{"paper_id":"005e8439-cfea-4e8f-919b-f707de1f4a2e","body_text":"Skin-Derived Precursor Cell-Differentiated Dopaminergic Neurons Promote Functional Recovery in Parkinson’s Disease via Tunneling Nanotube-Mediated Intercellular Communication | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Skin-Derived Precursor Cell-Differentiated Dopaminergic Neurons Promote Functional Recovery in Parkinson’s Disease via Tunneling Nanotube-Mediated Intercellular Communication Li Mu, Huimin Tao, Ying Wang, Qiuwen Sun, Tianyi Huang, Yulin Pan, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6363439/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The transplantation of stem cells has considerable potential in delaying the progression of Parkinson's disease (PD). Both the source of the stem cells and the method of differentiation induction are critical factors in this process. In the present work, for the first time, we developed a differentiation strategy that allows for the generation of functional dopaminergic (DA) neurons from skin-derived precursor cells (SKPs). Concurrently, intercellular tunneling nanotubes (TNTs) and substance transfer were observed in a direct coculture system of SKP-induced differentiated dopaminergic neurons (SKP-DA neurons) and primary DA neurons. Furthermore, we assessed the survival, differentiation, migration of SKP-DA neurons and enhancement of striatal functional deficits in the PD model after SKP-DA neurons transplantation. The intranasal administration of SKP-DA neurons resulted in effective survival and differentiation into DA neurons without the formation of tumors, thereby leading to improvements in the functional deficits of the PD model. This study provides evidence that SKPs undergoing induced differentiation can develop the morphological characteristics and functional properties of DA neurons, thereby improving the functional deficits associated with PD. These findings suggest the potential of noninvasive treatment as a novel regenerative therapeutic approach for PD. Biological sciences/Neuroscience/Diseases of the nervous system/Neurodegeneration Biological sciences/Neuroscience/Diseases of the nervous system/Parkinsons disease Biological sciences/Stem cells/Neural stem cells Biological sciences/Stem cells/Stem cell differentiation Skin-derived precursor cells intranasal administration dopaminergic neurons tunneling nanotubes Parkinson's disease Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Highlights • Utilized skin-derived precursor cells (SKPs) to generate functional dopaminergic (DA) neurons for Parkinson's disease (PD) treatment. • A specific culture medium with small molecule drugs and proteins to induce differentiation of SKPs into DA neurons. • SKP-DA neurons displayed typical morphological features and expression of markers specific to DA neurons, indicating successful differentiation. • A direct co-culture model showing inter-cellular tunneling nanotubes conducive to organelle transfer between SKP-DA neurons and primary culture of DA neurons. • Intranasal administration of SKP-DA neurons into an MPTP-induced PD model significantly improved striatal functional deficits. Background Parkinson’s disease (PD) is a progressive neurodegenerative disorder characterized by the selective degeneration of dopaminergic (DA) neurons within the substantia nigra pars compacta, leading to profound dopamine deficiency in the striatum 1 , 2 . This disruption underpins the hallmark motor symptoms of PD, including tremors, rigidity, bradykinesia, and postural instability 3 . While current therapeutic approaches, such as dopamine replacement therapy and deep brain stimulation, alleviate symptoms temporarily, they fail to halt the progression of neuronal degeneration or restore lost neuronal populations 4 , 5 . These findings underscore the urgent need for innovative regenerative strategies capable of addressing the underlying pathophysiology of PD. Stem cell-based therapies have emerged as promising avenues for regenerative medicine, with the potential to replace lost neurons and restore dopaminergic function. Recent studies have demonstrated that stem cells can be induced to develop into DA neurons via small chemical compounds and protein factors 6 , 7 . Furthermore, it has been shown that transplanted DA neurons can survive, integrate, and release dopamine into the host striatum. The transplantation of stem cell-derived DA neurons replaced a significant quantity of apoptotic DA neurons. It largely rehabilitates the compromised substantia nigra-striatal pathway 8 , 9 . The transplanted PD model animals exhibited notable pathological and behavioral enhancements 7 , 8 , indicating that stem cell-induced differentiation of DA neurons successfully mitigated PD symptoms. Among the various stem cell sources investigated, skin-derived precursor cells (SKPs) present unique advantages because of their accessibility, minimal collection invasiveness, and multipotent differentiation capacity. SKPs, derived from neural crest progenitors, can differentiate into neural and nonneural cell lineages under specific inductive conditions 10 . However, efficient and reproducible protocols for differentiating SKPs into functional DA neurons, along with the integration of these cells into host neural networks, remain critical challenges. Their readily accessible tissue source and absence of ethical controversy position them as vital resources in neurodegenerative therapy 11 , 12 . The demise of nigrostriatal dopamine neurons in PD patients results in a persistent reduction in dopamine in the striatum, ultimately causing an imbalance between the direct and indirect routes within the basal ganglia and resulting in motor dysfunction 13 . Consequently, the induced differentiation of SKPs into dopamine-secreting neurons and their transplantation into PD models is anticipated to be crucial for decelerating the progression of PD. The success of cell-based therapies in PD also depends on fostering a supportive microenvironment that promotes graft survival, integration, and functionality. Recent research highlights the importance of intercellular communication in enhancing the survival and functionality of transplanted cells 14 . Intercellular communication is crucial for organism development and differentiation, the execution of organizational tasks, and the synchronization of various physiological roles 15 . Tunnelling nanotubes (TNTs) are tubular membrane structures characterized by a high F-actin content and a diameter of several hundred nanometers 16 . They are thin cytoplasmic channels that facilitate the direct intercellular exchange of organelles, ions, and biomolecules and have garnered attention as potential mediators of such interactions 17 . TNTs may enhance the integration and functional coupling of transplanted cells with endogenous neuronal populations, thereby improving therapeutic outcomes 16 . They serve as direct connections between cells, facilitating the transport of various cytoplasmic contents, including mitochondria, lysosomes, vesicles, mRNAs, plasma membrane proteins, lipids, ions, and metabolites 18 , 19 . Direct cell contact results in significantly greater transfer efficiency than traditional transfer modes, such as endocrine and paracrine mechanisms, which rely on secretion-mediated transfer 20 . TNTs are essential for communication among cells and their microenvironments. The role of TNTs in the interaction between transplanted stem cells and neurons requires further investigation. In the present work, we developed a differentiation protocol for generating dopaminergic neurons from SKPs via a combination of small molecules and protein-based inducers. The morphological, genetic, and protein expression profiles of the generated SKP-induced differentiated dopaminergic neurons (SKP-DA neurons) were evaluated to confirm their functional identity as DA neurons. Furthermore, we investigated their interaction with primary DA neurons in a coculture system, focusing on TNTs formation, the bidirectional transfer of organelles, and changes in the number and length of TNTs before and after drug stimulation. Finally, we assessed the therapeutic potential of SKP-DA neurons in an MPTP-induced mouse model of PD, examining their survival, differentiation, migration, and ability to ameliorate striatal functional deficits. Intercellular material transfer between SKP-DA neurons and primary neurons through TNTs facilitates the transport of organelles, including mitochondria and lysosomes, potentially increasing resistance to harmful substances and improving cell survival rates. SKPs are more accessible, safer, and more reliable than other cell types. They are more straightforward and easier to manage, lowering overall costs and facilitating the utilization of SKP-DA neurons for PD treatment. This work aims to elucidate the potential of SKPs as renewable and noninvasive sources for generating functional DA neurons. By integrating findings on differentiation efficiency, intercellular interactions, and in vivo efficacy, this study provides critical insights into the development of novel regenerative therapies for PD. Results Characterization of the changes in SKPs eGFP following induced differentiation in vitro The isolation and purification of SKPs eGFP from the dermis of the dorsal skin of enhanced green fluorescent protein transgenic newborn SD rats followed the method established by Biernaskie and McKenzie in 2006 21 . They were induced to differentiate into the DA neuron GFP via a combination of small molecule compounds and protein factors, followed by transplantation into the brains of PD model mice to assess the effects of transplantation (Fig. 1 a). SKPs eGFP exhibited cell sphere morphology when observed via differential interference contrast microscopy, with nearly all cells expressing SRY-Box Transcription Factor 2 (SOX2), Nestin, and other markers specific to neural stem cells following purification (Fig. 1 b). During 1–2 days of induced differentiation, the morphology of SKPs eGFP changed from round to fusiform or prismatic. The cell cytosol decreased in size and became more compact, with an increased refractive index and stereoscopic perception. Additionally, neural protrusions gradually emerged, and synapses exhibited a multipolar morphology. SKPs eGFP exhibited a loss of original morphological characteristics, adopting a typical neuronal morphology, whereas the control group did not display similar morphological changes (Fig. 1 c). SKPs eGFP exhibits potential for neuronal differentiation SKPs eGFP cells were cultured with neuronal induction medium for approximately one day, resulting in greater than 90% expression of neural stem cell markers, including SOX2, NESTIN, Paired Box 6 (PAX6), and the astrocyte marker Glial fibrillary acidic protein (GFAP). After two days, the expression levels of the neural stem cell markers SOX2, NESTIN, and PAX6 significantly decreased. By the fourth day, the expression of these markers had decreased by 60%-70%, whereas the expression of the astrocyte marker GFAP had decreased by approximately 25% (Fig. 2 a). SKPs eGFP initiated the expression of the panneuronal marker Tubulin Class III β-tubulin (TUBB3), the mature neuronal marker microtubule-associated protein-2 (MAP2), and the presynaptic marker Synuclein (SYN) following 2 days of culture in the neuronal induction medium, with a significant increase in expression observed after 4–14 days (Fig. 2 b). SKPs has the potential to differentiate into DA neurons The markers specific to DA neurons, including tyrosine hydroxylase (TH), dopamine transporter protein (DAT), and nuclear receptor subfamily 4, group A, member 2 (NR4A2), were expressed starting from day 2 and showed a progressive increase, with a significant elevation in expression observed around day 7. The synapses of neurons continue to develop throughout the culture process, with DA neurons undergoing further differentiation and maturation after an additional seven days or more of culture (Fig. 3 a). On approximately day 14 of differentiation, we detected the percentages of TUBB3- and TH-positive cells among the total cells, which were 37% and 27.8%, respectively (Fig. 3 b-d). To ascertain the specific induced differentiation of SKPs eGFP into DA neurons, we identified cells that had undergone differentiation for over 14 days. These cells expressed DA neuron-specific markers, including TH, DAT, and NR4A2. In contrast, they did not express markers for GABA neurons (γ-aminobutyric acid, GABA), glutamatergic neurons (vesicular glutamate transporter protein 1, vGlut1), or cholinergic neurons (choline acetyltransferase, CHAT). These findings indicate that the differentiated neurons are DA neurons rather than GABA, glutamatergic, or cholinergic neurons (Fig. 3 e). Furthermore, we analyzed gene expression changes during the differentiation of SKPs eGFP into DA neurons by measuring the mRNA levels of SOX2, Nestin, and GFAP at 0, 1, 2, and 4 days postinduction. Additionally, we assessed TUBB3, MAP2, forkhead box A2 (FOXA2), TH, vesicular monoamine transporter (VMAT2), and NR4A2 expression at 4, 7, and 14 days following differentiation induction. The SKPs eGFP control group was cultured in standard medium for seven days, which resulted in a significant reduction in the expression of the SOX2, Nestin, and GFAP genes, approximately 80%-90%, approximately 4 days after induction of differentiation. After 14 days of induced differentiation, the expression levels of TUBB3 and MAP2 increased approximately 20-fold. The expression levels of TH, NR4A2, and VMAT2 increased 5–10-fold, whereas the expression of FOXA2 markedly increased approximately 400–500-fold (Fig. 3 f-h). Following 14 days of induced differentiation, SKPs eGFP developed into mature DA neurons, which were designated SKP-DA neurons eGFP . The cytoplasm of SKPs eGFP exhibited a reduction in size and increased compactness, whereas the number of axons increased, and their lengths increased, indicating that they aligned more closely with typical neuronal morphology. The neurons established a dense network of synaptic connections. Immunofluorescence staining revealed that SKP-DA neurons eGFP highly expressed neuron-specific markers, including TUBB3, MAP2, and NEUN; the presynaptic marker SYN; and DA neuron-specific markers, such as NR4A2, TH, and DAT (Fig. 4 a-e). SKPs-DA neurons undergo intercellular substance transport via TNTs We cocultured SKP-DA neurons expressing eGFP (SKPs-DA neurons eGFP ) with primary DA neurons. Direct cell‒cell connections between SKP–DA neurons and primary DA neurons were identified as TNTs. Tubular membrane structures known as TNTs are characterized by their abundance of F-agonist proteins and exhibit lengths varying from a few microns to several hundred microns. Cells linked by TNTs are capable of sharing plasma membranes. Transport through TNTs encompasses a range of entities, from small calcium ions to larger mitochondria 15 . Organelles, including mitochondria, lysosomes, and the Golgi apparatus of primary neurons, were fluorescently labeled. The SKPs-DA neurons eGFP were subsequently cocultured with these neurons for approximately 4–6 hours. The TNTs formed between the two cell types, facilitating the transfer of organelles from primary neurons to the SKP-DA neurons eGFP (Fig. 5 a). The mitochondria, lysosomes, Golgi apparatus, and other organelles of the SKP-DA neurons eGFP were fluorescently labeled and subsequently cocultured with 6-OHDA-modeled primary neurons for approximately 4–6 hours. The identical two forms of intercellular TNTs structure formation and the transport of various organelles through TNTs from SKP-DA neurons eGFP to 6-OHDA-modeled primary neurons are illustrated (Fig. 5 b). These findings indicate that the transport of intracellular substances via TNTs may occur bidirectionally. The number and length of TNTs in primary neurons and SKP-DA neurons eGFP stimulated with 6-OHDA were compared with those in the normal group. We found that after 6-OHDA stimulation, more TNTs were produced between SKP-DA neurons and progenitor neurons, and the length of the TNTs was significantly shortened (Fig. 5 c-d). Histopathological alterations in the PD mouse model after SKP-DA neurons response to transplantation To assess the potential of the transplanted SKP-DA neurons eGFP to decelerate PD progression in vivo , and establish functional connections with primary DA neurons, we conducted intranasal transplantation of the SKP-DA neurons eGFP into the brains of PD model mice. Four weeks post-transplantation, TH-positive cells in the midbrain substantia nigra were labeled via immunofluorescence staining. Compared with SKP-DA neurons eGFP revealed that neurons, these neurons survived in the midbrain substantia nigra and expressed a measurable amount of TH (Fig. 6 a-c). Immunofluorescence semiquantification revealed that the expression of TH in the substantia nigra of the midbrain in the experimental group of mice was significantly greater than that in the sham-operated group (Fig. 6 d-f). Furthermore, SKPs-DA neurons eGFP were capable of establishing connections with DA neurons (Fig. 6 g). This finding demonstrated that SKP-DA neurons eGFP , differentiated in vitro for approximately 5 days, preserved their neuronal activity and further differentiated into DA neurons following transplantation into the midbrain. Western blot analysis revealed that the expression of TH positive in the midbrain substantia nigra of was significantly greater in the experimental group than in the sham-operated group. Nonetheless, it was inferior to that of the standard control group of equivalent age. The expression of DAT in the midbrain substantia nigra of the experimental group of mice exceeded that of the control group. The expression of GRP78 in the substantia nigra of the sham-operated mice was significantly elevated, approximately double that observed in the control and experimental groups (Fig. 6 h-k). These results indicate that the SKP-DA neurons eGFP demonstrated the capacity to express a specific quantity of TH in the midbrain substantia nigra following transplantation into the PD model mouse brain, facilitating connections with neurons and mitigating apoptosis and stress in DA neurons. Behavioral recovery following the transplantation of SKPs-DA neurons In addition to histopathological evidence that transplanted SKPs eGFP survived in the midbrain substantia nigra and differentiated into DA neurons, we further assessed the impact of cell transplantation on the progression of the disease in PD model mice. The behavioral tests (rod-turning experiment and open-field experiment) were conducted on the day of transplantation and again four weeks post-transplantation across three groups of mice. The trajectory maps and thermograms from the open field experiment indicate that the frequency of exploration in the central region, the time spent in the central region, and the total distance moved were significantly reduced (Fig. 7 a-b). Post-MPTP modelling, the mice exhibited predominantly limbic region movements and explorations. Four weeks post-transplantation of SKP-DA neurons eGFP , the experimental group of mice exhibited enhanced locomotion and exploration. This was demonstrated by an increased frequency of central region exploration, extended time spent in the central region, greater total distance travelled, longer body extension time, and reduced body curl accumulation time and percentage (Fig. 7 c-h). Compared with the experimental group, the sham-operated group also showed improvements in locomotion, albeit to a lesser degree. The rod-turning experiment demonstrated a notable reduction in both the fall time and total distance of rod turning, alongside an increase in fall velocity in MPTP-modelled mice (Fig. 7 i-k), suggesting substantial impairment in locomotor ability in this group. Four weeks post-transplantation of the SKP-DA neurons eGFP , the experimental group of mice presented increased rod-turning fall time and total rod-turning distance alongside a reduced fall velocity, indicating an improvement in locomotor ability relative to those of the sham-operated group. The results of the statistical analyses of the open field experiment and the baton twirling experiment demonstrated that the transplantation of the SKP-DA neurons eGFP via the nasal cavity could partially restore locomotor ability and reduce depression and anxiety in the experimental group of mice. Furthermore, the transplantation of SKP-DA neurons eGFP labelled neurites labeled with eGFP may attenuate disease progression in a PD model in mice. Discussion Our work demonstrated the potential of SKPs as a viable and noninvasive source for generating functional DA neurons, offering promising implications for regenerative therapies for PD. By employing a combination of small molecule compounds and protein inducers, we successfully directed SKPs toward differentiation into DA neurons, as confirmed by morphological, genetic, and protein expression analyses. Moreover, the integration of these cells into the