end to localize anti-MET protein in the periplasmic space of expressing bacteria which can then be easily harvested in its native structure after disrupting the bacterial wall, a 6 constitutive histidine tag moiety at 5' to isolate the protein by Ni-NTA affinity chromatography and also for protein characterization by immunoblotting and the compatible overhang sequence compatible to pET-32 Ek-LIC vector at both ends of the codon. (Fig. 1 A) The primers were designed by Gene Runner Software v3.05 (Hastings Software Inc. Las Vegas, U.S.A) and then synthesized by Pishgam Biotech Co. (Tehran, Iran). The PCR reaction mix was comprised of 5 µl dNTP mix (0.2 mM), 5 µl of 10× reaction buffer with 1.5 mM MgCl2, 2 µl of each primer (12.5 mM/µl), 0.4 µl Taq DNA polymerase (1 Unit) and 2 µl template (50 ng/ml) and 8.6 µl ddH2O in a total volume of 50 µl in 30 cycles. Each cycle was started with an initial denaturation at 95°C for 2min, followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 1 min and a final extension at 72°C for 5 min. Then the final PCR product was harvested from the 2% agarose gel after the electrophoresis and concentrated with the Qiagen gel extraction kit (Qiagen, Germany). Molecular weight and theoretical isoelectric point were estimated with Expasy ( https://web.expasy.org/compute_pi/ ). Table 1 List of primers used for construction of anti-MET scFv expression cassette Name Sequence (5'-3') Forward 1 GACATCCATGACCCAG Reverse 1 AGAAGAAACGGTAACCACG Forward 2 AGAAGAAACGGTAACCACG Reverse 2 CGTTTTTTCTATTGCTACAAATGCCTATGCAGACATCCAGATGACCCAG Forward 3 ATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAATG Reverse 3 ATGATGATGATGATGATGAGAAGAAACGGTAACCACG Cloning And Expression Of Recombinant Anti-met Scfv The achieved DNA amplicon were cloned within the ligation-independent cloning (LIC) site of the pET-32 EK/LIC vector based on the protocol of manufacturer (Novagen- USA). Transforming the constructed plasmid, pET-32 Ek-LIC/Anti-MET, into E-coli Nova Blue GigaSingles™ competent cells (Novagen- USA), was performed by the calcium chloride method ( 28 ). Transformants were then cultured on LB agar containing ampicillin (50µg/ml). The recombinant clones were submitted randomly to colony-PCR and clones with desirable insertion sizes were characterized by sequencing (Gene Fanavaran Co, Iran) to confirm successful cloning. The accuracy of the sequence was confirmed using Sequence Alignment Editor Software Bio Edit. Harvested plasmids were then used to transform into protein-expressing E-coli strain, BL21 (DE3) competent cells (Novagen, USA), and transformants were cultures on LB agar plates containing 50 µg/ml ampicillin. Single colonies of the E. coli BL21 DE3 containing pET32Ek/LIC-anti-MET plasmids were then grown in 5 ml LB broth containing 50 µg/ml ampicillin and incubated at 37°C and 180 rpm in a shaker incubator for 16 h. Subsequently, the culturing tube was poured into 200 mL ampicillin containing terrific broth to reach an optical density (OD) 600 of at least 0.4. At this point, isopropyl thiogalactoside (IPTG) was added (1mM) to induce protein expression at 27°C for 16 h in a shaker incubator (150 rpm). Protein Purification And Concentration For the purification of anti-MET scFv, immobilized metal affinity chromatography (IMAC) was performed through denaturing method and by using a Ni-NTA-Agarose column (Qiagen, Germany). For this purpose, expressing bacterial cells were first collected by centrifugation (9000 rpm, 4°C, and 30 min). After resuspension of pellets in the ice-cold denaturing buffer (500mM NaCl, 8 mM Urea, Tris-HCl pH 8.0, and imidazole 10 mM), all soluble periplasmic proteins were extracted utilizing sonication (1mA for 10 min) with subsequent centrifugation (4°C, 15000 rpm). The supernatant, containing His-tagged anti-MET scFv and the host soluble proteins were collected and then submitted for IMAC. First, the column was prepared by passing the binding buffer (300 mM NaCl, 6 mM Urea, Tris-HCl pH:8.0, and imidazole 2 mM) through 5 mg Ni-NTA HisBind Resin (Qiagen). Afterward, the extracted protein was added to the column, incubated at 26°C for 1 h, then washed by three sequential wash buffers to reduce the urea concentration gradually (wash 1: 500 mM NaCl, 4 mM Urea, Tris-HCl pH: 8.0; wash 2: 500 mM NaCl, 2 mM Urea, Tris-HCl pH 8.0; wash 3: 500 mM NaCl, Tris-HCl pH 8.0). In the last stage, the bound anti-MET was eluted by 5 column volumes of elution buffer (300 mM NaCl, 300 mM imidazole, and Tris-HCl pH 8.0). The imidazole of the elute was eliminated by diafiltration. Then Purified proteins were concentrated to 500 micrograms per milliliter on an Amicon (Merk, Germany) concentrator using sterile PBS, pH 7.6, and kept at 4°C for experiments. The concentration was measured by a spectrophotometer (WPA Biowave II, Bichrom, England). Characterization Of The Purified Protein; Sds-page, Western Blotting Eluted fractions of IPTG positive, IPTG negative, and purified anti-MET fragments were electrophoresed on a 12% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel), in the presence of 2-mercaptoethanol as a reducing agent. The gels were then stained with Coomassie brilliant blue to evaluate the protein bands. Isolated proteins by SDS-PAGE were then submitted to the polyvinylidene difluoride; PVDF (Millipore Merk) membrane using a semi-dry blot transfer device (Bio-Rad, Hercules, CA) based on the standard protocol ( 29 ). To improve the signal-to-noise ratio, the membrane was blocked with a blocking buffer comprising 5% w/v non-fat dried milk (Merck) in 0.05% v/v PBS-Tween-20 solution for 18 h at 4°C. Afterward, the membrane was rinsed thrice in Tris-buffered saline; TBS and 0.1% (v/v) Tween 20 and probed with a mouse horseradish peroxidase (HRP)-conjugated anti-His tag monoclonal antibody (Qiagen, Germany; 1:2000) at 27°C. The protein blots were finally visualized by using 0.05% 3, 3′ -diaminobenzidine (DAB; Sigma-Germany) (0.05% DAB; 0.03% hydrogen peroxide in 100 mM Tris-HCl pH 7.5). Cell Surface Antigen-binding Assay Via Flow Cytometry A human metastatic breast carcinoma cell line BT-483 and a putative breast/melanoma cell line MDA-MB-435 were used as rarely expressing (as a control cell line) and constitutively expressing MET, respectively ( 27 ). The cells were incubated with 50 µg/ml of purified concentrated anti-MET scFv for 1 h at 4°C. FBS-treated cells were used as a negative control. The cells were then washed three times with ice-cold PBS and 4% FBS and were incubated with 10 µg/ml FITC conjugated anti-His specific antibody (Abcam- UK) for 1 h at 4°C (1:500). Subsequently, antigen-binding to the cell surface was assessed using the FACScalibur Flow Cytometer (FC) device (Becton Dickinson- USA) at the FL1 channel. Cell Viability Assay; Mtt Assay To appraise the potentiality of anti-MET scFv cytotoxicity, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H- tetrazolium bromide (MTT) assay was performed. Briefly, 5×10 3 MBA-MD-435 and BT-483 cells were seeded in every well of a 96-well plate and the cells were cultured with 0.2 ml medium at 37°C for 24 h. Different concentrations (4 to 132 µg/ml) of anti-MET scFv were added to wells followed by 48 h incubation. Cells were then incubated with the MTT dye at 37°C for 3 h. After washing out the MTT with PBS, formazan which was formed from MTT in viable cells by dehydrogenase enzyme was dissolved using DMSO. Finally, absorbance rate was read at 570 nm by a microplate absorbance reader (BioRad- USA), and fifty percent inhibitory concentration values (IC50) were calculated using GraphPad Prism 7 as the concentration of the protein inducing a 50% reduction in viability when compared to untreated cells. Apoptosis Assay The percentage of the total, late and early apoptotic cells was determined using flow cytometric Annexin V-FITC)/propidium iodide (PI) assay (Biolegend, San Diego, CA) according to the guidelines manufacturer. For this purpose, 4×10 5 cells were seeded into each well of a 6-well plate, treated with anti-MET scFv at different concentrations (18, 32, and 50 µg/ml), then incubated for 48 h at 37°C. These concentrations were selected based on the average of 25% and 75% growth inhibitory activity of our protein in the MTT assay amongst all cell lines. Then Cells were harvested utilizing 1X trypsin-EDTA (Gibco-USA) and washed with PBS. Cells were then centrifuged and the pellet was resuspended in 100 µl binding buffer of the assay kit and then stained by FITC-labeled Annexin V and PI. Cells were then submitted to flow cytometry analysis (BD FACS, Calibur) on the FL1/FL3 channels and the double staining quadrant was gated on targeted cells. The single positive FL1 population (Annexin V labeled cells) and double-positive cells (FLs1/FL3) as respective early and late apoptosis, were summed up to obtain the total apoptotic cell percentage. Invasion Assay Given the role of MET in metastasis, we examined whether anti-MET scFv affects cancer cell invasion and migration. The Cultrex BME Cell Invasion Assay (R&D Systems) (Trevigen Inc., Gaithersburg, MD, USA) was used based on manufacturer protocol using MBA-MD435 and BT-483 lines. 50 µL basement membrane extract (BME) solution was added to each well of the top chamber and incubated at 37°C. 50,000 cells/ 50 µL serum-free medium containing 10 µM anti-MET were plated on the coated BME. Control wells contained PBS instead of anti-Met. 150 µL of the medium was then loaded into the lower chambers. The Cells were then incubated for 24 h, at 37°C. 100 µL of Calcein AM solution/cell dissociation solution was added to the bottom chamber and incubated for 1 h, at 37°C. Relative fluorescence units (RFU) of the samples were determined at 485 nm excitation and 520 nm emission with an ELISA reader (BioTek-VT- USA). The data was compared to the standard curve to measure the number of cells that have invaded through BME. Migration Assay Migration assay was performed utilizing Cultrex BME Cell Migration Assay (R&D Systems) (Trevigen Inc., Gaithersburg, MD, USA) similar to the above-mentioned invasion assay. On the second day, the upper chamber was carefully aspirated and washed with 1X cell wash buffer. Afterward, 100 µL of cell cissociation solution/Calcein-AM was added to the bottom chamber of a black assayed 96-well microplate. The cell migration chamber was assembled and incubated for 1 h, 37°C. The top chamber was eliminated and absorbance was read at 485 nm excitation and 520 emissions compared to the standard curve. Breast cancer tumor model ( In-vivo ) 6–7 week-old female inbred BALB/c mice, weighing 16–17 gram (Veterinary Faculty, University of Tehran) were used for in vivo 4T1 syngeneic homograft TN breast cancer mouse model. Mice were placed in conventional condition at the Animal Care Facility, Veterinary Faculty, and the University of Tehran according to guidelines established by the Animal Care Committee of the University of Tehran. Tumors were established on the left flank by subcutaneous transplantation of 4T1 tumor tissues with the dimensions of 3 mm obtained from a 4T1 tumor-bearing BALB/c mouse. The first day of treatment was initiated when the average tumor size reached 100 cm3 as measured using Ultrasonography (US). 5 µg/g of anti-MET scFv was injected systemically into the mice through the tail vein. A total of 7 injections were performed every other day. The bodyweight of animal was monitored daily. Tumor volume was measured non-invasively through the US imaging every 3 days according to the following formula: V (mm 3 ) = 1/6 π × x × y × z In which x, y, and z represent tumor height, width, and length (mm), respectively. The results were then compared to the PBS receiving control group. At the end of the treatment period, mice were sacrificed, then tumors were surgically excised, weighed, and submitted to 10% formaldehyde (NPF, fixative, Sigma-Aldrich, HT501128) for histopathology assessment. Ultrasonography Techniques Percutaneous real-time ultrasonography (B-mode and color Doppler) was performed using a multi-frequency (6–13 MHz) linear transducer with a small footprint (SLAx/6–13 Ultrasound Transducer), connected to a portable ultrasound unit (Micro Maxx, Sono Site, USA, 2009). The transducer was aligned to the tumor’s central plane and the maximum depth of 19 mm was set to gain the sagittal and transverse planes. The tumor’s height, width, and length were measured using the unit’s caliper. In addition, tumor’s shape, margin (smooth or irregular), parenchymal echogenicity (hypoechoic or hyperechoic), and echotexture (homogeneous or heterogeneous) were evaluated. Also, probable invasion to regional structures, severity (mild, moderate and severe), and the pattern of the vascularization (centrally, peripherally or both) were assessed. The ultrasonography was performed every 3 days with all the above parameters checked to analyze the amount of tumor outgrowth, spreading and invasion. For the best attachment of the probe to the skin, the tumor site was shaved and an ultrasonography jelly was applied. Image orientation was performed using landmarks to procure standardized planes and correct measurements. In Color Doppler Technique, high-quality images and accurate measurements of optimum velocity were obtained by setting the sample volume size to 13 mm and by changing its angle to 60 degrees. This was repeated in all animals to decrease the possible miscues. Histopathology At the end of the treatment period, tumors were excised and prepared for histopathological evaluation. The H&E staining was performed to study the percentage of the tumor necrosis, mitotic count (per 10 HPF), nuclear pleomorphism (scores 1, 2, and 3), and tumor-infiltrating lymphocytes (TILs) (number of lymphocytes in 10 HPF). Following antibodies were used for immunohistochemical staining: anti-CD8 monoclonal antibody (Catalog number: ab209775, Abcam, USA), marker of cytotoxic T cells; anti-Bax monoclonal antibody (Catalog number: ab263897, Abcam, USA), apoptosis regulator; anti-Ki-67 monoclonal antibody (ab15580, Abcam, USA), marker of proliferation; anti-VEGF receptor 2 (VEGFR2) monoclonal antibody (Catalog number: ab2349, Abcam, USA), indicator of angiogenesis, and anti-matrix metalloproteinase-9 (MMP-9) monoclonal antibody (Catalog number: ab38898, Abcam, USA), a proteinase up-regulating in metastasis and angiogenesis. The specific HRP-conjugated secondary antibody was used. Gill’s hematoxylin was used as counterstaining for all sections. Microvessel density (MVD) was assessed as the average number of microvessels in 4 random fields after VEGF-R2 staining. The percentage of positive nuclei for Ki-67 per 1000 malignant cells was also used to assess proliferation and a modified ALL-Red scoring system (proportion score and intensity score) was used to assess MMP-9- and BAX-stained sections. Statistics