host neural network and their ability to alleviate motor deficits in a PD model provide compelling evidence for their therapeutic utility. The progressive degeneration of DA neurons in the nigrostriatal region of the brain in PD patients results in a sustained reduction in dopamine levels in the striatum. This depletion causes an imbalance between the direct and indirect pathways within the basal ganglia, ultimately leading to motor dysfunction 22 , 23 . While interventions, including pharmacotherapy, genetic approaches, surgical procedures, and deep brain stimulation, exist to alleviate symptoms in patients, there remains no definitive cure for the disease at present 24 , 25 . Stem cell transplantation therapy represents a promising therapeutic strategy for PD, given the current state of affairs. Allogeneic DA precursors, including ESCs, iPSCs, and MSCs, exhibit significant therapeutic potential; however, their availability is limited by increased tumorigenic risk, ethical concerns, and immunological challenges 26 , 27 . Notably, increased cellular plasticity is correlated with increased stemness and an associated increase in tumorigenic risk 28 , 29 . It is essential to identify an optimal PD therapy for cell transplantation. Purified SKPs eGFP was isolated from the dermis of the dorsal skin of SD rats following the method established by Biernaskie and McKenzie in 2006 30 . SKPs are cells that originate from the neural crest and can be reliably propagated; SKPs are neural crest-derived cells characterized by stable progeny and limited differentiation potential. Compared with pluripotent stem cells, stem cells are classified as adult tissue stem cells, which present a reduced risk of tumorigenesis 31 – 33 . Moreover, SKPs are readily accessible, devoid of ethical concerns, and can be autologously transplanted without eliciting a host immune response 34 , 35 . They represent a significant source of stem cells and are anticipated to be leading candidates for clinical applications. The differentiation protocol used in the present work effectively induced SKPs to acquire DA neuron-specific phenotypes, including neuronal morphology and the expression of key markers such as TH and DAT. Prolonged induction time was positively correlated with increased expression of differentiation markers, suggesting that the protocol supports a robust and progressive maturation process. Concurrently, the reduction in the expression of neural stem cell-specific markers indicates a successful transition from a progenitor state to a specialized dopaminergic phenotype. This dual confirmation underscores the reliability and efficacy of the induction strategy employed. The present work presents a protocol for differentiating SKPs into functional DA neurons through the application of small molecule compounds and protein factors, including B-27, GlutaMAX, kenpaullone, forskolin, Y-27632, purmorphamine, FGF-8b, SHH, CHIR-99021, BDNF and GDNF. Differentiated SKPs display characteristic neuronal morphology along with a biochemical profile indicative of midbrain DA neurons 8 , 36 . Neuronal differentiation media utilize a specific combination of factors, such as SHH, FGF8b, CHIR-99021, GDNF, and BDNF, which are essential for neurogenesis and differentiation 37 . A variety of factors, including SHH and FGF8α, are essential for the specification of differentiated neuronal subtypes during embryonic brain development. FoxA2 and Lmxla/b, two key effectors downstream of the SHH signaling pathway, have demonstrated efficacy in converting differentiated neuronal cells into DA neurons and in sustaining phenotypic specification 38 . GDNF has target-derived neurotrophic factor effects, and its expression in the substantia nigra-striatal system is linked primarily to the biological functions of midbrain DA neurons. These functions include the promotion of proliferation and specification, neurite growth, synaptic and electrophysiological maturation, cytosolic amplification, the expression of phenotype-specific proteins, and the regulation of downstream effector genes 39 . The overexpression of the developmentally significant molecule GDNF in the host striatum alters the neural microenvironment, thereby promoting dopamine differentiation. It promotes axonal growth in pluripotent human fetal neural stem cells (hfNSCs) administered to the substantia nigra 40 . BDNF enhances cell survival, particularly in the developmental differentiation, growth, and regeneration of DA neurons, facilitating their maintenance and promotion 41 – 43 . SKPs exhibit various DA neuron-specific markers following differentiation induction, with FOXA2 being a transcription factor that initially emerges in the floor plate of the neural tube and subsequently shows widespread expression in the ventral midbrain. This finding indicates that differentiation involves the repression of neural stem cell gene expression alongside the activation of genes associated with neurons and DA neurons 38 . FOXA2 functions as a developmental factor and is crucial for the survival of adult DA neurons 44 . Its administration before the induction of DA neurons enhances TH expression. It combines with SHH and FGF-8b, which are critical for guiding DA neuron generation 44 . NR4A2 functions as a nuclear receptor and transcription factor, playing crucial roles in the differentiation, survival, and maintenance of DA neurons. It is important for regulating various genes essential for DA signaling 45 . Research has indicated that NR4A2 is a reliable marker for survival and differentiation into mature DA neurons following transplantation 46 . TH is the rate-limiting enzyme in converting tyrosine to dopamine, which is crucial for catecholamine synthesis. It significantly influences the physiology of dopamine neurons and represents the rate-limiting step in dopamine biosynthesis 47 . The dopamine transporter (DAT) is a membrane glycoprotein that facilitates the uptake of dopamine (DA). It is located on the presynaptic membrane of dopamine neurons. It functions to reabsorb dopamine released into the synaptic cleft back into the presynaptic membrane through active transport, thereby maintaining the normal physiological function of the synapse 48 . DA neuron-specific markers indicate the level of differentiation of SKPs at various time points. Recent studies indicate that the primary pathogenic mechanisms of PD include pathological aggregation of α-synuclein, mitochondrial dysfunction, lysosomal or vesicular transport impairment, oxidative stress, and neuroimmune-inflammatory responses. Pathological α-synuclein diminishes neuronal mitochondrial gene expression, decreases mitochondrial quantity, elevates oxidative stress, and significantly impairs mitochondrial adenosine triphosphate production. Additionally, it upregulates lysosomal gene expression and enhances lysosomal abundance, leading to the development of Lewy bodies 49 . MPTP exerts a toxic effect on DA neurons primarily by inhibiting mitochondrial complex I activity, leading to disrupted mitochondrial function and elevated oxidative stress 50 . The maintenance of the normal physiological function of organelles is crucial for cell survival 51 , 52 . The transplantation of the SKP-DA neurons eGFP into the striatum of MPTP-induced PD mice resulted in significant improvements in motor function, indicating successful integration and functional restoration. Importantly, the absence of tumor formation in the transplanted animals supports the safety profile of the SKP-DA neurons eGFP , addressing a critical concern in stem cell therapies. The observed differentiation, survival, and migration of the transplanted cells further validated their potential to replenish lost dopaminergic neurons and restore striatal function. The pathological manifestations in PD patients include the degeneration of DA neurons in the midbrain substantia nigra. This study examined whether stem cell transplantation can decelerate PD progression via intercellular communication and the supply of organelles, including mitochondria and lysosomes 53 , 54 . The discovery of TNTs between SKP-DA neurons eGFP and primary DA neurons highlights a novel mechanism for intercellular communication that may enhance the functional integration of transplanted cells. TNTs facilitate the bidirectional transfer of organelles, including mitochondria, lysosomes, and the Golgi apparatus, which are critical for cellular health and function. This exchange could support metabolic homeostasis, mitigate cellular stress, and promote the survival of both transplanted and host neurons. Our research revealed that after 6-OHDA stimulation, the number of TNTs between primary neurons and SKP-DA interneurons increased, but the length of the TNTs significantly decreased, which may improve the efficiency of intercellular substance transport by increasing the number of TNTs and shortening the length of the TNTs, thus increasing the resistance of the cells to harmful substances and increasing the cell survival rate. While the precise molecular mechanisms governing TNT formation and organelle transfer remain to be elucidated, these findings suggest that TNTs could play a pivotal role in the success of stem cell-based therapies by fostering functional connectivity within the host neural network. In the past, we thought that stem cell transplantation played a role of “cell replacement” in the treatment, but the discovery of TNTs between SKPs-DA neurons and primary neurons showed that the transplanted cells played a role in protecting neurons and slowing down apoptosis to a certain extent. Therefore, we propose a new paradigm of “cell replacement-neuroprotection bimodal therapy”, which breaks through the limitation of a single mechanism of traditional cell therapy. Further investigation is needed to determine whether the in vivo SKP-DA neurons eGFP can \"rescue\" primary DA neurons from apoptosis through TNTs, thereby slowing the progression of PD. The influence of environmental factors on the formation and transport of TNTs, their specific role in cell-to-cell communication, and their impact on the PD process remain ambiguous and require further investigation. The primary objective of inducing stem cells to differentiate into neurons is to address PD through cell transplantation. Given that the onset of PD typically occurs in individuals over 65 years of age 55 , 12-month-old C57BL/6 mice were utilized in the experiments to model disease onset more accurately. The inability of differentiated mature neurons to proliferate and regenerate highlights the importance of timing in cell transplantation 56 , 57 . The optimal stage for transplantation must effectively balance the survival and maturation capabilities of the cells involved. A greater degree of cell stemness correlates with increased graft survival rates, yet it diminishes the probability of differentiation into mature DA neurons. Conversely, as stem cells undergo in vitro differentiation, their fragility increases, resulting in reduced survival rates post-transplantation 58 . Consequently, we selected SKP-DA neurons eGFP with 5–7 days of differentiation for transplantation instead of fully differentiated mature DA neurons. There are various methods of stem cell transplantation, including brain stereotaxis and tail vein injection. Brain stereotaxis can damage brain tissue to a certain extent, which may be feasible in animal experiments, but its clinical application is extremely limited; however, the intravenous injection method involves only a very small number of cells that can cross the blood‒brain barrier, and the transplantation effect is not ideal. Currently, phase I clinical studies have reported that intranasal transplantation of neural stem cells can significantly improve clinical symptoms in Parkinson's patients, and safety testing has revealed no safety concerns 59 . We conducted intranasal transplantation of SKPs-DA neurons eGFP into the brains of PD model mice. Four weeks post-transplantation, we monitored the changes in the SKP-DA neurons eGFP and observed that these transplanted neurons could differentiate into a spectrum of DA neurons without tumour formation. PD model of transplanted skin-derived precursor dopamine neurons expressing enhanced green fluorescent protein (eGFP). Compared with those in the sham-operated group, the expression levels of TH and DAT in the SKP-DA neurons eGFP -treated group were significantly elevated. Compared with that in the sham-operated group, the expression of the glucose-regulated protein GRP78 was significantly lower. Cellular response and various life processes. Endoplasmic reticulum stress plays a crucial role in neurodegeneration, with MPTP significantly increasing GRP78 expression 60 . The repair of midbrain nigrostriatal DA neuronal damage in the experimental group of mice transplanted with SKPs-DA neurons eGFP was significantly greater than that in the nontransplanted group. Behavioural assessments further demonstrated that the transplantation of SKPs-DA neurons eGFP labelled with eGFP markedly enhanced locomotor activity and alleviated depression‒anxiety symptoms in a PD model in mice. Both molecular biological and behavioural assessments indicated that the SKP-DA neurons eGFP reduced the progression of PD following transplantation into the PD model. This study may offer insights into the application of SKPs-based eGFP transplantation therapy in regenerative medicine. Despite these promising outcomes, several limitations warrant further investigation. First, while the MPTP model provides insights into the therapeutic potential of the SKP-DA neurons eGFP , it does not fully replicate the progressive and multifactorial nature of human PD. Future studies should explore the efficacy of this approach in other preclinical models that better mimic the chronic and heterogeneous progression of the disease. Second, the molecular mechanisms underlying TNTs formation and their functional implications require in-depth analysis. Understanding the signaling pathways involved could enable the design of strategies to enhance TNTs formation and optimize therapeutic outcomes. Finally, the long-term safety and efficacy of SKP-DA neurons eGFP transplantation in vivo need to be evaluated through extended follow-up studies. Conclusions The present work advances the understanding of SKPs as scalable and minimally invasive sources for generating DA neurons. Compared with other stem cell sources, such as embryonic stem cells or induced pluripotent stem cells, SKPs offer practical advantages, including ethical acceptability, a reduced risk of immunogenicity, and ease of collection. Additionally, the demonstration of TNT-mediated interactions suggests new avenues for optimizing cell-based therapies by enhancing the functional integration of transplanted cells. In conclusion, this study underscores the potential of SKP-derived DA neurons as a novel therapeutic strategy for PD. By demonstrating efficient differentiation, TNT-mediated functional integration, and in vivo efficacy, we provide a strong foundation for advancing SKP-based regenerative approaches. Continued research into optimizing differentiation protocols, understanding intercellular communication, and assessing long-term outcomes will be essential to translate these findings into clinical applications. Methods Skin precursor cell extraction and culture The dermis of the rat's back skin was minced and digested in HBSS solution with 0.1% trypsin at 37°C for 1 hour. The dermis was centrifuged, washed, and ground multiple times before being placed in SKPs proliferation medium. This medium comprised 73.5% DMEM (Thermo Fisher Scientific, 11885076), 24.5% F-12 (Thermo Fisher Scientific, 11765054), 2% B-27 (Thermo Fisher Scientific, A1486701), 20 ng/ml EGF (PeproTech, AF-100-15), 40 ng/ml bFGF (PeproTech, AF-100-18C), 2 mmol/L GlutaMAX (Thermo Fisher Scientific, 35050061), and 1% penicillin/streptomycin (Thermo Fisher Scientific, 10378016). The mixture was incubated at 37°C with 5% CO2 for propagation. Skin precursor cells that were stably passaged were cultured for more than 21 days. Differentiation of skin precursor cells The protocol for differentiating skin precursor cells into functional DA neurons comprises two steps. Initially, skin precursor stem cells were digested, resuspended, and inoculated at a density of 1 × 10 4 cells/cm² onto PDL-coated Petri dishes or allowed to crawl. The medium was replaced with neuron induction medium, which was subsequently replaced with half of the new neuron induction medium every two days. The neuronal induction medium comprised a DMEM/F12 ratio of 3:1 basal medium supplemented with 2% B-27, 2 mmol/L GlutaMAX, 1% penicillin/streptomycin, 5 µmol/L kenpaullone (MedChem Express, HY-12302), 5 µmol/L forskolin (Selleck, S2449), 5 µmol/L Y-27632 (MedChem Express, HY-10071), and 2 µmol/L purmorphamine (MedChem Express, HY-15108), along with 100 ng/ml Murine Sonic Hedgehog (SHH, PeproTech, 315 − 22), 100 ng/ml fibroblast growth factor-8b (FGF-8b, MedChem Express, HY-P70533), and 20 ng/ml basic fibroblast growth factor (bFGF, MedChem Express, HY-P7091) for days 0–3. Additionally, 3 µmol/L CHIR-99021 (MedChem Express, HY-10182) was included for days 3–14, along with other small molecule compounds and growth factors. Following 6–8 days of chemical induction, the neuronal maturation medium consisted of 20 ng/ml brain-derived neurotrophic factor (BDNF, PeproTech, AF-450-02) and 20 ng/ml glial cell-derived neurotrophic factor (GDNF, PeproTech, AF-450-51). The culture was maintained for a duration of 7–14 days, with 50% of the neuronal maturation medium replaced with fresh medium bidaily. In the control group, skin precursor stem cells were cultured in DMEM/F12 (3:1) basal medium supplemented with 2% B-27, 2 mmol/L GlutaMAX, and 1% penicillin/streptomycin. Primary neuron culture Pregnant rats at 13.5 days of gestation were prepared. The meninges and vascular membranes of the fetal rats were removed, followed by the extraction of midbrain parts, which were enzymatically digested and centrifuged. The resulting primary cells were cultured in Neuron Complete Medium, which consisted of 97% Neural Basal Medium (Thermo Fisher Scientific, 21103049), 2% B-27, and 1% PS, with medium changes occurring every 2 days. The medium was changed every two and a half days. The cells were inoculated at a density of 1–1.5 × 10 5 /ml. After 5–6 days of culture, SKP-DA neurons were cocultured at a density of 5–10 × 10 4 /ml. The formation of and changes in TNTs between the cells were observed microscopically. Immunocytochemical analysis The induction system utilized immunofluorescence staining to identify cultured and differentiated skin precursor cells, as previously described. The cells were fixed with 4% PFA for 10 minutes at room temperature, followed by three washes with PBS. The samples were subsequently incubated in PBS containing 5% goat serum and 0.3% Triton X-100 for 60 minutes at room temperature. The cells were incubated overnight at 4°C with the following primary antibodies: rabbit anti-TUBB3 (Zenbio, R23620), rabbit anti-MAP2 (Proteintech, 67015-1-Ig), rabbit anti-SYN (Proteintech, 10842-1-AP), and mouse anti-NEUN (Abcam, Ab104224). The antibodies utilized included rabbit anti-TH (Abcam, Ab104224), rabbit anti-TH (Abcam, Ab137869), chicken anti-TH (Abcam, Ab76442), rabbit anti-GABA (Servicebio, GB114791), rabbit anti-vGlut1 (Servicebio, GB11821), goat anti-CHAT (Servicebio, GB11070), rabbit anti-DAT (Proteintech, 22524-1-AP), rabbit anti-NURR1 (Proteintech, 10975-2-AP), rabbit anti-PAX6 (Servicebio, GB11777), rabbit anti-SOX2 (Abcam, Ab92494), rabbit anti-NESTIN (Abcam, Ab105389), rabbit anti-FOX2 (CST, 8186), and mouse anti-GFAP (Servicebio, GB12100) antibodies. The following day, the cells were washed three times with PBS and incubated with the appropriate Alexa Fluor® 555 (Ab150114) or Alexa Fluor® 647 (Ab150175) secondary antibodies (sourced from Abcam) at a dilution of 1:1000–1:2000 for one hour at room temperature. The nuclei of the cells were subsequently restained with DAPI. Images were acquired with a Leica DMI8 (Thunder) inverted fluorescence microscope. Protein blot analysis The cells were lysed in RIPA buffer (Beyotime, P0013B) supplemented with a protease inhibitor mixture (Beyotime, ST506). Protein lysates were then loaded onto SDS‒PAGE gels (10% separating gels, Epizyme, PG112) and subsequently transferred to PVDF membranes (Millipore, ISS) following electrophoresis. The protein lysate was applied to the membrane (Millipore, ISEQ00010). The membrane was incubated with the primary antibody overnight at 4°C, followed by a 1-hour incubation with the HRP-conjugated secondary antibody at room temperature. Chemiluminescence was identified via the Immobilon Protein Immunoblotting Kit (New Cell & Molecular Biotech, p10200). Antibodies were utilized to stain specific proteins at the following dilutions: TH (1:1000, Abcam, ab137869), DAT (1:1000, Proteintech, 22524-1-AP), GRP78 (1:1000, Proteintech, 11587-1-AP), and GAPDH (1:1000, Proteintech, 60004-1-Ig). Horseradish