The quantitative data are expressed as means ± SD. Gaussian distribution was assessed by the Shapiro-Wilk test. Ordinary one-way ANOVA was used to analyze among 3 or more group differences and a Tukey test as post-hop. Two-tailed unpaired t-test was carried out to compare between two groups. Statistically significant, P-value < 0.05 was considered (* p < .05, **p < .01, ***p < .001). Graphpad Prism version 9.0.0 and Excel 2016 software were used for statistical analysis. Results Gene cloning A full-length anti-MET-scFv coding sequence was cloned into the pET32 /LIC vector. To screen the anti-Met-bearing colonies containing our desired sequence, colony PCR was performed using primers specific to the recombinant anti-MET fraction (Fig. 1 B). Based on our results, DNA sequences were successfully incorporated into the plasmids and subsequent sequencing results showed no point mutation or rearrangement. Protein Expression And Characterization To recognize the expression of our desired recombinant anti-MET scFv among all of the harvested periplasmic proteins, a comparison between the protein panel of IPTG-positive and IPTG-negative bacteria was done using 12% SDS-PAGE. Figure 1 C depicts the occurrence of a ~ 35 kDa protein band among other bacterial proteins which is absent in the negative control. This molecular weight is consistent with the anti-MET scFv and the histidine tag. The signal peptide moiety detaches during the expression. Purified anti-MET scFv demonstrated only a single band with the same molecular weight (Fig. 1 D) while having a lower concentration. The final concentration of purified protein after passing through the Amicon (Merk, Germany) concentrator was 500 micrograms per milliliter. The concentration was also shown by SDS-page (Fig. 1 D), with the purified band being then confirmed through western blotting (Fig. 1 E). Cell Surface Antigen-binding Assay To check the particular binding of anti-MET scFv to the HGFR, flow cytometry analysis was accomplished using MET-positive MDA-MB-435 and MET-negative BT-483 cancer cell lines. As exhibited in Fig. 2 A, the MET-positive MDA-MB-435 line showed a high binding capacity with recombinant anti-MET scFv; however, a very low capacity of binding was observed with MET negative BT-483 cells (Fig. 2 A). The results showed 48.8% and 0.87% of binding to the MDA-MB-435 and BT-483 cancer cell lines, respectively. These findings propose that anti-MET scfv is specifically bound to HGFR-positive cancer cells. Cell Viability Assay MTT reduction assay was conducted on the MDA-MB-435 and BT-483 cell lines, expressing high and rare MET, respectively to evaluate the cell growth inhibitory ability of our purified antibody fragment. Cells were treated with recombinant anti-MET scFv for 48 h with concentrations ranging from 4 to 132 µg/ml and then cell viability was assessed. The IC50 value of anti-MET scFv against MET-positive human breast cancer cell line (MDA-MB-435) was 11.4 nM whereas this value was measured as 47.01nM in MET-negative cell line BT-483 (Fig. 2 B). The results relying on the dose of anti-MET in an increasing concentration show a gradual reduction in the proliferation of MDA-MB- 435 in vitro (Fig. 2 B). A negligible difference was seen in the cellular viability of the BT-483 cells upon treatment with the anti-MET antibody fragment. Apoptosis Assay The potential of apoptosis induction by our anti-MET scFv was evaluated on MDA-MB-435 and BT-483 cell lines using Annexin V/PI assay. The results showed a considerably higher percentage of total apoptosis in the MDA-MB-435 cell line in comparison to the rare expressing cell line BT-483 (Fig. 2 C). The apoptosis potency of the anti-MET scFv to MDA-MB-435 and BT-483 was measured as 52.5%, and 10.1%, respectively (Fig. 2 C). Migration And Invasion Assay To evaluate the anti-invasive properties of anti-Met scFv, the Cultrex® BME cell invasion assay kit was used. This assay offers a standardized and flexible method for evaluation of the severity penetration of invasive cells through a barrier of basement membrane and extracellular matrix elements in vitro. The results showed significantly higher inhibition of migration and invasion of the anti-MET scFv treated MDA-MB-435 cell line. This effect was not seen in the BT-483 cells which express low levels of MET (Fig. 2 D). In Vivo Tumor Growth Suppression And Ultrasound Imaging After 14 days of anti-MET scFv administration in 4T1 tumor-bearing BALB/c mice, a decrease in tumor growth was recorded in comparison with the PBS receiving group (Fig. 3 B, D). In this context, Fig. 3 A represents the ultrasound imaging technique to gain transverse and longitudinal scans of tumor mass by changing the angle between the ultrasound waves and the direction of the animal. By this technique, three different dimensions were obtained from the ovoid mass (x, y, z) to calculate the tumor volume. As depicted in Fig. 3 , enhancement of tumor growth suppression and lac of logarithmic phase of tumor growth was significant in the anti-MET receiving animals (Fig. 3 B, D). No significant changes (more than 20%) were observed in the bodyweight of mice during the treatment, confirming that the administered dosage of anti-MET scFv was safely tolerated (Fig. 3 D). In addition, the tumor weight after the treatment period was significantly less in the anti-MET group than in the control group (Fig. 3 D). Differences in tumor size became meaningful from the second injection and progressively increased until the last injection (Fig. 3 D). In addition, inhomogeneity in the texture of tumor images, as well as the development of waved-shaped boundaries, is related to the invasiveness and metastatic behavior of tumors ( 30 ). Results demonstrated a higher risk of invasion and metastasis in the control animals than in the anti-MET scFv receiving group. Overall, tumors of the PBS receiving mice were inhomogeneous and had rough boundaries on the final day of treatment (Fig. 3 D). Contrarily in anti-MET scFv receiving mice, the smooth form of tumors was generally notified. Immunohistochemistry (Ihc), Quantification Of Microvessel’s Density And Histopathology Results of the hematoxylin and eosin staining (H&E) method showed a higher rate of response to therapy in the anti-MET scFv receiving group compared to the non-treated control one (Fig. 4 ). In parallel, the percentage of infiltrated lymphocytes was defined by an expert pathologist which was blinded from the experimental groups, based on their nuclear morphology. Our results showed no significant difference in the percentage of TILs in the anti-MET receiving tumors compared to the control tumors (less than 5% in both groups) (Fig. 4 A). Moreover, results of IHC analyses revealed a significantly reduced microvascular density in anti-MET receiving animals compared to the PBS receiving animals (Fig. 4 B). Analyzing apoptosis by evaluation of Bax in the control and treated mice, a significantly declined apoptosis rate was spotted in the anti-MET receiving tumors compared to the PBS control tumors (Fig. 4 B). Moreover, our results demonstrated that the expression level of Ki-67 was significantly decreased in the tumors harvested from the anti-MET receiving animals (Fig. 4 B). However, no significant change was observed in MMP-9 and CD-8 markers in the anti-MET receiving group when compared with the control tumors (Fig. 4 B). Discussion In the present study, we designed and synthesized a novel anti-MET scFv, and then investigated the functional properties and tumor-suppressive effects in vitro and in vivo. Met augments proliferation, migration, invasion, protection from apoptosis, and angiogenesis in malignant cells ( 31 ). Of note, MET overexpression acts as a ‘stress-response gene’ which leads to transcriptional adaptation of malignant cells to the undesirable microenvironment, including hypoxia ( 32 ). MET amplification and overexpression have been correlated with lymph node metastasis, depth of tumor invasion, advanced stage, and decreased survival rate ( 33 ). Exposure to antiangiogenic therapy bevacizumab results in upregulation of MET ( 34 ). Thus, activation of the MET axis has known as one of the mechanisms of resistance to the bevacizumab ( 35 ). Since MET plays a dual role both as a necessary oncogene and also as a proper target in the acquired drug resistance, it could apply to target c-Met alone or concurrent with other therapies to prevent the advent of resistance ( 34 , 36 ). However, targeting Met is still challenging so far, mainly due to the poor state of knowledge regarding MET kinase-independent function and the agonistic action of Met targeting for homo-dimerization ( 37 , 38 ). Although various clinical trials are ongoing in this field, none of the HGF/MET-targeted antibodies or antibody fragments could complete phase 3 of the clinical trial with satisfactory results ( 10 , 20 – 23 ). For example, a conventional monoclonal antibody against Met increases Met activity by imitating HGF-mediated dimerization, even so, it could mediate endo-lysosome-associated degradation ( 23 , 24 ). MET-targeted monovalent antibodies and antibody fragments aimed to be developed and replaced the whole antibodies to address this issue. In this regard, Onartuzumab (Genentech) has been engineered as a “one-armed” monovalent antibody with native-like architecture which lacks antibody-induced dimerization function with resultant antagonism of the HGF\\MET axis ( 24 ). This specific MetMAb is made up of a single humanized antigen-binding fragment (Fab) assembled to the constant domain fragment (Fc) expressed in E. coli ( 24 ). Another inhibitor of MET signaling is AMG 337, a selective small-molecule kinase repressor ( 39 ). The preclinical studies of AMG 337 showed, inhibition of MET phosphorylation and MET-dependent cell growth in several MET-overexpressing cell lines as well as induction of apoptosis and decreasing tumor growth in MET-dependent xenograft models ( 40 ). This study also showed anti-tumor activity in MET-amplified adenocarcinoma in phase 1 and 2 clinical trials ( 33 , 41 ). Other small molecule kinase inhibitors targeting Met, such as Tivantinib (ArQule), have been found unsuccessful ( 42 ). Different studies were designed anti-MET scFv to target MET RTK ( 43 – 46 ). The anti-MET scFv could also be used for drug delivery approaches ( 47 ). A more recent anti-MET scFv showed apoptotic and anti-proliferative potency in the human colorectal carcinoma cell line ( 46 ). The use of the bacterial expression of scFv resulted in lac of Fc effector function such as ADCC (Antibody-dependent cellular cytotoxicity) and high production yield as well as facilitating purification for further clinical use ( 48 ). Results presented herein confirmed the usefulness of an E-coli expressed recombinant scFv with the preserved capacity of binding and blocking the MET. In our study, we used the scFv fragment to target MET which was proven to have rapid blood circulation, providing good localization and tissue penetration of the drug within one hour after the administration ( 49 , 50 ). High binding affinity has been demonstrated between the Met receptor and three different anti-Met scFv fragments ( 47 ). Our study supports the aforementioned report in that it showed a significantly higher binding capacity to cancer cell lines over-expressing MET. As HGF/c-Met is known to play an important role in 4T1 tumor progression ( 51 ), the 4T1 breast cancer mice model was used for in-vivo experiments in the current study. MET RTK acts as an anti-apoptotic mediator by increasing the BAX/BCL2 ratio ( 52 ). MET-dependent cell growth is mediated by up-regulation of many signaling cascades including the extracellular signal-regulated kinase 1 (ErK1) and ErK, the phosphoinositide 3-kinase–Akt (Pi3K–Akt) axis, the mitogen-activated protein kinase (MAPK) and Jun amino-terminal kinases (JNKs) ( 53 , 54 ). Also the death receptor FAS (also known as CD95 and TNFRSF6) interacts the ectodomain of MET, which inhibits FAS self-aggregation and FAS receptor–FAS ligand (FASL) recognition, so preventing apoptosis through the extrinsic pathway ( 53 ). As we showed here, blocking of MET results in decreased cell growth and enhances cell apoptosis. Our results demonstrated increased BAX expression which was in agreement with the in-vitro Annexin V/PI assay exhibiting significantly higher apoptosis in response to the anti-MET treatment. The pro-invasive and pro-migratory potency of MET has been shown in several human breast cancer cell lines ( 55 ). Also, there is a positive association between the level of MET expression and the invasiveness-related genes (MMP-9 and MMP-2) ( 56 ). In our study, we showed that the invasion and migration could be significantly inhibited by anti-MET treatment in the MET over-expressing cell line, MDA-MB-435. Nevertheless, MMP-9 expression was not affected by anti-MET treatment in 4T1 tumor graft mice. This could be attributed to the different pro-invasive effects of MET in different cell lines. The HGF/ MET signaling is also deemed as a potent trigger of endothelial cell growth ( 55 ). The MET axis can increase VEGFR expression; with MET and VEGFR2 synergistically collaborating in inducing tumor angiogenesis ( 57 ). Our results showed the usefulness of the anti-MET scFv synthesized in this study to curb the microvessel’s density (MVD) in experimental breast cancer. Conclusion Altogether, scFv antibody fragments targeting tumor oncogenes, in particular MET TKR, could be regarded as appropriate therapeutic tools in targeted therapy for MET expressing tumors. In our study, we developed and synthesized a novel anti-MET scFv that could effectively suppress MET-overexpressing breast cancer cells. Our results showed that the anti-MET scFv fragment could be a potent therapeutic agent to inhibit tumor proliferation and invasiveness. However, evaluation of this antibody fragment in mice breast cancer model shed more light on the details of tumor suppression activity of the anti-MET fragment. Therefore, we conclude that the anti-MET scFv could be a promising candidate for MET-targeted cancer therapy. Declarations Ethics approval and consent to participate This project was in accordance with the national norms, the ethical principles and standards for conducting medical research in Iran and evaluated by Motamed Cancer Institute-Academic Centre for Education, Culture and Research. This institution performed its reviews based on United States Public Health Service (USPHS) regulations and applicable federal and local laws. Protocols were also approved by the Animal Care Committee of the University of Tehran (7508017623). Consent for publication All authors have agreed to publish this manuscript. Availability of data and materials The authors declare that all data supporting the findings