peroxidase (HRP)-conjugated secondary antibodies (Abcam, ab6721 & ab6789) were diluted 1:5000. Real-time fluorescence quantitative PCR (RT‒PCR) RNA was extracted from neurons at various stages of skin precursor cell differentiation via an RNA extraction kit (Eisenbio). The isolated RNA was reverse transcribed with a PrimeScript RT kit containing gDNA remover (Novozymes, RR047A). The selected target genes included Nestin, SOX-2, GFAP, TUBB3, MAP2, TH, DAT, Foxa2, VMAT2, NR4A2, and GAPDH. Table 1 shows the sequences designed for the gene primers. The expression levels of the target genes were normalized to those of an internal control, GAPDH. Quantitative real-time PCR was conducted via a Q5 real-time fluorescent quantitative PCR system (Applied Biosystems) with SYBR Premix Ex Taq II (Novozymes). Table 1 Primer sequences used for qPCR: Gene Forward primer Reverse primer Product size (bp) Tm (°C) Nestin TGGAGCAGGAGAAGCAAGGTC CAAGGGGGAAGGGAAGGATGT 281 62 SOX-2 CGCCGAGTGGAAACTTTTGTC TCATGAGCGTCTTGGTTTTCC 134 61 GFAP CCACCAGTAACATGCAAGAAACA AGTTGGCGGCGATAGTCATTAG 130 61 TUBB3 CAACTATGTGGGGGACTCGG TGGCTCTGGGCACATACTTG 89 60 MAP2 TCAGGCTCCCAGTGCGTTTA GGAGGATGGAGGAAGGTCTTG 104 62 FOXA2 ACCACCCCTTCTCTATCAACAAC GTTCGTAGGTCTTGAGGTCCATTT 102 60 TH TCTGTGCGTCGGGTGTCTGA GAATTGGTTCACCGTGCTTGTA 220 64 VMAT2 TATGAATTTGTGGGGAAGACAGC TCAGCAAGGTCGTTAGAGGTGTC 142 62 NR4A2 CCTGGCTGTTGGGATGGTTA GGTCATTGCCGGATTGGAGT 172 61 GAPDH CTGGAGAAACCTGCCAAGTATG GGTGGAAGAATGGGAGTTGCT 138 60 Animal models and stem cell transplantation MPTP-induced subacute injury PD mouse model: Twelve-month-old C57BL/6J mice were housed under a 12-hour light/dark cycle with unrestricted access to food and water. A subacute injury animal model of PD was established through daily intraperitoneal injections of MPTP-HCl solution (MedChemExpress, HY-15608) at a dosage of 30 mg/kg for 7 days. Stem cell intranasal transplantation in mice: To investigate the neural differentiation of SKPs and their in vivo functions, we transplanted SKP-DA neurons into the brains of MPTP-induced subacute injury PD model C57L/B6 mice and control C57L/B6 mice, which were maintained under a 12-hour light/dark cycle with unrestricted access to food and water. SKPs-DA neurons that had undergone differentiation for 5–7 days were subjected to digestion, centrifugation, and resuspension. The resulting cells must fulfill the following criteria: cell viability after 48 hours must be at least 80%, and endotoxin levels should not exceed 0.5 EU/ml. Prior to stem cell transplantation, the nasal cavities of the mice were treated with 4 µl of 100 U/µl hyaluronidase (H3884; Sigma‒Aldrich) for 30 minutes to increase blood‒brain barrier permeability. Throughout the administration, the mice were maintained in a supine position, and a microsyringe was used to slowly inject the cell suspension into the nasal cavity. Each mouse in the experimental group received 20 µl (1 × 10 7 /ml, 10 µl per side) of the cell suspension in the nasal cavity. Each mouse in the sham-operated group was administered 20 µl of saline into the nasal cavity. All procedures were conducted in accordance with the guidelines set forth by the Ethics Committee for the Use of Laboratory Animals at Nantong University. The stem cell transplantation experiments were categorized into three groups: control, sham-operated, and experimental. The control group consisted of 12-month-old C57BL/6 mice that did not receive any treatment. The sham-operated group included 12-month-old C57BL/6 mice that underwent intranasal transplantation of phosphate buffer solution (PBS) following MPTP subacute modeling. The experimental group comprised 12-month-old C57BL/6 mice that received intranasal transplantation of SKPs-DA after MPTP subacute modeling of the neurons eGFP in 12-month-old C57BL/6 rats. Rotarod experiments Prior to the initiation of the formal experiments, the mice underwent training for a duration of 3–5 days, beginning with a constant speed of 16 rpm and subsequently transitioning to a uniformly accelerated movement reaching 44 rpm. Each group of mice underwent baton twirling experiments three times daily for a minimum of 15 minutes per session, after which formal experiments commenced following their adaptation to the activity. The mice underwent uniform acceleration, starting at 0.5 rpm and reaching 44 rpm over a duration of 5 minutes. During this period, the distance, time, and fall speed of the bats were recorded upon the descent of the mice. Open field experiment A controlled environment with standard lighting and minimal noise is maintained. The experimental device and software were installed. The open field consisted of a 50 × 50 × 25 cm square box with a white background. The animals were positioned with their backs to the experimenter in the central area of the open field, allowing them to move freely within the experimental box. The mouse movement trajectories were recorded for 10 minutes via EthoVision software from Noldus. The bottom of the open field measures 50 cm × 50 cm, whereas the center measures 30 cm × 30 cm. Upon completion of the experiment, the mice were returned to their cages, and the device was sanitized to eliminate any residual data pertaining to the experimental subjects. Statistical analysis The data were analyzed and plotted statistically via GraphPad Prism 9.5 software. The quantitative data in this experiment are expressed as the mean ± standard error of the mean (MEAN SEM). One-way ANOVA was used for initial comparisons, followed by Dunnett's or Tukey's multiple comparisons tests. Additionally, comparisons between multiple groups were conducted via two-way ANOVA, with subsequent analysis via Tukey's multiple comparisons test. A p -value < 0.05 was considered statistically significant. Declarations Competing interests The authors declare that they have no competing interests. Ethics approval and consent to participate All studies complied with all relevant animal use guidelines and ethical regulations. All animal use and study protocols were approved both by the Institutional Animal Care Committee and by the Administration Committee of Experimental Animals, Jiangsu Province, China, in accordance with the guidelines of the Institutional Animal Care and Use Committee, Nantong University, China (Inspection No: 20190225-004). Consent for publication Not applicable. Funding This work was graciously supported by the Natural Science Foundation of Nantong Municipality (JC2023113). Author Contribution M.H.C., C.B.X., and H.Z. conceived the research, supervised the project, and provided research directions. L.M., H.M.T. and Q.W.S. carried out SKPs culture and induced differentiation in vitro. L.M. and H.M.T. carried out the confocal microscopy of the immunocyte fluorescence staining cover slides. Y.W., T.Y.H., Y.L.P. and J.H.S. performed the image analysis. L.M., Y.W., and Q.W.S. performed the animal experiments. L.M. wrote the manuscript. M.H.C., C.B.X., and H.Z. revised the manuscript. All the authors reviewed the manuscript. Acknowledgments We would like to thank Dr. Duan Jiangtao of the Shanghai Institute of Organic Chemistry, Chinese Academy of Sciences, for his advice and help and Dr. Wang Tianyi of Nantong University for his experimental guidance. Availability of data and materials All the data supporting the findings of this study are available within the paper, and the raw and analyzed datasets generated during the study are available for research purposes from the corresponding authors upon reasonable request. References Bloem, B. R., Okun, M. S. & Klein, C. Parkinson's disease. Lancet (London, England) 397, 2284–2303, doi: 10.1016/s0140-6736(21)00218-x (2021). Qi, S. et al. Prevalence of Parkinson's Disease: A Community-Based Study in China. Movement disorders: official journal of the Movement Disorder Society 36, 2940–2944, doi: 10.1002/mds.28762 (2021). Leite Silva, A. B. R. et al. Premotor, nonmotor and motor symptoms of Parkinson's Disease: A new clinical state of the art. Ageing research reviews 84, 101834, doi: 10.1016/j.arr.2022.101834 (2023). Reich, M. M. et al. A brain network for deep brain stimulation induced cognitive decline in Parkinson's disease. Brain: a journal of neurology 145, 1410–1421, doi: 10.1093/brain/awac012 (2022). de Luzy, I. R., Lee, M. K., Mobley, W. C. & Studer, L. Lessons from inducible pluripotent stem cell models on neuronal senescence in aging and neurodegeneration. Nat Aging 4, 309–318, doi: 10.1038/s43587-024-00586-3 (2024). Jiang, H. et al. Cell cycle and p53 gate the direct conversion of human fibroblasts to dopaminergic neurons. Nature communications 6, 10100, doi: 10.1038/ncomms10100 (2015). Stathakos, P. et al. A monolayer hiPSC culture system for autophagy/mitophagy studies in human dopaminergic neurons. Autophagy 17, 855–871, doi: 10.1080/15548627.2020.1739441 (2021). Qin, H., Zhao, A.-D., Sun, M.-L., Ma, K. & Fu, X.-B. Direct conversion of human fibroblasts into dopaminergic neuron-like cells using small molecules and protein factors. Military Medical Research 7, 52, doi: 10.1186/s40779-020-00284-2 (2020). Cheng, X.-y. et al. Human iPSCs derived astrocytes rescue rotenone-induced mitochondrial dysfunction and dopaminergic neurodegeneration in vitro by donating functional mitochondria. Translational neurodegeneration 9 (2020). Mehrotra, P., Tseropoulos, G., Bronner, M. E. & Andreadis, S. T. Adult tissue-derived neural crest-like stem cells: Sources, regulatory networks, and translational potential. Stem cells translational medicine 9, 328–341, doi: 10.1002/sctm.19-0173 (2020). Toma, J. G. et al. Isolation of multipotent adult stem cells from the dermis of mammalian skin. Nat Cell Biol 3, 778–784, doi: 10.1038/ncb0901-778 (2001). Joannides, A. et al. Efficient generation of neural precursors from adult human skin: astrocytes promote neurogenesis from skin-derived stem cells. Lancet (London, England) 364, 172–178, doi: 10.1016/s0140-6736(04)16630-0 (2004). Weiss, D. et al. Subthalamic stimulation modulates cortical motor network activity and synchronization in Parkinson's disease. Brain: a journal of neurology 138, 679–693, doi: 10.1093/brain/awu380 (2015). Yao, S. et al. Mesenchymal stem cell attenuates spinal cord injury by inhibiting mitochondrial quality control-associated neuronal ferroptosis. Redox biology 67, 102871, doi: 10.1016/j.redox.2023.102871 (2023). Allegra, A. et al. Specialized Intercellular Communications via Tunnelling Nanotubes in Acute and Chronic Leukemia. Cancers 14, doi: 10.3390/cancers14030659 (2022). Sartori-Rupp, A. et al. Correlative cryo-electron microscopy reveals the structure of TNTs in neuronal cells. Nature communications 10, 342, doi: 10.1038/s41467-018-08178-7 (2019). Lin, R. Z. et al. Mitochondrial transfer mediates endothelial cell engraftment through mitophagy. Nature 629, 660–668, doi: 10.1038/s41586-024-07340-0 (2024). Barutta, F. et al. Protective effect of the tunneling nanotube-TNFAIP2/M-sec system on podocyte autophagy in diabetic nephropathy. Autophagy 19, 505–524, doi: 10.1080/15548627.2022.2080382 (2023). Jiang, D. et al. Bioenergetic Crosstalk between Mesenchymal Stem Cells and various Ocular Cells through the intercellular trafficking of Mitochondria. Theranostics 10, 7260–7272, doi: 10.7150/thno.46332 (2020). Bittins, M. & Wang, X. TNT-Induced Phagocytosis: Tunneling Nanotubes Mediate the Transfer of Pro-Phagocytic Signals From Apoptotic to Viable Cells. Journal of cellular physiology 232, 2271–2279, doi: 10.1002/jcp.25584 (2017). Biernaskie, J. A., McKenzie, I. A., Toma, J. G. & Miller, F. D. Isolation of skin-derived precursors (SKPs) and differentiation and enrichment of their Schwann cell progeny. Nat Protoc 1, 2803–2812, doi: 10.1038/nprot.2006.422 (2006). Vrijsen, S., Houdou, M., Cascalho, A., Eggermont, J. & Vangheluwe, P. Polyamines in Parkinson's Disease: Balancing Between Neurotoxicity and Neuroprotection. Annual review of biochemistry 92, 435–464, doi: 10.1146/annurev-biochem-071322-021330 (2023). Chu, Y. et al. Nigrostriatal tau pathology in parkinsonism and Parkinson's disease. Brain: a journal of neurology 147, 444–457, doi: 10.1093/brain/awad388 (2024). Vijiaratnam, N., Simuni, T., Bandmann, O., Morris, H. R. & Foltynie, T. Progress towards therapies for disease modification in Parkinson's disease. The Lancet. Neurology 20, 559–572, doi: 10.1016/s1474-4422(21)00061-2 (2021). Yin, Z. et al. Cortical phase-amplitude coupling is key to the occurrence and treatment of freezing of gait. Brain: a journal of neurology 145, 2407–2421, doi: 10.1093/brain/awac121 (2022). Calatroni, M., Moroni, G., Reggiani, F. & Ponticelli, C. Renal sarcoidosis. J Nephrol 36, 5–15, doi: 10.1007/s40620-022-01369-y (2023). Delacher, M. et al. Precursors for Nonlymphoid-Tissue Treg Cells Reside in Secondary Lymphoid Organs and Are Programmed by the Transcription Factor BATF. Immunity 52, 295–312 e211, doi: 10.1016/j.immuni.2019.12.002 (2020). Cederberg, D., Visse, E., Marklund, N. & Siesjo, P. Prolonged and intense neuroinflammation after severe traumatic brain injury assessed by cerebral microdialysis with 300 kDa membranes. J Neuroimmunol 377, 578020, doi: 10.1016/j.jneuroim.2023.578020 (2023). Xin, L. EZH2 accompanies prostate cancer progression. Nat Cell Biol 23, 934–936, doi: 10.1038/s41556-021-00744-4 (2021). Biernaskie, J. A., McKenzie, I. A., Toma, J. G. & Miller, F. D. Isolation of skin-derived precursors (SKPs) and differentiation and enrichment of their Schwann cell progeny. Nature Protocols 1, 2803–2812, doi: 10.1038/nprot.2006.422 (2006). Lai, S. et al. Direct reprogramming of induced neural progenitors: a new promising strategy for AD treatment. Translational neurodegeneration 4, 7, doi: 10.1186/s40035-015-0028-y (2015). Ge, W. et al. Murine skin-derived multipotent papillary dermal fibroblast progenitors show germline potential in vitro. Stem Cell Res Ther 14, 17, doi: 10.1186/s13287-023-03243-5 (2023). Mozafari, S. et al. Skin-derived neural precursors competitively generate functional myelin in adult demyelinated mice. The Journal of clinical investigation 125, 3642–3656, doi: 10.1172/jci80437 (2015). Liu, W.-X. et al. Melatonin promotes the proliferation of primordial germ cell-like cells derived from porcine skin-derived stem cells: A mechanistic analysis. Journal of pineal research 73, e12833, doi: 10.1111/jpi.12833 (2022). Yi, S. et al. Application of stem cells in peripheral nerve regeneration. Burns & trauma 8, tkaa002, doi: 10.1093/burnst/tkaa002 (2020). Zhao, A.-D., Qin, H., Sun, M.-L., Ma, K. & Fu, X.-B. Efficient and rapid conversion of human astrocytes and ALS mouse model spinal cord astrocytes into motor neuron-like cells by defined small molecules. Military Medical Research 7, 42, doi: 10.1186/s40779-020-00271-7 (2020). Kirkeby, A. et al. Generation of regionally specified neural progenitors and functional neurons from human embryonic stem cells under defined conditions. Cell Rep 1, 703–714, doi: 10.1016/j.celrep.2012.04.009 (2012). Kriks, S. et al. Dopamine neurons derived from human ES cells efficiently engraft in animal models of Parkinson's disease. Nature 480, 547–551, doi: 10.1038/nature10648 (2011). Baloh, R. H. et al. Transplantation of human neural progenitor cells secreting GDNF into the spinal cord of patients with ALS: a phase 1/2a trial. Nature medicine 28, 1813–1822, doi: 10.1038/s41591-022-01956-3 (2022). Wakeman, D. R. et al. Human neural stem cells survive long term in the midbrain of dopamine-depleted monkeys after GDNF overexpression and project neurites toward an appropriate target. Stem cells translational medicine 3, 692–701, doi: 10.5966/sctm.2013-0208 (2014). Ishii, T., Warabi, E. & Mann, G. E. Circadian control of BDNF-mediated Nrf2 activation in astrocytes protects dopaminergic neurons from ferroptosis. Free radical biology & medicine 133, 169–178, doi: 10.1016/j.freeradbiomed.2018.09.002 (2019). Douma, E. H. & de Kloet, E. R. Stress-induced plasticity and functioning of ventral tegmental dopamine neurons. Neuroscience and biobehavioral reviews 108, 48–77, doi: 10.1016/j.neubiorev.2019.10.015 (2020). Cavalleri, L. et al. Ketamine enhances structural plasticity in mouse mesencephalic and human iPSC-derived dopaminergic neurons via AMPAR-driven BDNF and mTOR signaling. Molecular psychiatry 23, 812–823, doi: 10.1038/mp.2017.241 (2018). Arenas, E. Foxa2: the rise and fall of dopamine neurons. Cell stem cell 2, 110–112, doi: 10.1016/j.stem.2008.01.012 (2008). Jakaria, M. et al. Molecular Insights into NR4A2(Nurr1): an Emerging Target for Neuroprotective Therapy Against Neuroinflammation and Neuronal Cell Death. Molecular neurobiology 56, 5799–5814, doi: 10.1007/s12035-019-1487-4 (2019). Alavian, K. N. et al. The lifelong maintenance of mesencephalic dopaminergic neurons by Nurr1 and engrailed. Journal of biomedical science 21, 27, doi: 10.1186/1423-0127-21-27 (2014). Garritsen, O., van Battum, E. Y., Grossouw, L. M. & Pasterkamp, R. J. Development, wiring and function of dopamine neuron subtypes. Nature reviews. Neuroscience 24, 134–152, doi: 10.1038/s41583-022-00669-3 (2023). Afonso-Oramas, D. et al. Dopamine transporter glycosylation correlates with the vulnerability of midbrain dopaminergic cells in Parkinson's disease. Neurobiology of disease 36, 494–508, doi: 10.1016/j.nbd.2009.09.002 (2009). Geibl, F. F. et al. α-Synuclein pathology disrupts mitochondrial function in dopaminergic and cholinergic neurons at-risk in Parkinson's disease. Molecular neurodegeneration 19, 69, doi: 10.1186/s13024-024-00756-2 (2024). Han, X. et al. Neuronal SH2B1 attenuates apoptosis in an MPTP mouse model of Parkinson's disease via promoting PLIN4 degradation. Redox Biol 52, 102308, doi: 10.1016/j.redox.2022.102308 (2022). Ye, H., Robak, L. A., Yu, M., Cykowski, M. & Shulman, J. M. Genetics and Pathogenesis of Parkinson's Syndrome. Annual review of pathology 18, 95–121, doi: 10.1146/annurev-pathmechdis-031521-034145 (2023). Kalyanaraman, B., Cheng, G. & Hardy, M. Gut microbiome, short-chain fatty acids, alpha-synuclein, neuroinflammation, and ROS/RNS: Relevance to Parkinson's disease and therapeutic implications. Redox Biol 71, 103092, doi: 10.1016/j.redox.2024.103092 (2024). Scheiblich, H. et al. Microglia rescue neurons from aggregate-induced neuronal dysfunction and death through tunneling nanotubes. Neuron 112, 3106–3125.e3108, doi: 10.1016/j.neuron.2024.06.029 (2024). Chakraborty, R., Nonaka, T., Hasegawa, M. & Zurzolo, C. Tunnelling nanotubes between neuronal and microglial cells allow bi-directional transfer of α-Synuclein and mitochondria. Cell Death Dis 14, 329, doi: 10.1038/s41419-023-05835-8 (2023). Ben-Shlomo, Y. et al. The epidemiology of Parkinson's disease. Lancet 403, 283–292, doi: 10.1016/S0140-6736(23)01419-8 (2024). Molecular Cell editorial, t. Models that matter. Mol Cell 83, 315–316, doi: 10.1016/j.molcel.2023.01.001 (2023). Verpoorte-Botden, I. P. G., Minnema, M. C. & Raymakers, R. A. P. EBV-related lymphoma after long-term daratumumab treatment: a case report. Blood Cancer J 10, 113, doi: 10.1038/s41408-020-00379-y (2020). Skidmore, S. & Barker, R. A. Challenges in the clinical advancement of cell therapies for Parkinson's disease. Nature biomedical engineering 7, 370–386, doi: 10.1038/s41551-022-00987-y (2023). Jiang, S. et al. Phase 1 study of safety and preliminary efficacy of intranasal transplantation of human neural stem cells (ANGE-S003) in Parkinson's disease. Journal of neurology, neurosurgery, and psychiatry 95, 1102–1111, doi: 10.1136/jnnp-2023-332921 (2024). Liu, N. et al. TRPV4 contributes to ER stress and inflammation: implications for Parkinson's disease. Journal of neuroinflammation 19, 26, doi: 10.1186/s12974-022-02382-5 (2022). Additional Declarations No competing interests reported. Supplementary Files GraphicalAbstract.jpg Graphical Abstract Schematic illustration of the workflow in the present work. SKPs extracted from the back dermis of rats were induced to differentiate into SKP-DA neurons via small molecule compounds and protein factors: B-27, GlutaMAX, kenpaullone, forskolin, Y-27632, purmorphamine, SHH, FGF-8b, bFGF (0–3 days), CHIR-99021 (4–14 days), BDNF and GDNF (7–14 days) were induced, and the cells were differentiated into SKP-DA neurons. In vitro, TNTs, an intercellular communication structure, were observed by coculturing SKP-DA neurons with primary neurons; in vivo, SKP-DA neurons were transplanted into the brains of Parkinson's disease model mice and analyzed via behavioral analysis and histomorphological evaluation to detect the recovery of nigrostriatal DA neurons and the survival of SKP-DA neurons in Parkinson's disease model mice. Experiment6710s.avi Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6363439\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":446923064,\"identity\":\"968f5231-2411-45e9-a82c-0db978631438\",\"order_by\":0,\"name\":\"Li Mu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Affiliated Hospital of Nantong University, Nantong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Li\",\"middleName\":\"\",\"lastName\":\"Mu\",\"suffix\":\"\"},{\"id\":446923065,\"identity\":\"2d7816dd-6351-4498-926f-c784500990b9\",\"order_by\":1,\"name\":\"Huimin