of current study are provided within the manuscript. Competing interests Not applicable Funding This work was supported by Research Council, University of Tehran. Specialized research grant for Doctoral Program of Higher Education, Faculty of Veterinary Medicine (7508017/6/23). Author contributions L. F. developed the methodology; Z. Kh. and R.V. conducted the experiments, contributed to the data analysis and wrote the manuscript; M. S., N. J and S. M assisted the experiments; M. R. EN. and A.V. conducted ultrasonography; S. M. N. contributed to scientific assist and revised the manuscript. All authors read and approved the final manuscript. Acknowledgments We would thank Mr. Alireza Ghovati, Department of Clinical Pathology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran. for his technical assistance. References Ayyar BV, Arora S, O’Kennedy R (2016) Coming-of-age of antibodies in cancer therapeutics. Trends Pharmacol Sci 37:1009–1028 Rodgers KR, Chou RC (2016) Therapeutic monoclonal antibodies and derivatives: Historical perspectives and future directions. Biotechnol Adv 34(6):1149–1158 Manoutcharian K, Perez-Garmendia R, Gevorkian G (2017) Recombinant antibody fragments for neurodegenerative diseases. Curr Neuropharmacol 15(5):779–788 Wang Y, Li X, Chen X, Nielsen J, Petranovic D, Siewers V (2021) Expression of antibody fragments in Saccharomyces cerevisiae strains evolved for enhanced protein secretion. Microb Cell Factories 20(1):1–17 Holliger P, Hudson PJ (2005) Engineered antibody fragments and the rise of single domains. Nat Biotechnol 23(9):1126–1136 Ahmad ZA, Yeap SK, Ali AM, Ho WY, Alitheen NB, Hamid M (2012) scFv antibody: principles and clinical application. Clin Dev Immunol. https://doi.org/10.1155/2012/980250 Peterson E, Owens SM, Henry RL (2006) Monoclonal antibody form and function: manufacturing the right antibodies for treating drug abuse. The AAPS J 8(2):383 Monnier PP, Vigouroux RJ, Tassew NG (2013) In vivo applications of single chain Fv (variable domain)(scFv) fragments. Antibodies 2(2):193–208 Heo MA, Kim SH, Kim SY, Kim YJ, Chung J, Oh MK, Lee SG (2006) Functional expression of single-chain variable fragment antibody against c-Met in the cytoplasm of Escherichia coli. Protein Expr Purif 47(1):203–209 Su Z, Han Y, Sun Q, Wang X, Xu T, Xie W et al (2019) Anti-Met VHH pool overcomes MeT-targeted cancer therapeutic resistance. Mol Cancer Ther 18(1):100–111 Butti R, Das S, Gunasekaran VP, Yadav AS, Kumar D, Kundu GC (2018) Receptor tyrosine kinases (RTKs) in breast cancer: signaling, therapeutic implications and challenges. Mol Cancer 17(1):1–8 Sergina NV, Rausch M, Wang D, Blair J, Hann B, Shokat KM et al (2007) Escape from HER-family tyrosine kinase inhibitor therapy by the kinase-inactive HER3. Nature 445(7126):437–441 Petrelli A, Circosta P, Granziero L, Mazzone M, Pisacane A, Fenoglio S et al (2006) Ab-induced ectodomain shedding mediates hepatocytes growth factor receptor down-regulation and hampers biological activity. Proc Natl Acad Sci 103(13):5090–5095 Feng Y, Ma PC (2011) Anti-MET targeted therapy has come of age: The first durable complete response with MetMAb in metastatic gastric cancer. Cancer Discov 1(7):550–554 Zhang Y, Xia M, Jin K, Wang S, Wei H, Fan C, Wu Y, Li X, Li X, Li G, Zeng Z (2018) Function of the c-Met receptor tyrosine kinase in carcinogenesis and associated therapeutic opportunities. Mol Cancer 17(1):1–4 Minuti G, Cappuzzo F, Duchnowska R, Jassem J, Fabi A, O’brien T, Mendoza AD, Landi L, Biernat W, Czartoryska-Arłukowicz B, Jankowski T (2012) Increased MET and HGF gene copy numbers are associated with trastuzumab failure in HER2-positive metastatic breast cancer. Br J Cancer 107(5):793–799 Faiella A, Riccardi F, Cartenì G, Chiurazzi M, Onofrio L (2022) The Emerging Role of c-Met in Carcinogenesis and Clinical Implications as a Possible Therapeutic Target. J Oncol. https://doi.org/10.1155/2022/5179182 Maroun CR, Rowlands T (2014) The Met receptor tyrosine kinase: a key player in oncogenesis and drug resistance. Pharmacol Ther 142(3):316–338 Shattuck DL, Miller JK, Carraway KL, Sweeney C (2008) Met receptor contributes to trastuzumab resistance of Her2-overexpressing breast cancer cells. Cancer Res 68(5):1471–1477 Terlecka P, Krawczyk P, Grenda A, Milanowski J (2021) MET Gene Dysregulation as a Promising Therapeutic Target in Lung Cancer-A Review. J Pers Med 11(12):1370 Bouattour M, Raymond E, Qin S, Cheng AL, Stammberger U, Locatelli G et al (2018) Recent developments of c-Met as a therapeutic target in hepatocellular carcinoma. Hepatol 67(3):1132–1149 Merchant M, Ma X, Maun HR, Zheng Z, Peng J, Romero M, Huang A, Yang NY, Nishimura M, Greve J, Santell L (2013) Monovalent antibody design and mechanism of action of onartuzumab, a MET antagonist with anti-tumor activity as a therapeutic agent. Proc Natl Acad Sci 110(32):2987–2996 Jin H, Yang R, Zheng Z, Romero M, Ross J, Bou-Reslan H, Carano RA, Kasman I, Mai E, Young J, Zha J (2008) MetMAb, the one-armed 5D5 anti-c-Met antibody, inhibits orthotopic pancreatic tumor growth and improves survival. Cancer Res 68(11):4360–4368 Merchant M, Ma X, Maun HR, Zheng Z, Peng J, Romero M et al (2013) Monovalent antibody design and mechanism of action of onartuzumab, a MET antagonist with anti-tumor activity as a therapeutic agent. Proc Natl Acad Sci 110(32):2987–2996 Spigel DR, Edelman MJ, O’Byrne K, Paz-Ares L, Shames DS, Yu W et al (2014) Onartuzumab plus erlotinib versus erlotinib in previously treated stage IIIb or IV NSCLC: Results from the pivotal phase III randomized, multicenter, placebo-controlled MET Lung (OAM4971g) global trial. Clin Adv Hematol Oncol 15 – 6 Diéras V, Campone M, Yardley DA, Romieu G, Valero V, Isakoff SJ, Koeppen H, Wilson TR, Xiao Y, Shames DS, Mocci S (2015) Randomized, phase II, placebo-controlled trial of onartuzumab and/or bevacizumab in combination with weekly paclitaxel in patients with metastatic triple-negative breast cancer. Ann Oncol 26(9):1904–1910 Jagadeeswaran R, Jagadeeswaran S, Fackenthal J (2005) c-Met/HGF pathway in breast cancer cells and inhibition with specific small molecule inhibitor, SU11274. AACR 1229 Liu HY, Rashidbaigi A (1990) Comparison of various competent cell preparation methods for high efficiency DNA transformation. Biotechniques 8(1):21–25 Bass JJ, Wilkinson DJ, Rankin D, Phillips BE, Szewczyk NJ, Smith K et al (2017) An overview of technical considerations for Western blotting applications to physiological research. Scand J Med Sci Sports 2017(1):4–25 Alves KZ, Borges HL, Soletti RC, Viana AL, Petrella LI, Soldan M, Chagas VL, Schanaider A, Machado JC (2011) Features of in vitro ultrasound biomicroscopic imaging and colonoscopy for detection of colon tumor in mice. Ultrasound Med Biol 37(12):2086–2095 Comoglio PM, Giordano S, Trusolino L (2008) Drug development of MET inhibitors: targeting oncogene addiction and expedience. Nat Rev Drug Discov 7(6):504–516 Pennacchietti S, Michieli P, Galluzzo M, Mazzone M, Giordano S, Comoglio PM (2003) Hypoxia promotes invasive growth by transcriptional activation of the met protooncogene. Cancer Cell 3(4):347–361 Van Cutsem E, Karaszewska B, Kang YK, Chung HC, Shankaran V, Siena S, Go NF, Yang H, Schupp M, Cunningham D (2019) A multicenter phase II study of AMG 337 in patients with MET-amplified gastric/gastroesophageal junction/esophageal adenocarcinoma and other MET-amplified solid tumors. Clin Cancer Res 25(8):2414–2423 Gaule P, Mukherjee N, Corkery B, Eustace AJ, Gately K, Roche S et al (2019) Dasatinib treatment increases sensitivity to c-met inhibition in triple-negative breast cancer cells. Cancers 11(4):548–560 Jahangiri A, De Lay M, Miller LM, Carbonell WS, Hu YL, Lu K, Tom MW, Paquette J, Tokuyasu TA, Tsao S, Marshall R (2013) Gene expression profile identifies tyrosine kinase c-Met as a targetable mediator of antiangiogenic therapy resistance. Clin Cancer Res 19(7):1773–1783 Vigna E, Comoglio PM (2014) Targeting the oncogenic Met receptor by antibodies and gene therapy. Oncogene 34(15):1883–1889 Comoglio PM, Trusolino L, Boccaccio C (2018) Known and novel roles of the MET oncogene in cancer: a coherent approach to targeted therapy. Nat Rev Cancer 18(6):341–358 Corso S, Giordano S (2013) Cell-autonomous and non–cell-autonomous mechanisms of HGF/MET–driven resistance to targeted therapies: from basic research to a clinical perspective. Cancer discov 3(9):978–992 Boezio AA, Copeland KW, Rex K, Albrecht BK, Bauer D, Bellon SF et al (2016) of (R)-6-(1-(8-Fluoro-6-(1-methyl-1H-pyrazol-4-yl)-pyridin-3-yl)ethyl)-3-(2-methoxyethoxy)-1,6-naphthyridin-5(6H)-one (AMG 337), a Potent and Selective Inhibitor of MET with High Unbound Target Coverage and Robust In Vivo Antitumor Activity. J Med Chem 4(6):24–42 Hughes PE, Rex K, Caenepeel S, Yang Y, Zhang Y, Broome MA et al (2016) In vitro and in vivo activity of AMG 337, a potent and selective MET kinase inhibitor, in MET-dependent cancer models. Mol Cancer Ther 15(7):1568–1579 Hong Hong DS, LoRusso P, Hamid O, Janku F, Kittaneh M, Catenacci DV, Chan E, Bekaii-Saab T, Gadgeel SM, Loberg RD, Amore BM (2019) Phase I study of AMG 337, a highly selective small-molecule MET inhibitor, in patients with advanced solid tumors. Clin Cancer Res 25(8):2403–2413 Lu S, Török HP, Gallmeier E, Kolligs FT, Rizzani A, Arena S, Göke B, Gerbes AL, De Toni EN (2015) Tivantinib (ARQ 197) affects the apoptotic and proliferative machinery downstream of c-MET: role of Mcl-1, Bcl-xl and Cyclin B1. Oncotarget 6(26):22167 Edwardraja S, Neelamegam R, Ramadoss V, Venkatesan S, Lee SG (2010) Redesigning of anti-c-Met single chain Fv antibody for the cytoplasmic folding and its structural analysis. Biotechnol Bioeng 106(3):367–375 Heo MA, Kim SH, Kim SY, Kim YJ, Chung J, Oh MK et al (2006) Functional expression of single-chain variable fragment antibody against c-Met in the cytoplasm of Escherichia coli. Protein Expr Purif 47(1):203–209 Li K, Tavaré R, Zettlitz KA, Mumenthaler SM, Mallick P, Zhou Y et al (2014) Anti-MET immunoPET for non-small cell lung cancer using novel fully human antibody fragments. Mol Cancer Ther 13(11):2607–2617 Qamsari ES, Sharifzadeh Z, Bagheri S, Riazi-Rad F, Younesi V, Abolhassani M et al (2017) Isolation and characterization of anti c-met single chain fragment variable (scFv) antibodies. J Immunotoxicol 14(1):23–30 Lu RM, Chang YL, Chen MS, Wu HC (2011) Single chain anti-c-Met antibody conjugated nanoparticles for in vivo tumor-targeted imaging and drug delivery. Biomaterials 32(12):3265–3274 Brinkmann U, Kontermann RE (2017) The making of bispecific antibodies. MAbs 9(2):182–212 Pucca MB, Bertolini TB, Barbosa JE, Galina SVR, Porto GS (2011) Therapeutic monoclonal antibodies: ScFv patents as a marker of a new class of potential biopharmaceuticals. Brazilian J Pharm Sci 47(1):31–39 Batra SK, Jain M, Wittel UA, Chauhan SC, Colcher D (2002) Pharmacokinetics and biodistribution of genetically engineered antibodies. Curr Opin Biotechnol 13(6):603–608 Cheng N, Chytil A, Shyr Y, Joly A, Moses HL (2007) Enhanced hepatocyte growth factor signaling by type II transforming growth factor-β receptor knockout fibroblasts promotes mammary tumorigenesis. Cancer Res 67(10):4869–4877 Liu Y, Liu J-H, Chai K, Tashiro S-I, Onodera S, Ikejima T (2013) Inhibition of c-Met promoted apoptosis, autophagy and loss of the mitochondrial transmembrane potential in oridonin-induced A549 lung cancer cells. J Pharm Pharmacol 65(11):1622–1642 Trusolino L, Bertotti A (2010) Comoglio PM. MET signalling: principles and functions in development, organ regeneration and cancer. Nat Rev Mol Cell Biol 11(12):834–848 Barzaman K, Vafaei R, Samadi M, Kazemi MH, Hosseinzadeh A, Merikhian P, Moradi-Kalbolandi S, Eisavand MR, Dinvari H, Farahmand L (2022) Anti-cancer therapeutic strategies based on HGF/MET, EpCAM, and tumor-stromal cross talk. Cancer Cell Int 22(1):1–20 Ho-Yen CM, Jones JL, Kermorgant S (2015) The clinical and functional significance of c-Met in breast cancer: A review. Breast Cancer Res 17(1):1–11 Lee Y, Lee JK, Ahn SH, Lee J, Nam DH (2016) WNT signaling in glioblastoma and therapeutic opportunities. Lab Invest 96(2):137–150 Gherardi E, Birchmeier W, Birchmeier C, Woude GV (2012) Targeting MET in cancer: rationale and progress. Nat Rev Cancer 12(2):89–103 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 01 Apr, 2023 Read the published version in Investigational New Drugs → Version 1 posted Editorial decision: Major revision 24 Feb, 2023 Reviews received at journal 24 Feb, 2023 Reviewers agreed at journal 20 Feb, 2023 Reviewers agreed at journal 02 Nov, 2022 Reviewers invited by journal 31 Oct, 2022 Editor assigned by journal 31 Oct, 2022 Submission checks completed at journal 31 Oct, 2022 First submitted to journal 29 Oct, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-2216162\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":148124963,\"identity\":\"8831fef9-f974-403c-8a00-166fa176acf1\",\"order_by\":0,\"name\":\"Rana Vafaei\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Tehran\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Rana\",\"middleName\":\"\",\"lastName\":\"Vafaei\",\"suffix\":\"\"},{\"id\":148124964,\"identity\":\"8143f6c7-430c-47ec-a619-1d78bed8c920\",\"order_by\":1,\"name\":\"Zohreh Khaki\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAr0lEQVRIiWNgGAWjYDACHh4GxgYDGyjPgHgtaQw8JGphOAzVQgyQ7zl78OOMgvOJ+xmYH35gKLhHWAtjb1+y5AaD24k9DGzGEgwGxYS1MPPzGEg+AGthMAP6JYGwFjZ+HuOfDwzOAbWwfyNOCw9vjxnQYQeAWniItEWC54yZ5QyDZOOewzzFEgnEaJHvyTG+2fPHTra9vX3jhw9/iNCCAMxATJKGUTAKRsEoGAW4AQDWnS/7xcmPXgAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"University of Tehran\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zohreh\",\"middleName\":\"\",\"lastName\":\"Khaki\",\"suffix\":\"\"},{\"id\":148124965,\"identity\":\"716f1586-5026-4c2a-9610-bf93c43cb132\",\"order_by\":2,\"name\":\"Malihe Salehi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Motamed Cancer Institute, ACECR\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Malihe\",\"middleName\":\"\",\"lastName\":\"Salehi\",\"suffix\":\"\"},{\"id\":148124966,\"identity\":\"76ab7090-8c74-4119-aecc-c792e26818f5\",\"order_by\":3,\"name\":\"Neda Jalili\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Motamed Cancer Institute, ACECR\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Neda\",\"middleName\":\"\",\"lastName\":\"Jalili\",\"suffix\":\"\"},{\"id\":148124967,\"identity\":\"76932912-2045-4e1a-b279-303e183da158\",\"order_by\":4,\"name\":\"Mohammad Reza Esmailinejad\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Tehran\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mohammad\",\"middleName\":\"Reza\",\"lastName\":\"Esmailinejad\",\"suffix\":\"\"},{\"id\":148124968,\"identity\":\"a4554bcf-6a5e-46db-9974-faefd6bac628\",\"order_by\":5,\"name\":\"Ahad Muhammadnajad\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tehran University of Medical Sciences\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ahad\",\"middleName\":\"\",\"lastName\":\"Muhammadnajad\",\"suffix\":\"\"},{\"id\":148124969,\"identity\":\"ac9a4a0c-dd53-498c-b6e9-36519f149660\",\"order_by\":6,\"name\":\"Seyed Mahdi Nassiri\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Tehran\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Seyed\",\"middleName\":\"Mahdi\",\"lastName\":\"Nassiri\",\"suffix\":\"\"},{\"id\":148124970,\"identity\":\"a22aee27-3924-497b-89fe-9d05995b1f2e\",\"order_by\":7,\"name\":\"Alireza Vajhi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Tehran\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Alireza\",\"middleName\":\"\",\"lastName\":\"Vajhi\",\"suffix\":\"\"},{\"id\":148124971,\"identity\":\"bbe6d7d5-647f-4d32-ac31-02ead843a9e1\",\"order_by\":8,\"name\":\"Shima Moradi Kalbolandi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Motamed Cancer Institute, ACECR\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shima\",\"middleName\":\"Moradi\",\"lastName\":\"Kalbolandi\",\"suffix\":\"\"},{\"id\":148124972,\"identity\":\"abe7d79a-2f17-4b5d-a01c-4229bbfa2465\",\"order_by\":9,\"name\":\"Roya Mirzaei\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Motamed Cancer Institute, ACECR\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Roya\",\"middleName\":\"\",\"lastName\":\"Mirzaei\",\"suffix\":\"\"},{\"id\":148124973,\"identity\":\"b49c6cd3-93b9-4216-b1f9-ce63c038f486\",\"order_by\":10,\"name\":\"Leila Farahmand\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Motamed Cancer Institute, ACECR\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Leila\",\"middleName\":\"\",\"lastName\":\"Farahmand\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2022-10-29 11:59:17\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-2216162/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-2216162/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1007/s10637-023-01354-7\",\"type\":\"published\",\"date\":\"2023-04-01T20:13:37+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":28578288,\"identity\":\"858003f2-60e5-4a11-a0dd-b00098e23647\",\"added_by\":\"auto\",\"created_at\":\"2022-11-02 19:27:18\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":255734,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eAnti-MET scFv was successfully cloned, expressed, and purified in the bacterial host and predicted to block MET TKR. \\u003cstrong\\u003eA\\u003c/strong\\u003e schematic image of anti-MET scFv expressing cassette, including the stII signal peptide, the anti-MET scFv coding sequence and a histidine tag moiety within the pET-32 EK/LIC vector. \\u003cstrong\\u003eB\\u003c/strong\\u003eResults of four sequential PCRs to confirm correct amplification of the anti-MET scFv coding sequence. In addition, colony PCR confirms correct cloning of the gene and transformation of the sequence to the bacterial host; negative control (water) is next to the ladder. Experiment was performed for 9 different colonies. \\u003cstrong\\u003eC\\u003c/strong\\u003e SDS/PAGE analysis for the expression of anti-MET scFv at ~ 35 kDa following induction with IPTG. 1: Ladder; 2: Non-IPTG (negative control); and 3: IPTG-induced expression of scFv. \\u003cstrong\\u003eD\\u003c/strong\\u003e SDS/PAGE analysis of purified protein showing diminished concentration of expressed scFv after the purification process. The concentration of anti-MET scFv was then increased using an Amicon concentrator. 1: Ladder; 2: Concentrated protein; 3: Purified protein before concentration. \\u003cstrong\\u003eE\\u003c/strong\\u003e Western blotting exhibiting single positive blot at the predicted molecular weight (~ 35 kDa) confirming correct identity of scFv. 1: Ladder; 2: Negative control; 3: Purified anti-MET scFv.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2216162/v1/a917be8370d1cb698d6e198d.png\"},{\"id\":28578289,\"identity\":\"b6b7b337-704b-4fb7-b010-a769b6de6160\",\"added_by\":\"auto\",\"created_at\":\"2022-11-02 19:27:18\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1138748,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eAnti-MET scFv could effectively bind to MET over-expressing cell line to inhibit cancer cell’s growth and invasion and induce apoptosis. \\u003cstrong\\u003eA\\u003c/strong\\u003e Representative images for binding potency of the anti-MET scFv to the MDA-MB-435 and BT-483 cell lines, which is 48.8% and 0.82%, respectively. \\u003cstrong\\u003eB\\u003c/strong\\u003e Inhibitory effect of the recombinant antibody on cell viability (MTT assay) and concentration–response curves of anti-MET scFv for the MDA-MB-435 and BT-483 cell lines. IC50 values for each curve are shown next to their corresponding graphs. \\u003cstrong\\u003eC\\u003c/strong\\u003e Annexin V/PI staining of the MDA-MB-435 and BT-483 cell lines after treatment with the anti-MET scFv. Number of Annexin V+/PI− and Annexin V+/PI+ populations is related to the apoptotic and necrotic cells, respectively and the summation of both is related to total dead cells. \\u003cstrong\\u003eD\\u003c/strong\\u003e Migration and invasion of the anti-MET scFv MDA-MB-435 compared to the control cells. The BT-483 cell line was used as an MET-negative cell line, with no significant difference between the treated and untreated BT-483 cell line. Data are representative of mean ± SD. *\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05, **\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01, ***\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2216162/v1/f572cdf272bf96b35bf157e0.png\"},{\"id\":28578291,\"identity\":\"52034bbe-6532-4cf8-af34-164ee4c5c128\",\"added_by\":\"auto\",\"created_at\":\"2022-11-02 19:27:18\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2045781,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eUltrasound and Color-Doppler images confirmed decreased tumor size and blood supply in mice receiving the anti-MET scFv. \\u003cstrong\\u003eA\\u003c/strong\\u003e Representative transverse and longitudinal tumor scans for obtaining dimensions of tumor (x, y, z) and volume calculation formula. \\u003cstrong\\u003eB\\u003c/strong\\u003eUltrasonography scans from tumor masses obtained in 4 different days during the experimental period. Heterogeneous and waved-shaped tumor masses of PBS receiving animals in the last day represent a more invasive behavior. \\u003cstrong\\u003eC \\u003c/strong\\u003eColor-Doppler images to show the suppression of blood suppling to the tumor mass in the anti-MET scFv receiving mice versus BPS receiving mice. \\u003cstrong\\u003eD \\u003c/strong\\u003eTumor size in the anti-MET scFv and PBS receiving mice. Student’s t-test.\\u003c/p\\u003e\\n\\u003cp\\u003eData are representative of mean ± SD. *\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05, **\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01, ***\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2216162/v1/dafb94ee32cfef41c7b26d6e.png\"},{\"id\":28579424,\"identity\":\"da45c368-8320-4a0d-ad57-410eee9a879f\",\"added_by\":\"auto\",\"created_at\":\"2022-11-02 19:35:18\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1564205,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHistopathology and IHC images of anti-MET receiving and control tumor tissues. \\u003cstrong\\u003eA \\u003c/strong\\u003eEffect of Anti-MET scFv administration on TILs in tumor site compared to the control. TILs were counted in 10 high power fields (×40 magnification) and reported as percent ± SD, no significant change was noted. Scale bars are equal to 100 μm. \\u003cstrong\\u003eB \\u003c/strong\\u003eIHC staining of Bax (marker for apoptosis), Ki-67 (marker of proliferation), MMP-9 (marker for invasion), VEGF-R2 (marker for angiogenesis) and CD-8 (marker for cytotoxic T-cell). Data are representative of mean ± SD. *\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05, **\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01, ***\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.001. Scale bars are equal to 100 μm.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2216162/v1/46949fe494c01fdec328b36c.png\"},{\"id\":44724089,\"identity\":\"705cbec7-b3ad-43ae-9132-5bf348f420b3\",\"added_by\":\"auto\",\"created_at\":\"2023-10-16 20:24:12\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2904713,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2216162/v1/39d0717c-9266-4fbc-a9ce-63114d6eea76.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Development of a MET-targeted single-chain antibody fragment as an anti-oncogene targeted therapy for breast cancer\",\"fulltext\":[{\"header\":\"Background\",\"content\":\"\\u003cp\\u003eThe use of monoclonal antibodies (mAbs), as a matter branch of the biopharmaceutical industry, is increasingly developing. This includes a wide range of applications such as protein purification, protein-based in vitro diagnostic tests, and treatment of a large variety of human diseases in particular as a therapeutic approach against cancer cells (\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e). More recently, smaller antibody binding fragments have become the topic of interest, since they offer significant advantages over the full-length mAbs, such as higher affinity and specificity, less immunogenicity, better solubility, and stability as well as less expensive production (\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e). Three types of fragments, including the single V-type domain, antigen-binding fragment (Fab), and single-chain variable fragment (scFv) are representing consecutive waves of antibody fragment technologies (\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e). The scFv consists of variable regions of heavy and light chains of antibodies, which are assembled by a flexible linker (\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e). Although this unit of antibody is the smallest format of immunoglobulin, it still retains antigen-binding activity and specificity (\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e). Small size of scFv (\\u0026sim;30 kDa), is a desirable trait for tissue infiltration, especially in cancer therapy (\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e). The monovalency of this antibody fragment made it desirable for targeting receptor tyrosine kinases to overcome antibody-mediated receptor dimerization (\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eReceptor tyrosine kinases (RTKs) as transmembrane proteins are expressed on different normal cell types as well as tumor cells (\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e). Their substantial role in tumorigenesis made them targets for the development of promising anticancer drugs (\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e). Multifarious antibodies inhibiting RTKs are being used in clinical practice (\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e). A subfamily of RTKs known as hepatocyte growth factor receptor (HGFR) or mesenchymal-epithelial transition (MET or c-Me) is expressed on the epithelial cell surface. Upon binding of HGF to this receptor, MET homodimerization and phosphorylation occur, triggering a signaling cascade that is responsible for early embryonic development, which is generally quiescent in adult tissues, except for tissue repair (\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e). Aberrant activation of the MET/HGF signaling pathway in cancer cells, as a result of overexpression, mutation, or amplification of the MET gene, plays a pivotal role in growth factor-mediated proliferation, epithelial to mesenchymal transition, metastasis, and survival, leading to neoplastic transformation in a variety of cancers, including breast cancer (\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e, \\u003cspan additionalcitationids=\\\"CR16\\\" citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e). This signaling axis, as one of the hallmarks of malignancy in initiating invasion and metastasis, has become a favorite target for developing monoclonal antibodies for immunotherapeutic purposes (\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e). Besides the ability of the oncogenic driver, MET also contributes to targeted therapy resistance during using approved VEGFR, EGFR, and Her2 inhibitors (\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eAlthough several MET-targeted drug candidates have been designed and developed, none of the HGF/MET-targeted antibodies or antibody fragments reached phase 4 clinical trials (\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e, \\u003cspan additionalcitationids=\\\"CR21 CR22\\\" citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e). The challenging complication of ordinary monoclonal antibodies is the undesirable MET activation rather than antagonization, which happens as a result of RTK dimerization, leading to kinase auto-activation (\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e). For example, DN30 which is a monoclonal antibody against an epitope on the extracellular domain behaves as a partial agonist (\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e). But this antibody induced MET down-regulation by the mechanism of shedding the ectodomain of the receptor (\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e). To overcome this problem, monovalent antibodies were replaced by traditional bivalent antibodies to target MET without dimerization-induced activation (\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e). The widely known anti-MET one-armed antibody, Onartuzumab (Genetech), was successful in avoiding MET dimerization but, the phase III study did not confirm the efficacy results observed in the phase II study for non-small cell lung cancer (\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e). Furthermore, this drug was not successful in phase 2 of the clinical trial in triple-negative breast cancer (\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e). Hence, future efforts are to be made to overcome the current difficulties of MET targeted therapy, which is considered an important immunotherapeutic program in epithelial neoplasms.\\u003c/p\\u003e \\u003cp\\u003eCongruent with this notion, here we developed a novel modeled anti-MET scFv, which was synthesized by gene cloning and expression in a bacterial host. Designing, construction, and purification of this antibody fraction were then followed by functional assessment as well as in vivo assays.