Tao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Affiliated Hospital of Nantong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Huimin\",\"middleName\":\"\",\"lastName\":\"Tao\",\"suffix\":\"\"},{\"id\":446923066,\"identity\":\"01acde07-0b4b-4e6a-8292-2f508fed532e\",\"order_by\":2,\"name\":\"Ying Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Affiliated Hospital of Nantong University, Nantong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ying\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":446923067,\"identity\":\"85cf860d-42c6-4611-ab8d-86d1c1992686\",\"order_by\":3,\"name\":\"Qiuwen Sun\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Affiliated Hospital of Nantong University, Nantong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Qiuwen\",\"middleName\":\"\",\"lastName\":\"Sun\",\"suffix\":\"\"},{\"id\":446923068,\"identity\":\"bbecbb9e-d47a-4d88-94b0-f7553e8930db\",\"order_by\":4,\"name\":\"Tianyi Huang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Medical School of Nantong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tianyi\",\"middleName\":\"\",\"lastName\":\"Huang\",\"suffix\":\"\"},{\"id\":446923069,\"identity\":\"d50b9b12-5115-4a03-befc-8470824b65bf\",\"order_by\":5,\"name\":\"Yulin Pan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Medical School of Nantong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yulin\",\"middleName\":\"\",\"lastName\":\"Pan\",\"suffix\":\"\"},{\"id\":446923070,\"identity\":\"b73bb031-9edb-4bd3-a13f-1503447c005f\",\"order_by\":6,\"name\":\"Jiahui Song\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Affiliated Hospital of Nantong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jiahui\",\"middleName\":\"\",\"lastName\":\"Song\",\"suffix\":\"\"},{\"id\":446923071,\"identity\":\"53ef52c3-a13f-4b86-b59c-580d5bd42315\",\"order_by\":7,\"name\":\"Feng Han\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Medical School of Nantong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Feng\",\"middleName\":\"\",\"lastName\":\"Han\",\"suffix\":\"\"},{\"id\":446923072,\"identity\":\"7d3639b7-276f-414a-aa89-6c8199baf46a\",\"order_by\":8,\"name\":\"Hui Zhu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Affiliated Hospital of Nantong University, Nantong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hui\",\"middleName\":\"\",\"lastName\":\"Zhu\",\"suffix\":\"\"},{\"id\":446923073,\"identity\":\"a58e1942-25aa-4f89-8f79-75580eae9535\",\"order_by\":9,\"name\":\"Chengbin Xue\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Affiliated Hospital of Nantong University, Nantong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Chengbin\",\"middleName\":\"\",\"lastName\":\"Xue\",\"suffix\":\"\"},{\"id\":446923074,\"identity\":\"f229ff45-4e37-475b-abd8-ddef2afdf70e\",\"order_by\":10,\"name\":\"Maohong Cao\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtUlEQVRIiWNgGAWjYFACHgjFz8DYQJoWCckGkrUYHCBWA/+0swcfF/y6U2d8/nDbgx8MdnK6hCyTuJ2XbDyz75mE2Y3EdsMehmRjM0LWGUjnmEnz9hwGamFsk+BhOJC4jWgtxv0H2yT/EK2F58dhCQOGxDZpomyRuJ1jbMzbcFhyxg2gFhkDIvzCPzvH8DHPn8P8/P3Hn0m+qbCTI6gFDBjb4O4kRjkY/CFa5SgYBaNgFIxEAADhDz5Si8z4ZAAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"Affiliated Hospital of Nantong University, Nantong University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Maohong\",\"middleName\":\"\",\"lastName\":\"Cao\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-04-02 17:38:17\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6363439/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6363439/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":81376909,\"identity\":\"5c24613e-57ff-44e6-b51f-9a3fc87b1df6\",\"added_by\":\"auto\",\"created_at\":\"2025-04-25 11:48:22\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":3065218,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eWith the action of small-molecule compounds and protein factors, SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e induces differentiation into neurons.\\u003cstrong\\u003e a\\u003c/strong\\u003e Schematic representation of SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e-induced differentiation into dopaminergic neurons. \\u003cstrong\\u003eb\\u003c/strong\\u003e SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e cells expressed neural stem cell markers, including Nestin and SOX2. \\u003cstrong\\u003ec\\u003c/strong\\u003e Differential interference phase contrast microscopy revealed morphological alterations in SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e over the duration of induced differentiation. Scale bars = 50 μm.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6363439/v1/ce6b15d1ddca6958358b50de.jpg\"},{\"id\":81376919,\"identity\":\"aeb13605-dfdb-4631-8828-f48899dec259\",\"added_by\":\"auto\",\"created_at\":\"2025-04-25 11:48:22\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":3984532,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSKPs\\u003csup\\u003eeGFP \\u003c/sup\\u003eexhibits neuronal differentiation with prolonged differentiation time. The stemness properties of SKPs\\u003csup\\u003eeGFP \\u003c/sup\\u003ecells initially increased but then decreased after differentiation was induced. \\u003cstrong\\u003ea-b\\u003c/strong\\u003e Variations in the expression of the neural stem cell markers NESTIN, SOX2, PAX6, and GFAP in SKPs\\u003csup\\u003eeGFP \\u003c/sup\\u003ecells during the first four days of induced differentiation.\\u003cstrong\\u003e c-d\\u003c/strong\\u003e SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e gradually increased the expression of neuronal cell markers, including SYN, TUBB3, and MAP2. Scale bars = 50 μm, bar data represent the mean ± SEM, dots represent data points, ****\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.0001, ***\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.001, **\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01, *\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, ns: not significant (\\u003cem\\u003ep\\u003c/em\\u003e \\u0026gt; 0.05).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig2.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6363439/v1/e5c9913404c99c304e9294cb.jpg\"},{\"id\":81376904,\"identity\":\"affdda9d-5a30-4809-a71e-abaded3addee\",\"added_by\":\"auto\",\"created_at\":\"2025-04-25 11:48:21\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":5055030,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eDifferentiation of SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e into DA neurons. \\u003cstrong\\u003ea\\u003c/strong\\u003e SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e gradually increased the expression of DA neuronal markers, including NR4A2, TH, and DAT. \\u003cstrong\\u003eb-c\\u003c/strong\\u003e After approximately 14 days of differentiation, SKPs expressed TUBB3 and TH. \\u003cstrong\\u003ed\\u003c/strong\\u003e After 14 days of differentiation induction culture, TUBB3- and TH-positive cells accounted for the percentage of total cells. \\u003cstrong\\u003ee\\u003c/strong\\u003e SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e differentiated for 14 days did not express the GABA neuron marker γ-aminobutyric acid (GABA), the glutamatergic neuron marker vesicular glutamate transporter protein 1 (vGlut1), or the cholinergic neuron marker choline acetyltransferase (CHAT). \\u003cstrong\\u003ef-h\\u003c/strong\\u003e The mRNA expression levels of genes associated with neural stem cells, neurons, and DA neurons were analyzed at various time points during induced differentiation. Scale bars = 50 μm, bar data represent the mean ± SEM, dots represent data points, ****\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.0001, ***\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.001, **\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01, *\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, ns: not significant (\\u003cem\\u003ep\\u003c/em\\u003e \\u0026gt; 0.05).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig3.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6363439/v1/c56c1012bae1ac72c9d011a6.jpg\"},{\"id\":81376911,\"identity\":\"fd82511c-af20-4ccc-8a38-ac2edad4e8a0\",\"added_by\":\"auto\",\"created_at\":\"2025-04-25 11:48:22\",\"extension\":\"jpg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":4909824,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e differentiated into dopaminergic neurons. \\u003cstrong\\u003ea-e\\u003c/strong\\u003e Morphological features and the expression of the neuron-specific markers TUBB3, MAP2, and NEUN; the presynaptic marker SYN; and the dopaminergic neuron-specific markers NR4A2, TH, and DAT were analyzed following SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e-induced differentiation over a period of 14 days. Scale bars = 50 μm.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig4.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6363439/v1/5ac9297b669659a11a924266.jpg\"},{\"id\":81377652,\"identity\":\"3816eebf-67f3-44c3-81f6-5f4939c00771\",\"added_by\":\"auto\",\"created_at\":\"2025-04-25 11:56:21\",\"extension\":\"jpg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":3734873,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e undergo intercellular substance transport via TNTs. Functional assessment of the SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e following transplantation into the brains of PD model mice.\\u003cstrong\\u003e \\u003c/strong\\u003eThe presence of TNTs structures between SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e and primary neurons. \\u003cstrong\\u003ea\\u003c/strong\\u003e Following the fluorescent labeling of organelles, including mitochondria, lysosomes, and the Golgi apparatus in primary neurons, SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e were cocultured with these neurons. This results in the formation of intercellular structures known as TNTs, which facilitate the transport of organelles. \\u003cstrong\\u003eb\\u003c/strong\\u003e The mitochondria, lysosomes, and Golgi apparatus in SKPs-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e, which were fluorescently labeled, were cocultured with primary neurons generated with 6-OHDA. These primary neurons also form TNTs structures between cells and facilitate the transport of organelles via TNTs. \\u003cstrong\\u003ec‒d \\u003c/strong\\u003eThe number and length of TNTs in primary neurons and SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e stimulated with 6-OHDA were compared with those in the normal group. The white arrows indicate organelles such as mitochondria, lysosomes and the Golgi apparatus, and the black arrows indicate TNTs. Scale bars = 50 μm.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig5.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6363439/v1/80e2c81079668a489ed2c89e.jpg\"},{\"id\":81377663,\"identity\":\"dd42e793-03cd-43c9-8d87-f8807e3e7325\",\"added_by\":\"auto\",\"created_at\":\"2025-04-25 11:56:22\",\"extension\":\"jpg\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":6683562,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSKPs-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e were transplanted into the brains of PD model rats. \\u003cstrong\\u003ea-c\\u003c/strong\\u003e Panels b-d show the expression of TH in the substantia nigra midbrains of control, sham-operated, and model C57BL/6 rats, respectively. (Scale bars = 500 μm \\u0026amp; 50 μm) \\u003cstrong\\u003ed-f\\u003c/strong\\u003e Immunofluorescence semi-quantitative analysis of DA neurons in the substantia nigra of the control, sham-operated, and experimental groups.\\u003cstrong\\u003e g\\u003c/strong\\u003e Dopaminergic neuron expression in the substantia nigra of midbrain PD model rats was assessed 4 weeks post-transplantation of SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e (Scale bars = 50 μm). \\u003cstrong\\u003eh\\u003c/strong\\u003e Western blot analysis of TH, DAT, and GRP78 expression in the substantia nigra across the control, sham-operated, and experimental groups. \\u003cstrong\\u003ei-k \\u003c/strong\\u003eWestern blot semi-quantitative analysis of TH, DAT, and GRP78 expression in the substantia nigra of the control, sham-operated, and experimental groups. Bar data show mean ± SEM, Dots represent data points. ****\\u003cem\\u003ep \\u003c/em\\u003e\\u0026lt; 0.0001, ***\\u003cem\\u003e p\\u003c/em\\u003e \\u0026lt; 0.001, **\\u003cem\\u003e p\\u003c/em\\u003e \\u0026lt; 0.01, *\\u003cem\\u003e p\\u003c/em\\u003e \\u0026lt; 0.05, ns: not significant (\\u003cem\\u003ep\\u003c/em\\u003e \\u0026gt;0.05).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig6.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6363439/v1/b4dc81e969966b9a881c7c63.jpg\"},{\"id\":81377655,\"identity\":\"e7319ac0-7ff9-4dc8-8d0e-0666933aa159\",\"added_by\":\"auto\",\"created_at\":\"2025-04-25 11:56:22\",\"extension\":\"jpg\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":3487522,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eBehavioral alterations following the transplantation of the SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e into a PD model in mice. \\u003cstrong\\u003ea\\u003c/strong\\u003e Roadmap detailing control, sham-operated, and experimental mice in the open-field experiment conducted before and four weeks post-transplantation of the SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e. \\u003cstrong\\u003eb\\u003c/strong\\u003e Heatmap representing the results of the open-field experiment. \\u003cstrong\\u003ec-h\\u003c/strong\\u003e Statistical comparison of the frequency of central region exploration, duration of central region exploration, total distance traveled, body time, cumulative time of body curling, and percentage of body curling among the control, sham-operated, and experimental groups of mice in the open-field experiment, which was conducted before and four weeks after transplantation. \\u003cstrong\\u003ei‒k\\u003c/strong\\u003e Statistical comparisons of baton fall time, baton fall speed, and total baton distance traveled were conducted in the baton twirling experiment across the control, sham-operated, and experimental groups of mice both before and four weeks after transplantation. Bar data show mean ± SEM. Dots represent data points. ****\\u003cem\\u003ep \\u003c/em\\u003e\\u0026lt; 0.0001; ***\\u003cem\\u003e p\\u003c/em\\u003e \\u0026lt; 0.001, **\\u003cem\\u003e p\\u003c/em\\u003e \\u0026lt; 0.01, *\\u003cem\\u003e p\\u003c/em\\u003e \\u0026lt; 0.05, ns:not significant (\\u003cem\\u003ep\\u003c/em\\u003e \\u0026gt; 0.05).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig7.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6363439/v1/8c8da5404dc37c1ace273ee9.jpg\"},{\"id\":89586465,\"identity\":\"2430f5c7-9639-48d7-a23c-adc80c622661\",\"added_by\":\"auto\",\"created_at\":\"2025-08-21 15:17:12\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":32002435,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6363439/v1/847ebc97-44c0-4076-8e90-d5de288f1cb1.pdf\"},{\"id\":81378082,\"identity\":\"aa153d3a-8494-4dbc-95b6-916074366978\",\"added_by\":\"auto\",\"created_at\":\"2025-04-25 12:04:21\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":1943740,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eGraphical Abstract\\u003c/p\\u003e\\n\\u003cp\\u003eSchematic illustration of the workflow in the present work. SKPs extracted from the back dermis of rats were induced to differentiate into SKP-DA neurons via small molecule compounds and protein factors: B-27, GlutaMAX, kenpaullone, forskolin, Y-27632, purmorphamine, SHH, FGF-8b, bFGF (0–3 days), CHIR-99021 (4–14 days), BDNF and GDNF (7–14 days) were induced, and the cells were differentiated into SKP-DA neurons. In vitro, TNTs, an intercellular communication structure, were observed by coculturing SKP-DA neurons with primary neurons; in vivo, SKP-DA neurons were transplanted into the brains of Parkinson's disease model mice and analyzed via behavioral analysis and histomorphological evaluation to detect the recovery of nigrostriatal DA neurons and the survival of SKP-DA neurons in Parkinson's disease model mice.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"GraphicalAbstract.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6363439/v1/b5ab6d030cb7ecd2035063fc.jpg\"},{\"id\":81377658,\"identity\":\"85f5ffec-d515-49cc-8b47-c1ccec86b1c6\",\"added_by\":\"auto\",\"created_at\":\"2025-04-25 11:56:22\",\"extension\":\"avi\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":8273408,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Experiment6710s.avi\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6363439/v1/1f87a1e3cd539364e3da0d8a.avi\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Skin-Derived Precursor Cell-Differentiated Dopaminergic Neurons Promote Functional Recovery in Parkinson’s Disease via Tunneling Nanotube-Mediated Intercellular Communication\",\"fulltext\":[{\"header\":\"Highlights\",\"content\":\"\\u003cp\\u003e\\u0026bull; Utilized skin-derived precursor cells (SKPs) to generate functional dopaminergic (DA) neurons for Parkinson's disease (PD) treatment.\\u003c/p\\u003e\\u003cp\\u003e\\u0026bull; A specific culture medium with small molecule drugs and proteins to induce differentiation of SKPs into DA neurons.\\u003c/p\\u003e\\u003cp\\u003e\\u0026bull; SKP-DA neurons displayed typical morphological features and expression of markers specific to DA neurons, indicating successful differentiation.\\u003c/p\\u003e\\u003cp\\u003e\\u0026bull; A direct co-culture model showing inter-cellular tunneling nanotubes conducive to organelle transfer between SKP-DA neurons and primary culture of DA neurons.\\u003c/p\\u003e\\u003cp\\u003e\\u0026bull; Intranasal administration of SKP-DA neurons into an MPTP-induced PD model significantly improved striatal functional deficits.\\u003c/p\\u003e\"},{\"header\":\"Background\",\"content\":\"\\u003cp\\u003eParkinson\\u0026rsquo;s disease (PD) is a progressive neurodegenerative disorder characterized by the selective degeneration of dopaminergic (DA) neurons within the substantia nigra pars compacta, leading to profound dopamine deficiency in the striatum \\u003csup\\u003e\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u003c/sup\\u003e. This disruption \\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eunderpins\\u003c/span\\u003e the hallmark motor symptoms of PD, including tremors, rigidity, bradykinesia, and postural instability \\u003csup\\u003e\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e\\u003c/sup\\u003e. While current therapeutic approaches, such as dopamine replacement therapy and deep brain stimulation, alleviate symptoms temporarily, they fail to halt the progression of neuronal degeneration or restore lost neuronal populations\\u003csup\\u003e\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e\\u003c/sup\\u003e. These findings underscore the urgent need for innovative regenerative strategies capable of addressing the underlying pathophysiology of PD.\\u003c/p\\u003e \\u003cp\\u003eStem cell-based therapies have emerged as promising avenues for regenerative medicine, with the potential to replace lost neurons and restore dopaminergic function. Recent studies have demonstrated that stem cells can be induced to develop into DA neurons via small chemical compounds and protein factors \\u003csup\\u003e\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e\\u003c/sup\\u003e. Furthermore, it has been shown that transplanted DA neurons can survive, integrate, and release dopamine into the host striatum. The transplantation of stem cell-derived DA neurons replaced a significant quantity of apoptotic DA neurons. It largely rehabilitates the compromised substantia nigra-striatal pathway \\u003csup\\u003e\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e\\u003c/sup\\u003e. The transplanted PD model animals exhibited notable pathological and behavioral enhancements \\u003csup\\u003e\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e\\u003c/sup\\u003e, indicating that stem cell-induced differentiation of DA neurons successfully mitigated PD symptoms.\\u003c/p\\u003e \\u003cp\\u003eAmong the various stem cell sources investigated, skin-derived precursor cells (SKPs) present unique advantages because of their accessibility, minimal collection invasiveness, and multipotent differentiation capacity. SKPs, derived from neural crest progenitors, can differentiate into neural and nonneural cell lineages under specific inductive conditions \\u003csup\\u003e\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e\\u003c/sup\\u003e. However, efficient and reproducible protocols for differentiating SKPs into functional DA neurons, along with the integration of these cells into host neural networks, remain critical challenges. Their readily accessible tissue source and absence of ethical controversy position them as vital resources in neurodegenerative therapy \\u003csup\\u003e\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e\\u003c/sup\\u003e. The demise of nigrostriatal dopamine neurons in PD patients results in a persistent reduction in dopamine in the striatum, ultimately causing an imbalance between the direct and indirect routes within the basal ganglia and resulting in motor dysfunction \\u003csup\\u003e\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u003c/sup\\u003e. Consequently, the induced differentiation of SKPs into dopamine-secreting neurons and their transplantation into PD models is anticipated to be crucial for decelerating the progression of PD.\\u003c/p\\u003e \\u003cp\\u003eThe success of cell-based therapies in PD also depends on fostering a supportive microenvironment that promotes graft survival, integration, and functionality. Recent research highlights the importance of intercellular communication in enhancing the survival and functionality of transplanted cells\\u003csup\\u003e\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u003c/sup\\u003e. Intercellular communication is crucial for organism development and differentiation, the execution of organizational tasks, and the synchronization of various physiological roles \\u003csup\\u003e\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e\\u003c/sup\\u003e. Tunnelling nanotubes (TNTs) are tubular membrane structures characterized by a high F-actin content and a diameter of several hundred nanometers\\u003csup\\u003e\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e\\u003c/sup\\u003e. They are thin cytoplasmic channels that facilitate the direct intercellular exchange of organelles, ions, and biomolecules and have garnered attention as potential mediators of such interactions\\u003csup\\u003e\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e\\u003c/sup\\u003e. TNTs may enhance the integration and functional coupling of transplanted cells with endogenous neuronal populations, thereby improving therapeutic outcomes \\u003csup\\u003e\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eThey serve as direct connections between cells, facilitating the transport of various cytoplasmic contents, including mitochondria, lysosomes, vesicles, mRNAs, plasma membrane proteins, lipids, ions, and metabolites \\u003csup\\u003e\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e\\u003c/sup\\u003e. Direct cell contact results in significantly greater transfer efficiency than traditional transfer modes, such as endocrine and paracrine mechanisms, which rely on secretion-mediated transfer \\u003csup\\u003e\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e\\u003c/sup\\u003e. TNTs are essential for communication among cells and their microenvironments. The role of TNTs in the interaction between transplanted stem cells and neurons requires further investigation.\\u003c/p\\u003e \\u003cp\\u003eIn the present work, we developed a differentiation protocol for generating dopaminergic neurons from SKPs via a combination of small molecules and protein-based inducers. The morphological, genetic, and protein expression profiles of the generated SKP-induced differentiated dopaminergic neurons (SKP-DA neurons) were evaluated to confirm their functional identity as DA neurons. Furthermore, we investigated their interaction with primary DA neurons in a coculture system, focusing on TNTs formation, the bidirectional transfer of organelles, and changes in the number and length of TNTs before and after drug stimulation. Finally, we assessed the therapeutic potential of SKP-DA neurons in an MPTP-induced mouse model of PD, examining their survival, differentiation, migration, and ability to ameliorate striatal functional deficits. Intercellular material transfer between SKP-DA neurons and primary neurons through TNTs facilitates the transport of organelles, including mitochondria and lysosomes, potentially increasing resistance to harmful substances and improving cell survival rates. SKPs are more accessible, safer, and more reliable than other cell types. They are more straightforward and easier to manage, lowering overall costs and facilitating the utilization of SKP-DA neurons for PD treatment.\\u003c/p\\u003e \\u003cp\\u003eThis work aims to elucidate the potential of SKPs as renewable and noninvasive sources for generating functional DA neurons. By integrating findings on differentiation efficiency, intercellular interactions, and \\u003cem\\u003ein vivo\\u003c/em\\u003e efficacy, this study provides critical insights into the development of novel regenerative therapies for PD.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e \\u003cb\\u003eCharacterization of the changes in SKPs\\u003c/b\\u003e \\u003csup\\u003e \\u003cb\\u003eeGFP\\u003c/b\\u003e \\u003c/sup\\u003e \\u003cb\\u003efollowing induced differentiation\\u003c/b\\u003e \\u003cb\\u003ein vitro\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eThe isolation and purification of SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e from the dermis of the dorsal skin of enhanced green fluorescent protein transgenic newborn SD rats followed the method established by Biernaskie and McKenzie in 2006 \\u003csup\\u003e21\\u003c/sup\\u003e. They were induced to differentiate into the DA neuron GFP via a combination of small molecule compounds and protein factors, followed by transplantation into the brains of PD model mice to assess the effects of transplantation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea). SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e exhibited cell sphere morphology when observed via differential interference contrast microscopy, with nearly all cells expressing SRY-Box Transcription Factor 2 (SOX2), Nestin, and other markers specific to neural stem cells following purification (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eb).\\u003c/p\\u003e \\u003cp\\u003eDuring 1\\u0026ndash;2 days of induced differentiation, the morphology of SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e changed from round to fusiform or prismatic. The cell cytosol decreased in size and became more compact, with an increased refractive index and stereoscopic perception. Additionally, neural protrusions gradually emerged, and synapses exhibited a multipolar morphology. SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e exhibited a loss of original morphological characteristics, adopting a typical neuronal morphology, whereas the control group did not display similar morphological changes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ec).\\u003c/p\\u003e \\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e exhibits potential for neuronal differentiation\\u003c/h2\\u003e \\u003cp\\u003eSKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e cells were cultured with neuronal induction medium for approximately one day, resulting in greater than 90% expression of neural stem cell markers, including SOX2, NESTIN, Paired Box 6 (PAX6), and the astrocyte marker Glial fibrillary acidic protein (GFAP). After two days, the expression levels of the neural stem cell markers SOX2, NESTIN, and PAX6 significantly decreased. By the fourth day, the expression of these markers had decreased by 60%-70%, whereas the expression of the astrocyte marker GFAP had decreased by approximately 25% (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ea). SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e initiated the expression of the panneuronal marker Tubulin Class III β-tubulin (TUBB3), the mature neuronal marker microtubule-associated protein-2 (MAP2), and the presynaptic marker Synuclein (SYN) following 2 days of culture in the neuronal induction medium, with a significant increase in expression observed after 4\\u0026ndash;14 days (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eb).\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eSKPs has the potential to differentiate into DA neurons\\u003c/h3\\u003e\\n\\u003cp\\u003eThe markers specific to DA neurons, including tyrosine hydroxylase (TH), dopamine transporter protein (DAT), and nuclear receptor subfamily 4, group A, member 2 (NR4A2), were expressed starting from day 2 and showed a progressive increase, with a significant elevation in expression observed around day 7. The synapses of neurons continue to develop throughout the culture process, with DA neurons undergoing further differentiation and maturation after an additional seven days or more of culture (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea). On approximately day 14 of differentiation, we detected the percentages of TUBB3- and TH-positive cells among the total cells, which were 37% and 27.8%, respectively (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eb-d).\\u003c/p\\u003e \\u003cp\\u003eTo ascertain the specific induced differentiation of SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e into DA neurons, we identified cells that had undergone differentiation for over 14 days. These cells expressed DA neuron-specific markers, including TH, DAT, and NR4A2. In contrast, they did not express markers for GABA neurons (γ-aminobutyric acid, GABA), glutamatergic neurons (vesicular glutamate transporter protein 1, vGlut1), or cholinergic neurons (choline acetyltransferase, CHAT). These findings indicate that the differentiated neurons are DA neurons rather than GABA, glutamatergic, or cholinergic neurons (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ee).\\u003c/p\\u003e \\u003cp\\u003eFurthermore, we analyzed gene expression changes during the differentiation of SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e into DA neurons by measuring the mRNA levels of SOX2, Nestin, and GFAP at 0, 1, 2, and 4 days postinduction. Additionally, we assessed TUBB3, MAP2, forkhead box A2 (FOXA2), TH, vesicular monoamine transporter (VMAT2), and NR4A2 expression at 4, 7, and 14 days following differentiation induction. The SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e control group was cultured in standard medium for seven days, which resulted in a significant reduction in the expression of the SOX2, Nestin, and GFAP genes, approximately 80%-90%, approximately 4 days after induction of differentiation. After 14 days of induced differentiation, the expression levels of TUBB3 and MAP2 increased approximately 20-fold. The expression levels of TH, NR4A2, and VMAT2 increased 5\\u0026ndash;10-fold, whereas the expression of FOXA2 markedly increased approximately 400\\u0026ndash;500-fold (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ef-h).\\u003c/p\\u003e \\u003cp\\u003eFollowing 14 days of induced differentiation, SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e developed into mature DA neurons, which were designated SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e. The cytoplasm of SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e exhibited a reduction in size and increased compactness, whereas the number of axons increased, and their lengths increased, indicating that they aligned more closely with typical neuronal morphology. The neurons established a dense network of synaptic connections. Immunofluorescence staining revealed that SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e highly expressed neuron-specific markers, including TUBB3, MAP2, and NEUN; the presynaptic marker SYN; and DA neuron-specific markers, such as NR4A2, TH, and DAT (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ea-e).\\u003c/p\\u003e\\n\\u003ch3\\u003eSKPs-DA neurons undergo intercellular substance transport via TNTs\\u003c/h3\\u003e\\n\\u003cp\\u003eWe cocultured SKP-DA neurons expressing eGFP (SKPs-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e) with primary DA neurons. Direct cell‒cell connections between SKP\\u0026ndash;DA neurons and primary DA neurons were identified as TNTs. Tubular membrane structures known as TNTs are characterized by their abundance of F-agonist proteins and exhibit lengths varying from a few microns to several hundred microns. Cells linked by TNTs are capable of sharing plasma membranes. Transport through TNTs encompasses a range of entities, from small calcium ions to larger mitochondria \\u003csup\\u003e\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eOrganelles, including mitochondria, lysosomes, and the Golgi apparatus of primary neurons, were fluorescently labeled. The SKPs-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e were subsequently cocultured with these neurons for approximately 4\\u0026ndash;6 hours. The TNTs formed between the two cell types, facilitating the transfer of organelles from primary neurons to the SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig10\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ea). The mitochondria, lysosomes, Golgi apparatus, and other organelles of the SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e were fluorescently labeled and subsequently cocultured with 6-OHDA-modeled primary neurons for approximately 4\\u0026ndash;6 hours. The identical two forms of intercellular TNTs structure formation and the transport of various organelles through TNTs from SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e to 6-OHDA-modeled primary neurons are illustrated (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig10\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eb).\\u003c/p\\u003e \\u003cp\\u003eThese findings indicate that the transport of intracellular substances via TNTs may occur bidirectionally. The number and length of TNTs in primary neurons and SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e stimulated with 6-OHDA were compared with those in the normal group. We found that after 6-OHDA stimulation, more TNTs were produced between SKP-DA neurons and progenitor neurons, and the length of the TNTs was significantly shortened (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig10\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ec-d).\\u003c/p\\u003e\\n\\u003ch3\\u003eHistopathological alterations in the PD mouse model after SKP-DA neurons response to transplantation\\u003c/h3\\u003e\\n\\u003cp\\u003eTo assess the potential of the transplanted SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e to decelerate PD progression \\u003cem\\u003ein vivo\\u003c/em\\u003e, and establish functional connections with primary DA neurons, we conducted intranasal transplantation of the SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e into the brains of PD model mice.\\u003c/p\\u003e \\u003cp\\u003eFour weeks post-transplantation, TH-positive cells in the midbrain substantia nigra were labeled via immunofluorescence staining. Compared with SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e revealed that neurons, these neurons survived in the midbrain substantia nigra and expressed a measurable amount of TH (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig12\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003ea-c). Immunofluorescence semiquantification revealed that the expression of TH in the substantia nigra of the midbrain in the experimental group of mice was significantly greater than that in the sham-operated group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig12\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003ed-f). Furthermore, SKPs-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e were capable of establishing connections with DA neurons (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig12\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eg).\\u003c/p\\u003e \\u003cp\\u003eThis finding demonstrated that SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e, differentiated in vitro for approximately 5 days, preserved their neuronal activity and further differentiated into DA neurons following transplantation into the midbrain. Western blot analysis revealed that the expression of TH positive in the midbrain substantia nigra of was significantly greater in the experimental group than in the sham-operated group. Nonetheless, it was inferior to that of the standard control group of equivalent age. The expression of DAT in the midbrain substantia nigra of the experimental group of mice exceeded that of the control group. The expression of GRP78 in the substantia nigra of the sham-operated mice was significantly elevated, approximately double that observed in the control and experimental groups (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig12\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eh-k). These results indicate that the SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e demonstrated the capacity to express a specific quantity of TH in the midbrain substantia nigra following transplantation into the PD model mouse brain, facilitating connections with neurons and mitigating apoptosis and stress in DA neurons.\\u003c/p\\u003e\\n\\u003ch3\\u003eBehavioral recovery following the transplantation of SKPs-DA neurons\\u003c/h3\\u003e\\n\\u003cp\\u003eIn addition to histopathological evidence that transplanted SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e survived in the midbrain substantia nigra and differentiated into DA neurons, we further assessed the impact of cell transplantation on the progression of the disease in PD model mice. The behavioral tests (rod-turning experiment and open-field experiment) were conducted on the day of transplantation and again four weeks post-transplantation across three groups of mice. The trajectory maps and thermograms from the open field experiment indicate that the frequency of exploration in the central region, the time spent in the central region, and the total distance moved were significantly reduced (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig14\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ea-b). Post-MPTP modelling, the mice exhibited predominantly limbic region movements and explorations. Four weeks post-transplantation of SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e, the experimental group of mice exhibited enhanced locomotion and exploration. This was demonstrated by an increased frequency of central region exploration, extended time spent in the central region, greater total distance travelled, longer body extension time, and reduced body curl accumulation time and percentage (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig14\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ec-h).\\u003c/p\\u003e \\u003cp\\u003eCompared with the experimental group, the sham-operated group also showed improvements in locomotion, albeit to a lesser degree. The rod-turning experiment demonstrated a notable reduction in both the fall time and total distance of rod turning, alongside an increase in fall velocity in MPTP-modelled mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig14\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ei-k), suggesting substantial impairment in locomotor ability in this group. Four weeks post-transplantation of the SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e, the experimental group of mice presented increased rod-turning fall time and total rod-turning distance alongside a reduced fall velocity, indicating an improvement in locomotor ability relative to those of the sham-operated group.\\u003c/p\\u003e \\u003cp\\u003eThe results of the statistical analyses of the open field experiment and the baton twirling experiment demonstrated that the transplantation of the SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e via the nasal cavity could partially restore locomotor ability and reduce depression and anxiety in the experimental group of mice. Furthermore, the transplantation of SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e labelled neurites labeled with eGFP may attenuate disease progression in a PD model in mice.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eOur work demonstrated the potential of SKPs as a viable and noninvasive source for generating functional DA neurons, offering promising implications for regenerative therapies for PD. By employing a combination of small molecule compounds and protein inducers, we successfully directed SKPs toward differentiation into DA neurons, as confirmed by morphological, genetic, and protein expression analyses. Moreover, the integration of these cells into the host neural network and their ability to alleviate motor deficits in a PD model provide compelling evidence for their therapeutic utility. The progressive degeneration of DA neurons in the nigrostriatal region of the brain in PD patients results in a sustained reduction in dopamine levels in the striatum. This depletion causes an imbalance between the direct and indirect pathways within the basal ganglia, ultimately leading to motor dysfunction \\u003csup\\u003e\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u003c/sup\\u003e. While interventions, including pharmacotherapy, genetic approaches, surgical procedures, and deep brain stimulation, exist to alleviate symptoms in patients, there remains no definitive cure for the disease at present \\u003csup\\u003e\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e\\u003c/sup\\u003e. Stem cell transplantation therapy represents a promising therapeutic strategy for PD, given the current state of affairs.