\\u003c/p\\u003e\"},{\"header\":\"Materials And Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell culture \\u0026amp; Bacteria strains\\u003c/h2\\u003e \\u003cp\\u003eCloning and gene expression were accomplish using \\u003cem\\u003eE. coli\\u003c/em\\u003e strains NovaBlue GigaSingles\\u0026trade; (Novagen- USA) as the primary cloning host and BL21-DE3 (Novagen-USA) as the expressing host. For gene cloning, plasmid pET-32 LIC vector (Novagen- USA) was utilized. The cell surface expression of MET is abundant in the MDA-MB-435 cell line whereas this protein has no expression in the BT-483 cell line (\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e). Thus, authenticated human ductal carcinoma cell lines (MDA-MB-435 and BT-483), as well as mouse breast cancer lines (4T1), were purchased from Pasteur Institute of Iran (IPI, Iran). All cell lines were cultured as adherent cells in high glucose Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Gibco, USA), 1% non-essential amino acid (Gibco-USA), 2 mM L-glutamine (Gibco, USA), 1 mM sodium pyruvate (Gibco, USA), and 1% penicillin-streptomycin (Gibco, USA) in gamma radiated sterile polystyrene plates and flasks then stayed at 37\\u0026deg;C in a 5% CO2 humidified atmosphere incubator.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eConstruction Of Recombinant Anti-met Scfv Expression Cassette\\u003c/h3\\u003e\\n\\u003cp\\u003eThe DNA sequences of the variable heavy chain (VH), as well as variable light chain (VL) domains of anti-MET Onartuzumab Fab, were obtained from GenBank (Accession number: 4K3J-H and 4K3J-L respectively). The detailed process of construction of Onartuzumab antibody has been described elsewhere (\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e). A glycine-rich 15 amino acid peptide was inserted between variable chains as a flexible linker. After the synthesis of this codon (Cinnagen, Inc. Tehran, Iran), it was amplified by PCR, followed by 3 sequential PCR runs to add the following sequences to the reading frame by use of specific primers listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e: a stII signal peptide coding sequence at the 3' end to localize anti-MET protein in the periplasmic space of expressing bacteria which can then be easily harvested in its native structure after disrupting the bacterial wall, a 6 constitutive histidine tag moiety at 5' to isolate the protein by Ni-NTA affinity chromatography and also for protein characterization by immunoblotting and the compatible overhang sequence compatible to pET-32 Ek-LIC vector at both ends of the codon. (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA) The primers were designed by Gene Runner Software v3.05 (Hastings Software Inc. Las Vegas, U.S.A) and then synthesized by Pishgam Biotech Co. (Tehran, Iran). The PCR reaction mix was comprised of 5 \\u0026micro;l dNTP mix (0.2 mM), 5 \\u0026micro;l of 10\\u0026times; reaction buffer with 1.5 mM MgCl2, 2 \\u0026micro;l of each primer (12.5 mM/\\u0026micro;l), 0.4 \\u0026micro;l Taq DNA polymerase (1 Unit) and 2 \\u0026micro;l template (50 ng/ml) and 8.6 \\u0026micro;l ddH2O in a total volume of 50 \\u0026micro;l in 30 cycles. Each cycle was started with an initial denaturation at 95\\u0026deg;C for 2min, followed by 30 cycles of denaturation at 95\\u0026deg;C for 30 s, annealing at 52\\u0026deg;C for 30 s, extension at 72\\u0026deg;C for 1 min and a final extension at 72\\u0026deg;C for 5 min. Then the final PCR product was harvested from the 2% agarose gel after the electrophoresis and concentrated with the Qiagen gel extraction kit (Qiagen, Germany). Molecular weight and theoretical isoelectric point were estimated with Expasy (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://web.expasy.org/compute_pi/\\u003c/span\\u003e\\u003cspan address=\\\"https://web.expasy.org/compute_pi/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eList of primers used for construction of anti-MET scFv expression cassette\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eName\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eSequence (5'-3')\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eForward 1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGACATCCATGACCCAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eReverse 1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAGAAGAAACGGTAACCACG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eForward 2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAGAAGAAACGGTAACCACG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eReverse 2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCGTTTTTTCTATTGCTACAAATGCCTATGCAGACATCCAGATGACCCAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eForward 3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAATG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eReverse 3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eATGATGATGATGATGATGAGAAGAAACGGTAACCACG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\\n\\u003ch3\\u003eCloning And Expression Of Recombinant Anti-met Scfv\\u003c/h3\\u003e\\n\\u003cp\\u003eThe achieved DNA amplicon were cloned within the ligation-independent cloning (LIC) site of the pET-32 EK/LIC vector based on the protocol of manufacturer (Novagen- USA). Transforming the constructed plasmid, pET-32 Ek-LIC/Anti-MET, into E-coli Nova Blue GigaSingles\\u0026trade; competent cells (Novagen- USA), was performed by the calcium chloride method (\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e). Transformants were then cultured on LB agar containing ampicillin (50\\u0026micro;g/ml). The recombinant clones were submitted randomly to colony-PCR and clones with desirable insertion sizes were characterized by sequencing (Gene Fanavaran Co, Iran) to confirm successful cloning. The accuracy of the sequence was confirmed using Sequence Alignment Editor Software Bio Edit. Harvested plasmids were then used to transform into protein-expressing E-coli strain, BL21 (DE3) competent cells (Novagen, USA), and transformants were cultures on LB agar plates containing 50 \\u0026micro;g/ml ampicillin. Single colonies of the E. coli BL21 DE3 containing pET32Ek/LIC-anti-MET plasmids were then grown in 5 ml LB broth containing 50 \\u0026micro;g/ml ampicillin and incubated at 37\\u0026deg;C and 180 rpm in a shaker incubator for 16 h. Subsequently, the culturing tube was poured into 200 mL ampicillin containing terrific broth to reach an optical density (OD) 600 of at least 0.4. At this point, isopropyl thiogalactoside (IPTG) was added (1mM) to induce protein expression at 27\\u0026deg;C for 16 h in a shaker incubator (150 rpm).\\u003c/p\\u003e\\n\\u003ch3\\u003eProtein Purification And Concentration\\u003c/h3\\u003e\\n\\u003cp\\u003eFor the purification of anti-MET scFv, immobilized metal affinity chromatography (IMAC) was performed through denaturing method and by using a Ni-NTA-Agarose column (Qiagen, Germany). For this purpose, expressing bacterial cells were first collected by centrifugation (9000 rpm, 4\\u0026deg;C, and 30 min). After resuspension of pellets in the ice-cold denaturing buffer (500mM NaCl, 8 mM Urea, Tris-HCl pH 8.0, and imidazole 10 mM), all soluble periplasmic proteins were extracted utilizing sonication (1mA for 10 min) with subsequent centrifugation (4\\u0026deg;C, 15000 rpm). The supernatant, containing His-tagged anti-MET scFv and the host soluble proteins were collected and then submitted for IMAC. First, the column was prepared by passing the binding buffer (300 mM NaCl, 6 mM Urea, Tris-HCl pH:8.0, and imidazole 2 mM) through 5 mg Ni-NTA HisBind Resin (Qiagen). Afterward, the extracted protein was added to the column, incubated at 26\\u0026deg;C for 1 h, then washed by three sequential wash buffers to reduce the urea concentration gradually (wash 1: 500 mM NaCl, 4 mM Urea, Tris-HCl pH: 8.0; wash 2: 500 mM NaCl, 2 mM Urea, Tris-HCl pH 8.0; wash 3: 500 mM NaCl, Tris-HCl pH 8.0). In the last stage, the bound anti-MET was eluted by 5 column volumes of elution buffer (300 mM NaCl, 300 mM imidazole, and Tris-HCl pH 8.0). The imidazole of the elute was eliminated by diafiltration. Then Purified proteins were concentrated to 500 micrograms per milliliter on an Amicon (Merk, Germany) concentrator using sterile PBS, pH 7.6, and kept at 4\\u0026deg;C for experiments. The concentration was measured by a spectrophotometer (WPA Biowave II, Bichrom, England).\\u003c/p\\u003e\\n\\u003ch3\\u003eCharacterization Of The Purified Protein; Sds-page, Western Blotting\\u003c/h3\\u003e\\n\\u003cp\\u003eEluted fractions of IPTG positive, IPTG negative, and purified anti-MET fragments were electrophoresed on a 12% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel), in the presence of 2-mercaptoethanol as a reducing agent. The gels were then stained with Coomassie brilliant blue to evaluate the protein bands. Isolated proteins by SDS-PAGE were then submitted to the polyvinylidene difluoride; PVDF (Millipore Merk) membrane using a semi-dry blot transfer device (Bio-Rad, Hercules, CA) based on the standard protocol (\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e). To improve the signal-to-noise ratio, the membrane was blocked with a blocking buffer comprising 5% w/v non-fat dried milk (Merck) in 0.05% v/v PBS-Tween-20 solution for 18 h at 4\\u0026deg;C. Afterward, the membrane was rinsed thrice in Tris-buffered saline; TBS and 0.1% (v/v) Tween 20 and probed with a mouse horseradish peroxidase (HRP)-conjugated anti-His tag monoclonal antibody (Qiagen, Germany; 1:2000) at 27\\u0026deg;C. The protein blots were finally visualized by using 0.05% 3, 3\\u0026prime; -diaminobenzidine (DAB; Sigma-Germany) (0.05% DAB; 0.03% hydrogen peroxide in 100 mM Tris-HCl pH 7.5).\\u003c/p\\u003e\\n\\u003ch3\\u003eCell Surface Antigen-binding Assay Via Flow Cytometry\\u003c/h3\\u003e\\n\\u003cp\\u003eA human metastatic breast carcinoma cell line BT-483 and a putative breast/melanoma cell line MDA-MB-435 were used as rarely expressing (as a control cell line) and constitutively expressing MET, respectively (\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e). The cells were incubated with 50 \\u0026micro;g/ml of purified concentrated anti-MET scFv for 1 h at 4\\u0026deg;C. FBS-treated cells were used as a negative control. The cells were then washed three times with ice-cold PBS and 4% FBS and were incubated with 10 \\u0026micro;g/ml FITC conjugated anti-His specific antibody (Abcam- UK) for 1 h at 4\\u0026deg;C (1:500). Subsequently, antigen-binding to the cell surface was assessed using the FACScalibur Flow Cytometer (FC) device (Becton Dickinson- USA) at the FL1 channel.\\u003c/p\\u003e\\n\\u003ch3\\u003eCell Viability Assay; Mtt Assay\\u003c/h3\\u003e\\n\\u003cp\\u003eTo appraise the potentiality of anti-MET scFv cytotoxicity, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H- tetrazolium bromide (MTT) assay was performed. Briefly, 5\\u0026times;10\\u003csup\\u003e3\\u003c/sup\\u003e MBA-MD-435 and BT-483 cells were seeded in every well of a 96-well plate and the cells were cultured with 0.2 ml medium at 37\\u0026deg;C for 24 h. Different concentrations (4 to 132 \\u0026micro;g/ml) of anti-MET scFv were added to wells followed by 48 h incubation. Cells were then incubated with the MTT dye at 37\\u0026deg;C for 3 h. After washing out the MTT with PBS, formazan which was formed from MTT in viable cells by dehydrogenase enzyme was dissolved using DMSO. Finally, absorbance rate was read at 570 nm by a microplate absorbance reader (BioRad- USA), and fifty percent inhibitory concentration values (IC50) were calculated using GraphPad Prism 7 as the concentration of the protein inducing a 50% reduction in viability when compared to untreated cells.\\u003c/p\\u003e\\n\\u003ch3\\u003eApoptosis Assay\\u003c/h3\\u003e\\n\\u003cp\\u003eThe percentage of the total, late and early apoptotic cells was determined using flow cytometric Annexin V-FITC)/propidium iodide (PI) assay (Biolegend, San Diego, CA) according to the guidelines manufacturer. For this purpose, 4\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e cells were seeded into each well of a 6-well plate, treated with anti-MET scFv at different concentrations (18, 32, and 50 \\u0026micro;g/ml), then incubated for 48 h at 37\\u0026deg;C. These concentrations were selected based on the average of 25% and 75% growth inhibitory activity of our protein in the MTT assay amongst all cell lines. Then Cells were harvested utilizing 1X trypsin-EDTA (Gibco-USA) and washed with PBS. Cells were then centrifuged and the pellet was resuspended in 100 \\u0026micro;l binding buffer of the assay kit and then stained by FITC-labeled Annexin V and PI. Cells were then submitted to flow cytometry analysis (BD FACS, Calibur) on the FL1/FL3 channels and the double staining quadrant was gated on targeted cells. The single positive FL1 population (Annexin V labeled cells) and double-positive cells (FLs1/FL3) as respective early and late apoptosis, were summed up to obtain the total apoptotic cell percentage.\\u003c/p\\u003e\\n\\u003ch3\\u003eInvasion Assay\\u003c/h3\\u003e\\n\\u003cp\\u003eGiven the role of MET in metastasis, we examined whether anti-MET scFv affects cancer cell invasion and migration. The Cultrex BME Cell Invasion Assay (R\\u0026amp;D Systems) (Trevigen Inc., Gaithersburg, MD, USA) was used based on manufacturer protocol using MBA-MD435 and BT-483 lines. 50 \\u0026micro;L basement membrane extract (BME) solution was added to each well of the top chamber and incubated at 37\\u0026deg;C. 50,000 cells/ 50 \\u0026micro;L serum-free medium containing 10 \\u0026micro;M anti-MET were plated on the coated BME. Control wells contained PBS instead of anti-Met. 150 \\u0026micro;L of the medium was then loaded into the lower chambers. The Cells were then incubated for 24 h, at 37\\u0026deg;C. 100 \\u0026micro;L of Calcein AM solution/cell dissociation solution was added to the bottom chamber and incubated for 1 h, at 37\\u0026deg;C. Relative fluorescence units (RFU) of the samples were determined at 485 nm excitation and 520 nm emission with an ELISA reader (BioTek-VT- USA). The data was compared to the standard curve to measure the number of cells that have invaded through BME.\\u003c/p\\u003e\\n\\u003ch3\\u003eMigration Assay\\u003c/h3\\u003e\\n\\u003cp\\u003eMigration assay was performed utilizing Cultrex BME Cell Migration Assay (R\\u0026amp;D Systems) (Trevigen Inc., Gaithersburg, MD, USA) similar to the above-mentioned invasion assay. On the second day, the upper chamber was carefully aspirated and washed with 1X cell wash buffer. Afterward, 100 \\u0026micro;L of cell cissociation solution/Calcein-AM was added to the bottom chamber of a black assayed 96-well microplate. The cell migration chamber was assembled and incubated for 1 h, 37\\u0026deg;C. The top chamber was eliminated and absorbance was read at 485 nm excitation and 520 emissions compared to the standard curve.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eBreast cancer tumor model (\\u003c/b\\u003e \\u003cspan type=\\\"BoldItalic\\\" class=\\\"BoldItalic\\\" name=\\\"Emphasis\\\"\\u003eIn-vivo\\u003c/span\\u003e \\u003cb\\u003e)\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003e6\\u0026ndash;7 week-old female inbred BALB/c mice, weighing 16\\u0026ndash;17 gram (Veterinary Faculty, University of Tehran) were used for in vivo 4T1 syngeneic homograft TN breast cancer mouse model. Mice were placed in conventional condition at the Animal Care Facility, Veterinary Faculty, and the University of Tehran according to guidelines established by the Animal Care Committee of the University of Tehran. Tumors were established on the left flank by subcutaneous transplantation of 4T1 tumor tissues with the dimensions of 3 mm obtained from a 4T1 tumor-bearing BALB/c mouse. The first day of treatment was initiated when the average tumor size reached 100 cm3 as measured using Ultrasonography (US). 5 \\u0026micro;g/g of anti-MET scFv was injected systemically into the mice through the tail vein. A total of 7 injections were performed every other day. The bodyweight of animal was monitored daily. Tumor volume was measured non-invasively through the US imaging every 3 days according to the following formula:\\u003c/p\\u003e \\u003cp\\u003eV (mm\\u003csup\\u003e3\\u003c/sup\\u003e)\\u0026thinsp;=\\u0026thinsp;1/6 π\\u0026thinsp;\\u0026times;\\u0026thinsp;x \\u0026times; y \\u0026times; z\\u003c/p\\u003e \\u003cp\\u003eIn which x, y, and z represent tumor height, width, and length (mm), respectively. The results were then compared to the PBS receiving control group. At the end of the treatment period, mice were sacrificed, then tumors were surgically excised, weighed, and submitted to 10% formaldehyde (NPF, fixative, Sigma-Aldrich, HT501128) for histopathology assessment.\\u003c/p\\u003e\\n\\u003ch3\\u003eUltrasonography Techniques\\u003c/h3\\u003e\\n\\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003ePercutaneous real-time ultrasonography (B-mode and color Doppler) was performed using a multi-frequency (6\\u0026ndash;13 MHz) linear transducer with a small footprint (SLAx/6\\u0026ndash;13 Ultrasound Transducer), connected to a portable ultrasound unit (Micro Maxx, Sono Site, USA, 2009). The transducer was aligned to the tumor\\u0026rsquo;s central plane and the maximum depth of 19 mm was set to gain the sagittal and transverse planes. The tumor\\u0026rsquo;s height, width, and length were measured using the unit\\u0026rsquo;s caliper. In addition, tumor\\u0026rsquo;s shape, margin (smooth or irregular), parenchymal echogenicity (hypoechoic or hyperechoic), and echotexture (homogeneous or heterogeneous) were evaluated. Also, probable invasion to regional structures, severity (mild, moderate and severe), and the pattern of the vascularization (centrally, peripherally or both) were assessed. The ultrasonography was performed every 3 days with all the above parameters checked to analyze the amount of tumor outgrowth, spreading and invasion.\\u003c/p\\u003e \\u003cp\\u003eFor the best attachment of the probe to the skin, the tumor site was shaved and an ultrasonography jelly was applied. Image orientation was performed using landmarks to procure standardized planes and correct measurements. In Color Doppler Technique, high-quality images and accurate measurements of optimum velocity were obtained by setting the sample volume size to 13 mm and by changing its angle to 60 degrees. This was repeated in all animals to decrease the possible miscues.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e\\n\\u003ch3\\u003eHistopathology\\u003c/h3\\u003e\\n\\u003cp\\u003eAt the end of the treatment period, tumors were excised and prepared for histopathological evaluation. The H\\u0026amp;E staining was performed to study the percentage of the tumor necrosis, mitotic count (per 10 HPF), nuclear pleomorphism (scores 1, 2, and 3), and tumor-infiltrating lymphocytes (TILs) (number of lymphocytes in 10 HPF). Following antibodies were used for immunohistochemical staining: anti-CD8 monoclonal antibody (Catalog number: ab209775, Abcam, USA), marker of cytotoxic T cells; anti-Bax monoclonal antibody (Catalog number: ab263897, Abcam, USA), apoptosis regulator; anti-Ki-67 monoclonal antibody (ab15580, Abcam, USA), marker of proliferation; anti-VEGF receptor 2 (VEGFR2) monoclonal antibody (Catalog number: ab2349, Abcam, USA), indicator of angiogenesis, and anti-matrix metalloproteinase-9 (MMP-9) monoclonal antibody (Catalog number: ab38898, Abcam, USA), a proteinase up-regulating in metastasis and angiogenesis. The specific HRP-conjugated secondary antibody was used. Gill\\u0026rsquo;s hematoxylin was used as counterstaining for all sections. Microvessel density (MVD) was assessed as the average number of microvessels in 4 random fields after VEGF-R2 staining. The percentage of positive nuclei for Ki-67 per 1000 malignant cells was also used to assess proliferation and a modified ALL-Red scoring system (proportion score and intensity score) was used to assess MMP-9- and BAX-stained sections.\\u003c/p\\u003e\\n\\u003ch3\\u003eStatistics\\u003c/h3\\u003e\\n\\u003cp\\u003eThe quantitative data are expressed as means\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD. Gaussian distribution was assessed by the Shapiro-Wilk test. Ordinary one-way ANOVA was used to analyze among 3 or more group differences and a Tukey test as post-hop. Two-tailed unpaired t-test was carried out to compare between two groups. Statistically significant, P-value\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was considered (* p\\u0026thinsp;\\u0026lt;\\u0026thinsp;.05, **p\\u0026thinsp;\\u0026lt;\\u0026thinsp;.01, ***p\\u0026thinsp;\\u0026lt;\\u0026thinsp;.001). Graphpad Prism version 9.0.0 and Excel 2016 software were used for statistical analysis.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eGene cloning\\u003c/h2\\u003e \\u003cp\\u003eA full-length anti-MET-scFv coding sequence was cloned into the pET32 /LIC vector. To screen the anti-Met-bearing colonies containing our desired sequence, colony PCR was performed using primers specific to the recombinant anti-MET fraction (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB). Based on our results, DNA sequences were successfully incorporated into the plasmids and subsequent sequencing results showed no point mutation or rearrangement.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eProtein Expression And Characterization\\u003c/h3\\u003e\\n\\u003cp\\u003eTo recognize the expression of our desired recombinant anti-MET scFv among all of the harvested periplasmic proteins, a comparison between the protein panel of IPTG-positive and IPTG-negative bacteria was done using 12% SDS-PAGE. Figure\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC depicts the occurrence of a\\u0026thinsp;~\\u0026thinsp;35 kDa protein band among other bacterial proteins which is absent in the negative control. This molecular weight is consistent with the anti-MET scFv and the histidine tag. The signal peptide moiety detaches during the expression. Purified anti-MET scFv demonstrated only a single band with the same molecular weight (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD) while having a lower concentration. The final concentration of purified protein after passing through the Amicon (Merk, Germany) concentrator was 500 micrograms per milliliter. The concentration was also shown by SDS-page (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD), with the purified band being then confirmed through western blotting (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eE).\\u003c/p\\u003e\\n\\u003ch3\\u003eCell Surface Antigen-binding Assay\\u003c/h3\\u003e\\n\\u003cp\\u003eTo check the particular binding of anti-MET scFv to the HGFR, flow cytometry analysis was accomplished using MET-positive MDA-MB-435 and MET-negative BT-483 cancer cell lines. As exhibited in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA, the MET-positive MDA-MB-435 line showed a high binding capacity with recombinant anti-MET scFv; however, a very low capacity of binding was observed with MET negative BT-483 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA). The results showed 48.8% and 0.87% of binding to the MDA-MB-435 and BT-483 cancer cell lines, respectively. These findings propose that anti-MET scfv is specifically bound to HGFR-positive cancer cells.\\u003c/p\\u003e\\n\\u003ch3\\u003eCell Viability Assay\\u003c/h3\\u003e\\n\\u003cp\\u003eMTT reduction assay was conducted on the MDA-MB-435 and BT-483 cell lines, expressing high and rare MET, respectively to evaluate the cell growth inhibitory ability of our purified antibody fragment. Cells were treated with recombinant anti-MET scFv for 48 h with concentrations ranging from 4 to 132 \\u0026micro;g/ml and then cell viability was assessed. The IC50 value of anti-MET scFv against MET-positive human breast cancer cell line (MDA-MB-435) was 11.4 nM whereas this value was measured as 47.01nM in MET-negative cell line BT-483 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). The results relying on the dose of anti-MET in an increasing concentration show a gradual reduction in the proliferation of MDA-MB- 435 in vitro (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). A negligible difference was seen in the cellular viability of the BT-483 cells upon treatment with the anti-MET antibody fragment.\\u003c/p\\u003e\\n\\u003ch3\\u003eApoptosis Assay\\u003c/h3\\u003e\\n\\u003cp\\u003eThe potential of apoptosis induction by our anti-MET scFv was evaluated on MDA-MB-435 and BT-483 cell lines using Annexin V/PI assay. The results showed a considerably higher percentage of total apoptosis in the MDA-MB-435 cell line in comparison to the rare expressing cell line BT-483 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC). The apoptosis potency of the anti-MET scFv to MDA-MB-435 and BT-483 was measured as 52.5%, and 10.1%, respectively (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC).\\u003c/p\\u003e\\n\\u003ch3\\u003eMigration And Invasion Assay\\u003c/h3\\u003e\\n\\u003cp\\u003eTo evaluate the anti-invasive properties of anti-Met scFv, the Cultrex\\u0026reg; BME cell invasion assay kit was used. This assay offers a standardized and flexible method for evaluation of the severity penetration of invasive cells through a barrier of basement membrane and extracellular matrix elements in vitro. The results showed significantly higher inhibition of migration and invasion of the anti-MET scFv treated MDA-MB-435 cell line. This effect was not seen in the BT-483 cells which express low levels of MET (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD).\\u003c/p\\u003e\\n\\u003ch3\\u003eIn Vivo Tumor Growth Suppression And Ultrasound Imaging\\u003c/h3\\u003e\\n\\u003cp\\u003eAfter 14 days of anti-MET scFv administration in 4T1 tumor-bearing BALB/c mice, a decrease in tumor growth was recorded in comparison with the PBS receiving group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB, D). In this context, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA represents the ultrasound imaging technique to gain transverse and longitudinal scans of tumor mass by changing the angle between the ultrasound waves and the direction of the animal. By this technique, three different dimensions were obtained from the ovoid mass (x, y, z) to calculate the tumor volume. As depicted in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e, enhancement of tumor growth suppression and lac of logarithmic phase of tumor growth was significant in the anti-MET receiving animals (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB, D). No significant changes (more than 20%) were observed in the bodyweight of mice during the treatment, confirming that the administered dosage of anti-MET scFv was safely tolerated (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). In addition, the tumor weight after the treatment period was significantly less in the anti-MET group than in the control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). Differences in tumor size became meaningful from the second injection and progressively increased until the last injection (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). In addition, inhomogeneity in the texture of tumor images, as well as the development of waved-shaped boundaries, is related to the invasiveness and metastatic behavior of tumors (\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e). Results demonstrated a higher risk of invasion and metastasis in the control animals than in the anti-MET scFv receiving group. Overall, tumors of the PBS receiving mice were inhomogeneous and had rough boundaries on the final day of treatment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). Contrarily in anti-MET scFv receiving mice, the smooth form of tumors was generally notified.