\\u003c/p\\u003e \\u003cp\\u003eAllogeneic DA precursors, including ESCs, iPSCs, and MSCs, exhibit significant therapeutic potential; however, their availability is limited by increased tumorigenic risk, ethical concerns, and immunological challenges\\u003csup\\u003e\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e\\u003c/sup\\u003e. Notably, increased cellular plasticity is correlated with increased stemness and an associated increase in tumorigenic risk\\u003csup\\u003e\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e\\u003c/sup\\u003e. It is essential to identify an optimal PD therapy for cell transplantation. Purified SKPs\\u003csup\\u003eeGFP\\u003c/sup\\u003e was isolated from the dermis of the dorsal skin of SD rats following the method established by Biernaskie and McKenzie in 2006 \\u003csup\\u003e30\\u003c/sup\\u003e. SKPs are cells that originate from the neural crest and can be reliably propagated; SKPs are neural crest-derived cells characterized by stable progeny and limited differentiation potential. Compared with pluripotent stem cells, stem cells are classified as adult tissue stem cells, which present a reduced risk of tumorigenesis \\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR32\\\" citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e\\u003c/sup\\u003e. Moreover, SKPs are readily accessible, devoid of ethical concerns, and can be autologously transplanted without eliciting a host immune response \\u003csup\\u003e\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e\\u003c/sup\\u003e. They represent a significant source of stem cells and are anticipated to be leading candidates for clinical applications.\\u003c/p\\u003e \\u003cp\\u003eThe differentiation protocol used in the present work effectively induced SKPs to acquire DA neuron-specific phenotypes, including neuronal morphology and the expression of key markers such as TH and DAT. Prolonged induction time was positively correlated with increased expression of differentiation markers, suggesting that the protocol supports a robust and progressive maturation process. Concurrently, the reduction in the expression of neural stem cell-specific markers indicates a successful transition from a progenitor state to a specialized dopaminergic phenotype. This dual confirmation underscores the reliability and efficacy of the induction strategy employed. The present work presents a protocol for differentiating SKPs into functional DA neurons through the application of small molecule compounds and protein factors, including B-27, GlutaMAX, kenpaullone, forskolin, Y-27632, purmorphamine, FGF-8b, SHH, CHIR-99021, BDNF and GDNF. Differentiated SKPs display characteristic neuronal morphology along with a biochemical profile indicative of midbrain DA neurons \\u003csup\\u003e\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e\\u003c/sup\\u003e. Neuronal differentiation media utilize a specific combination of factors, such as SHH, FGF8b, CHIR-99021, GDNF, and BDNF, which are essential for neurogenesis and differentiation \\u003csup\\u003e\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e\\u003c/sup\\u003e. A variety of factors, including SHH and FGF8α, are essential for the specification of differentiated neuronal subtypes during embryonic brain development. FoxA2 and Lmxla/b, two key effectors downstream of the SHH signaling pathway, have demonstrated efficacy in converting differentiated neuronal cells into DA neurons and in sustaining phenotypic specification \\u003csup\\u003e\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e\\u003c/sup\\u003e. GDNF has target-derived neurotrophic factor effects, and its expression in the substantia nigra-striatal system is linked primarily to the biological functions of midbrain DA neurons. These functions include the promotion of proliferation and specification, neurite growth, synaptic and electrophysiological maturation, cytosolic amplification, the expression of phenotype-specific proteins, and the regulation of downstream effector genes \\u003csup\\u003e\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e\\u003c/sup\\u003e. The overexpression of the developmentally significant molecule GDNF in the host striatum alters the neural microenvironment, thereby promoting dopamine differentiation. It promotes axonal growth in pluripotent human fetal neural stem cells (hfNSCs) administered to the substantia nigra \\u003csup\\u003e\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e\\u003c/sup\\u003e. BDNF enhances cell survival, particularly in the developmental differentiation, growth, and regeneration of DA neurons, facilitating their maintenance and promotion \\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR42\\\" citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eSKPs exhibit various DA neuron-specific markers following differentiation induction, with FOXA2 being a transcription factor that initially emerges in the floor plate of the neural tube and subsequently shows widespread expression in the ventral midbrain. This finding indicates that differentiation involves the repression of neural stem cell gene expression alongside the activation of genes associated with neurons and DA neurons \\u003csup\\u003e\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e\\u003c/sup\\u003e. FOXA2 functions as a developmental factor and is crucial for the survival of adult DA neurons \\u003csup\\u003e\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e\\u003c/sup\\u003e. Its administration before the induction of DA neurons enhances TH expression. It combines with SHH and FGF-8b, which are critical for guiding DA neuron generation \\u003csup\\u003e\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e\\u003c/sup\\u003e. NR4A2 functions as a nuclear receptor and transcription factor, playing crucial roles in the differentiation, survival, and maintenance of DA neurons. It is important for regulating various genes essential for DA signaling \\u003csup\\u003e\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e\\u003c/sup\\u003e. Research has indicated that NR4A2 is a reliable marker for survival and differentiation into mature DA neurons following transplantation \\u003csup\\u003e\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e\\u003c/sup\\u003e. TH is the rate-limiting enzyme in converting tyrosine to dopamine, which is crucial for catecholamine synthesis. It significantly influences the physiology of dopamine neurons and represents the rate-limiting step in dopamine biosynthesis \\u003csup\\u003e\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e\\u003c/sup\\u003e. The dopamine transporter (DAT) is a membrane glycoprotein that facilitates the uptake of dopamine (DA). It is located on the presynaptic membrane of dopamine neurons. It functions to reabsorb dopamine released into the synaptic cleft back into the presynaptic membrane through active transport, thereby maintaining the normal physiological function of the synapse \\u003csup\\u003e\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e\\u003c/sup\\u003e. DA neuron-specific markers indicate the level of differentiation of SKPs at various time points.\\u003c/p\\u003e \\u003cp\\u003eRecent studies indicate that the primary pathogenic mechanisms of PD include pathological aggregation of α-synuclein, mitochondrial dysfunction, lysosomal or vesicular transport impairment, oxidative stress, and neuroimmune-inflammatory responses. Pathological α-synuclein diminishes neuronal mitochondrial gene expression, decreases mitochondrial quantity, elevates oxidative stress, and significantly impairs mitochondrial adenosine triphosphate production. Additionally, it upregulates lysosomal gene expression and enhances lysosomal abundance, leading to the development of Lewy bodies \\u003csup\\u003e\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e\\u003c/sup\\u003e. MPTP exerts a toxic effect on DA neurons primarily by inhibiting mitochondrial complex I activity, leading to disrupted mitochondrial function and elevated oxidative stress \\u003csup\\u003e\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e\\u003c/sup\\u003e. The maintenance of the normal physiological function of organelles is crucial for cell survival \\u003csup\\u003e\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eThe transplantation of the SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e into the striatum of MPTP-induced PD mice resulted in significant improvements in motor function, indicating successful integration and functional restoration. Importantly, the absence of tumor formation in the transplanted animals supports the safety profile of the SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e, addressing a critical concern in stem cell therapies. The observed differentiation, survival, and migration of the transplanted cells further validated their potential to replenish lost dopaminergic neurons and restore striatal function.\\u003c/p\\u003e \\u003cp\\u003eThe pathological manifestations in PD patients include the degeneration of DA neurons in the midbrain substantia nigra. This study examined whether stem cell transplantation can decelerate PD progression via intercellular communication and the supply of organelles, including mitochondria and lysosomes \\u003csup\\u003e\\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e53\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e54\\u003c/span\\u003e\\u003c/sup\\u003e. The discovery of TNTs between SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e and primary DA neurons highlights a novel mechanism for intercellular communication that may enhance the functional integration of transplanted cells. TNTs facilitate the bidirectional transfer of organelles, including mitochondria, lysosomes, and the Golgi apparatus, which are critical for cellular health and function. This exchange could support metabolic homeostasis, mitigate cellular stress, and promote the survival of both transplanted and host neurons.\\u003c/p\\u003e \\u003cp\\u003eOur research revealed that after 6-OHDA stimulation, the number of TNTs between primary neurons and SKP-DA interneurons increased, but the length of the TNTs significantly decreased, which may improve the efficiency of intercellular substance transport by increasing the number of TNTs and shortening the length of the TNTs, thus increasing the resistance of the cells to harmful substances and increasing the cell survival rate. While the precise molecular mechanisms governing TNT formation and organelle transfer remain to be elucidated, these findings suggest that TNTs could play a pivotal role in the success of stem cell-based therapies by fostering functional connectivity within the host neural network. In the past, we thought that stem cell transplantation played a role of \\u0026ldquo;cell replacement\\u0026rdquo; in the treatment, but the discovery of TNTs between SKPs-DA neurons and primary neurons showed that the transplanted cells played a role in protecting neurons and slowing down apoptosis to a certain extent. Therefore, we propose a new paradigm of \\u0026ldquo;cell replacement-neuroprotection bimodal therapy\\u0026rdquo;, which breaks through the limitation of a single mechanism of traditional cell therapy. Further investigation is needed to determine whether the in vivo SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e can \\\"rescue\\\" primary DA neurons from apoptosis through TNTs, thereby slowing the progression of PD. The influence of environmental factors on the formation and transport of TNTs, their specific role in cell-to-cell communication, and their impact on the PD process remain ambiguous and require further investigation.\\u003c/p\\u003e \\u003cp\\u003eThe primary objective of inducing stem cells to differentiate into neurons is to address PD through cell transplantation. Given that the onset of PD typically occurs in individuals over 65 years of age\\u003csup\\u003e\\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e55\\u003c/span\\u003e\\u003c/sup\\u003e, 12-month-old C57BL/6 mice were utilized in the experiments to model disease onset more accurately. The inability of differentiated mature neurons to proliferate and regenerate highlights the importance of timing in cell transplantation\\u003csup\\u003e\\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e56\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e57\\u003c/span\\u003e\\u003c/sup\\u003e. The optimal stage for transplantation must effectively balance the survival and maturation capabilities of the cells involved. A greater degree of cell stemness correlates with increased graft survival rates, yet it diminishes the probability of differentiation into mature DA neurons. Conversely, as stem cells undergo \\u003cem\\u003ein vitro\\u003c/em\\u003e differentiation, their fragility increases, resulting in reduced survival rates post-transplantation \\u003csup\\u003e\\u003cspan citationid=\\\"CR58\\\" class=\\\"CitationRef\\\"\\u003e58\\u003c/span\\u003e\\u003c/sup\\u003e. Consequently, we selected SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e with 5\\u0026ndash;7 days of differentiation for transplantation instead of fully differentiated mature DA neurons.\\u003c/p\\u003e \\u003cp\\u003eThere are various methods of stem cell transplantation, including brain stereotaxis and tail vein injection. Brain stereotaxis can damage brain tissue to a certain extent, which may be feasible in animal experiments, but its clinical application is extremely limited; however, the intravenous injection method involves only a very small number of cells that can cross the blood‒brain barrier, and the transplantation effect is not ideal. Currently, phase I clinical studies have reported that intranasal transplantation of neural stem cells can significantly improve clinical symptoms in Parkinson's patients, and safety testing has revealed no safety concerns\\u003csup\\u003e\\u003cspan citationid=\\\"CR59\\\" class=\\\"CitationRef\\\"\\u003e59\\u003c/span\\u003e\\u003c/sup\\u003e. We conducted intranasal transplantation of SKPs-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e into the brains of PD model mice. Four weeks post-transplantation, we monitored the changes in the SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e and observed that these transplanted neurons could differentiate into a spectrum of DA neurons without tumour formation. PD model of transplanted skin-derived precursor dopamine neurons expressing enhanced green fluorescent protein (eGFP). Compared with those in the sham-operated group, the expression levels of TH and DAT in the SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e-treated group were significantly elevated. Compared with that in the sham-operated group, the expression of the glucose-regulated protein GRP78 was significantly lower. Cellular response and various life processes. Endoplasmic reticulum stress plays a crucial role in neurodegeneration, with MPTP significantly increasing GRP78 expression \\u003csup\\u003e\\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e60\\u003c/span\\u003e\\u003c/sup\\u003e. The repair of midbrain nigrostriatal DA neuronal damage in the experimental group of mice transplanted with SKPs-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e was significantly greater than that in the nontransplanted group. Behavioural assessments further demonstrated that the transplantation of SKPs-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e labelled with eGFP markedly enhanced locomotor activity and alleviated depression‒anxiety symptoms in a PD model in mice. Both molecular biological and behavioural assessments indicated that the SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e reduced the progression of PD following transplantation into the PD model. This study may offer insights into the application of SKPs-based\\u003csup\\u003eeGFP\\u003c/sup\\u003e transplantation therapy in regenerative medicine.\\u003c/p\\u003e \\u003cp\\u003eDespite these promising outcomes, several limitations warrant further investigation. First, while the MPTP model provides insights into the therapeutic potential of the SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e, it does not fully replicate the progressive and multifactorial nature of human PD. Future studies should explore the efficacy of this approach in other preclinical models that better mimic the chronic and heterogeneous progression of the disease. Second, the molecular mechanisms underlying TNTs formation and their functional implications require in-depth analysis. Understanding the signaling pathways involved could enable the design of strategies to enhance TNTs formation and optimize therapeutic outcomes. Finally, the long-term safety and efficacy of SKP-DA neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e transplantation in vivo need to be evaluated through extended follow-up studies.\\u003c/p\\u003e\"},{\"header\":\"Conclusions\",\"content\":\"\\u003cp\\u003eThe present work advances the understanding of SKPs as scalable and minimally invasive sources for generating DA neurons. Compared with other stem cell sources, such as embryonic stem cells or induced pluripotent stem cells, SKPs offer practical advantages, including ethical acceptability, a reduced risk of immunogenicity, and ease of collection. Additionally, the demonstration of TNT-mediated interactions suggests new avenues for optimizing cell-based therapies by enhancing the functional integration of transplanted cells. In conclusion, this study underscores the potential of SKP-derived DA neurons as a novel therapeutic strategy for PD. By demonstrating efficient differentiation, TNT-mediated functional integration, and \\u003cem\\u003ein vivo\\u003c/em\\u003e efficacy, we provide a strong foundation for advancing SKP-based regenerative approaches. Continued research into optimizing differentiation protocols, understanding intercellular communication, and assessing long-term outcomes will be essential to translate these findings into clinical applications.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSkin precursor cell extraction and culture\\u003c/h2\\u003e \\u003cp\\u003eThe dermis of the rat's back skin was minced and digested in HBSS solution with 0.1% trypsin at 37\\u0026deg;C for 1 hour. The dermis was centrifuged, washed, and ground multiple times before being placed in SKPs proliferation medium. This medium comprised 73.5% DMEM (Thermo Fisher Scientific, 11885076), 24.5% F-12 (Thermo Fisher Scientific, 11765054), 2% B-27 (Thermo Fisher Scientific, A1486701), 20 ng/ml EGF (PeproTech, AF-100-15), 40 ng/ml bFGF (PeproTech, AF-100-18C), 2 mmol/L GlutaMAX (Thermo Fisher Scientific, 35050061), and 1% penicillin/streptomycin (Thermo Fisher Scientific, 10378016). The mixture was incubated at 37\\u0026deg;C with 5% CO2 for propagation. Skin precursor cells that were stably passaged were cultured for more than 21 days.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDifferentiation of skin precursor cells\\u003c/h2\\u003e \\u003cp\\u003eThe protocol for differentiating skin precursor cells into functional DA neurons comprises two steps. Initially, skin precursor stem cells were digested, resuspended, and inoculated at a density of 1 \\u0026times; 10\\u003csup\\u003e4\\u003c/sup\\u003e cells/cm\\u0026sup2; onto PDL-coated Petri dishes or allowed to crawl. The medium was replaced with neuron induction medium, which was subsequently replaced with half of the new neuron induction medium every two days. The neuronal induction medium comprised a DMEM/F12 ratio of 3:1 basal medium supplemented with 2% B-27, 2 mmol/L GlutaMAX, 1% penicillin/streptomycin, 5 \\u0026micro;mol/L kenpaullone (MedChem Express, HY-12302), 5 \\u0026micro;mol/L forskolin (Selleck, S2449), 5 \\u0026micro;mol/L Y-27632 (MedChem Express, HY-10071), and 2 \\u0026micro;mol/L purmorphamine (MedChem Express, HY-15108), along with 100 ng/ml Murine Sonic Hedgehog (SHH, PeproTech, 315\\u0026thinsp;\\u0026minus;\\u0026thinsp;22), 100 ng/ml fibroblast growth factor-8b (FGF-8b, MedChem Express, HY-P70533), and 20 ng/ml basic fibroblast growth factor (bFGF, MedChem Express, HY-P7091) for days 0\\u0026ndash;3. Additionally, 3 \\u0026micro;mol/L CHIR-99021 (MedChem Express, HY-10182) was included for days 3\\u0026ndash;14, along with other small molecule compounds and growth factors. Following 6\\u0026ndash;8 days of chemical induction, the neuronal maturation medium consisted of 20 ng/ml brain-derived neurotrophic factor (BDNF, PeproTech, AF-450-02) and 20 ng/ml glial cell-derived neurotrophic factor (GDNF, PeproTech, AF-450-51). The culture was maintained for a duration of 7\\u0026ndash;14 days, with 50% of the neuronal maturation medium replaced with fresh medium bidaily. In the control group, skin precursor stem cells were cultured in DMEM/F12 (3:1) basal medium supplemented with 2% B-27, 2 mmol/L GlutaMAX, and 1% penicillin/streptomycin.