\\u003c/p\\u003e\\n\\u003ch3\\u003eImmunohistochemistry (Ihc), Quantification Of Microvessel’s Density And Histopathology\\u003c/h3\\u003e\\n\\u003cp\\u003eResults of the hematoxylin and eosin staining (H\\u0026amp;E) method showed a higher rate of response to therapy in the anti-MET scFv receiving group compared to the non-treated control one (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). In parallel, the percentage of infiltrated lymphocytes was defined by an expert pathologist which was blinded from the experimental groups, based on their nuclear morphology. Our results showed no significant difference in the percentage of TILs in the anti-MET receiving tumors compared to the control tumors (less than 5% in both groups) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA). Moreover, results of IHC analyses revealed a significantly reduced microvascular density in anti-MET receiving animals compared to the PBS receiving animals (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB). Analyzing apoptosis by evaluation of Bax in the control and treated mice, a significantly declined apoptosis rate was spotted in the anti-MET receiving tumors compared to the PBS control tumors (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB). Moreover, our results demonstrated that the expression level of Ki-67 was significantly decreased in the tumors harvested from the anti-MET receiving animals (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB). However, no significant change was observed in MMP-9 and CD-8 markers in the anti-MET receiving group when compared with the control tumors (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eIn the present study, we designed and synthesized a novel anti-MET scFv, and then investigated the functional properties and tumor-suppressive effects in vitro and in vivo. Met augments proliferation, migration, invasion, protection from apoptosis, and angiogenesis in malignant cells (\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e). Of note, MET overexpression acts as a \\u0026lsquo;stress-response gene\\u0026rsquo; which leads to transcriptional adaptation of malignant cells to the undesirable microenvironment, including hypoxia (\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e). MET amplification and overexpression have been correlated with lymph node metastasis, depth of tumor invasion, advanced stage, and decreased survival rate (\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e). Exposure to antiangiogenic therapy bevacizumab results in upregulation of MET (\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e). Thus, activation of the MET axis has known as one of the mechanisms of resistance to the bevacizumab (\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e). Since MET plays a dual role both as a necessary oncogene and also as a proper target in the acquired drug resistance, it could apply to target c-Met alone or concurrent with other therapies to prevent the advent of resistance (\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e). However, targeting Met is still challenging so far, mainly due to the poor state of knowledge regarding MET kinase-independent function and the agonistic action of Met targeting for homo-dimerization (\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e). Although various clinical trials are ongoing in this field, none of the HGF/MET-targeted antibodies or antibody fragments could complete phase 3 of the clinical trial with satisfactory results (\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e, \\u003cspan additionalcitationids=\\\"CR21 CR22\\\" citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e). For example, a conventional monoclonal antibody against Met increases Met activity by imitating HGF-mediated dimerization, even so, it could mediate endo-lysosome-associated degradation (\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e). MET-targeted monovalent antibodies and antibody fragments aimed to be developed and replaced the whole antibodies to address this issue. In this regard, Onartuzumab (Genentech) has been engineered as a \\u0026ldquo;one-armed\\u0026rdquo; monovalent antibody with native-like architecture which lacks antibody-induced dimerization function with resultant antagonism of the HGF\\\\MET axis (\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e). This specific MetMAb is made up of a single humanized antigen-binding fragment (Fab) assembled to the constant domain fragment (Fc) expressed in E. coli (\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e). Another inhibitor of MET signaling is AMG 337, a selective small-molecule kinase repressor (\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e). The preclinical studies of AMG 337 showed, inhibition of MET phosphorylation and MET-dependent cell growth in several MET-overexpressing cell lines as well as induction of apoptosis and decreasing tumor growth in MET-dependent xenograft models (\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e). This study also showed anti-tumor activity in MET-amplified adenocarcinoma in phase 1 and 2 clinical trials (\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e). Other small molecule kinase inhibitors targeting Met, such as Tivantinib (ArQule), have been found unsuccessful (\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e). Different studies were designed anti-MET scFv to target MET RTK (\\u003cspan additionalcitationids=\\\"CR44 CR45\\\" citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e). The anti-MET scFv could also be used for drug delivery approaches (\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e). A more recent anti-MET scFv showed apoptotic and anti-proliferative potency in the human colorectal carcinoma cell line (\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e). The use of the bacterial expression of scFv resulted in lac of Fc effector function such as ADCC (Antibody-dependent cellular cytotoxicity) and high production yield as well as facilitating purification for further clinical use (\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e). Results presented herein confirmed the usefulness of an E-coli expressed recombinant scFv with the preserved capacity of binding and blocking the MET. In our study, we used the scFv fragment to target MET which was proven to have rapid blood circulation, providing good localization and tissue penetration of the drug within one hour after the administration (\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e). High binding affinity has been demonstrated between the Met receptor and three different anti-Met scFv fragments (\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e). Our study supports the aforementioned report in that it showed a significantly higher binding capacity to cancer cell lines over-expressing MET. As HGF/c-Met is known to play an important role in 4T1 tumor progression (\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e), the 4T1 breast cancer mice model was used for in-vivo experiments in the current study. MET RTK acts as an anti-apoptotic mediator by increasing the BAX/BCL2 ratio (\\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e). MET-dependent cell growth is mediated by up-regulation of many signaling cascades including the extracellular signal-regulated kinase 1 (ErK1) and ErK, the phosphoinositide 3-kinase\\u0026ndash;Akt (Pi3K\\u0026ndash;Akt) axis, the mitogen-activated protein kinase (MAPK) and Jun amino-terminal kinases (JNKs) (\\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e53\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e54\\u003c/span\\u003e). Also the death receptor FAS (also known as CD95 and TNFRSF6) interacts the ectodomain of MET, which inhibits FAS self-aggregation and FAS receptor\\u0026ndash;FAS ligand (FASL) recognition, so preventing apoptosis through the extrinsic pathway (\\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e53\\u003c/span\\u003e). As we showed here, blocking of MET results in decreased cell growth and enhances cell apoptosis. Our results demonstrated increased BAX expression which was in agreement with the in-vitro Annexin V/PI assay exhibiting significantly higher apoptosis in response to the anti-MET treatment. The pro-invasive and pro-migratory potency of MET has been shown in several human breast cancer cell lines (\\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e55\\u003c/span\\u003e). Also, there is a positive association between the level of MET expression and the invasiveness-related genes (MMP-9 and MMP-2) (\\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e56\\u003c/span\\u003e). In our study, we showed that the invasion and migration could be significantly inhibited by anti-MET treatment in the MET over-expressing cell line, MDA-MB-435. Nevertheless, MMP-9 expression was not affected by anti-MET treatment in 4T1 tumor graft mice. This could be attributed to the different pro-invasive effects of MET in different cell lines. The HGF/ MET signaling is also deemed as a potent trigger of endothelial cell growth (\\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e55\\u003c/span\\u003e). The MET axis can increase VEGFR expression; with MET and VEGFR2 synergistically collaborating in inducing tumor angiogenesis (\\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e57\\u003c/span\\u003e). Our results showed the usefulness of the anti-MET scFv synthesized in this study to curb the microvessel\\u0026rsquo;s density (MVD) in experimental breast cancer.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eAltogether, scFv antibody fragments targeting tumor oncogenes, in particular MET TKR, could be regarded as appropriate therapeutic tools in targeted therapy for MET expressing tumors. In our study, we developed and synthesized a novel anti-MET scFv that could effectively suppress MET-overexpressing breast cancer cells. Our results showed that the anti-MET scFv fragment could be a potent therapeutic agent to inhibit tumor proliferation and invasiveness. However, evaluation of this antibody fragment in mice breast cancer model shed more light on the details of tumor suppression activity of the anti-MET fragment. Therefore, we conclude that the anti-MET scFv could be a promising candidate for MET-targeted cancer therapy.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis project was in accordance with the national norms, the ethical principles and standards for conducting medical research in Iran and evaluated by Motamed Cancer Institute-Academic Centre for Education, Culture and Research. This institution performed its reviews based on United States Public Health Service (USPHS) regulations and applicable federal and local laws. Protocols were also approved by the Animal Care Committee of the University of Tehran (7508017623).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll authors have agreed to publish this manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that all data supporting the findings of current study are provided within the manuscript.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by Research Council,\\u0026nbsp;University of Tehran.\\u0026nbsp;Specialized research grant for Doctoral Program of Higher Education, Faculty of Veterinary Medicine (7508017/6/23).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eL. F. developed the methodology; Z. Kh. and R.V. conducted the experiments, contributed to the data analysis and wrote the manuscript; M. S., N. J and S. M assisted the experiments; M. R. EN. and A.V. conducted ultrasonography; S. M. N. contributed to scientific assist and revised the manuscript. All authors read and approved the final manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe would thank Mr. Alireza Ghovati, Department of Clinical Pathology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran. for his technical assistance.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eAyyar BV, Arora S, O\\u0026rsquo;Kennedy R (2016) Coming-of-age of antibodies in cancer therapeutics. Trends Pharmacol Sci 37:1009\\u0026ndash;1028\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRodgers KR, Chou RC (2016) Therapeutic monoclonal antibodies and derivatives: Historical perspectives and future directions. Biotechnol Adv 34(6):1149\\u0026ndash;1158\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eManoutcharian K, Perez-Garmendia R, Gevorkian G (2017) Recombinant antibody fragments for neurodegenerative diseases. Curr Neuropharmacol 15(5):779\\u0026ndash;788\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang Y, Li X, Chen X, Nielsen J, Petranovic D, Siewers V (2021) Expression of antibody fragments in Saccharomyces cerevisiae strains evolved for enhanced protein secretion. Microb Cell Factories 20(1):1\\u0026ndash;17\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHolliger P, Hudson PJ (2005) Engineered antibody fragments and the rise of single domains. Nat Biotechnol 23(9):1126\\u0026ndash;1136\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAhmad ZA, Yeap SK, Ali AM, Ho WY, Alitheen NB, Hamid M (2012) scFv antibody: principles and clinical application. Clin Dev Immunol. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1155/2012/980250\\u003c/span\\u003e\\u003cspan address=\\\"10.1155/2012/980250\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePeterson E, Owens SM, Henry RL (2006) Monoclonal antibody form and function: manufacturing the right antibodies for treating drug abuse. The AAPS J 8(2):383\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMonnier PP, Vigouroux RJ, Tassew NG (2013) In vivo applications of single chain Fv (variable domain)(scFv) fragments. Antibodies 2(2):193\\u0026ndash;208\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHeo MA, Kim SH, Kim SY, Kim YJ, Chung J, Oh MK, Lee SG (2006) Functional expression of single-chain variable fragment antibody against c-Met in the cytoplasm of Escherichia coli. Protein Expr Purif 47(1):203\\u0026ndash;209\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSu Z, Han Y, Sun Q, Wang X, Xu T, Xie W et al (2019) Anti-Met VHH pool overcomes MeT-targeted cancer therapeutic resistance. Mol Cancer Ther 18(1):100\\u0026ndash;111\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eButti R, Das S, Gunasekaran VP, Yadav AS, Kumar D, Kundu GC (2018) Receptor tyrosine kinases (RTKs) in breast cancer: signaling, therapeutic implications and challenges. Mol Cancer 17(1):1\\u0026ndash;8\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSergina NV, Rausch M, Wang D, Blair J, Hann B, Shokat KM et al (2007) Escape from HER-family tyrosine kinase inhibitor therapy by the kinase-inactive HER3. Nature 445(7126):437\\u0026ndash;441\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePetrelli A, Circosta P, Granziero L, Mazzone M, Pisacane A, Fenoglio S et al (2006) Ab-induced ectodomain shedding mediates hepatocytes growth factor receptor down-regulation and hampers biological activity. Proc Natl Acad Sci 103(13):5090\\u0026ndash;5095\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFeng Y, Ma PC (2011) Anti-MET targeted therapy has come of age: The first durable complete response with MetMAb in metastatic gastric cancer. Cancer Discov 1(7):550\\u0026ndash;554\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang Y, Xia M, Jin K, Wang S, Wei H, Fan C, Wu Y, Li X, Li X, Li G, Zeng Z (2018) Function of the c-Met receptor tyrosine kinase in carcinogenesis and associated therapeutic opportunities. Mol Cancer 17(1):1\\u0026ndash;4\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMinuti G, Cappuzzo F, Duchnowska R, Jassem J, Fabi A, O\\u0026rsquo;brien T, Mendoza AD, Landi L, Biernat W, Czartoryska-Arłukowicz B, Jankowski T (2012) Increased MET and HGF gene copy numbers are associated with trastuzumab failure in HER2-positive metastatic breast cancer. Br J Cancer 107(5):793\\u0026ndash;799\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFaiella A, Riccardi F, Carten\\u0026igrave; G, Chiurazzi M, Onofrio L (2022) The Emerging Role of c-Met in Carcinogenesis and Clinical Implications as a Possible Therapeutic Target. J Oncol. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1155/2022/5179182\\u003c/span\\u003e\\u003cspan address=\\\"10.1155/2022/5179182\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMaroun CR, Rowlands T (2014) The Met receptor tyrosine kinase: a key player in oncogenesis and drug resistance. Pharmacol Ther 142(3):316\\u0026ndash;338\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShattuck DL, Miller JK, Carraway KL, Sweeney C (2008) Met receptor contributes to trastuzumab resistance of Her2-overexpressing breast cancer cells. Cancer Res 68(5):1471\\u0026ndash;1477\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTerlecka P, Krawczyk P, Grenda A, Milanowski J (2021) MET Gene Dysregulation as a Promising Therapeutic Target in Lung Cancer-A Review. J Pers Med 11(12):1370\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBouattour M, Raymond E, Qin S, Cheng AL, Stammberger U, Locatelli G et al (2018) Recent developments of c-Met as a therapeutic target in hepatocellular carcinoma. Hepatol 67(3):1132\\u0026ndash;1149\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMerchant M, Ma X, Maun HR, Zheng Z, Peng J, Romero M, Huang A, Yang NY, Nishimura M, Greve J, Santell L (2013) Monovalent antibody design and mechanism of action of onartuzumab, a MET antagonist with anti-tumor activity as a therapeutic agent. Proc Natl Acad Sci 110(32):2987\\u0026ndash;2996\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJin H, Yang R, Zheng Z, Romero M, Ross J, Bou-Reslan H, Carano RA, Kasman I, Mai E, Young J, Zha J (2008) MetMAb, the one-armed 5D5 anti-c-Met antibody, inhibits orthotopic pancreatic tumor growth and improves survival. Cancer Res 68(11):4360\\u0026ndash;4368\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMerchant M, Ma X, Maun HR, Zheng Z, Peng J, Romero M et al (2013) Monovalent antibody design and mechanism of action of onartuzumab, a MET antagonist with anti-tumor activity as a therapeutic agent. Proc Natl Acad Sci 110(32):2987\\u0026ndash;2996\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSpigel DR, Edelman MJ, O\\u0026rsquo;Byrne K, Paz-Ares L, Shames DS, Yu W et al (2014) Onartuzumab plus erlotinib versus erlotinib in previously treated stage IIIb or IV NSCLC: Results from the pivotal phase III randomized, multicenter, placebo-controlled MET Lung (OAM4971g) global trial. Clin Adv Hematol Oncol 15 \\u0026ndash; 6\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDi\\u0026eacute;ras V, Campone M, Yardley DA, Romieu G, Valero V, Isakoff SJ, Koeppen H, Wilson TR, Xiao Y, Shames DS, Mocci S (2015) Randomized, phase II, placebo-controlled trial of onartuzumab and/or bevacizumab in combination with weekly paclitaxel in patients with metastatic triple-negative breast cancer. Ann Oncol 26(9):1904\\u0026ndash;1910\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJagadeeswaran R, Jagadeeswaran S, Fackenthal J (2005) c-Met/HGF pathway in breast cancer cells and inhibition with specific small molecule inhibitor, SU11274. AACR 1229\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu HY, Rashidbaigi A (1990) Comparison of various competent cell preparation methods for high efficiency DNA transformation. Biotechniques 8(1):21\\u0026ndash;25\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBass JJ, Wilkinson DJ, Rankin D, Phillips BE, Szewczyk NJ, Smith K et al (2017) An overview of technical considerations for Western blotting applications to physiological research. Scand J Med Sci Sports 2017(1):4\\u0026ndash;25\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAlves KZ, Borges HL, Soletti RC, Viana AL, Petrella LI, Soldan M, Chagas VL, Schanaider A, Machado JC (2011) Features of in vitro ultrasound biomicroscopic imaging and colonoscopy for detection of colon tumor in mice. Ultrasound Med Biol 37(12):2086\\u0026ndash;2095\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eComoglio PM, Giordano S, Trusolino L (2008) Drug development of MET inhibitors: targeting oncogene addiction and expedience. Nat Rev Drug Discov 7(6):504\\u0026ndash;516\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePennacchietti S, Michieli P, Galluzzo M, Mazzone M, Giordano S, Comoglio PM (2003) Hypoxia promotes invasive growth by transcriptional activation of the met protooncogene. Cancer Cell 3(4):347\\u0026ndash;361\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVan Cutsem E, Karaszewska B, Kang YK, Chung HC, Shankaran V, Siena S, Go NF, Yang H, Schupp M, Cunningham D (2019) A multicenter phase II study of AMG 337 in patients with MET-amplified gastric/gastroesophageal junction/esophageal adenocarcinoma and other MET-amplified solid tumors. Clin Cancer Res 25(8):2414\\u0026ndash;2423\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGaule P, Mukherjee N, Corkery B, Eustace AJ, Gately K, Roche S et al (2019) Dasatinib treatment increases sensitivity to c-met inhibition in triple-negative breast cancer cells. Cancers 11(4):548\\u0026ndash;560\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJahangiri A, De Lay M, Miller LM, Carbonell WS, Hu YL, Lu K, Tom MW, Paquette J, Tokuyasu TA, Tsao S, Marshall R (2013) Gene expression profile identifies tyrosine kinase c-Met as a targetable mediator of antiangiogenic therapy resistance. Clin Cancer Res 19(7):1773\\u0026ndash;1783\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVigna E, Comoglio PM (2014) Targeting the oncogenic Met receptor by antibodies and gene therapy. Oncogene 34(15):1883\\u0026ndash;1889\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eComoglio PM, Trusolino L, Boccaccio C (2018) Known and novel roles of the MET oncogene in cancer: a coherent approach to targeted therapy. Nat Rev Cancer 18(6):341\\u0026ndash;358\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCorso S, Giordano S (2013) Cell-autonomous and non\\u0026ndash;cell-autonomous mechanisms of HGF/MET\\u0026ndash;driven resistance to targeted therapies: from basic research to a clinical perspective. Cancer discov 3(9):978\\u0026ndash;992\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBoezio AA, Copeland KW, Rex K, Albrecht BK, Bauer D, Bellon SF et al (2016) of (R)-6-(1-(8-Fluoro-6-(1-methyl-1H-pyrazol-4-yl)-pyridin-3-yl)ethyl)-3-(2-methoxyethoxy)-1,6-naphthyridin-5(6H)-one (AMG 337), a Potent and Selective Inhibitor of MET with High Unbound Target Coverage and Robust In Vivo Antitumor Activity. J Med Chem 4(6):24\\u0026ndash;42\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHughes PE, Rex K, Caenepeel S, Yang Y, Zhang Y, Broome MA et al (2016) In vitro and in vivo activity of AMG 337, a potent and selective MET kinase inhibitor, in MET-dependent cancer models. Mol Cancer Ther 15(7):1568\\u0026ndash;1579\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHong Hong DS, LoRusso P, Hamid O, Janku F, Kittaneh M, Catenacci DV, Chan E, Bekaii-Saab T, Gadgeel SM, Loberg RD, Amore BM (2019) Phase I study of AMG 337, a highly selective small-molecule MET inhibitor, in patients with advanced solid tumors. Clin Cancer Res 25(8):2403\\u0026ndash;2413\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLu S, T\\u0026ouml;r\\u0026ouml;k HP, Gallmeier E, Kolligs FT, Rizzani A, Arena S, G\\u0026ouml;ke B, Gerbes AL, De Toni EN (2015) Tivantinib (ARQ 197) affects the apoptotic and proliferative machinery downstream of c-MET: role of Mcl-1, Bcl-xl and Cyclin B1. Oncotarget 6(26):22167\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEdwardraja S, Neelamegam R, Ramadoss V, Venkatesan S, Lee SG (2010) Redesigning of anti-c-Met single chain Fv antibody for the cytoplasmic folding and its structural analysis. Biotechnol Bioeng 106(3):367\\u0026ndash;375\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHeo MA, Kim SH, Kim SY, Kim YJ, Chung J, Oh MK et al (2006) Functional expression of single-chain variable fragment antibody against c-Met in the cytoplasm of Escherichia coli. Protein Expr Purif 47(1):203\\u0026ndash;209\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi K, Tavar\\u0026eacute; R, Zettlitz KA, Mumenthaler SM, Mallick P, Zhou Y et al (2014) Anti-MET immunoPET for non-small cell lung cancer using novel fully human antibody fragments. Mol Cancer Ther 13(11):2607\\u0026ndash;2617\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eQamsari ES, Sharifzadeh Z, Bagheri S, Riazi-Rad F, Younesi V, Abolhassani M et al (2017) Isolation and characterization of anti c-met single chain fragment variable (scFv) antibodies. J Immunotoxicol 14(1):23\\u0026ndash;30\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLu RM, Chang YL, Chen MS, Wu HC (2011) Single chain anti-c-Met antibody conjugated nanoparticles for in vivo tumor-targeted imaging and drug delivery. Biomaterials 32(12):3265\\u0026ndash;3274\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBrinkmann U, Kontermann RE (2017) The making of bispecific antibodies. MAbs 9(2):182\\u0026ndash;212\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePucca MB, Bertolini TB, Barbosa JE, Galina SVR, Porto GS (2011) Therapeutic monoclonal antibodies: ScFv patents as a marker of a new class of potential biopharmaceuticals. Brazilian J Pharm Sci 47(1):31\\u0026ndash;39\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBatra SK, Jain M, Wittel UA, Chauhan SC, Colcher D (2002) Pharmacokinetics and biodistribution of genetically engineered antibodies. Curr Opin Biotechnol 13(6):603\\u0026ndash;608\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCheng N, Chytil A, Shyr Y, Joly A, Moses HL (2007) Enhanced hepatocyte growth factor signaling by type II transforming growth factor-β receptor knockout fibroblasts promotes mammary tumorigenesis. Cancer Res 67(10):4869\\u0026ndash;4877\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu Y, Liu J-H, Chai K, Tashiro S-I, Onodera S, Ikejima T (2013) Inhibition of c-Met promoted apoptosis, autophagy and loss of the mitochondrial transmembrane potential in oridonin-induced A549 lung cancer cells. J Pharm Pharmacol 65(11):1622\\u0026ndash;1642\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTrusolino L, Bertotti A (2010) Comoglio PM. MET signalling: principles and functions in development, organ regeneration and cancer. Nat Rev Mol Cell Biol 11(12):834\\u0026ndash;848\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBarzaman K, Vafaei R, Samadi M, Kazemi MH, Hosseinzadeh A, Merikhian P, Moradi-Kalbolandi S, Eisavand MR, Dinvari H, Farahmand L (2022) Anti-cancer therapeutic strategies based on HGF/MET, EpCAM, and tumor-stromal cross talk. Cancer Cell Int 22(1):1\\u0026ndash;20\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHo-Yen CM, Jones JL, Kermorgant S (2015) The clinical and functional significance of c-Met in breast cancer: A review. Breast Cancer Res 17(1):1\\u0026ndash;11\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLee Y, Lee JK, Ahn SH, Lee J, Nam DH (2016) WNT signaling in glioblastoma and therapeutic opportunities. Lab Invest 96(2):137\\u0026ndash;150\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGherardi E, Birchmeier W, Birchmeier C, Woude GV (2012) Targeting MET in cancer: rationale and progress. Nat Rev Cancer 12(2):89\\u0026ndash;103\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"investigational-new-drugs\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"drug\",\"sideBox\":\"Learn more about [Investigational New Drugs](https://www.springer.com/journal/10637)\",\"snPcode\":\"10637\",\"submissionUrl\":\"https://submission.nature.com/new-submission/10637/3\",\"title\":\"Investigational New Drugs\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"MET, Receptor Tyrosine Kinase, Breast Cancer, Antibody Fragment, scFv, Recombinant\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-2216162/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-2216162/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eThe usage of monoclonal antibodies (mAbs), as a matter associated with the biopharmaceutical industry, is increasingly growing. Harmonious with this concept, we designed the exquisitely modeled anti-MET scFv against breast cancer by gene cloning, and expression using a bacterial host. Herein, we developed a recombinant scFv against MET and examined its preclinical efficacy for the reduction of tumor growth, invasiveness and angiogenesis in vitro and in vivo. Expressed anti-MET scFv demonstrated high binding capacity (48.8%) toward MET-overexpressing cancer cells. The IC50 value of anti-MET scFv against MET-positive human breast cancer cell line (MDA-MB-435) was 11.4 nM whereas this value was measured as 47.01 nM in MET-negative cell line BT-483. Similar concentrations could also effectively induce apoptosis in MDA-MB-435 cancer cells. Moreover, this antibody fragment could reduce migration and invasion in MDA-MB-435 cells. Grafted breast tumors in Balb/c mice showed significant tumor growth suppression as well as reduction of blood-supply in response to recombinant anti-MET treatment. Histopathology and immunohistochemical assessments revealed higher rate of response to therapy. In our study, we designed and synthetized a novel anti-MET scFv which could effectively suppress MET-overexpressing breast cancer tumors.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Development of a MET-targeted single-chain antibody fragment as an anti-oncogene targeted therapy for breast cancer\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2022-11-02 19:27:13\",\"doi\":\"10.21203/rs.3.rs-2216162/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Major revision\",\"date\":\"2023-02-24T16:19:01+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2023-02-24T12:23:01+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"a892f2fa-7c5a-4109-afb5-582a6d32e228\",\"date\":\"2023-02-20T13:41:31+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"4b950d26-37ba-42c7-b1c5-06315db4f79f\",\"date\":\"2022-11-02T12:28:08+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2022-10-31T12:41:53+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2022-10-31T04:35:26+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2022-10-31T04:35:25+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Investigational New Drugs\",\"date\":\"2022-10-29T11:51:01+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"investigational-new-drugs\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"drug\",\"sideBox\":\"Learn more about [Investigational New Drugs](https://www.springer.com/journal/10637)\",\"snPcode\":\"10637\",\"submissionUrl\":\"https://submission.nature.com/new-submission/10637/3\",\"title\":\"Investigational New Drugs\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"eba02d2a-81d0-4600-bfa7-e702047de2e3\",\"owner\":[],\"postedDate\":\"November 2nd, 2022\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2023-10-16T20:23:09+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-2216162\",\"link\":\"https://doi.org/10.1007/s10637-023-01354-7\",\"journal\":{\"identity\":\"investigational-new-drugs\",\"isVorOnly\":false,\"title\":\"Investigational New Drugs\"},\"publishedOn\":\"2023-04-01 20:13:37\",\"publishedOnDateReadable\":\"April 1st, 2023\"},\"versionCreatedAt\":\"2022-11-02 19:27:13\",\"video\":\"\",\"vorDoi\":\"10.1007/s10637-023-01354-7\",\"vorDoiUrl\":\"https://doi.org/10.1007/s10637-023-01354-7\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-2216162\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-2216162\",\"identity\":\"rs-2216162\",\"version\":[\"v1\"]},\"buildId\":\"cTy_lsJlmDsVRNrSptgXS\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}