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePrimary neuron culture\\u003c/h2\\u003e \\u003cp\\u003ePregnant rats at 13.5 days of gestation were prepared. The meninges and vascular membranes of the fetal rats were removed, followed by the extraction of midbrain parts, which were enzymatically digested and centrifuged. The resulting primary cells were cultured in Neuron Complete Medium, which consisted of 97% Neural Basal Medium (Thermo Fisher Scientific, 21103049), 2% B-27, and 1% PS, with medium changes occurring every 2 days. The medium was changed every two and a half days. The cells were inoculated at a density of 1\\u0026ndash;1.5 \\u0026times; 10\\u003csup\\u003e5\\u003c/sup\\u003e/ml. After 5\\u0026ndash;6 days of culture, SKP-DA neurons were cocultured at a density of 5\\u0026ndash;10 \\u0026times; 10\\u003csup\\u003e4\\u003c/sup\\u003e/ml. The formation of and changes in TNTs between the cells were observed microscopically.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eImmunocytochemical analysis\\u003c/h2\\u003e \\u003cp\\u003eThe induction system utilized immunofluorescence staining to identify cultured and differentiated skin precursor cells, as previously described. The cells were fixed with 4% PFA for 10 minutes at room temperature, followed by three washes with PBS. The samples were subsequently incubated in PBS containing 5% goat serum and 0.3% Triton X-100 for 60 minutes at room temperature. The cells were incubated overnight at 4\\u0026deg;C with the following primary antibodies: rabbit anti-TUBB3 (Zenbio, R23620), rabbit anti-MAP2 (Proteintech, 67015-1-Ig), rabbit anti-SYN (Proteintech, 10842-1-AP), and mouse anti-NEUN (Abcam, Ab104224). The antibodies utilized included rabbit anti-TH (Abcam, Ab104224), rabbit anti-TH (Abcam, Ab137869), chicken anti-TH (Abcam, Ab76442), rabbit anti-GABA (Servicebio, GB114791), rabbit anti-vGlut1 (Servicebio, GB11821), goat anti-CHAT (Servicebio, GB11070), rabbit anti-DAT (Proteintech, 22524-1-AP), rabbit anti-NURR1 (Proteintech, 10975-2-AP), rabbit anti-PAX6 (Servicebio, GB11777), rabbit anti-SOX2 (Abcam, Ab92494), rabbit anti-NESTIN (Abcam, Ab105389), rabbit anti-FOX2 (CST, 8186), and mouse anti-GFAP (Servicebio, GB12100) antibodies. The following day, the cells were washed three times with PBS and incubated with the appropriate Alexa Fluor\\u0026reg; 555 (Ab150114) or Alexa Fluor\\u0026reg; 647 (Ab150175) secondary antibodies (sourced from Abcam) at a dilution of 1:1000\\u0026ndash;1:2000 for one hour at room temperature. The nuclei of the cells were subsequently restained with DAPI. Images were acquired with a Leica DMI8 (Thunder) inverted fluorescence microscope.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eProtein blot analysis\\u003c/h2\\u003e \\u003cp\\u003eThe cells were lysed in RIPA buffer (Beyotime, P0013B) supplemented with a protease inhibitor mixture (Beyotime, ST506). Protein lysates were then loaded onto SDS‒PAGE gels (10% separating gels, Epizyme, PG112) and subsequently transferred to PVDF membranes (Millipore, ISS) following electrophoresis. The protein lysate was applied to the membrane (Millipore, ISEQ00010). The membrane was incubated with the primary antibody overnight at 4\\u0026deg;C, followed by a 1-hour incubation with the HRP-conjugated secondary antibody at room temperature. Chemiluminescence was identified via the Immobilon Protein Immunoblotting Kit (New Cell \\u0026amp; Molecular Biotech, p10200). Antibodies were utilized to stain specific proteins at the following dilutions: TH (1:1000, Abcam, ab137869), DAT (1:1000, Proteintech, 22524-1-AP), GRP78 (1:1000, Proteintech, 11587-1-AP), and GAPDH (1:1000, Proteintech, 60004-1-Ig). Horseradish peroxidase (HRP)-conjugated secondary antibodies (Abcam, ab6721 \\u0026amp; ab6789) were diluted 1:5000.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eReal-time fluorescence quantitative PCR (RT‒PCR)\\u003c/h2\\u003e \\u003cp\\u003eRNA was extracted from neurons at various stages of skin precursor cell differentiation via an RNA extraction kit (Eisenbio). The isolated RNA was reverse transcribed with a PrimeScript RT kit containing gDNA remover (Novozymes, RR047A). The selected target genes included Nestin, SOX-2, GFAP, TUBB3, MAP2, TH, DAT, Foxa2, VMAT2, NR4A2, and GAPDH. Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e shows the sequences designed for the gene primers. The expression levels of the target genes were normalized to those of an internal control, GAPDH. Quantitative real-time PCR was conducted via a Q5 real-time fluorescent quantitative PCR system (Applied Biosystems) with SYBR Premix Ex Taq II (Novozymes).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePrimer sequences used for qPCR:\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"5\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGene\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward primer\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eReverse primer\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eProduct size (bp)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eTm (\\u0026deg;C)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eNestin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTGGAGCAGGAGAAGCAAGGTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCAAGGGGGAAGGGAAGGATGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e281\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e62\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSOX-2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCGCCGAGTGGAAACTTTTGTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTCATGAGCGTCTTGGTTTTCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e134\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e61\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGFAP\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCACCAGTAACATGCAAGAAACA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAGTTGGCGGCGATAGTCATTAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e130\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e61\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTUBB3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCAACTATGTGGGGGACTCGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTGGCTCTGGGCACATACTTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e89\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e60\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMAP2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTCAGGCTCCCAGTGCGTTTA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGGAGGATGGAGGAAGGTCTTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e104\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e62\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eFOXA2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eACCACCCCTTCTCTATCAACAAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGTTCGTAGGTCTTGAGGTCCATTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e102\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e60\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTH\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTCTGTGCGTCGGGTGTCTGA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGAATTGGTTCACCGTGCTTGTA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e220\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e64\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eVMAT2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTATGAATTTGTGGGGAAGACAGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTCAGCAAGGTCGTTAGAGGTGTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e142\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e62\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eNR4A2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCTGGCTGTTGGGATGGTTA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGGTCATTGCCGGATTGGAGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e172\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e61\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGAPDH\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCTGGAGAAACCTGCCAAGTATG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGGTGGAAGAATGGGAGTTGCT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e138\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e60\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAnimal models and stem cell transplantation\\u003c/h2\\u003e \\u003cp\\u003eMPTP-induced subacute injury PD mouse model: Twelve-month-old C57BL/6J mice were housed under a 12-hour light/dark cycle with unrestricted access to food and water. A subacute injury animal model of PD was established through daily intraperitoneal injections of MPTP-HCl solution (MedChemExpress, HY-15608) at a dosage of 30 mg/kg for 7 days.\\u003c/p\\u003e \\u003cp\\u003eStem cell intranasal transplantation in mice: To investigate the neural differentiation of SKPs and their in vivo functions, we transplanted SKP-DA neurons into the brains of MPTP-induced subacute injury PD model C57L/B6 mice and control C57L/B6 mice, which were maintained under a 12-hour light/dark cycle with unrestricted access to food and water. SKPs-DA neurons that had undergone differentiation for 5\\u0026ndash;7 days were subjected to digestion, centrifugation, and resuspension. The resulting cells must fulfill the following criteria: cell viability after 48 hours must be at least 80%, and endotoxin levels should not exceed 0.5 EU/ml. Prior to stem cell transplantation, the nasal cavities of the mice were treated with 4 \\u0026micro;l of 100 U/\\u0026micro;l hyaluronidase (H3884; Sigma‒Aldrich) for 30 minutes to increase blood‒brain barrier permeability. Throughout the administration, the mice were maintained in a supine position, and a microsyringe was used to slowly inject the cell suspension into the nasal cavity. Each mouse in the experimental group received 20 \\u0026micro;l (1 \\u0026times; 10\\u003csup\\u003e7\\u003c/sup\\u003e/ml, 10 \\u0026micro;l per side) of the cell suspension in the nasal cavity. Each mouse in the sham-operated group was administered 20 \\u0026micro;l of saline into the nasal cavity. All procedures were conducted in accordance with the guidelines set forth by the Ethics Committee for the Use of Laboratory Animals at Nantong University.\\u003c/p\\u003e \\u003cp\\u003eThe stem cell transplantation experiments were categorized into three groups: control, sham-operated, and experimental. The control group consisted of 12-month-old C57BL/6 mice that did not receive any treatment. The sham-operated group included 12-month-old C57BL/6 mice that underwent intranasal transplantation of phosphate buffer solution (PBS) following MPTP subacute modeling. The experimental group comprised 12-month-old C57BL/6 mice that received intranasal transplantation of SKPs-DA after MPTP subacute modeling of the neurons\\u003csup\\u003eeGFP\\u003c/sup\\u003e in 12-month-old C57BL/6 rats.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eRotarod experiments\\u003c/h2\\u003e \\u003cp\\u003ePrior to the initiation of the formal experiments, the mice underwent training for a duration of 3\\u0026ndash;5 days, beginning with a constant speed of 16 rpm and subsequently transitioning to a uniformly accelerated movement reaching 44 rpm. Each group of mice underwent baton twirling experiments three times daily for a minimum of 15 minutes per session, after which formal experiments commenced following their adaptation to the activity. The mice underwent uniform acceleration, starting at 0.5 rpm and reaching 44 rpm over a duration of 5 minutes. During this period, the distance, time, and fall speed of the bats were recorded upon the descent of the mice.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eOpen field experiment\\u003c/h2\\u003e \\u003cp\\u003eA controlled environment with standard lighting and minimal noise is maintained. The experimental device and software were installed. The open field consisted of a 50 \\u0026times; 50 \\u0026times; 25 cm square box with a white background. The animals were positioned with their backs to the experimenter in the central area of the open field, allowing them to move freely within the experimental box. The mouse movement trajectories were recorded for 10 minutes via EthoVision software from Noldus. The bottom of the open field measures 50 cm \\u0026times; 50 cm, whereas the center measures 30 cm \\u0026times; 30 cm. Upon completion of the experiment, the mice were returned to their cages, and the device was sanitized to eliminate any residual data pertaining to the experimental subjects.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eThe data were analyzed and plotted statistically via GraphPad Prism 9.5 software. The quantitative data in this experiment are expressed as the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard error of the mean (MEAN SEM). One-way ANOVA was used for initial comparisons, followed by Dunnett's or Tukey's multiple comparisons tests. Additionally, comparisons between multiple groups were conducted via two-way ANOVA, with subsequent analysis via Tukey's multiple comparisons test. A \\u003cem\\u003ep\\u003c/em\\u003e-value\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was considered statistically significant.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e \\u003ch2\\u003eCompeting interests\\u003c/h2\\u003e \\u003cp\\u003eThe authors declare that they have no competing interests.\\u003c/p\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e \\u003cp\\u003e All studies complied with all relevant animal use guidelines and ethical regulations. All animal use and study protocols were approved both by the Institutional Animal Care Committee and by the Administration Committee of Experimental Animals, Jiangsu Province, China, in accordance with the guidelines of the Institutional Animal Care and Use Committee, Nantong University, China (Inspection No: 20190225-004).\\u003c/p\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e \\u003cp\\u003eNot applicable.\\u003c/p\\u003e \\u003c/p\\u003e\\u003ch2\\u003eFunding\\u003c/h2\\u003e \\u003cp\\u003eThis work was graciously supported by the Natural Science Foundation of Nantong Municipality (JC2023113).\\u003c/p\\u003e\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\u003cp\\u003eM.H.C., C.B.X., and H.Z. conceived the research, supervised the project, and provided research directions. L.M., H.M.T. and Q.W.S. carried out SKPs culture and induced differentiation in vitro. L.M. and H.M.T. carried out the confocal microscopy of the immunocyte fluorescence staining cover slides. Y.W., T.Y.H., Y.L.P. and J.H.S. performed the image analysis. L.M., Y.W., and Q.W.S. performed the animal experiments. L.M. wrote the manuscript. M.H.C., C.B.X., and H.Z. revised the manuscript. All the authors reviewed the manuscript.\\u003c/p\\u003e\\u003ch2\\u003eAcknowledgments\\u003c/h2\\u003e \\u003cp\\u003eWe would like to thank Dr. Duan Jiangtao of the Shanghai Institute of Organic Chemistry, Chinese Academy of Sciences, for his advice and help and Dr. Wang Tianyi of Nantong University for his experimental guidance.\\u003c/p\\u003e\\u003ch2\\u003eAvailability of data and materials\\u003c/h2\\u003e \\u003cp\\u003eAll the data supporting the findings of this study are available within the paper, and the raw and analyzed datasets generated during the study are available for research purposes from the corresponding authors upon reasonable request.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e \\u003cli\\u003e\\u003cspan\\u003eBloem, B. R., Okun, M. S. \\u0026amp; Klein, C. Parkinson's disease. Lancet (London, England) 397, 2284\\u0026ndash;2303, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/s0140-6736(21)00218-x\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/s0140-6736(21)00218-x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eQi, S. \\u003cem\\u003eet al.\\u003c/em\\u003e Prevalence of Parkinson's Disease: A Community-Based Study in China. Movement disorders: official journal of the Movement Disorder Society 36, 2940\\u0026ndash;2944, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/mds.28762\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/mds.28762\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLeite Silva, A. B. R. \\u003cem\\u003eet al.\\u003c/em\\u003e Premotor, nonmotor and motor symptoms of Parkinson's Disease: A new clinical state of the art. Ageing research reviews 84, 101834, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.arr.2022.101834\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.arr.2022.101834\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eReich, M. M. \\u003cem\\u003eet al.\\u003c/em\\u003e A brain network for deep brain stimulation induced cognitive decline in Parkinson's disease. Brain: a journal of neurology 145, 1410\\u0026ndash;1421, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/brain/awac012\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/brain/awac012\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ede Luzy, I. R., Lee, M. K., Mobley, W. C. \\u0026amp; Studer, L. Lessons from inducible pluripotent stem cell models on neuronal senescence in aging and neurodegeneration. Nat Aging 4, 309\\u0026ndash;318, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s43587-024-00586-3\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s43587-024-00586-3\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJiang, H. \\u003cem\\u003eet al.\\u003c/em\\u003e Cell cycle and p53 gate the direct conversion of human fibroblasts to dopaminergic neurons. Nature communications 6, 10100, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/ncomms10100\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/ncomms10100\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eStathakos, P. \\u003cem\\u003eet al.\\u003c/em\\u003e A monolayer hiPSC culture system for autophagy/mitophagy studies in human dopaminergic neurons. Autophagy 17, 855\\u0026ndash;871, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1080/15548627.2020.1739441\\u003c/span\\u003e\\u003cspan address=\\\"10.1080/15548627.2020.1739441\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eQin, H., Zhao, A.-D., Sun, M.-L., Ma, K. \\u0026amp; Fu, X.-B. Direct conversion of human fibroblasts into dopaminergic neuron-like cells using small molecules and protein factors. Military Medical Research 7, 52, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/s40779-020-00284-2\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s40779-020-00284-2\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCheng, X.-y. \\u003cem\\u003eet al.\\u003c/em\\u003e Human iPSCs derived astrocytes rescue rotenone-induced mitochondrial dysfunction and dopaminergic neurodegeneration in vitro by donating functional mitochondria. Translational neurodegeneration 9 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMehrotra, P., Tseropoulos, G., Bronner, M. E. \\u0026amp; Andreadis, S. T. Adult tissue-derived neural crest-like stem cells: Sources, regulatory networks, and translational potential. Stem cells translational medicine 9, 328\\u0026ndash;341, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/sctm.19-0173\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/sctm.19-0173\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eToma, J. G. \\u003cem\\u003eet al.\\u003c/em\\u003e Isolation of multipotent adult stem cells from the dermis of mammalian skin. Nat Cell Biol 3, 778\\u0026ndash;784, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/ncb0901-778\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/ncb0901-778\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2001).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJoannides, A. \\u003cem\\u003eet al.\\u003c/em\\u003e Efficient generation of neural precursors from adult human skin: astrocytes promote neurogenesis from skin-derived stem cells. Lancet (London, England) 364, 172\\u0026ndash;178, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/s0140-6736(04)16630-0\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/s0140-6736(04)16630-0\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2004).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWeiss, D. \\u003cem\\u003eet al.\\u003c/em\\u003e Subthalamic stimulation modulates cortical motor network activity and synchronization in Parkinson's disease. Brain: a journal of neurology 138, 679\\u0026ndash;693, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/brain/awu380\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/brain/awu380\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYao, S. \\u003cem\\u003eet al.\\u003c/em\\u003e Mesenchymal stem cell attenuates spinal cord injury by inhibiting mitochondrial quality control-associated neuronal ferroptosis. Redox biology 67, 102871, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.redox.2023.102871\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.redox.2023.102871\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAllegra, A. \\u003cem\\u003eet al.\\u003c/em\\u003e Specialized Intercellular Communications via Tunnelling Nanotubes in Acute and Chronic Leukemia. \\u003cem\\u003eCancers\\u003c/em\\u003e 14, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3390/cancers14030659\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/cancers14030659\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSartori-Rupp, A. \\u003cem\\u003eet al.\\u003c/em\\u003e Correlative cryo-electron microscopy reveals the structure of TNTs in neuronal cells. Nature communications 10, 342, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41467-018-08178-7\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41467-018-08178-7\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLin, R. Z. \\u003cem\\u003eet al.\\u003c/em\\u003e Mitochondrial transfer mediates endothelial cell engraftment through mitophagy. Nature 629, 660\\u0026ndash;668, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41586-024-07340-0\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41586-024-07340-0\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBarutta, F. \\u003cem\\u003eet al.\\u003c/em\\u003e Protective effect of the tunneling nanotube-TNFAIP2/M-sec system on podocyte autophagy in diabetic nephropathy. Autophagy 19, 505\\u0026ndash;524, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1080/15548627.2022.2080382\\u003c/span\\u003e\\u003cspan address=\\\"10.1080/15548627.2022.2080382\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJiang, D. \\u003cem\\u003eet al.\\u003c/em\\u003e Bioenergetic Crosstalk between Mesenchymal Stem Cells and various Ocular Cells through the intercellular trafficking of Mitochondria. Theranostics 10, 7260\\u0026ndash;7272, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.7150/thno.46332\\u003c/span\\u003e\\u003cspan address=\\\"10.7150/thno.46332\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBittins, M. \\u0026amp; Wang, X. TNT-Induced Phagocytosis: Tunneling Nanotubes Mediate the Transfer of Pro-Phagocytic Signals From Apoptotic to Viable Cells. Journal of cellular physiology 232, 2271\\u0026ndash;2279, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/jcp.25584\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/jcp.25584\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBiernaskie, J. A., McKenzie, I. A., Toma, J. G. \\u0026amp; Miller, F. D. Isolation of skin-derived precursors (SKPs) and differentiation and enrichment of their Schwann cell progeny. Nat Protoc 1, 2803\\u0026ndash;2812, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/nprot.2006.422\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/nprot.2006.422\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2006).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVrijsen, S., Houdou, M., Cascalho, A., Eggermont, J. \\u0026amp; Vangheluwe, P. Polyamines in Parkinson's Disease: Balancing Between Neurotoxicity and Neuroprotection. Annual review of biochemistry 92, 435\\u0026ndash;464, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1146/annurev-biochem-071322-021330\\u003c/span\\u003e\\u003cspan address=\\\"10.1146/annurev-biochem-071322-021330\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChu, Y. \\u003cem\\u003eet al.\\u003c/em\\u003e Nigrostriatal tau pathology in parkinsonism and Parkinson's disease. Brain: a journal of neurology 147, 444\\u0026ndash;457, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/brain/awad388\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/brain/awad388\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVijiaratnam, N., Simuni, T., Bandmann, O., Morris, H. R. \\u0026amp; Foltynie, T. Progress towards therapies for disease modification in Parkinson's disease. The Lancet. Neurology 20, 559\\u0026ndash;572, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/s1474-4422(21)00061-2\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/s1474-4422(21)00061-2\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYin, Z. \\u003cem\\u003eet al.\\u003c/em\\u003e Cortical phase-amplitude coupling is key to the occurrence and treatment of freezing of gait. Brain: a journal of neurology 145, 2407\\u0026ndash;2421, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/brain/awac121\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/brain/awac121\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCalatroni, M., Moroni, G., Reggiani, F. \\u0026amp; Ponticelli, C. Renal sarcoidosis. J Nephrol 36, 5\\u0026ndash;15, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s40620-022-01369-y\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s40620-022-01369-y\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDelacher, M. \\u003cem\\u003eet al.\\u003c/em\\u003e Precursors for Nonlymphoid-Tissue Treg Cells Reside in Secondary Lymphoid Organs and Are Programmed by the Transcription Factor BATF. \\u003cem\\u003eImmunity\\u003c/em\\u003e 52, 295\\u0026ndash;312 e211, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.immuni.2019.12.002\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.immuni.2019.12.002\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCederberg, D., Visse, E., Marklund, N. \\u0026amp; Siesjo, P. Prolonged and intense neuroinflammation after severe traumatic brain injury assessed by cerebral microdialysis with 300 kDa membranes. J Neuroimmunol 377, 578020, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.jneuroim.2023.578020\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jneuroim.2023.578020\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXin, L. EZH2 accompanies prostate cancer progression. Nat Cell Biol 23, 934\\u0026ndash;936, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41556-021-00744-4\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41556-021-00744-4\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBiernaskie, J. A., McKenzie, I. A., Toma, J. G. \\u0026amp; Miller, F. D. Isolation of skin-derived precursors (SKPs) and differentiation and enrichment of their Schwann cell progeny. Nature Protocols 1, 2803\\u0026ndash;2812, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/nprot.2006.422\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/nprot.2006.422\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2006).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLai, S. \\u003cem\\u003eet al.\\u003c/em\\u003e Direct reprogramming of induced neural progenitors: a new promising strategy for AD treatment. Translational neurodegeneration 4, 7, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/s40035-015-0028-y\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s40035-015-0028-y\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGe, W. \\u003cem\\u003eet al.\\u003c/em\\u003e Murine skin-derived multipotent papillary dermal fibroblast progenitors show germline potential in vitro. Stem Cell Res Ther 14, 17, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/s13287-023-03243-5\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s13287-023-03243-5\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMozafari, S. \\u003cem\\u003eet al.\\u003c/em\\u003e Skin-derived neural precursors competitively generate functional myelin in adult demyelinated mice. The Journal of clinical investigation 125, 3642\\u0026ndash;3656, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1172/jci80437\\u003c/span\\u003e\\u003cspan address=\\\"10.1172/jci80437\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu, W.-X. \\u003cem\\u003eet al.\\u003c/em\\u003e Melatonin promotes the proliferation of primordial germ cell-like cells derived from porcine skin-derived stem cells: A mechanistic analysis. Journal of pineal research 73, e12833, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/jpi.12833\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/jpi.12833\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYi, S. \\u003cem\\u003eet al.\\u003c/em\\u003e Application of stem cells in peripheral nerve regeneration. Burns \\u0026amp; trauma 8, tkaa002, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/burnst/tkaa002\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/burnst/tkaa002\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhao, A.-D., Qin, H., Sun, M.-L., Ma, K. \\u0026amp; Fu, X.-B. Efficient and rapid conversion of human astrocytes and ALS mouse model spinal cord astrocytes into motor neuron-like cells by defined small molecules. Military Medical Research 7, 42, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/s40779-020-00271-7\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s40779-020-00271-7\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKirkeby, A. \\u003cem\\u003eet al.\\u003c/em\\u003e Generation of regionally specified neural progenitors and functional neurons from human embryonic stem cells under defined conditions. Cell Rep 1, 703\\u0026ndash;714, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.celrep.2012.04.009\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.celrep.2012.04.009\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKriks, S. \\u003cem\\u003eet al.\\u003c/em\\u003e Dopamine neurons derived from human ES cells efficiently engraft in animal models of Parkinson's disease. Nature 480, 547\\u0026ndash;551, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/nature10648\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/nature10648\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2011).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBaloh, R. H. \\u003cem\\u003eet al.\\u003c/em\\u003e Transplantation of human neural progenitor cells secreting GDNF into the spinal cord of patients with ALS: a phase 1/2a trial. Nature medicine 28, 1813\\u0026ndash;1822, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41591-022-01956-3\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41591-022-01956-3\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWakeman, D. R. \\u003cem\\u003eet al.\\u003c/em\\u003e Human neural stem cells survive long term in the midbrain of dopamine-depleted monkeys after GDNF overexpression and project neurites toward an appropriate target. Stem cells translational medicine 3, 692\\u0026ndash;701, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.5966/sctm.2013-0208\\u003c/span\\u003e\\u003cspan address=\\\"10.5966/sctm.2013-0208\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eIshii, T., Warabi, E. \\u0026amp; Mann, G. E. Circadian control of BDNF-mediated Nrf2 activation in astrocytes protects dopaminergic neurons from ferroptosis. Free radical biology \\u0026amp; medicine 133, 169\\u0026ndash;178, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.freeradbiomed.2018.09.002\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.freeradbiomed.2018.09.002\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDouma, E. H. \\u0026amp; de Kloet, E. R. Stress-induced plasticity and functioning of ventral tegmental dopamine neurons. Neuroscience and biobehavioral reviews 108, 48\\u0026ndash;77, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.neubiorev.2019.10.015\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.neubiorev.2019.10.015\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCavalleri, L. \\u003cem\\u003eet al.\\u003c/em\\u003e Ketamine enhances structural plasticity in mouse mesencephalic and human iPSC-derived dopaminergic neurons via AMPAR-driven BDNF and mTOR signaling. Molecular psychiatry 23, 812\\u0026ndash;823, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/mp.2017.241\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/mp.2017.241\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eArenas, E. Foxa2: the rise and fall of dopamine neurons. Cell stem cell 2, 110\\u0026ndash;112, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.stem.2008.01.012\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.stem.2008.01.012\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2008).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJakaria, M. \\u003cem\\u003eet al.\\u003c/em\\u003e Molecular Insights into NR4A2(Nurr1): an Emerging Target for Neuroprotective Therapy Against Neuroinflammation and Neuronal Cell Death. Molecular neurobiology 56, 5799\\u0026ndash;5814, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s12035-019-1487-4\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s12035-019-1487-4\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAlavian, K. N. \\u003cem\\u003eet al.\\u003c/em\\u003e The lifelong maintenance of mesencephalic dopaminergic neurons by Nurr1 and engrailed. Journal of biomedical science 21, 27, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/1423-0127-21-27\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/1423-0127-21-27\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGarritsen, O., van Battum, E. Y., Grossouw, L. M. \\u0026amp; Pasterkamp, R. J. Development, wiring and function of dopamine neuron subtypes. Nature reviews. Neuroscience 24, 134\\u0026ndash;152, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41583-022-00669-3\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41583-022-00669-3\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAfonso-Oramas, D. \\u003cem\\u003eet al.\\u003c/em\\u003e Dopamine transporter glycosylation correlates with the vulnerability of midbrain dopaminergic cells in Parkinson's disease. Neurobiology of disease 36, 494\\u0026ndash;508, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.nbd.2009.09.002\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.nbd.2009.09.002\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2009).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGeibl, F. F. \\u003cem\\u003eet al.\\u003c/em\\u003e α-Synuclein pathology disrupts mitochondrial function in dopaminergic and cholinergic neurons at-risk in Parkinson's disease. Molecular neurodegeneration 19, 69, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/s13024-024-00756-2\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s13024-024-00756-2\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHan, X. \\u003cem\\u003eet al.\\u003c/em\\u003e Neuronal SH2B1 attenuates apoptosis in an MPTP mouse model of Parkinson's disease via promoting PLIN4 degradation. Redox Biol 52, 102308, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.redox.2022.102308\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.redox.2022.102308\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYe, H., Robak, L. A., Yu, M., Cykowski, M. \\u0026amp; Shulman, J. M. Genetics and Pathogenesis of Parkinson's Syndrome. Annual review of pathology 18, 95\\u0026ndash;121, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1146/annurev-pathmechdis-031521-034145\\u003c/span\\u003e\\u003cspan address=\\\"10.1146/annurev-pathmechdis-031521-034145\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKalyanaraman, B., Cheng, G. \\u0026amp; Hardy, M. Gut microbiome, short-chain fatty acids, alpha-synuclein, neuroinflammation, and ROS/RNS: Relevance to Parkinson's disease and therapeutic implications. Redox Biol 71, 103092, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.redox.2024.103092\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.redox.2024.103092\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eScheiblich, H. \\u003cem\\u003eet al.\\u003c/em\\u003e Microglia rescue neurons from aggregate-induced neuronal dysfunction and death through tunneling nanotubes. Neuron 112, 3106\\u0026ndash;3125.e3108, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.neuron.2024.06.029\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.neuron.2024.06.029\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChakraborty, R., Nonaka, T., Hasegawa, M. \\u0026amp; Zurzolo, C. Tunnelling nanotubes between neuronal and microglial cells allow bi-directional transfer of α-Synuclein and mitochondria. Cell Death Dis 14, 329, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41419-023-05835-8\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41419-023-05835-8\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBen-Shlomo, Y. \\u003cem\\u003eet al.\\u003c/em\\u003e The epidemiology of Parkinson's disease. Lancet 403, 283\\u0026ndash;292, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/S0140-6736(23)01419-8\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/S0140-6736(23)01419-8\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMolecular Cell editorial, t. Models that matter. \\u003cem\\u003eMol Cell\\u003c/em\\u003e 83, 315\\u0026ndash;316, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.molcel.2023.01.001\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.molcel.2023.01.001\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVerpoorte-Botden, I. P. G., Minnema, M. C. \\u0026amp; Raymakers, R. A. P. EBV-related lymphoma after long-term daratumumab treatment: a case report. Blood Cancer J 10, 113, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41408-020-00379-y\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41408-020-00379-y\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSkidmore, S. \\u0026amp; Barker, R. A. Challenges in the clinical advancement of cell therapies for Parkinson's disease. Nature biomedical engineering 7, 370\\u0026ndash;386, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41551-022-00987-y\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41551-022-00987-y\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJiang, S. \\u003cem\\u003eet al.\\u003c/em\\u003e Phase 1 study of safety and preliminary efficacy of intranasal transplantation of human neural stem cells (ANGE-S003) in Parkinson's disease. Journal of neurology, neurosurgery, and psychiatry 95, 1102\\u0026ndash;1111, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1136/jnnp-2023-332921\\u003c/span\\u003e\\u003cspan address=\\\"10.1136/jnnp-2023-332921\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu, N. \\u003cem\\u003eet al.\\u003c/em\\u003e TRPV4 contributes to ER stress and inflammation: implications for Parkinson's disease. Journal of neuroinflammation 19, 26, doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/s12974-022-02382-5\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s12974-022-02382-5\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Skin-derived precursor cells, intranasal administration, dopaminergic neurons, tunneling nanotubes, Parkinson's disease\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6363439/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6363439/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eThe transplantation of stem cells has considerable potential in delaying the progression of Parkinson's disease (PD). Both the source of the stem cells and the method of differentiation induction are critical factors in this process. In the present work, for the first time, we developed a differentiation strategy that allows for the generation of functional dopaminergic (DA) neurons from skin-derived precursor cells (SKPs). Concurrently, intercellular tunneling nanotubes (TNTs) and substance transfer were observed in a direct coculture system of SKP-induced differentiated dopaminergic neurons (SKP-DA neurons) and primary DA neurons. Furthermore, we assessed the survival, differentiation, migration of SKP-DA neurons and enhancement of striatal functional deficits in the PD model after SKP-DA neurons transplantation. The intranasal administration of SKP-DA neurons resulted in effective survival and differentiation into DA neurons without the formation of tumors, thereby leading to improvements in the functional deficits of the PD model. This study provides evidence that SKPs undergoing induced differentiation can develop the morphological characteristics and functional properties of DA neurons, thereby improving the functional deficits associated with PD. These findings suggest the potential of noninvasive treatment as a novel regenerative therapeutic approach for PD.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Skin-Derived Precursor Cell-Differentiated Dopaminergic Neurons Promote Functional Recovery in Parkinson’s Disease via Tunneling Nanotube-Mediated Intercellular Communication\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-04-25 11:48:16\",\"doi\":\"10.21203/rs.3.rs-6363439/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"8a4ae980-985c-4a23-8cdd-caa25ea57046\",\"owner\":[],\"postedDate\":\"April 25th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":47570073,\"name\":\"Biological sciences/Neuroscience/Diseases of the nervous system/Neurodegeneration\"},{\"id\":47570074,\"name\":\"Biological sciences/Neuroscience/Diseases of the nervous system/Parkinsons disease\"},{\"id\":47570075,\"name\":\"Biological sciences/Stem cells/Neural stem cells\"},{\"id\":47570076,\"name\":\"Biological sciences/Stem cells/Stem cell differentiation\"}],\"tags\":[],\"updatedAt\":\"2025-08-21T15:08:47+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-04-25 11:48:16\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6363439\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6363439\",\"identity\":\"rs-6363439\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}